JPH11113585A - Oligonucleotide for detecting bacillus dysenteriae and its detection using the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain the subject oligonucleotide useful for, e.g. simply and quickly detecting Bacillus dysenteriae at high sensitivity, which is targeted at a base sequence coding for an ipaH gene having a specific base sequence and selectively present in Bacillus dysenteriae and enteroinvasive Escherichia coli. SOLUTION: This nucleotide is targeted at a nucleotide sequence coding for an ipaH gene selectively present in Bacillus dysenteriae (Shigelladysenteria, Shigellaflexneri, Shigella boydii and Shigella sonnei) and enteroinvasive Escherichia coli present in a sample, and is chemically synthesized in such a way as to be complementary to the above nucleotide sequence. It is a new type of oligonucleotide of an oligonucleotide sequence containing at least 10 continuous bases of the sequence shown by the formula I or II, or of the sequence complementary thereto, and capable of quickly detecting, at high sensitivity, Shiga toxin gene of Bacillus dysenteriae, ipaH gene and invE gene.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to quarantine, clinical examination,
In particular, it relates to testing for food poisoning or bacterial diarrhea, or detection of Shigella in food testing.

[0002]

2. Description of the Related Art Detection of Shigella is important for various medical and public health purposes, and conventionally, detection has been carried out by the following steps. First, isolation culture using a medium such as DHL agar or MacConkey agar is performed from the patient's feces and food as test materials, and then differential culture using a TSI agar, a LIM agar, or the like.

[0003]

However, in the conventional method, the time required for each culturing step is 18 to 24 hours, and the total required time is 3 to 4 days, which is poor in quickness. Reverse passive latex agglutination using a specific antibody against Shiga toxin of Shigella, and an EIA method using a specific antibody against a 140 megadalton plasmid product involved in the pathogenicity of Shigella and enteroinvasive E. coli (Kenichiro Ito) Et al., Japanese Bacteriological Journal 41,414 (1986)) and a DNA probe method for detecting the ipaB gene, ipaC gene, or ipaD gene (US Patent Applicatio).
n No. 888194), however, these test methods involve complicated and cumbersome preparation of reagents and specimens, and require much time.

Accordingly, an object of the present invention is to provide a simple, rapid and highly sensitive novel detection method for quarantine, clinical examination and food inspection.

[0005]

Means for Solving the Problems In order to solve the above problems, the present invention detects ipaH and invE of Shigella and enteroinvasive Escherichia coli by a gene amplification technique in which an oligonucleotide functions as a primer for a nucleic acid synthesis reaction. There is something. Oligonucleotides used in the present invention are Shigella bacteria (Shigelladysenteriae, Shigella) present in a sample.
flexneri, Shigella boydii and Shigella sonnei)
And enteroinvasive Escherichi
a), the target is a nucleotide sequence encoding the ipaH gene selectively present in an a.coli) oligonucleotide that is chemically synthesized so as to be complementary to the nucleotide sequence. Oligonucleotide containing at least 10 consecutive nucleotides or more of the sequence group (5 ′)-TGTATCACAGATATGGCATGC- (3 ′) (c; SEQ ID NO: 1) (5 ′)-TCCGGAGATTGTTCCATGTG- (3 ′) -(D; SEQ ID NO: 2) or the corresponding complementary sequence.

[0006] Shigella dysen present in a specimen
teriae, Shigella flexneri, Shigella boydii, and
Shigella sonnei) and enteroinvasive Escherichia coli (enteroinv)
asive Escherichia coli)
When targeting a nucleotide sequence encoding the vE gene, it is an oligonucleotide chemically synthesized so as to be complementary to the nucleotide sequence, wherein the synthetic nucleotide contains at least 10 consecutive bases or more of the following sequence group: Oligonucleotide, (5 ')-CAAGATTTAACCTTCGTCCAACC- (3') ... (e; SEQ ID NO: 3) (5 ')-AGTTCTCGGATGCTATGCTC- (3') ... (f; SEQ ID NO: 4) or Consists of the corresponding complementary sequence.

[0007] Gene amplification is carried out using the Polyme
It is carried out based on the rase chain reaction method (hereinafter abbreviated as PCR method; Science 230, 1350 (1985)).
This method uses a specific nucleotide sequence region (in the case of the present invention, ipaH of Shigella and enteroinvasive E. coli).
invE), one of both ends of the region is +
An oligonucleotide is prepared that recognizes the strand and recognizes the-strand on the other side and hybridizes, and functions as a primer for a template-dependent nucleotide polymerization reaction on a sample nucleic acid that has been made into a single-stranded state by heat denaturation,
The generated double-stranded nucleic acid is again separated into single-stranded, and the same reaction is caused again. By repeating this series of operations, 2
The copy number of the region between the two primers increases until it can be detected.

The specimen may be a clinical test material such as feces, urine, blood, tissue homogenate, or a food material. In order to use these materials as a sample for PCR, an operation of releasing nucleic acid components from cells present in the materials is required as pretreatment. However, if the nucleic acid to which the primer can hybridize is present from several molecules to several tens of nucleons or more, the PCR will proceed. A sample solution having a nucleic acid amount can be prepared.

The oligonucleotide used as a primer in the present invention is a nucleotide fragment having a length of 10 bases or more, preferably 15 bases or more in consideration of selectivity, detection sensitivity and reproducibility. either will do. Further, the primer may not be particularly labeled for detection.

The amplified region in the nucleotide sequence of the Shigella and enterotoxigenic Escherichia coli genes defined by the primers is 50 to 2,000 bases, preferably
What is necessary is just to change from 100 bases to 1,000 bases. For the template-dependent nucleotide polymerization reaction, a thermostable DNA polymerase is used.
5 ° C, the temperature of the annealing operation for hybridizing the primer is 37 to 65 ° C, and the polymerization reaction is 50 to 75 ° C.
Then, the PCR is carried out for 20 to 42 cycles in which this is defined as one cycle, and amplification is performed.

The detection can be carried out by directly subjecting the reaction solution after PCR to agarose gel electrophoresis to confirm the presence and length of the amplified nucleotide fragment. From the result, it can be determined whether or not a nucleotide having a sequence to be recognized by the primer exists in the sample. This determination directly determines the presence or absence of Shigella with Shiga and intestinal enteric Escherichia coli having ipaH and invE. Other electrophoresis and chromatography are also effective for detecting the amplified nucleotide fragment.

[0012]

【Example】

(Example 1: lipaH of Shigella and enteroinvasive Escherichia coli)
[Detection of Gene] [Experimental Example 1] Preparation of Specimens The strains of Shigella and enteroinvasive Escherichia coli used were derived from patients and the like, and a total of 341 strains shown in Table 1 were used. Each strain was inoculated into LB medium (1% tryptone, 0.5% yeast extract, and 1% sodium chloride, and
Shaking culture was performed overnight at 7 ° C. under aerobic conditions. Each strain culture was diluted 10-fold with 10 mM Tris-HCl buffer pH 7.5 (hereinafter referred to as TE buffer), heated at 95 ° C. for 10 minutes, centrifuged, and the supernatant was used as a sample. And

Synthesis of primers (Hartman, AB, et al., J. Bacteriol., 172,
1905-1915, 1990, Venkatesan, MM, et al., Mol.M
icrobiol. 5, 2435-2446 1991), each of the sequences shown in claim 1 is selected from the nucleotide sequence of the ipaH gene of Shigella and enteroinvasive Escherichia coli, and an oligonucleotide having the same sequence is chemically synthesized. Synthesized. Chemical synthesis was performed by a β-cyanoethylphosphoramidite method using a cyclone plus DNA synthesizer (Milligen / BioResearch). Purification of the synthesized oligonucleotide was performed by high performance liquid chromatography using a C18 reverse phase column.

PCR Using 3 μl of the sample solution, add 17.05 sterile distilled water.
μl, 3 μl of 10x reaction buffer, dNTP solution 4.8
μl, Primer (1) 1.0 μl, Primer (2) 1.
0 μl and 0.15 μl of thermostable DNA polymerase
Was added to prepare a reaction solution having a total volume of 30 μl. 50 ml of mineral oil (manufactured by SIGMA) is added to the container containing
μl was added and overlaid on the reaction solution. The contents of each used solution and the combinations of the primers (1) and (2) are as follows.

10x reaction buffer: 500mM KCl, 100mM Tri
s-HCl pH 8.3, 15 mM MgCl2, 0.1% (w / V) gelatin dNTP solution: A mixture of dATP, dCTP, dGTP, and dTTP, each having a final concentration of 1.25 mM primers (1) and (2): as described above Aqueous solution of purified chemically synthesized product (concentration 3.75 OD / ml) Combination of primers: The above-mentioned chemically synthesized product was used in combination as follows. Primer (1) + Primer (2) (c) + (d) Thermostable DNA polymerase: Taq DNA polymerase (5 units / ml; PerkinElmer cetus)

The reaction conditions are as follows. Thermal denaturation: 94 ° C., 1 minute Annealing: 55 ° C., 1 minute Polymerization reaction: 72 ° C., 1 minute The process from heat denaturation to annealing to the polymerization reaction is one cycle (required time: 5.7 minutes), and this is 35 cycles (Total time required: about 3 hours). These operations are
The above reaction conditions were programmed into an NA thermal cycler (Perkin Elmer Cetus) and performed.

Detection In order to detect the amplified nucleotide fragment from the reaction solution, agarose gel electrophoresis was performed as follows. The agarose gel used had a gel concentration of 3% (W / V) and contained ethidium bromide (0.5 μl / ml). The electrophoresis was performed at a constant voltage of 100 V for 30 minutes. The operation method and other conditions were performed by the technique described in Maniatis et al., Molecular Cloning, 2nd edition (1989). In addition to the reaction solution, electrophoresis of a molecular weight marker was performed at the same time, and the length of the nucleotide fragment was calculated by comparing the relative mobilities.

Colony Hybridization Test The Grunstein method (Grunstein, M. and Hogne) was performed using an oligonucleotide probe specific for the ipaH gene.
ss, D., Proc. Natl. Acad. Sci. 72, 3961 (1975)).

Results As described above, Shipa and Shigella enteropathy E. coli ipa
The base sequence of the H gene has already been determined, and the oligonucleotide of the present invention, that is, the primer is PCR
The size of the nucleotide to be amplified can be easily estimated. According to this, in the combination of the primers (c) and (d), a nucleotide having a length of 242 bases (or 242 base pairs) should be amplified. If these estimates match the length of the amplified nucleotides, this combination of primers correctly amplifies the targeted region in the ipaH gene and the strain is ipaH.
It was determined to have the H gene. Table 1 shows the results of the tests performed on the test strain 347 strains.

The primer of the present invention amplified only the DNA of the strain determined to be positive for the ipaH gene in the colony hybridization test, and did not react at all with the DNA of the strain negative for the ipaH gene. That is, ipaH
This indicates that the gene was correctly amplified, and Shigella with the ipaH gene and Escherichia coli were correctly detected.

[0021]

[Table 1-1]

[Table 1-2]

[Table 1-3]

[Table 1-4]

[Table 1-5]

[Table 1-6]

[Table 1-7]

[Experiment 2] The result obtained in Experiment 1 is i
In order to confirm whether the primers are selective for the paH gene, whether the primers of the present invention react with genes such as diarrhea bacillus other than Shigella and enteroinvasive Escherichia coli to be tested in clinical tests is examined. Examined. The method is the same as that shown in Experimental Example 1 except for the method of preparing the specimen.

Preparation of Specimens Each of the strains shown in Table 2 was inoculated into an appropriate enrichment medium, and cultured overnight at 37 ° C. under aerobic or anaerobic conditions (anaerobic conditions among them) The strain grown underneath is Cl
ostridium perfringens, Campylobacter jejuni, Camp
ylobactercoli, Bacteroides flagilis, Bacteroides v
ulgatus, Lactobacillusacidophilus, Bifidobacteriu
m adolescentis). The cells were collected from 0.5 ml of each culture by centrifugation, and the cells were collected with TE buffer.
Washed twice. Add 50 mM phosphate buffer pH 7.
5 was dissolved in an N-acetylmuraminidase solution and an achromopeptidase solution at a final concentration of 50 μg / m 2.
l, and 1 mg / ml.
Treated for 0 minutes and lysed. A mixture of phenol and chloroform (1: 1 mixing ratio) saturated with TE buffer was added to the lysate, and the mixture was stirred well. After centrifugation, the upper layer solution was collected and treated with ethanol to precipitate nucleic acid components. The precipitate was dissolved in 1 ml of a TE buffer to obtain a sample. In addition, human placenta-derived DNA (Human placen
ta DNA) was prepared at a concentration of 1 μg / ml and subjected to PCR in the same manner.

Results Table 2 shows the test results for the primer combinations. The primer combination of the present invention did not amplify various DNAs, including diarrhea DNA, except for DNAs of Shigella and enteroinvasive Escherichia coli. Therefore, it can be said that the oligonucleotide of the present invention, that is, the primer, selectively reacts only with the bacterium having the ipaH gene.

[0025]

[Table 2]

(Example 2: Detection of invE gene of Shigella and enteroinvasive Escherichia coli) [Experimental Example 1] Preparation of specimen As strains of Shigella and enteroinvasive Escherichia coli, 34 in Table 1 were used.
Using one strain, a sample was prepared in the same manner as in Example 1.

Synthesis of primers Reference (Watanabe, H. et al., J. Bacteriol., 172, 619)
-629, 1990), each of the sequences shown in claim 3 was selected from the nucleotide sequence of the invE gene of Shigella and enteroinvasive Escherichia coli, and an oligonucleotide having the same sequence was chemically synthesized. Chemical synthesis was performed by a β-cyanoethylphosphoramidite method using a cyclone plus DNA synthesizer (Milligen / BioResearch). Purification of the synthesized oligonucleotide was performed by high performance liquid chromatography using a C18 reverse phase column.

PCR was performed under the same reaction conditions as in Example 1 except that the following combinations were used as combinations of PCR primers. Primer (1) + Primer (2) (e) + (f)

Detection was carried out in the same manner as in Example 1.

Colony hybridization test Using an oligonucleotide probe specific to the invE gene, the Grunstein method (Grunstein, M. and Hogne) was used.
ss, D., Proc. Natl. Acad. Sci. 72, 3961 (1975)).

Results As described above, Shigella and enteroinvasive Escherichia coli inv
The base sequence of the E gene has already been determined, and the oligonucleotide of the present invention, that is, the primer is PCR
The size of the nucleotide to be amplified can be easily estimated. According to this, in the combination of the primers (e) and (f), a nucleotide having a length of 293 bases (or 293 base pairs) should be amplified. If the lengths of the amplified nucleotides match these estimates, the combination of primers correctly amplifies the targeted region in the invE gene and the strain is inv
It was determined to have the E gene. Table 3 shows the results obtained by examining the test strain 347 strains.

The primer of the present invention amplified only the DNA of the strain determined to be positive for the invE gene in the colony hybridization test, and did not react at all with the DNA of the strain negative for the invE gene. That is, invE
This shows that the gene was correctly amplified, and Shigella and intestinal invasive Escherichia coli having the invE gene were correctly detected.

[0033]

[Table 3-1]

[Table 3-2]

[Table 3-3]

[Table 3-4]

[Table 3-5]

[Table 3-6]

[Table 3-7]

[Experimental Example 2] The result obtained in Experimental Example 1 is i
In order to confirm whether the primers are selective for the nvE gene, it is determined whether or not the primer of the present invention reacts with genes such as Shigella and diarrhea other than intestinal invasive Escherichia coli to be tested in clinical tests. Examined. The method is the same as that shown in Experimental Example 1 except for the method of preparing the specimen.

Preparation of Specimens Each strain shown in Table 4 was prepared in the same manner as in Experimental Example 2 of Example 1.

Results Table 4 shows the test results for the combinations of primers. The primer combination of the present invention did not amplify various DNAs, including diarrhea DNA, except for DNAs of Shigella and enteroinvasive Escherichia coli. Therefore, it can be said that the oligonucleotide of the present invention, that is, the primer, selectively reacts only with the bacterium having the invE gene.

[0037]

[Table 4]

[0038]

According to the present invention, the use of the PCR method and the use of primers targeting the inpaE and invE genes, which are one of the pathogenic factors of Shigella, enable the detection of bacteria having the Shiga toxin gene. High detection sensitivity due to the gene amplification effect and high selectivity due to the reaction being defined by two or more primers are obtained.

Further, since the detection sensitivity is high, a large amount of the sample is not required, and the pretreatment of the sample can be simplified. In the embodiment of the present invention, the reaction time is 3 hours, and the operation for detection is 3 hours.
It was 0 minutes. Furthermore, by using agarose gel electrophoresis and nucleic acid staining with ethidium bromide for detection, detection can be performed without labeling primers or the like. Moreover, since the length of the amplified nucleotide can be confirmed, the reliability of the test result is high.

Inspection of Shigella requires accurate results without delay in order to promptly and appropriately treat the detected patients and take preventive measures. Further, the present invention selectively detects ipaH and invE genes, which are one of the pathogenic factors of Shigella. Therefore, according to the present invention, it is possible to accurately detect Shigella as the causative bacterium.

[0041]

[Sequence list]

SEQ ID NO: 1 Sequence length 21 bases Sequence type Number of nucleic acid strands Single strand Topology Linear Sequence type Genomic DNA Hypothetical sequence NO Antisense NO Origin Shigella dysenteriae, Shigella flexneri,
Characteristics of Shigella boydii and Shigella sonnei sequences Method of determining S sequence TGTATCACAGATATGCGCATGC

Sequence number (SEQ ID NO); 2 Sequence length 20 bases Sequence type Number of nucleic acid strands Single strand Topology Linear Sequence type Genomic DNA Hypothetical sequence NO Antisense NO Origin Shigella dysenteriae, Shigella flexneri,
Characteristics of Shigella boydii and Shigella sonnei sequences Method of determining S sequence TCCGGAGATTGTTCCATGTG

Sequence number (SEQ ID NO); 3 Sequence length 22 bases Sequence type Number of nucleic acid strands Single strand Topology Linear Sequence type Genomic DNA Hypothetical sequence NO Antisense NO Origin Shigella dysenteriae, Shigella flexneri,
Characteristics of Shigella boydii and Shigella sonnei Sequences Method of Characterization S Sequence CAAGATTTAACCTTCGTCAACC

SEQ ID NO: 4 Sequence length 20 bases Sequence type Number of nucleic acid strands Single strand Topology Linear Sequence type Genomic DNA Hypothetical sequence NO Antisense NO Origin Shigella dysenteriae, Shigella flexneri,
Characteristics of Shigella boydii and Shigella sonnei Sequences Method of Characterization S Sequence AGTTCTCGGATGCTATGCTC

Claims (3)

[Claims] 1. Shigella dys (Shigella dys) present in a sample
enteriae, Shigella flexneri, Shigella boydii and
Shigella sonnei) and enteroinvasive Escherichia coli (enteroinv)
asive Escherichia coli)
An oligonucleotide which targets a nucleotide sequence encoding the paH gene and is chemically synthesized so as to be complementary to the nucleotide sequence, wherein the synthetic nucleotide comprises at least 10 consecutive nucleotides or more of the following sequence (5 (5) -TCCGGAGATTGTTCCATGTG- (3 ')... (D) or a corresponding complementary sequence. 2. Shigella dys (Shigella dys) present in a specimen.
enteriae, Shigella flexneri, Shigella boydii, and Shigella sonnei) and enteroinvasive E. coli (entero
invasive Escherichia coli)
An oligonucleotide which targets a nucleotide sequence encoding the nvE gene and is chemically synthesized so as to be complementary to the nucleotide sequence, wherein the synthetic nucleotide comprises at least 10 consecutive nucleotides or more of the following sequence group ( 5 ')-CAAGATTTAACCTTCGTCCAACC- (3') (e) (5 ')-AGTTCTCGGATGCTATGCTC- (3') (f) or a corresponding complementary sequence Oligonucleotides. 3. A method comprising selectively amplifying a sequence of an oligonucleotide having one of the sequences of the oligonucleotides according to claims 1 and 2, wherein a) A primer is hybridized to a target nucleotide sequence in a single strand state in a sample, and a chain length reaction is carried out by a polymerization reaction of four nucleotides. (b) One double-stranded nucleotide sequence obtained is obtained. When separated into strands, the complementary strand functions as a template for the chain reaction with the other primer, (c) simultaneous chain length reaction with these two primers, separation of the chain length product from the template, and new By repeating the hybridization with the primers, a specific nucleotide sequence is amplified and detected. (D) As a result, it is determined whether or not the sequence to be recognized exists in the sample. It is a method which is characterized in that the detection of Shigella that.