JPH119281A - Oligonucleotide for detecting bacteria and process utilizing the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain new oligonucleotides having sequences complementary to nucleic acid sequences encoding verocytotoxins produced by enterohemorrhagic Escherichia coli, Verocytotoxin-producing Escherichia coli, etc., detecting verocytotoxins used for clinical examination of food poisoning, diarrhea, etc. SOLUTION: The new chemically synthesized oligonucleotides have sequences expressed by formula I-IV having nucleotides sequences complementary to the targeting nucleotide sequence encoding genes of type 1 verocytotoxin(VT1) and type 2 verocytotoxin(VT2) produced by enterohemorrhagic Escherichia coli(EHEC), Verocytotoxin-producing Escherichia coli(VTEC), and their variational gene existing in the sample, or oligonucleotides having relating complementary sequences, useful for clinical examination, especially in examination relating to food poisoning, diarrhea, etc., simply, rapidly, in high sensitivity in examination of EHEC, VTEC. The oligonucleotide is obtained by selecting base sequence from the gene of verocytotoxin of EHEC(VTEC) and synthesizing.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

[0001] The present invention relates to the detection of EHEC or VTEC, and the VT1 and VT2 genes in clinical tests, especially in food poisoning tests or diarrhea tests.

[0002]

2. Description of the Related Art EHEC or VTEC is recognized not only as a food poisoning symptom typified by hemorrhagic colitis, but also as a causative bacterium of a serious disease, hemolytic uremic syndrome. , In clinical tests,
Emphasis is being placed on quick detection of this bacterium.

[0003] In the inspection concerning EHEC (VTEC),
The test material is feces, food, or water (drinking water, river water, etc.) collected from the patient's surrounding environment. In order to detect and identify EHEC (VTEC) from these specimens, it is necessary to perform an operation from a direct isolation culture, a primary confirmation culture test, a secondary confirmation culture test to an antiserum agglutination test.

[0004]

However, the time required for these culturing steps is 18 to 24 hours, respectively, and the total required time is 3 to 4 days, which is a very long time. At present, O157: H7 is a typical serotype of EHEC (VTEC).
The pathogenicity of EC) is derived from the ability to produce verotoxin, and the serotype and pathogenicity are not always the same. Therefore, it is often difficult to judge as a causative bacterium only by identification by serotype. For these reasons, current EHEC (VTEC) testing methods lack speed and simplicity and are not effective.

[0005] Therefore, the present invention is to detect the VT1 and VT2 genes of EHEC (VTEC) by a gene amplification technique in which an oligonucleotide functions as a primer for a nucleic acid synthesis reaction, and is used for clinical tests, especially for food poisoning and diarrhea. An object of the present invention is to provide a simple, rapid, and highly sensitive EHEC (VTEC) test method in such a test.

[0006]

SUMMARY OF THE INVENTION The present invention provides an EHEC (V
An oligonucleotide that selectively hybridizes to the VT1 gene and the VT2 gene of (TEC) is prepared, and this oligonucleotide is used as a primer for gene amplification to produce only one of VT1 and VT2, which are the virulence factors of this bacterium. It is characterized by selectively detecting only bacteria or those producing both VT1 and VT2.

[0007] Here, the oligonucleotides include VT1 gene and VT2 gene and their mutant genes (VT2 gene).
vha, VT2vhb, VT2vp1, and VT2v
oligonucleotides that target the nucleotide sequence encoding p2) and are chemically synthesized to be complementary to the nucleotide sequence, wherein the synthesized nucleotides are the following sequence group: (5 ′) d-CAACACTGGATGATCTCAG- (3 ′) (A, SEQ ID NO: 1) (5 ') d-CCCCCTCAACTGCTATA- (3') ... (b, SEQ ID NO: 2) (5 ') d-ATCAGTCGTCACTCACTGGT- (3 (C, SEQ ID NO: 3) (5 ') d-CTGCTGTCACAGTGACAA- (3') ... (d, SEQ ID NO: 4) or a corresponding complementary sequence And

The gene amplification was developed by Saiki et al.
It is performed based on the Polymerase Chain Reaction method (hereinafter abbreviated as PCR method; Science 230, 1350 (1985)).
In this method, when detecting a specific nucleotide sequence region (in the present invention, a region having a substantially common base sequence in the VT1 gene and VT2 gene of EHEC or VTEC), one of both ends of the region is + An oligonucleotide that recognizes the strand and hybridizes by recognizing the negative strand is prepared, and is used as a primer for a template-dependent nucleotide polymerization reaction on a sample nucleic acid that has been made into a single-stranded state by thermal denaturation. ,
The generated double-stranded nucleic acid is again separated into single-stranded, and the same reaction is caused again. By repeating this series of operations,
The copy number of the region between the two primers increases until it can be detected.

The specimen may be a clinical test material such as feces, urine, blood, tissue homogenate, or a food material. In order to use these materials as PCR samples, an operation of releasing nucleic acid components from cells present in the materials is required as pretreatment. However, if the nucleic acid to which the primer can hybridize is present from several molecules to several tens of nucleons or more, the PCR will proceed. A sample solution having a nucleic acid amount can be prepared.

The oligonucleotide used as a primer in the present invention is a nucleotide fragment having a length of 10 bases or more, preferably 15 bases or more in consideration of selectivity, detection sensitivity and reproducibility. either will do. Further, the primer may not be particularly labeled for detection. The amplification region in the nucleotide sequence of the VT1 gene and VT2 gene of EHEC (VTEC) defined by the primer is 50 to 2,000, preferably 100 to 1,1.
It may be 000 bases.

[0011] A heat-resistant DNA polymerase is used in the template-dependent nucleotide polymerization reaction, and the origin of this enzyme may be derived from any species as long as the activity is maintained at a temperature of 90 to 95 ° C. The heat denaturation temperature is 90-9
5 ° C, the temperature of the annealing operation for hybridizing the primer is 37 to 65 ° C, and the polymerization reaction is 50 to 75 ° C.
Then, the PCR is carried out for 20 to 42 cycles in which this is defined as one cycle, and amplification is performed. For the detection, the presence and length of the amplified nucleotide fragment can be confirmed by subjecting the reaction solution after the PCR to agarose gel electrophoresis as it is. From the result, it can be determined whether or not a nucleotide having a sequence to be recognized by the primer exists in the sample. This determination is made using the EHE having the VT1 gene or the V2 gene or both genes as they are.
The presence or absence of C (VTEC) bacteria is determined. For detection of the amplified nucleotide fragment, other electrophoresis methods, chromatography, and nucleic acid staining with ethidium bromide are also effective.

[0012]

【Example】

(Example 1) Preparation of specimen EHEC (VTEC) used was derived from patients and the like, and a total of 320 strains were used. Each strain was placed in LB medium (1
% Tryptone, 0.5% yeast extract, and 1% sodium chloride, and cultured overnight at 37 ° C. under aerobic conditions with shaking. 10 mM of each strain culture
1 with Tris-HCl buffer pH 7.5 (hereinafter TE buffer)
After dilution by a factor of 0 and heat treatment at 95 ° C. for 10 minutes, these were centrifuged and the supernatant was used as a sample.

Synthesis of primers VT1 of EHEC (VTEC) described in the following literature:
Each sequence shown in claim 1 was selected from the nucleotide sequences of the gene and the VT2 gene, and an oligonucleotide having the same sequence was chemically synthesized. For chemical synthesis, a cyclone plus DNA synthesizer (Milligen / BioResearch)
And by the β-cyanoethylphosphoramidite method. Purification of the synthesized oligonucleotide was performed by high performance liquid chromatography using a C18 reverse phase column.

Literature; Takao, T. et al., Microb. Patho
g., 5: 357-369, 1988 Jackson, MP et al., FEMS Microbio. Lett., 44:10
9-114, 1987 Ito, H., et al., Microb.Pathog., 8: 47-60, 1990 Weinstein, DL, J. Bacteriol., 170: 4223-4230, 19
88 PCR Use 3 μl of the above sample solution and add 17.05 sterile distilled water to it.
μl, 3 μl of 10x reaction buffer, dNTP solution 4.8
μl, Primer (1) 1.0 μl, Primer (2) 1.
0 μl and 0.15 μl of thermostable DNA polymerase
Was added to prepare a reaction solution having a total volume of 30 μl. 50 ml of mineral oil (manufactured by SIGMA) is added to the container containing
μl was added and overlaid on the reaction solution. The contents of each used solution and the combinations of the primers (1) and (2) are as follows.

10x reaction buffer: 500mM KCl, 100mM Tri
s-HCl pH 8.3, 15 mM MgCl ₂ 0.1% (w / V) gelatin dNTP solution: a mixture of dATP, dCTP, dGTP, dTTP, each having a final concentration of 1.25 mM primer: as described in claim (1) An aqueous solution (concentration: 3.75 OD / ml) of four oligonucleotide chemically synthesized purified products was used by mixing in equal amounts.

Thermostable DNA polymerase: Taq DNA
Polymerase (5 unit / ml; PerkinElmer Cetus) The reaction conditions are as follows.

Thermal denaturation: 94 ° C., 1 minute Annealing: 55 ° C., Polymerization reaction: 72 ° C., 1 minute The process from heat denaturation to annealing to annealing to a polymerization reaction is defined as one cycle (required time: 5.7 minutes). A cycle (total time required about 3 hours) was performed. These operations are
The above reaction conditions were programmed into an NA thermal cycler (Perkin Elmer Cetus) and performed.

In order to detect the amplified nucleotide fragment from the detection reaction solution, agarose gel electrophoresis was performed as follows. The agarose gel used had a gel concentration of 3% (W / V) and contained ethidium bromide (0.5 μl / ml). The electrophoresis was performed at a constant voltage of 100 V for 30 minutes. The operation method and other conditions were performed by the technique described in Maniatis et al., Molecular Cloning, 2nd edition (1989). In addition to the reaction solution, electrophoresis of a molecular weight marker was performed at the same time, and the length of the nucleotide fragment was calculated by comparing the relative mobilities.

Colony Hybridization Test The Grunstein method (Grunstein, M. and Hogness, D., Proc. Natl. Acad.) Was carried out using oligonucleotide probes specific to the VT1 gene or the VT2 gene, respectively.
Sci. 72, 3961 (1975)).

Results As described above, the nucleotide sequences of the VT1 gene and VT2 gene of EHEC (VTEC) have already been determined, and the oligonucleotide of the present invention, ie, the size of the nucleotide to be amplified by the PCR by the primer, can be easily determined. Can be estimated. According to this, in the combination of the primers (a: SEQ ID NO: 1) and (b: SEQ ID NO: 2), a nucleotide having a length of 349 bases (or 349 base pairs) should be amplified. Similarly, a primer (c: SEQ ID NO: 3)
And (d: SEQ ID NO: 4), a nucleotide of 112 bases (or 112 base pairs) in length should be amplified. When the lengths of these estimated values and the nucleotides actually amplified by the PCR method match, the combination of the primers correctly amplifies the target region of the VT1 gene or VT2 gene, and the strain is It was determined to have the VT1 gene or VT2 gene.

Table 1 shows the results of the tests performed on 320 test strains. Each primer combination amplifies only the DNA of the strain determined to have the VT1 gene or the VT2 gene in the colony hybridization test, and does not react at all with the DNA of the strain having neither the VT1 gene nor the VT2 gene. Was. That is, the VT1 gene or VT2 gene is correctly amplified,
EHEC with two genes or both genes
(VTEC) is correctly detected.

[0022]

[Table 1] (Example 2) In order to confirm whether or not the results obtained in Example 1 were selective for EHEC (VTEC) having the VT1 gene or VT2 gene, EHEC (VTEC) to be tested in a clinical test was used. It was examined whether the primers of the present invention react with genes such as diarrhea germs other than those described in (1). The method is the same as that shown in Example 1 except for the method of preparing the sample.

Preparation of Specimens Each of the strains shown in Table 2 was inoculated into an appropriate enrichment medium and cultured overnight at 37 ° C. under aerobic or anaerobic conditions (of which anaerobic conditions were included) in cultured strains, Clos
tridium perfringens, Campylobacter jejuni, Bacter
oides fragilis , Bacteroides vulgatus , and Lactob
acillus acidophilus ). 0.5m of each strain culture
The cells were recovered from the cells by centrifugation and washed once with a TE buffer. Add 50 mM phosphate buffer p
N-acetylmuraminidase solution dissolved in H7.5,
And achromopeptidase solution to a final concentration of 50 μg
/ Ml, and 1 mg / ml.
And lysed. A mixture of phenol and chloroform (1: 1 mixing ratio) saturated with TE buffer was added to the lysate, and the mixture was stirred well. After centrifugation,
The upper layer solution was recovered and treated with ethanol to precipitate nucleic acid components. The precipitate was dissolved in 1 ml of a TE buffer to obtain a sample. In addition, human placenta-derived DNA (Human plac
Enta DNA) was prepared at a concentration of 1 μg / ml and subjected to PCR in the same manner.

Results Table 2 shows the test results for some combinations of primers. All combinations of the primers in the table are, except for some Shigella dysenteriae type I DNA.
About various DNA including diarrhea bacillus DNA,
They did not amplify their DNA. Also, Shig
ella dysenteriae type I has a VT1 gene, and EHEC (VTE
It is well known in academia that it is impossible to distinguish C) from Shigella dysenteriae type I. Therefore, it can be said that the oligonucleotide of the present invention, that is, the primer, selectively reacts only with the bacterium having the VT1 gene or VT2 gene. Incidentally, if the agarose gel electrophoresis method used in the examples of the present invention is performed under the above-described conditions,
For nucleotides less than 100 bases (or 100 base pairs) in length, 5 to 10 bases (base pairs) and 1
With nucleotides in the range of 00 to 500 bases (base pairs), differences in nucleotide length of 10 to 20 bases (base pairs) can be distinguished. Further, by using acrylamide or the like for the gel material, the measurement accuracy of nucleotide length can be improved, and the VT1 gene and V
It is believed that the reliability in the selective detection of the T2 gene will be further increased.

[0025]

[Table 2]

[0026]

According to the present invention, the use of the PCR method and the use of primers targeting the VT1 and VT2 genes (VT1 gene and VT2 gene), which are the pathogens of EHEC (VTEC), VT
In the detection of a bacterium having one gene or the VT2 gene or both genes, high detection sensitivity by gene amplification and high selectivity by defining the reaction with two or more primers Is obtained. Further, since the detection sensitivity is high, a large amount of the sample is not required, and the pretreatment of the sample can be simplified. In the example of the present invention, the reaction time was 3 hours, and the operation required for the detection was 30 minutes. Furthermore, by using agarose gel electrophoresis and nucleic acid staining with ethidium bromide for detection, detection can be performed without labeling primers or the like. Moreover, since the length of the amplified nucleotide can be confirmed, the reliability of the test result is high.

The examination of EHEC (VTEC) requires accurate results without delay in order to promptly and appropriately treat found patients and preventive measures. In addition, the present invention provides an EHE
The present invention selectively detects genes (VT1 gene and VT2 gene) encoding VT1 or VT2, which are pathogenic factors of C (VTEC). Therefore, according to the present invention, it is possible to accurately detect EHEC (VTEC) as a causative bacterium.

[0028]

[Sequence list]

SEQ ID NO: 1 Sequence length 19 bases Sequence type Number of nucleic acid strands Single strand Topology Linear type of sequence Genomic DNA Hypothetical sequence NO Antisense NO Origin Escherichia coli Sequence characteristics Characteristics Determined method S sequence CAACACTGGATGATCTCAG

SEQ ID NO: 2 Sequence length 18 bases Sequence type Number of nucleic acid strands Single strand Topology Linear Sequence type Genomic DNA Hypothetical sequence NO Antisense NO Origin Escherichia coli sequence Features Method for determining features S Sequence CCCCCTCAACTGCTAATA

Sequence number (SEQ ID NO); 3 Sequence length 20 bases Sequence type Number of nucleic acid strands Single strand Topology Linear Sequence type Genomic DNA Hypothetical sequence NO Antisense NO Origin Escherichia coli sequence Features Method for determining features S sequence ATCAGTTCGTCACTCACTGGT

Sequence number (SEQ ID NO); 4 Sequence length 19 bases Sequence type Number of nucleic acid strands Single strand Topology Linear Sequence type Genomic DNA Hypothetical sequence NO Antisense NO Origin Escherichia coli sequence Features Method for determining features S Sequence CTGCTGTCACAGTGACAAAA

Claims (2)

[Claims] 1. An enterohemorrhagic Escherichia coli (en) present in a specimen.
terohemorrhagic Es cherichia coli (EHEC)
Or Verocytotoxin-producin
g Escherichia coli (hereinafter referred to as VTEC) produced verotoxin type 1 (hereinafter referred to as VT1) gene (hereinafter referred to as VT1 gene) and verotoxin type 2 (hereinafter referred to as VT2) gene (hereinafter referred to as VT2 gene) and variants thereof Gene (VT2vh
a, VT2vhb, VT2vp1, and VT2vp
An oligonucleotide which targets a nucleotide sequence encoding 2) and is chemically synthesized so as to be complementary to the nucleotide sequence, wherein the synthetic nucleotides are the following sequence group: (5 ′) d-CAACACTGGGATGATCTCAG- (3 ′) (A, SEQ ID NO: 1) (5 ') d-CCCCCTCAACTGCTAATA- (3') ... (b, SEQ ID NO: 2) (5 ') d-ATCAGTCGTCACTCACTGGT- (3') ... (c, SEQ ID NO: 3) (5 ′) d-CTGCTGTCACAGTGACAAA- (3 ′) (d, SEQ ID NO: 4) or an oligonucleotide comprising a corresponding complementary sequence. 2. A method comprising causing an oligonucleotide having each sequence according to claim 1 to function as a primer for a chain length reaction to selectively amplify a target nucleotide sequence, a) A primer is hybridized to a single-stranded target nucleotide sequence in a sample, and a chain length reaction is performed by a polymerization reaction of four nucleotides. (b) The obtained double-stranded target nucleotide sequence is When separated into main strands, the complementary strand functions as a template for a chain length reaction with the other primer. (C) By repeating hybridization with these two primers, a specific nucleotide sequence is amplified and electrophoresis is performed. Or, detecting the amplified nucleotide fragment by chromatography, (d) as a result, the sequence to be recognized is present in the sample EHEC or VTE by determining whether Luke
A method for detecting C and typing the Vero toxin gene.