JPH07284400A - Oligonucleotide for detecting dysentery bacillus and detection method using the same nucleotide - Google Patents

Abstract

PURPOSE:To detect a Shigella toxicin gene, etc., of dysentery bacillus by carrying out gene amplification using an oligonucleotide complementary to a nucleotide sequence coding the Shigella toxicin gene, ipaH gene or invE gene as a primer. CONSTITUTION:Amplification of genes is carried out using an oligonucleotide (an oligonucleotide of formula I and formula II in the case of a Shigella toxicin gene) having a length of >=10, preferably >=15 bases and complementary to a nucleotide coding the Shigella toxicin gene produced by a bacterial strain of Shigella dysenteriae type 1, an ipaH gene or an invE gene which selectively exists in Shigella dysenteriae, Shigella flexneri, Shigella boydii and Shigella sonnei and enteroinvasive Escherichia coli as a primer.

Description

Detailed Description of the Invention

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to quarantine, clinical tests, particularly tests for food poisoning or bacterial diarrhea, or detection of Shigella in food tests.

[0002]

2. Description of the Related Art The detection of Shigella is important for various medicines and public health, and conventionally, detection was carried out by the following steps.

First, a separation culture is performed from a patient's stool or food as a test material using a medium such as DHL agar or MacConkey agar, and then a differential culture using TSI agar, LIM agar or the like.

[0004]

However, in the conventional method, the time required for each culture step is 18 to 24 hours, and the total required time is 3 to 4 days, which is not rapid. In addition, a reverse passive latex particle agglutination method using a specific antibody against Shiga toxin of Shigella, and an EIA method using a specific antibody against a 140-megadalton plasmid product involved in pathogenicity of Shigella and enteroinvasive Escherichia coli (Kenichiro Ito) Et al., Japanese Bacteriology Journal 41,414 (1986)) and a DNA probe method for detecting the ipaB gene, the ipaC gene, or the ipaD gene (US patent Applicatio).
n No. 888194), but these test methods require complicated preparation of reagents and samples, and require a lot of time.

Therefore, the present invention is to provide a simple, rapid and highly sensitive novel detection method for quarantine, clinical examination, and food inspection.

[0006]

In order to solve the above problems, the present invention provides a Shiga toxin gene of Shigella or Shigella and intestinal invasive Escherichia coli by a gene amplification technique in which an oligonucleotide is made to function as a primer for a nucleic acid synthesis reaction. I
There are those that detect paH and invE .

The oligonucleotide used in the present invention is an oligonucleotide chemically synthesized so as to be complementary to the nucleotide sequence encoding the Shiga toxin gene when the target is a nucleotide sequence, (5 ′)-CAACACTGGATGATCTCAG- (3 ′) containing at least 10 consecutive bases of the sequence group of (5 ′)-(5 ′)-CCCCCTCAACTGCTAATA- (3 ′) ... (b; SEQ ID NO: 2) or the corresponding complementary sequence, which is present in the specimen Shigella dysenteriae , Shigella flexner i, Sh
igel la boydi i and Shigella sonnei ) and the nucleotide sequence encoding the ipaH gene selectively present in enteroinvasive Escherichia coli , should be complementary to the nucleotide sequence. An oligonucleotide that is chemically synthesized, wherein the synthetic nucleotide contains at least 10 consecutive bases of the following sequence group (5 ′)-TGTATCACAGATATGGGCATGC- (3 ′) ... (C; SEQ ID NO: 3) (5 ')-TCCGGAGATTGTTCCATGTG- (3') (d; SEQ ID NO: 4) or a corresponding complementary sequence, which is present in a sample. Shigella dysenteriae , Shigella flexner i, S
hige lla boydii , and Shigella sonnei ) and the nucleotide sequence encoding the invE gene selectively present in enteroinvasive Escherichia coli should be complementary to the nucleotide sequence. An oligonucleotide that has been chemically synthesized, wherein the synthetic nucleotide contains at least 10 consecutive bases of the following sequence group, (5 ′)-CAAGATTTAACCTTCGTCAACC- (3 ′) (e; SEQ ID NO: 5) (5 ')-AGTTCTCGGATGCTATGCTC- (3') (f; SEQ ID NO: 6) or a corresponding complementary sequence.

[0008] Gene amplification is based on the Polyme developed by Saiki et al.
It is performed based on the rase chain reaction method (hereinafter, abbreviated as PCR method; Science 230, 1350 (1985)).
In this method, when a specific nucleotide sequence region (in the present invention, Shiga toxin gene of Shigella or ipaH , invE of Shigella and enteroinvasive Escherichia coli) is detected, one of both ends of the region is + strand. On the other hand, an oligonucleotide that recognizes each strand and hybridizes is prepared, and it is generated by causing it to function as a primer for a template-dependent nucleotide polymerization reaction for a sample nucleic acid that has been converted into a single-stranded state by heat denaturation. The double-stranded nucleic acid thus prepared is again separated into single strands, and the same reaction is caused again. By repeating this series of operations, the copy number of the region sandwiched between the two primers increases until it can be detected.

The specimen may be a clinical test material such as feces, urine, blood, tissue homogenate, or food material. In order to use these materials as a PCR sample, an operation of releasing the nucleic acid component from the bacterial cells present in the material is required as a pretreatment. However, PCR will proceed if the nucleic acid to which the primer can hybridize exists from several molecules to several tens of molecules or more, so that simply treating the test material with a lytic enzyme, a surfactant, an alkali, etc. for a short time is sufficient for the PCR to proceed. A sample solution having an amount of nucleic acid can be prepared.

The oligonucleotide used as a primer in the present invention is a nucleotide fragment having a length of 10 bases or more, preferably 15 bases or more, in view of selectivity, detection sensitivity and reproducibility. either will do. Further, the primer does not have to be labeled particularly for detection.

The amplification region in the nucleotide sequences of the Shigella and intestinal invasive Escherichia coli genes defined by the primers is 50 to 2,000 bases, preferably,
It may be 100 bases to 1,000 bases. A thermostable DNA polymerase is used in the template-dependent nucleotide polymerization reaction, and the origin of this enzyme is 90 to 9
5 ° C, temperature of annealing operation for hybridizing the primer is 37 to 65 ° C, polymerization reaction is 50 to 75 ° C
Then, PCR is performed for 20 to 42 cycles with this as one cycle for amplification.

[0012] For detection, the presence of the amplified nucleotide fragment and its length can be confirmed by subjecting the reaction solution after completion of PCR to agarose gel electrophoresis as it is. From the result, it can be determined whether or not a nucleotide having a sequence to be recognized by the primer is present in the sample. This determination directly determines the presence or absence of the Shiga toxin gene or Shigella and Shigella having intestinal invasive Escherichia coli ipaH 2 and invE . Other electrophoresis and chromatography are also effective for detecting the amplified nucleotide fragment.

[0013]

The present invention produces an oligonucleotide that selectively hybridizes with Shiga toxin gene of Shigella or ipaH and invE of Shigella and intestinal invasive Escherichia coli, and the oligonucleotide is used as a primer for gene amplification. Select only bacteria and enteroinvasive E. coli.

[0014]

【Example】

(Example 1: Detection of Shiga toxin gene of Shigella) [Experimental Example 1] Preparation of sample The strain of Shigella dysenteriae used was derived from a patient or the like, and a total of 42 strains in Table 1 were used. I was there.
Each strain was inoculated into LB medium (1% tryptone, 0.5% yeast extract, and 1% sodium chloride,
Shaking culture was performed overnight at 37 ° C. under aerobic conditions. Each strain culture solution was added with 10 mM Tris-HCl buffer pH 7.5.
After diluting 10-fold with (hereinafter, TE buffer) and heating at 95 ° C. for 10 minutes, these were centrifuged and the supernatant was used as a sample.

Synthesis of Primer Shiga toxin gene of Shigella is an enterohemorrhagic Escherichia coli (entero)
hemorrhagic Escherichia coli (EHEC) or Verocytotoxin-producing Escherichia
coli (VTEC) has only a few bases different from the VT1 gene, and they are considered to be the same gene. Therefore, the literature (Takao, T et al., Microb. Pathog., 5: 357-3
69 (1988)), each sequence shown in claim 1 was selected, and an oligonucleotide having the same sequence was chemically synthesized. The chemical synthesis was performed by a β-cyanoethylphosphoramidite method using a cyclone plus DNA synthesizer (Milligen / Bioresearch). Purification of the synthesized oligonucleotide was performed by high performance liquid chromatography using a C18 reverse phase column.

PCR Using 3 μl of the above-mentioned sample liquid, sterile distilled water 17.0
μl, 10 × reaction buffer 3 μl, dNTP solution 4.8
μl, primer (1) 1.0 μl, primer (2) 1.
0 μl, and thermostable DNA polymerase 0.15 μl
Was added to prepare a reaction solution having a total volume of 30 μl. 50 containers of mineral oil (SIGMA) in this reaction solution
μl was added and overlaid on the reaction solution. The contents of each solution used and the combination of primers (1) and (2) are as follows.

10x reaction buffer: 500 mM KCl, 100 mM Tri
_{s-HCl pH8.3, 15mM MgCl 2} , 0.1% (w / V) gelatin dNTP solution: dATP, dCTP, dGTP, each final concentration that is mixed with dTTP 1.25 mM Primer (1) and (2): Aqueous solution of chemically synthesized purified product (concentration: 3.75 OD / ml) Primer combination: The chemically synthesized purified product was used in combination as described below.

Primer (1) + Primer (2) (a) + (b) Thermostable DNA polymerase: Taq DNA polymerase (5 unit / ml; manufactured by PerkinElmer cetus) The reaction conditions are as follows.

Thermal denaturation: 94 ° C., 1 minute Annealing: 55 ° C., 1 minute Polymerization reaction: 72 ° C., 1 minute The process from thermal denaturation to annealing to the polymerization reaction is one cycle (required time is 5.7 minutes). 35 cycles (total required time about 3 hours). These operations are D
An NA thermal cycler (manufactured by Perkin Elmer Cetus) was programmed with the above reaction conditions.

In order to detect the amplified nucleotide fragment from the detection reaction solution, agarose gel electrophoresis was performed as follows.

The agarose gel had a gel concentration of 3% (W / V) and contained ethidium bromide (0.5 μl / ml). The electrophoresis conditions were constant voltage of 100 V and 30 minutes. The procedure and other conditions are described in Maniatis et al. Molecular C
It was performed by the technique described in loning 2nd edition (1989). In addition to the reaction solution, the migration of molecular weight markers is performed at the same time,
The length of the nucleotide fragment was calculated by comparing the relative mobilities.

Reverse passive latex agglutination reaction (Reversed Pas
sive Latex Agglutination (RPLA) test A commercially available RPLA kit for detecting Escherichia coli verotoxin (manufactured by Denka Seiken) was purchased, a sample was prepared according to the attached instruction manual, and a test was conducted.

Results As described above, the Shiga toxin gene of Shigella has the nucleotide sequence already determined, and the oligonucleotide of the present invention,
That is, the size of the nucleotide amplified by the primer by PCR can be easily estimated. It shows that in the combination of primers (a) and (b), 349 bases (or 3
Nucleotides with a length of 49 base pairs) should be amplified. If these estimated values and the length of the amplified nucleotides match, this primer combination correctly amplifies the targeted region in the Shiga toxin gene, and the strain has the Shiga toxin gene. I decided that. Table 1 shows the results of the examination with 34 test strains. The primer of the present invention amplified only the DNA of vero toxin, that is, the strain judged to be Shiga toxin positive in the RPLA test, and did not react with the Shiga toxin gene negative strain DNA at all. That is, it is shown that the Shiga toxin gene is correctly amplified and Shigella having the Shiga toxin gene is accurately detected.

[0024]

[Table 1] [Experimental Example 2] Genes other than Shigella, such as diarrhea, which are to be examined in clinical tests to confirm whether the results obtained in Experimental Example 1 are selective for the Shiga toxin gene It was investigated whether the primer of the present invention would react. The method is the same as that shown in Experimental Example 1, except for the method for preparing the sample.

Preparation of Specimens Each of the strains shown in Table 2 was inoculated into an appropriate enrichment medium and cultured overnight at 37 ° C. under aerobic or anaerobic conditions (of which, anaerobic conditions were used). The strains cultivated in
tridium perfringens, Campylobacter jejuni, Campyl
Bacteroides, Bacteroides flagilis, Bacteroides vu
lgatus, Lactobacillus acidophilus, Bifidobacteriu
m adolescentis). The bacterial cells were collected from 0.5 ml of each strain culture solution by centrifugation, and the bacterial cells were washed with TE buffer to 1 cell.
Washed twice. 50 mM phosphate buffer pH 7.
The N-acetylmuraminidase solution and the achromopeptidase solution, which had been dissolved in No. 5, were added to a final concentration of 50 μg / m 2.
1 and 1 mg / ml, and add 1 at 37 ° C.
It was treated for 0 minutes and lysed. A mixed solution of phenol and chloroform saturated with TE buffer (mixing ratio 1: 1) was added to the lysate and stirred well. After centrifugation, the upper layer liquid was collected and treated with ethanol to precipitate the nucleic acid component. This precipitate was dissolved in 1 ml of TE buffer to give a sample. In addition, human placenta-derived DNA (Human placen
ta DNA) was prepared at a concentration of 1 μg / ml, and this was also subjected to PCR in the same manner.

Results Table 2 shows the test results for the combinations of primers. The primer combination of the present invention does not amplify DNA of various DNAs including diarrhea bacterium DNA, except for DNAs of Shiga toxin-producing Shigella and Vero toxin type 1-producing Escherichia coli. It was Therefore, it can be asserted that the oligonucleotide of the present invention, that is, the primer, selectively reacts only with the bacterium having the Shiga toxin gene. If the agarose gel electrophoresis method used in the examples of the present invention is carried out under the above-mentioned conditions, nucleotides having a length of 100 bases (or 100 base pairs) or less are 5 to 10 bases (base pairs). , And in the range of 100 to 500 bases (base pairs),
Different lengths of nucleotides of 10 to 20 bases (base pairs) can be distinguished. Furthermore, by using acrylamide or the like as the gel material, the measurement accuracy of the nucleotide length can be improved, and the reliability in the selective detection of the Shiga toxin gene is considered to be further increased.

[0027]

[Table 2] (Example 2: ipaH of Shigella and enteroinvasive Escherichia coli )
Gene Detection) [Experimental Example 1] Preparation of Specimens 34 of Table 3 as strains of Shigella and enteroinvasive Escherichia coli
A sample was prepared in the same manner as in Example 1 except that one strain was used.

Synthesis of primers (Hartman, AB, et al., J. Bacteriol., 172,
1905-1915, 1990, Venkatesan, MM, et al., Mol. M
icrobiol. 5, 2435-2446 1991), each sequence shown in claim 2 is selected from the nucleotide sequences of the ipaH gene of Shigella and enteroinvasive Escherichia coli described in icrobiol. Synthesized. The chemical synthesis was performed by a β-cyanoethylphosphoramidite method using a cyclone plus DNA synthesizer (Milligen / Bioresearch). Purification of the synthesized oligonucleotide was performed by high performance liquid chromatography using a C18 reverse phase column.

PCR was performed under the same reaction conditions as in Example 1 except that the following combinations of PCR primers were used.

Detection of primer (1) + primer (2) (c) + (d) It was carried out in the same manner as in Example 1.

Colony Hybridization Test Using an oligonucleotide probe specific for the ipaH gene, the method of Grunstein (Grunstein, M. and Hogne
ss, D., Proc. Natl. Acad. Sci. 72, 3961 (1975))
Went according to.

Results As described above, the ipa of Shigella and enteroinvasive Escherichia coli
The nucleotide sequence of the H gene has already been determined, and the oligonucleotide of the present invention, that is, the primer is PCR.
The size of the nucleotide to be amplified by can be easily estimated. According to this, the combination of the primers (c) and (d) should amplify a nucleotide having a length of 242 bases (or 242 base pairs). If these estimates match the length of the amplified nucleotides, this primer combination correctly amplifies the targeted region in the ipaH gene and the strain is ipaH.
It was judged to have the H gene. Table 3 shows the results obtained by examining 347 test strains. The primer of the present invention amplified only the DNA of the strain that was determined to be positive for the ipaH gene in the colony hybridization test, and did not react with the DNA of the strain that was negative for the ipaH gene at all. That is, it shows that the ipaH gene was correctly amplified, and Shigella and intestinal invasive Escherichia coli carrying the ipaH gene were accurately detected.

[0033]

[Table 3-1]

[0034]

[Table 3-2]

[0035]

[Table 3-3]

[0036]

[Table 3-4]

[0037]

[Table 3-5]

[0038]

[Table 3-6]

[0039]

[Table 3-7] [Experimental Example 2] In order to confirm whether the results obtained in Experimental Example 1 are selective for the ipaH gene, diarrheal bacteria other than Shigella and enteroinvasive Escherichia coli to be tested in clinical tests. It was examined whether or not the primers of the present invention react with respect to such genes. The method is the same as that shown in Experimental Example 1, except for the method for preparing the sample.

Preparation of Specimens Each strain shown in Table 4 was subjected to the same procedure as in Experimental Example 2 of Example 1.

Results Table 4 shows the test results for the combinations of primers. The primer combination of the present invention did not amplify various types of DNA including diarrhea bacterium DNA except Shigella bacterium and enteroinvasive E. coli DNA. Therefore, it can be asserted that the oligonucleotide of the present invention, that is, the primer, selectively reacts only with the bacterium having the ipaH gene.

[0042]

[Table 4-1] (Example 3: invE of Shigella and enteroinvasive Escherichia coli )
Gene Detection) [Experimental Example 1] Preparation of Specimens 34 of Table 3 as strains of Shigella and enteroinvasive Escherichia coli
A sample was prepared in the same manner as in Example 1 except that one strain was used.

Synthesis of primers (Watanabe, H. et al., J. Bacteriol., 172, 619)
-629, 1990), each sequence shown in claim 3 was selected from the nucleotide sequences of the invE genes of Shigella and Escherichia coli invading the intestinal tract, and oligonucleotides having the same sequences were chemically synthesized. The chemical synthesis was performed by a β-cyanoethylphosphoramidite method using a cyclone plus DNA synthesizer (Milligen / Bioresearch). Purification of the synthesized oligonucleotide was performed by high performance liquid chromatography using a C18 reverse phase column.

PCR was performed under the same reaction conditions as in Example 1 except that the following combinations were used as the PCR primer combinations.

Detection of primer (1) + primer (2) (e) + (f) The same procedure as in Example 1 was performed.

Colony Hybridization Test Using the oligonucleotide probe specific for the invE gene, the method of Grunstein (Grunstein, M. and Hogne
ss, D., Proc. Natl. Acad. Sci. 72, 3961 (1975))
Went according to.

Results As described above, inv of Shigella and enteroinvasive Escherichia coli
The nucleotide sequence of the E gene has already been determined, and the oligonucleotide of the present invention, that is, the primer is PCR.
The size of the nucleotide to be amplified by can be easily estimated. According to this, the combination of the primers (e) and (f) should amplify a nucleotide having a length of 293 bases (or 293 base pairs). If these estimates match the length of the amplified nucleotides, this primer combination correctly amplifies the targeted region in the invE gene, and the strain is inv
It was judged to have the E gene. Table 5 shows the results obtained by examining 347 test strains. The primer of the present invention amplified only the DNA of the strain determined to be positive for the invE gene in the colony hybridization test, and did not react with the DNA of the strain negative for the invE gene at all. That is, it indicates that the invE gene was correctly amplified, and Shigella and intestinal invasive Escherichia coli carrying the invE gene were accurately detected.

[0048]

[Table 5-1]

[0049]

[Table 5-2]

[0050]

[Table 5-3]

[0051]

[Table 5-4]

[0052]

[Table 5-5]

[0053]

[Table 5-6]

[0054]

[Table 5-7] [Experimental Example 2] In order to confirm whether the results obtained in Experimental Example 1 are selective for the invE gene, diarrhea bacteria other than Shigella and enteroinvasive Escherichia coli to be tested in clinical tests. It was examined whether or not the primers of the present invention react with respect to such genes. The method is the same as that shown in Experimental Example 1, except for the method for preparing the sample.

Preparation of Specimens Each strain shown in Table 6 was subjected to the same procedure as in Experimental Example 2 of Example 1.

Results Table 6 shows the test results for the combinations of primers. The primer combination of the present invention did not amplify various types of DNA including diarrhea bacterium DNA except Shigella bacterium and enteroinvasive E. coli DNA. Therefore, it can be asserted that the oligonucleotide of the present invention, that is, the primer, selectively reacts only with the bacterium having the invE gene.

[0057]

[Table 6-1]

[0058]

INDUSTRIAL APPLICABILITY In the present invention, the PCR method was used, and the Shiga toxin gene or i
By using the primers targeting the paH and invE genes, in the detection of the bacterium carrying the Shiga toxin gene, the high detection sensitivity due to the gene amplification action and the reaction is defined by two or more primers. It is possible to obtain high selectivity. Further, since the detection sensitivity is high, a large amount of sample is not required and pretreatment of the sample can be simplified. In the examples of the present invention, the reaction time is 3 hours,
The operation for detection was 30 minutes. In addition, by using the agarose gel electrophoresis method and the nucleic acid staining method with ethidium bromide for the detection, the detection can be performed without labeling the primer and the like. Moreover, since the length of the amplified nucleotide can be confirmed, the reliability of the test result is high.

The examination of Shigella requires accurate results without delay in order to promptly and appropriately treat the detected patient and preventative measures. In addition, the present invention selectively detects the Shiga toxin gene, which is one of the pathogenic factors of Shigella, or the ipaH 2 and invE genes. Therefore, according to the present invention, it is possible to accurately detect Shigella as a causative bacterium.

[0060]

[Sequence list]

Sequence number (SEQ ID NO); 1 Sequence length 19 bases Sequence type Number of nucleic acid strand Single strand topology Linear sequence type Genomic DNA hypothetical sequence NO antisense NO origin Shigella dysenteriae type 1 Sequence characteristics Method for characterizing S sequence CAACACTGGATGATCTCAG

SEQ ID NO: (SEQ ID NO); 2 Length of sequence 18 bases Type of sequence Number of nucleic acid strand Single-strand topology Type of linear sequence Genomic DNA hypothetical sequence NO antisense NO origin Shigella dysenteriae type 1 Sequence features Method for determining features S sequence CCCCCTCAACTGCTAATA

SEQ ID NO: (SEQ ID NO); 3 Sequence length 21 bases Sequence type Nucleic acid Number of strands Single-strand topology Linear sequence type Genomic DNA Hypothetical sequence NO antisense NO Origin Shigella dysenteriae , Shigella flexner i,
Features of Shigella boydi i and Shigella sonnei sequences Characterized method S sequence TGTATCACAGATATAGGGCATGC

SEQ ID NO: (SEQ ID NO); 4 Length of sequence 20 bases Sequence type Number of nucleic acid strand Single-strand topology Linear sequence type Genomic DNA Hypothetical sequence NO antisense NO Origin Shigella dysenteriae , Shigella flexner i,
Features of Shigella boydi i and Shigella sonnei sequences Characterized method S sequence TCCGGAGATTGTTTCCATGTG

SEQ ID NO: (SEQ ID NO); 5 Sequence length 22 bases Sequence type Number of nucleic acid strand Single-strand topology Linear sequence type Genomic DNA Hypothetical sequence NO antisense NO Origin Shigella dysenteriae , Shigella flexner i,
Features of Shigella boydi i and Shigella sonnei sequences Characterized method S sequence CAAGATTTAACCTTCGTCAACC

SEQ ID NO: (SEQ ID NO); 6 Length of sequence 20 bases Sequence type Number of nucleic acid strand Single-strand topology Linear sequence type Genomic DNA Hypothetical sequence NO antisense NO Origin Shigella dysenteriae , Shigella flexner i,
Features of Shigella boydi i and Shigella sonnei sequences Characterized method S sequence AGTTCTCGGATGTCATGCTC

Claims (4)

[Claims] 1. Subgroup A Shigella serotype 1 present in a sample
( Shigella dysente riae type 1) targeting a nucleotide sequence encoding a toxin gene (Shiga toxin gene) produced by a strain of ( Shigella dysente riae type 1), an oligonucleotide chemically synthesized so as to be complementary to the nucleotide sequence,
Oligonucleotide (5 ')-CAACACTGGATGATCTCAG- (3') --- (a) (5 ')-CCCCCTCAACTGCTAATA- (3') ... .. (b) or an oligonucleotide characterized in that it consists of the corresponding complementary sequence. 2. Shigella dys present in a sample
enteriae , Shigella flexner i, Shigella boydi i and
Shigella sonnei ) and enteroinvasive Escherichia coli (enteroinv)
i selectively present in asive Escherichia coli )
An oligonucleotide that is chemically synthesized so as to be complementary to the nucleotide sequence encoding the paH gene, the synthetic nucleotide containing at least 10 consecutive bases of the following sequence group ( 5 ')-TGTATCACAGATATGGGCATGC- (3') ... (c) (5 ')-TCCGGAGATTGTTTCCATGTG- (3') ... (d) or a corresponding complementary sequence. 3. Shigella dys present in a sample
enteriae , Shigella flexner i, Shigella boydii , and Shigella sonnei ) and enteroinvasive Escherichia coli (entero)
i present selectively in invasive Escherichia coli
An oligonucleotide which is chemically synthesized so as to be complementary to the nucleotide sequence encoding the nvE gene, the synthetic nucleotide comprising at least 10 consecutive bases of the following sequence group ( 5 ')-CAAGATTTAACCTTCGTCAACC- (3') ... (e) (5 ')-AGTTCTCGGATGCTATGCTC- (3') ... (f) or a corresponding complementary sequence. Oligonucleotides. 4. A method comprising selectively amplifying an oligonucleotide sequence having one of the oligonucleotide sequences according to claims 1 to 3, wherein: a) A primer is hybridized to a target nucleotide sequence in a single strand state in a sample, a chain length reaction is carried out by a polymerization reaction of four kinds of nucleotides, and (b) one double-stranded nucleotide sequence is obtained. When separated into chains, the complementary strand functions as a template for the chain length reaction by the other primer, (c) simultaneous chain length reaction by these two primers, separation of the chain length product from the template, and A specific nucleotide sequence is amplified and detected by repeating hybridization with a primer, and (d) as a result, it is determined whether or not the sequence to be recognized is present in the sample. It is a method which is characterized in that the detection of Shigella that.