JP2012144467A - V type collagen gene transcription promoter - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a V type collagen gene transcription promoter which can impart flexibility to a skin by promoting the production of V type collagen by fibroblast.SOLUTION: The V type collagen gene transcription promoter comprises the water-containing lower aliphatic alcohol extract of lithospermi radix and/or Saussureae radix as an active constituent.

Description

  The present invention relates to a V-type collagen gene transcription promoter having an action of activating transcription of a V-type collagen gene in fibroblasts and promoting production of V-type collagen. By using such a V-type collagen gene transcription promoter in skin cosmetics and the like, it is possible to impart to the skin cosmetics a texture-improving action that brings flexibility and flexibility to the skin.

  The skin is composed of a relatively thin epidermis (a layer mainly composed of epidermis keratinocytes) in contact with the outside air and a dermis located inside. The main structure of the dermis is formed by proteins such as collagen and elastin and mucopolysaccharides such as hyaluronic acid, and fibroblasts that produce these components are sparsely present in the dermis.

  Collagen, one of the main components responsible for the physical structure of the dermis, is secreted from cells as a triple helical elongated protein consisting of three polypeptide chains, and then associates into a fibrous form step by step to form collagen fibers. Deposit. There are many genes in collagen, and there are more than 20 types of protein molecules of triple helix, but type I collagen occupies the largest amount in living organisms. Usually, simply referring to collagen often refers to type I collagen.

  On the other hand, type V collagen, like type I collagen, is a protein with an elongated structure and can form fibers, but its abundance in the dermis is considerably less than that of type I collagen. However, it is known that type V collagen is mixed with type I collagen to form fibers, and as the proportion of type V collagen increases, the fibers become thinner (Non-patent Documents 1 and 2).

  By the way, various techniques are known about the anti-aging effect | action including the wrinkle prevention of the skin which the extract of a plant known as a crude drug shows. The action mechanism of the anti-aging effect by the crude drug is various, and includes elastase inhibition, hyaluronidase inhibition, removal of active oxygen, antioxidant, melanin production suppression, collagen synthesis promotion, Maillard reaction inhibition, laminin 5 production promotion and the like.

For example, Japanese Patent Application Laid-Open No. 11-246338 (Patent Document 1) discloses an anti-aging agent (elastase inhibition) containing a Murasaki extract.
Japanese Patent Laid-Open No. 2001-316240 (Patent Document 2) discloses a collagen production promoter containing an extract of a genus Saussurea.

  The collagen production promoting action promotes the production of collagen protein (substantially type I collagen) in order to compensate for the shortage of collagen, which is the main structural protein constituting the skin (dermis). As a result, the produced collagen protein forms collagen fibers, the collagen fibers are replenished to the skin (dermis), and the phenomenon associated with aging such as wrinkles and sagging is repaired. In other words, the skin tension is restored.

JP 11-246338 A JP 2001-316240 A

J Cell Sci. 1990 Apr; 95 (Pt 4): 649-57. Birk DE, Fitch JM, Babiarz JP, Doane KJ, Linsenmayer TF. Collagen fibrillogenesis in vitro: interaction of types I and V collagen regulates fibril diameter. Connect Tissue Res. 1986; 14 (4): 257-66. Adachi E, Hayashi T., In vitro formation of hybrid fibrils of type V collagen and type I collagen. Limited growth of type I collagen into thick fibrils by type V collagen. .

If the production of type V collagen can be promoted instead of type I collagen whose production can be promoted by a conventional collagen production promoter, the proportion of type V collagen in the collagen fibers constituting the skin increases, resulting in thin collagen fibers. It is thought that the skin can be supple.
Therefore, an object of the present invention is to provide a V-type collagen gene transcription promoter that can bring skin flexibility by promoting the production of V-type collagen by fibroblasts.

  As a result of intensive studies to solve the above-mentioned problems, the present inventors have transcribed the V-type collagen gene by using a composition containing a hydrous lower aliphatic alcohol extract of purple root and / or woody as an active ingredient. The present invention has been completed.

  Therefore, the present invention provides a V-type collagen gene transcription promoter containing a hydrated lower aliphatic alcohol extract of purple root and / or mushroom as an active ingredient.

The V-type collagen gene transcription promoter of the present invention can promote the flexibility of the skin by promoting the transcription of the V-type collagen gene and promoting the production of the V-type collagen.
The following can be considered as the mechanism of action of the V-type collagen gene transcription promoter of the present invention that can enhance skin suppleness.
The active ingredient contained in the V-type collagen gene transcription promoter of the present invention acts on the cells to promote the transcription of the V-type collagen gene, promote its production, and increase the amount ratio of V-type collagen to type I collagen. Has an inducing action. Type V collagen is a component that is considerably smaller than type I collagen, but is mixed with type I collagen to form collagen fibers. At this time, as the amount ratio of V-type collagen increases, a fibrous structure having a smaller diameter is formed. Therefore, it is considered that a more supple skin structure is obtained by increasing the proportion of V-type collagen in the skin.

  Generally, collagen production by cells in the skin (dermis) decreases with aging, but the composition ratio of type I collagen and type V collagen is not an indicator of aging or disease state. Therefore, the present invention does not attempt to “recover” from a “deteriorated” state caused by aging or the like, but is considered to be capable of reforming from a normal state to another constitution.

The V-type collagen gene transcription promoter of the present invention can also be used, for example, as a skin external preparation.
Moreover, according to this invention, the skin cosmetics containing a V-type collagen gene transcription promoter can be provided.

  The type-V collagen transcription promoter of the present invention contains a hydrous lower aliphatic alcohol extract of purple root and / or woody scent as an active ingredient.

  Purple roots are dried roots of the purple squirrels Lithospermum erythrorhizon Sieb.et.Zucc., Onosma paniculatum Bur.et.Fr., O.tsiangii IMJohnston, Arnebia guttata Bunge, Lithospermum arvense. Includes dried roots of L., Arnebia saxatilis Benth. Et. Hook. And Macrotomiae euchroma.

  Incense (Mokko) is a dry root of Aucklandia lappa Dcne., Vladimiria souliei Ling, Vladimiria denticulata Ling, Inura helenium L. of Compositae, Aristolochia debilis Sieb. Et Zucc, Aristolochiaceae Contains dry roots of A. contorta Bunge.

  The said plant can use what is normally used as a crude drug.

  Extracts from the above crude drugs can be obtained in accordance with conventional extraction methods from crude drugs. For example, the crude drug substance powder is pulverized and extracted by adding an appropriate extraction solvent of 1 to 50 times (weight), preferably 1 to 30 times, more preferably 1 to 15 times the weight of the bulk powder, Can be obtained by filtering and concentrating the filtrate appropriately.

  A water-containing lower aliphatic alcohol is used as the extraction solvent. Examples of lower aliphatic alcohols include aliphatic alcohols having 1 to 4 carbon atoms, such as methanol, ethanol, propanol, n-butanol, and t-butanol. The water content of the extraction solvent is preferably 30 to 70% by weight, more preferably 50%. The hydrous lower aliphatic alcohol is preferably 50% hydrous ethanol.

  The extraction is preferably performed at room temperature, but can also be performed by digestion or thermal immersion. The extraction is suitably performed, for example, by immersing the herbal medicine in the extraction solvent at room temperature with stirring or without stirring. When immersed under stirring, it is appropriate to carry out for about 1 hour to 2 days, and when immersed under non-agitated, it is appropriate to carry out for about 5 to 20 days. The extraction process may be performed only once for the same raw material, or may be performed a plurality of times, for example, about 2 to 5 times.

  The obtained extract may be filtered and recovered as a filtrate may be used as it is, but it is preferable to concentrate the filtrate and use it as a concentrated extract. Concentration is preferably performed under reduced pressure. This concentration may be performed until the extract is dry. Further, the extract may be in a concentrated state, or may be in the form of powder or lyophilized product. As a method for concentrating, a method for preparing a powder or lyophilized product, a method known in the art can be used.

  The obtained extract may be subjected to purification treatment before and after concentration. For the purification treatment, a chromatographic method, an elution method using an ion exchange resin, partition extraction with a solvent, or the like can be used alone or in combination. For example, examples of the chromatographic method include normal phase chromatography, reverse phase chromatography, high performance liquid chromatography, centrifugal liquid chromatography, column chromatography, thin layer chromatography and the like, or a method of performing a combination thereof. . In this case, purification conditions such as a carrier and an elution solvent can be appropriately selected according to various chromatographies.

  In the present invention, the above crude drug is extracted using a 1: 1 mixture of water / ethanol, the extract is filtered, and the substance obtained by drying the obtained filtrate under reduced pressure is used as a crude drug extract. Is more preferable.

The V-type collagen gene transcription promoter of the present invention may be one using the above-mentioned active ingredient as it is, or may contain an appropriate additive as long as the effect of the above-mentioned active ingredient is not hindered.
Suitable additives include preservatives (eg, parabens), antioxidants (eg, ascorbic acid), colorants, surfactants (anionic surfactants such as sodium cetyl sulfate), nonions such as polyoxyethylene alkyl ethers, etc. Surfactants, cationic surfactants such as tetraalkylammonium salts), oily solvents (vegetable oils such as olive oil and castor oil, waxes such as beeswax, silicone oils such as dimethylpolysiloxane), aqueous solvents (water, ethanol, etc.) Lower alcohol, propylene glycol, etc.), ultraviolet absorbers, perfumes, medicinal ingredients, and the like.

  The amount of the active ingredient in the V-type collagen gene transcription promoter of the present invention can be appropriately determined according to the use. The content of the active ingredient is 0.001 to 20% by weight, preferably 0.01 to 10% by weight, more preferably 0.1 to 5% by weight of the V-type collagen gene transcription promoter as a concentrated dry solid. %.

  The V-type collagen gene transcription promoter of the present invention can be suitably used for topical application to the skin. The amount used is not particularly limited, but is preferably about 0.1 to 100 mg per time.

In an embodiment of the present invention, a skin cosmetic containing the promoter, particularly a skin cosmetic for enhancing the suppleness of the skin, is provided by adding a V-type collagen gene transcription promoter to the skin cosmetic. be able to.
The amount of the V-type collagen gene transcription promoter contained in the skin cosmetic of the present invention is not particularly limited, and can be appropriately determined according to the form of the skin cosmetic. For example, the content is 0.001 to 20% by weight, more preferably 0.01 to 10% by weight, and still more preferably 0.1 to 5% by weight with respect to the total weight of the skin cosmetic.
Examples of the skin cosmetic composition of the present invention include creams, lotions (skin lotions), emulsions, foundations, essences (extracts), oils, packs, and the like.

  The present invention also provides a method for producing a V-type collagen gene transcription promoter using the water-containing lower aliphatic alcohol extract of purple root and / or mushroom.

  The present invention also includes a method for accelerating the production of type V collagen by cells, comprising supplying the above-mentioned hydrated lower aliphatic alcohol extract of purple root and / or woody scent to cultured cells.

The cultured cell is preferably a mammalian cell, and examples thereof include human, mouse, pig and bovine cells.
The above extract is preferably added so as to be 0.001 to 0.5% by weight in the medium in cell culture.
Cell culture conditions can be appropriately determined according to the cell type, and such conditions are known to those skilled in the art.

  The type V collagen obtained by promoting the production of type V collagen by the above method can be used by mixing with skin cosmetics and the like.

  EXAMPLES The present invention will be described in detail below with reference to examples, but the present invention is not limited to the examples.

Example 1 Manufacture of V-type collagen gene transcription promoter In a glass container (2 L), 1000 mL each of 100 g of dried purple and mushroom preparations mixed with distilled water and ethanol in an equal volume was added as an extraction solvent. The mixture was extracted at room temperature for 1 hour with slow stirring, the extracts were filtered, and the filtrates were dried under reduced pressure to obtain purple root and mushroom extracts.
The obtained extract was 25.2 g of purple root extract and 14.8 g of mushroom extract. These extracts were used in the following test examples as the type V collagen gene transcription promoter of the present invention.

Test Example 1 Evaluation of V-type Collagen Gene Transcription Promoting Activity In order to evaluate the V-type collagen gene transcription promoting activity of each of the above-described V-type collagen gene transcription promoting agents, Measured according to the indicated luciferase assay.
The luciferase assay is a method using a luciferase gene as a reporter gene for examining the transcriptional activity of a promoter. By measuring the luminescence activity of luciferase, the transcription activity of the gene to be analyzed can be measured. Specifically, the cell is transfected with a vector in which the luciferase gene is bound downstream of the promoter of the gene to be analyzed, and the cell is cultured. During culture, if the transcriptional activity of the promoter is strong, many enzymes (luciferase) are produced in the cell, and if the activity is weak, the amount of enzyme (luciferase) produced is small. The amount of the enzyme (luciferase) can be measured by the amount of luminescence.
In this example, a luciferase assay system for examining the transcriptional activity of the promoter of the type V collagen α1 chain gene was constructed, and each type V collagen gene transcription promoter obtained in Example 1 was added to the cells of the assay system. The effect of enhancing the transcription activity of the added type V collagen gene transcription promoter was evaluated.

<Preparation of plasmid DNA>
A promoter fragment of human type V collagen α1 chain gene was obtained by PCR using a primer set corresponding to the basic promoter region. The base sequences of the primer set and the obtained promoter fragment are shown below.
Primer 1: 5 ' gagct CCCGGGCCAGCCCCTTCCTCC 3' (SEQ ID NO: 1)
(Underlined sites are SacI restriction enzyme sites for cloning)
-Primer 2: 5 ' ctcgag TCGAGTGAGGTCCTGCGCCA 3' (SEQ ID NO: 2)
(Underlined XhoI restriction enzyme site for cloning)
Promoter fragment (NCBI accession number: AL591890): 5 'CCCGGGCCAGCCCCTTCCTCGCTGCGACTCGCCCGCTGTCCCCACCCCCTCGCCCGCGGCGCCCAGTGGGAGGCGGGGGCTGGCCTCGCCGAGCCCAGCGCCGGGCTCTGATTTGCTGCGGGCGTTGGGGATCGACAGCCTCCGCGGCTGCCTTCCAGGAGAGAGGGAGGGAGGAAAAGGGGGAAAAAAGTGCTCCGCGCCGAAGGCGAGGTCCGCACTCTCCGTCCCCGCGGCTGGCGCAGGACCTCACTCGA 3' (SEQ ID NO: 3)

  Using the SacI and XhoI restriction enzyme sites, the above promoter fragment was cloned into a pGL3 luciferase vector (Promega). Luciferase vector containing type I and type V collagen promoter fragments was used for transfection at 5 μg per sample. For use as an internal standard in the measurement of luciferase activity, pRL-TK plasmid DNA was also added at 0.25 μg (1/20 volume) per sample and co-transfected.

<Cell culture and transfection>
Mouse NIH-3T3 cells were cultured in 10% fetal bovine serum (FBS) / Dulbecco's modified Eagle medium (DMEM), and those in the logarithmic growth phase were used for the experiments. The day before transfection, cells were seeded in 1.5 × 10 ⁵ cells / 35 mm dish and cultured overnight at 37 ° C., 5% CO ₂ .
The next day, a calcium phosphate-plasmid DNA mixture (5 μg / dish) was prepared according to the calcium phosphate method (Chen, C and Okayama, H (1987), Mol. Cell Biol. 7, 2745-2852). The prepared mixed solution was added dropwise to the cell culture solution cultured overnight, and further cultured for 6 hours. In order to increase the efficiency of transfection, after 6 hours, the culture solution was removed, and a 15% glycerol / PBS (phosphate buffered saline) solution was added and treated for 1 minute. After washing the cells several times with PBS, each V-type collagen gene transcription promoter obtained in Example 1 was 10% FBS / DMEM medium containing 0.01% by weight of Mika and 0.005% by weight of purple root. And further cultured for 1 day.

<Luciferase assay>
Promoter activity was measured using a dual luciferase assay system (Promega). Specifically, after transfection, cells cultured in the presence of a type V collagen gene transcription promoter were washed with PBS and then treated with a cell lysate attached to the assay system. The treated cells were scraped with a rubber policeman, and the cell suspension was collected in a 1.5 ml centrifuge tube. The collected sample was centrifuged at 13,000 rpm for 10 minutes, and the supernatant (cell extract) was used for luciferase measurement. 50 μl of the luminescent substrate solution was added to 10 μl of the cell extract, and the amount of luminescence was measured for 10 seconds with a luminometer (Lumat LB9507 manufactured by Bertoled). In all samples, the amount of luminescence of the internal standard DNA (pRL-TK) was also measured, and the relative amount of luminescence obtained by dividing the measured value by the amount of luminescence of the internal standard DNA was taken as the measured value of luciferase activity.

<Data analysis>
The obtained data is expressed as the ratio of the luciferase activity when the V-type collagen gene transcription promoter is added to the luciferase activity measured when the V-type collagen gene transcription promoter is not added. The effect of enhancing promoter activity was evaluated. The results are shown in Table 1.

  From the results in Table 1, it can be seen that the V-type collagen gene transcription promoter of the present invention, which is an extract of purple root and mushroom, enhances the activity of the V-type collagen gene promoter.

Test Example 2 Evaluation of V-type Collagen Gene Transcriptional Promoting Activity Against Type I Collagen Gene Transcriptional Promoting Activity Test Example 1 using a promoter of type I collagen α1 chain gene instead of a promoter of type V collagen α1 chain gene in Test Example 1 The luciferase assay was repeated as in 1.
By dividing the luciferase activity for the transcription promoting activity of the promoter of the type V collagen gene obtained in Test Example 1 by the luciferase activity for the transcription promoting activity of the promoter of the type I collagen gene, The magnification of transcription promoting activity was calculated. The results are shown in Table 2.

  From the results in Table 2, it can be seen that the V-type collagen gene transcription promoter of the present invention promotes the transcription of V-type collagen preferentially over type I collagen.

From the results of Test Examples 1 and 2, since the V-type collagen gene transcription promoter of the present invention can enhance the promoter activity of the V-type collagen gene, it can promote the transcription of the V-type collagen gene. It turns out that production can be promoted.
According to the type V collagen gene transcription promoter of the present invention, since the amount of type V collagen relative to type I collagen can be increased, the production of collagen fibers with an increased content of type V collagen is promoted and supple. It is thought that skin can be obtained.

  Below, the formulation example of the V-type collagen gene transcription promoter of this invention is shown. In addition, what was obtained like Example 1 was used for each extract.

Examples 2-4
<Cream>
A cream which is the skin cosmetic of the present invention was produced. The blending ratio of each component is shown in Table 3 in wt%.
Each component of (A) was mixed and heated to 80 ° C. On the other hand, each component of (B) was mixed and heated to 80 ° C. To the mixture of (A), the mixture of (B) was gradually added with stirring to emulsify, and then cooled to 35 ° C. to obtain a cream.

Examples 5-7
<Lotion>
A lotion, which is the skin cosmetic of the present invention, was produced. The blending ratio of each component is shown in Table 4 in wt%.
The components (A) are mixed, heated to 80 ° C., further mixed and homogenized, and then cooled. To this, each component of (B) was sequentially added at 35 ° C., mixed and homogenized to obtain a lotion.

Claims (2)

  A type V collagen gene transcription promoter comprising a hydrated lower aliphatic alcohol extract of purple root and / or woody scent as an active ingredient.   A skin cosmetic comprising the V-type collagen gene transcription promoter according to claim 1.