JP2010187612A - Feed for cultured fish - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a feed for cultured fish, exhibiting high growth rate and high feed efficiency. <P>SOLUTION: The feed for the cultured fish contains 0.2-5.0% of a free branched amino acid based on the weight of the feed. The proportion of the free branched amino acid in the free amino acid contained in the feed is 18-80% in the feed for the cultured fish. The method for raising the cultured fish uses the feed. <P>COPYRIGHT: (C)2010,JPO&INPIT

Description

  The present invention relates to a feed for fish farming having excellent growth properties and a method for raising cultured fish using the feed.

  Development of feed with high growth potential is essential for fish farming. Formula feeds that are widely used nowadays have been developed with a basic composition of feeds that are naturally ingested by fish (mostly mainly small fish), and the main ingredients are fish meal and fish oil. . Vitamins, minerals, etc. are added to make the feed better growth, and part of the fish meal is replaced with vegetable protein or vegetable oil is used instead of fish oil to reduce costs. In addition, an adhesive such as starch, a bulking agent, and the like are also added to provide shape retention.

One way to improve such a mixed feed is to increase feed efficiency by increasing digestion and absorption even with feed of the same raw material. That is, the raw material protein is decomposed into peptides and amino acids and used. Non-Patent Document 1 is an example of decomposing into amino acids. It is described that when 19 to 56% of fish meal protein is replaced with crystalline amino acids, the growth ability is rather lowered. Examples of decomposition into peptides include feed using an enzyme degradation product of fish meal (Patent Document 1), and feed containing a decomposition product obtained by enzymatic decomposition of casein (Patent Document 2). In these methods, protein is decomposed into peptides, and the decomposed product is used as it is as a feed material to improve feed efficiency, growth rate, and the like.
Patent Documents 3 and 4 add a degradation product of a specific protein to a feed in order to increase the anti-disease property of fish. Patent Document 3 is a feed to which a hydrolyzate obtained by hydrolyzing wheat protein or corn protein is added. Patent Document 4 is a feed obtained by hydrolyzing milk / whey protein not containing lactophilin. Feed.
As a technique for adding a specific amino acid to the feed as compared with the technique using the protein degradation product as it is, there is Patent Document 5 and the like, and insulin is administered by administering L-arginine and L-alanine to fish. A method for enhancing the secretion inducing ability of fish and promoting the growth of fish is described.

  Patent Document 6 is a feed for livestock, and it is described that the amount of accumulated body fat is reduced by a feed in which valine, leucine, and isoleucine are enriched in the range of 0.01 to 3.00% by weight as amino acid components, respectively.

JP 2006-223164 A JP-A-6-62765 JP-A-9-84528 JP-A-9-23823 JP 2007-49938 A Japanese Patent Laid-Open No. Hei 3-219838

Aquaculture 250 (3-4): 755-764 2005

  An object of the present invention is to provide a feed for cultured fish with high fish growth rate and feed efficiency.

  The present inventors have studied the effects of various additives for the development of a feed with high feed efficiency that increases the growth rate of fish. As a result, the growth rate is increased by adding a specific amount of branched chain amino acids in the feed. The research was completed by finding that the feed efficiency was also increased.

The gist of the present invention is the following cultured fish feed.
(1) A feed for cultured fish, characterized in that it contains 0.2% to 5.0% of free branched chain amino acids per weight of feed.
(2) A cultured fish feed in which 18% to 80% of free amino acids contained in the feed are free branched chain amino acids.
(3) The feed for cultured fish according to (1), wherein a free branched chain amino acid is added.
(4) The feed for cultured fish according to (1) to (3), which is used from the juvenile stage to the breeding stage of the cultured fish.

The gist of the present invention is as follows.
(5) A method for raising cultured fish, characterized in that a free-branched amino acid is orally ingested into a cultured fish by 0.1 to 15 mg / g body weight per day.
(6) A method for raising cultured fish, comprising feeding a feed for cultured fish containing 0.2% to 5.0% of free branched chain amino acids per weight of the feed.
(7) A method for raising cultured fish, characterized in that 18% to 80% of the free amino acids contained in the feed is fed with a feed for cultured fish.
(8) Cultured fish raised by any of the methods (5) to (7).

The gist of the present invention is the following fish growth promoter.
(9) A fish growth promoter comprising a free branched chain amino acid as an active ingredient.
(10) A fish liver insulin-like growth factor-II production enhancer comprising a free branched chain amino acid as an active ingredient.

  According to the feed for cultured fish of the present invention, the growth rate of the cultured fish increases and the feed efficiency also increases.

FIG. 1 is a diagram showing the concentration of branched-chain amino acids in serum. FIG. 2 shows changes in gene expression of liver insulin-like growth factor-II.

In the present invention, aquaculture means artificially raising marine animals such as seafood and seaweed that grow in seawater or fresh water. Cultured fish means all farmed fish.
In the present invention, the feed for cultured fish refers to a diet given when raising the cultured fish. Cultured fish feed may be classified as fry, breeding, adult fish feed, etc., depending on the size of the farmed fish that provides it.
In the present invention, an amino acid refers to an α-amino acid that is a structural unit of a protein in a living body among a general term for organic compounds having both functional groups of an amino group and a carboxyl group. A free amino acid refers to an amino acid that exists as a single molecule other than amino acids that exist as proteins or peptides.
In the present invention, a branched chain amino acid is a kind of α-amino acid that constitutes a protein and belongs to the group of aliphatic amino acids (neutral amino acids). Among three kinds of valine, leucine, and isoleucine, the optical activity is L-form. This refers to those having a configuration, that is, L-valine, L-leucine, L-isoleucine. Branched chain amino acids are known to be assimilated in the same metabolic pathway in vertebrates (see Journal of Nutrition 2006, vol136: 207S-211S).

The feed of the present invention can be produced as follows.
The feed may be a blend of feeds normally administered to each fish and shellfish. The nature of the feed, such as moist pellets, dry pellets, EP pellets, etc., is not limited.
The feed raw material used in the present invention includes all the nutritional components necessary for the growth of cultured fish normally used in the aquaculture industry, for example, feed organisms such as rotifer, Artemia, chlorella; flour such as soybean flour and rice flour; Lipid content of soybean oil, fish oil, etc .; fish-based foods such as fish meal, willow meal, raw fish minced meat; rice cake; pregelatinized starch, wheat gluten, sodium caseinate, sodium alginate, sodium polyacrylate, sodium carboxymethylcellulose, various plant gums , Soybean whey and other binders; various vitamin sources; various mineral sources; various protein sources; prebiotic components such as fructooligosaccharides, lactose, oligosaccharides and galactooligosaccharides; . When a plurality of feed ingredients are used, the composition ratio of each ingredient is not particularly limited and can be appropriately selected by those skilled in the art.

The feed of the present invention is produced by adding a branched chain amino acid to a feed composition designed for a fish to be fed by combining the above feed raw materials.
The free branched chain amino acid in the feed of the present invention may be in any form as long as the free branched chain amino acid is adjusted to contain 0.2% to 5.0%, preferably 0.4% to 3.0% of the free branched chain amino acid per weight of the feed. May be included. In addition, 18% to 80%, preferably 30% to 75% of the free amino acids contained in the feed were included as long as they were adjusted to be free branched chain amino acids. It doesn't matter. That is, a purified branched chain amino acid may be added, or a composition containing a large amount of branched chain amino acids may be added.
As a composition containing a large amount of branched chain amino acids, a protein containing a large amount of branched chain amino acids such as fish meal, wheat gluten, corn gluten meal, etc., which has been decomposed by a method such as hydrolysis or enzyme treatment can be used and purified. As a branched chain amino acid, an isolated or purified product or a synthetic product can be used.

Fish meal, corn gluten meal, wheat gluten, casein and the like that contain a large amount of branched chain amino acids among feed materials contain 14.4% to 22.5% of branched chain amino acids per protein weight as amino acids constituting the protein. Since the amount contained as a free amino acid is small, it is necessary to decompose these raw materials into amino acid units for use in the present invention.
For example, the amount of branched chain amino acid per 100 g of protein of corn gluten meal, which is corn protein, is 19.2 g. By converting this completely to free amino acid by hydrolysis etc., the amount of free branched chain amino acid relative to the amount of free amino acid is reduced. The ratio can be increased to 19.2%. Similarly, in casein, the amount of branched chain amino acid per 100 g of protein is 22.5 g, and by converting this completely to free amino acid by hydrolysis etc., the ratio of free branched chain amino acid amount to free amino acid amount is 22.5 g. Can be increased to%.

  Due to the necessary nutrients of cultured fish, it is not possible to use only corn protein or casein as the protein in the feed. It is preferable to further purify and use a protein hydrolyzate or enzyme degradation product that is a source of branched-chain amino acids. By using such a composition having an increased free branched chain amino acid content, the free branched chain amino acid in the feed is contained in the feed so that the free branched chain amino acid is contained in an amount of 0.2% to 5.0% by weight of the feed. The free amino acids can be adjusted so that 18% to 80% are free branched chain amino acids.

  When the protein is enzymatically decomposed into amino acids for the purpose of the present invention, it is preferable that the protein is decomposed to a free amino acid rather than a peptide. It is effective to use. For example, after treatment with an excess amount of enzyme for 3 to 10 days or reaction for 24 hours, the undigested peptide fraction is separated by gel filtration, and the enzyme is further added to the fraction for reaction. Multi-stage processing such as advancing is effective.

  Commercially available crystalline amino acids (Wako Pure Chemical Industries, Ajinomoto, Kyowa Hakko, etc.) can be used as the free branched chain amino acid used in the present invention. As a method for preparing a free branched chain amino acid other than a method using a commercially available crystalline amino acid, a free branched chain amino acid can be prepared from an amino acid mixture using an ion exchange column. The amino acid mixture is a material in which free amino acids are produced by hydrolyzing proteins or peptides, such as hydrolysis, enzymatic degradation, or fermentation. By treating this with an ion exchange column, a fraction containing branched chain amino acids can be prepared.

  As a resin used in the treatment method using an ion exchange column, Dowex 50, which is a sulfonated polystyrene resin, is used. The mobile phase may be a buffer that can be eluted by changing the pH from 3.0 to 11.0, that is, a citrate buffer, a sodium acetate buffer, a sodium carbonate buffer, a sodium phosphate buffer, or the like. For example, after applying a protein acid hydrolyzate to a resin-packed column and then injecting a pH 3.0 buffer solution from a pH 3.0 buffer solution in sequence, the acidic amino acids are eluted in the order of basic amino acids. The Branched-chain amino acids are known to elute with a pH 4.25 buffer (the pH of the citrate buffer can be adjusted with a hydrochloric acid solution and adjusted to pH 4.25). This eluted fraction can be prepared as it is or concentrated to prepare a fraction containing branched chain amino acids, which can be included in the feed. When it is necessary to remove the solvent after elution, it is also possible to use a buffer that can easily remove the solvent by freeze drying, such as ammonium acetate buffer in addition to citrate buffer (Journal of Nutrition 2006, vol136: 207S -See 211S).

  Any method may be used to measure the amount of protein in the feed, but the Kjeldahl method is generally used as a reliable method (Journal of Biological Chemistry 1951 192 (2): 663-81 ). The amount of free amino acids in the feed can be measured by using an amino acid automatic analyzer after acid extraction from the feed (see AOAC Official Method 976.06 from Official Methods of Analysis of AOAC International 18th Ed. 2005).

The method of feeding the feed according to the present invention may be the same method as feeding normal feed. The feed of the present invention in which a free branched chain amino acid is reinforced with a normal feed for fish farming is fed with a feed containing 0.2% to 5.0% of the free branched chain amino acid of the present invention per weight of the feed so that the normal feed is fed. By doing so, the effect of promoting growth is demonstrated.
However, since the growth of fish is usually determined by the nutrients consumed during one to several days within the breeding period, it can be fed so that the amount of free branched chain amino acids given during that period is above a certain level. Then, a feed containing a free branched chain amino acid in only a part of the daily feed may be used, or a feed containing a free branched chain amino acid may be mixed with other feeds. In that case, it is preferable to use a feed containing a higher concentration of free branched chain amino acids than the feed of the present invention.
Usually, the feeding rate of fish is about 0.8 to 25% of the weight of the fish, and the larger the weight, the lower the weight. Therefore, when satiety feeding is performed using only the feed of the present invention, 0.1 to 15 mg / g of fish body weight of free branched chain amino acids is consumed per day. It is preferable to ingest free branched chain amino acids with the intake in this range as a guide.
The feed of the present invention may be fed at any time from fry to juveniles and adults, but it is preferable to feed from the fry stage to the juvenile stage where differences in fish growth tend to occur. Even if it is given only for a certain period from the juvenile stage to the juvenile stage, and then switched to a normal feed, the influence of the feed given from the juvenile stage to the juvenile stage can be maintained. The feeding rate from fry to fish farming is 2-25%. In that case, it is preferable to consume 0.2 to 15 mg / g of fish body weight of free branched chain amino acids per day.
The feeding season may be summer when fish grows well due to high water temperature, or winter when fish grows less due to low water temperature. Feeding can be done with limited or satiety feeding, but once a few times a day to grow more efficiently, depending on the growth status of the fish and the appetite brought by the farm environment It is preferable to perform satiation feeding.

  In the present invention, the phrase “added with free branched chain amino acids” does not mean that the feed raw material itself contains a large amount of free branched chain amino acids, but a process of concentrating free branched chain amino acids as a feed raw material. It means to use the added one.

  In the present invention, in order to measure the change in the gene expression level of insulin-like growth factor in the liver, any method can be used as long as it measures the transcription level of mRNA. After total RNA is extracted from the liver, it can be measured by preparing cDNA by reverse transcription and performing quantitative PCR using an insulin-like growth factor-specific primer.

The type of fish that can be a target in the present invention is not limited as long as it is a fish to be cultured. It may be either saltwater fish or freshwater fish, and more specific examples include yellowtail (Seriola quinqueradiata), amberjack, flounder, red sea bream, eel, tuna, trough pufferfish, sea bream, flounder , Horse mackerel, mackerel, sardine, kiss, rockfish, salmon, trout, sweetfish, carp, yamame trout, goldfish, and goldfish, but are not particularly limited thereto.
It has been reported that branched chain amino acids are preferentially used (catabolized) in muscles during exercise compared to other amino acids to suppress muscle protein degradation and promote synthesis (Journal of Nutritional Biochemistry 2002: Feb; 13 (2) p121-127, Journal of Nutrition
2006: 136 (2) p533S-537 and the 56th Annual Meeting of the Society of Nutrition and Food Science, p88), it is effective to take during exercise. For this reason, the present invention is always migratory, that is, migratory fish that are in motion, i.e. yellowtails such as yellowtail and amberjack, Thais including red sea bream and European sea bream, tuna including bluefin tuna, Particularly effective for horse mackerel, mackerel, salmon and trout, which is preferable.

  The feed of the present invention can be used not only in the above-described adult fish but also in any of various growth stages such as seedlings and young fish after hatching. In particular, it is preferable to use it from the juvenile stage to the breeding stage where the difference in growth due to feeding tends to occur. The fry period to the breeding period specifically refers to the following periods. In yellowtail, it is often cultivated using seeds that are collected in nature, and there are few cultures using artificial seeds. The juvenile yellowtail is often called Mojako among the fishermen and weighs 2g to 200g, and the growing season is 200g to 4kg, including 3kg to 8kg, which is a common shipping size. The same goes for amberjack. In red sea bream, the fry season is 2g to 200g, and the growing season is 200g to 3kg, including 2kg to 5kg which is the main shipping size. In bluefin tuna, the juvenile season is 3g to 300g, the growing season can be 300g to 50kg, the shipping size is as wide as 3kg to 600kg, and the growing season fish can be widely included as the shipping size fish.

Examples of the present invention will be described below, but the present invention is not limited thereto.
In the examples, what is indicated by “%” means “% by weight” unless otherwise specified.

The feed of the present invention was produced and the content of free branched chain amino acids and the like were measured. A commercial feed (Nihon Suisan Co., Ltd., Nissui initial feed D-2) was used as a control feed. The branched-chain amino acid-added feed for cultured fish of the present invention was prepared by adding the free branched-chain amino acids in the amount shown in Table 1 to the control feed. The addition was carried out by dissolving a necessary amount of free branched chain amino acids in 300 ml of hot water per 1 kg of feed, soaking them uniformly, and drying at 60 ° C. for 4 hours. The added branched chain amino acid is BCAA (a mixture of valine: leucine: isoleucine, the ratio is 1: 2: 1) or leucine (Leu). Any amino acid was a crystalline amino acid manufactured by Wako Pure Chemical Industries. The manufacturer code of each reagent is as follows. L-leucine (Leu): 128-0085, L-valine (Val): 222-0085, L-isoleucine (Ile): 125-00865.
The results are shown in Table 1.

  The feed of the present invention was prepared in the same manner as in Example 1, and a breeding test was conducted using a 1 t water tank. The test fish used was a juvenile yellowtail (Seriola Quinqueradiata) (average weight 22.0-22.7 g). As the number of breeding fish per tank increased with the growth, the weight of fish was measured and care was taken to maintain the average weight of each group. The breeding period was 80 each from the 0th to the 19th day, 40 each from the 19th to the 52nd day, and 30 each from the 52nd to the 77th day. The breeding water temperature was 23 ° C on day 0, 23 ° C on day 19, 25 ° C on day 52, and 27 ° C on day 77. For feed, Nissui initial sample D-2 with crystalline amino acids valine: leucine: isoleucine added at a ratio of 1: 2: 1 0.4%, 1% or 2% of feed weight (BCAA) or Nissui initial sample For D-2, the crystalline amino acid leucine (Leu) alone was added at 1% or 3% of the feed weight.

As a feeding method, the yellowtail was fed twice or three times a day. In the case of twice a day, they were fed in the morning and evening, and in the case of three times a day, they were fed in the morning, noon and evening. Feeding amount was recorded every time. After feeding for 77 days, we measured the weight of yellowtail, calculated the growth rate and feed efficiency based on the following formula, and evaluated the effect of the feed.
Growth rate = {average body weight at the end of the rearing period (g) −average body weight before starting the rearing period (g)} / number of days in rearing (day) / average body weight before starting the rearing period (g).
Feed efficiency = {average body weight at the end of the rearing period (g) −average body weight before starting the rearing period (g)} / feeding amount (g).

  The results are shown in Table 2. When breeding in a 1-ton aquarium for 77 days, feeding the yellowtail with a free branched-chain amino acid feed for cultured fish increased the growth rate and feed efficiency compared to the control feed.

The feed of the present invention was prepared in the same manner as in Example 1, and a breeding test was conducted using a 50 t water tank. The yellowtail was reared in a 50-ton water tank for 22 days. The yellowtail used for breeding was 96 and the average body weight at the start was 132-136 g. As a feed, Nissui initial sample D-2 was fed with the crystalline amino acids valine: leucine: isoleucine at a ratio of 1: 2: 1 and 1% of the feed weight. The body weights on the 0th and 22nd days were measured to determine the average body weight, and the growth rate and feed efficiency were calculated in the same manner as in Example 2.
The results are shown in Table 3.

In the test using 132 to 136 g of yellowtail, the growth rate and feed efficiency were improved by feeding the feed containing a free branched chain amino acid for cultured fish in the test using 132 to 136 g yellowtail.

The feed of the present invention was fed only during the fry, and after reaching a certain weight, a test was conducted to confirm whether or not the effects of the present invention would be sustained when the normal feed was fed.
After preparing the feed of the present invention in the same manner as in Example 1 and feeding the feed of the present invention or the control feed in a 1 t water tank for 60 days, a portion of the fish is transferred to a 4 t water tank and the normal feed (same as the control feed) Were fed for 36 days. 10 out of 35 yellowtails bred with a control feed in a 1 t tank for 60 days and 4 out of 29 yellowtails bred with a feed to which the feed of the present invention was added for 60 days were introduced into a 4 t tank. The control feed was Nissui initial sample D-2, and the feed of the present invention was obtained by adding 1% valine (Val) (a crystalline amino acid of Wako Pure Chemical Industries) to the control feed. There was no drowning during the breeding period. At the time of 1t aquarium breeding, 7 fish were thinned out for sampling in the control feed group, and 3 fish were thinned out for sampling in the 1% valine group. The water temperature during the test period was stable at 24 ° C.
The body weight of the fish during the breeding period was measured to determine the average body weight, and the growth rate and feed efficiency were calculated in the same manner as in Example 2.

Table 4 shows the results of breeding in the 1t tank, and Table 5 shows the results of breeding in the 4t tank.
The yellowtail grown on the diet supplemented with 1% valine for 3 months increased in growth rate compared to the yellowtail that had been fed only the control diet for a long time after being introduced into the 4t tank and given only the control diet for 36 days. . This means that the growth of the yellowtail that has been fed with the free branched chain amino acid-added feed for cultured fish continues even when it is switched to the normal feed (control feed) thereafter.

The change in serum free amino acid concentration when the feed of the present invention was fed was measured. Serum was collected from yellowtails reared in Example 2 and the change in free amino acid concentration was measured. Samples were collected from yellowtails bred using a feed supplemented with 3% 2% branched chain amino acids and yellowtails bred using a feed supplemented with 3% leucine. The sample serum was measured on the 77th day of breeding, then stopped for 2 days, and collected before feeding and 12 hours after feeding.
In order to measure the blood concentration of free amino acids, blood was collected from the tail region under anesthesia, and serum was obtained by centrifugation (5000 rpm, 4 ° C., 10 minutes). Serum was stored at −80 ° C. until analysis. Samples were collected from yellowtails that were bred using a feed supplemented with 3% of 2% branched chain amino acids and yellowtails that were bred using a feed supplemented with 1% and 3% leucine. The collected serum was mixed with an equal volume of 6% sulfosalicylic acid solution under ice cooling, stirred vigorously for 15 seconds, and then allowed to stand on ice for 30 minutes. This was centrifuged at 15000 rpm at 4 ° C. for 10 minutes for deproteinization. The supernatant was filtered through a 0.45 um filter (Advantech Toyo Co., Ltd., Cellulose Acetate 0.45 um) and placed in a glass brown vial to obtain an amino acid analysis sample. Until analysis, it was stored at -80 ° C. The measurement of free amino acid concentration in serum was analyzed by the same method as the measurement of free amino acid concentration in feed, that is, using an amino acid automatic analyzer (Hitachi High-Speed Amino Acid Analyzer, L-8900, Hitachi) as analysis equipment. Amino acid analysis kit ninhydrin reagent L-8500 set (Wako Pure Chemical Industries, 142-05051) was used as a reagent. The results are shown in FIG.

  When the change in serum free amino acid concentration was measured, the free branched chain amino acid concentration in serum increased in yellowtail that was fed a diet containing a free branched chain amino acid for cultured fish compared to the control feed. It was observed that the feed containing free branched chain amino acids for cultured fish increased the concentration of free branched chain amino acids in the blood.

  Changes in gene expression of liver insulin-like growth factor-II were measured. In order to measure the gene expression change of the growth factor for insulin in the liver of the yellowtail raised in Example 2, the yellowtail was opened under anesthesia, and the liver was extracted. In order to obtain data from the same sample as the sample for measuring blood concentration of free amino acid, blood was collected from the tail part under anesthesia, and serum was obtained by centrifugation (5000 rpm, 4 ° C., 10 minutes). Liver and serum were stored at −80 ° C. until analysis. Samples were collected from yellowtails that were bred using a feed supplemented with 3% of 2% branched chain amino acids and yellowtails that were bred using a feed supplemented with 1% and 3% leucine.

  The extracted liver was frozen with dry ice or placed in RNA Later (Ambion), which is a stock solution for RNA extraction, and stored at −80 ° C. until analysis. Total RNA was extracted using RNeasy from QIAGEN and Total RNA Isolation system from Promega. Using this total RNA, a reverse transcription reaction was performed to prepare cDNA. For the reverse transcription reaction, a Takara Bio PrimeScript RT-PCR kit and an Invitrogen First-strand synthesis system were used. That is, 1 μg of the extracted RNA was subjected to reverse transcription reaction to prepare cDNA. A product obtained by diluting this cDNA solution 5-fold with sterile water was used as a quantitative PCR sample. Measurement of gene expression change of insulin-like growth factor by quantitative PCR was performed by real-time PCR using 7500system of Applied Biosystems, and Power SYBR of Applied Biosystems was used as a reaction reagent. The reaction method followed the method described in the reagent manual.

The gene sequence of insulin-like growth factor was searched from the NCBI website database. Based on the gene sequence searched from here, a specific primer was designed using Primer Express software.
Primer sequences for yellowtail β-actin and IGF-II are as follows:
β-actin
FW: AGGCCGCAGAGCCTAGATG
RV: TGAGTCAAGCGCCAAAAATAAC
IGF-II
FW: GGAGAGAGAGGCTTTTATTTCAGTAAAC
RV: CGTGACCGCCGTGCAT
Using β-actin gene as an endogenous control of gene expression, calculating the value obtained by correcting the gene expression level of insulin-like growth factor with the gene expression level of β-actin, and the relative expression when the expression level in the control group is 1.0 Indicated by value. The results are shown in FIG.

  As a result of measuring changes in insulin-like growth factor gene expression in yellowtail liver, the amount of insulin-like growth factor-II gene expression increased in yellowtail liver fed with a diet containing a free branched chain amino acid for cultured fish. Insulin-like growth factor is a hormone that promotes cell growth and growth, so the increase in gene expression in the liver due to the feeding of free branched-chain amino acids for cultured fish It is considered that the data will support the increase in the growth rate. In addition, an increase in the gene expression change of insulin-like growth factor is considered to be one of the characteristics of a free branched chain amino acid-added feed for cultured fish.

In order to examine the composition containing free branched chain amino acids that can be used in the present invention, amino acid analyzes of various feed materials and food additives were performed.
Among commercially available feed ingredients, fish meal (made by Nakamura Trading Co., Ltd.), corn gluten meal (made by Cargill Japan), wheat gluten (made by Kakishima Starch Co., Ltd.), soybean meal (made by Riken Agricultural Chemical Company), casein (made by Tomen Chemical Co., Ltd.) ) Amino acid analysis. Among commercially available food additives, fish degradation products (Enzap FP manufactured by Dainippon Meiji Sugar Co., Ltd., amino acid gold manufactured by Cosmo Foods Co., Ltd.), corn degradation products (Enzap CP manufactured by Dainippon Meiji Sugar Co., Ltd., AL manufactured by Kirin Foodtech Co., Ltd.) -G2), amino acid analysis and free amino acids of whey protein degradation product (Progress AW manufactured by Daiichi Kasei Co., Ltd.), wheat degradation product (Wheat HVP manufactured by Cosmo Foods) and soybean degradation product (AE-2 manufactured by Kirin Foodtech) Analysis was carried out. To measure the amount of free amino acids in the sample, the amino acid solution extracted from the sample was analyzed with an amino acid automatic analyzer (Hitachi High-Speed Amino Acid Analyzer, L-8900, Hitachi). The analysis reagent used was an amino acid analysis kit ninhydrin reagent L-8500 set (Wako Pure Chemical Industries, 142-05051). When measuring the amount of amino acids in a sample, a sample obtained by homogenizing a pulverized sample with a polytron homogenizer with a 1% picric acid solution and deproteinizing the sample was used. This was filtered through a filter paper and made up, and then subjected to a Dowex1 column to prepare a depicric acid solution. A solution obtained by filtering this solution with a syringe filter (Advantech Toyo Co., Ltd., Cellulose Acetate 0.45um) was put into a glass brown vial to obtain an amino acid analysis sample. Until analysis, it was stored at -80 ° C.

The amino acid automatic analysis method used the ninhydrin method in which each amino acid was separated by column chromatography using a cation exchange resin, and then the color was developed with ninhydrin and the absorbance was measured. Since α-amino acids including branched chain amino acids react with ninhydrin to produce a colored product having a maximum absorption at an absorbance of 570 nm, the peak area of this colored product is compared with the peak area of the sample and the amino acid concentration of the sample Was calculated.
Table 6 shows the analysis results of the feed ingredients, and Table 7 shows the analysis results of the food additives.

As shown in Table 6, since a certain amount of branched-chain amino acids are contained in any feed material, if these are decomposed into amino acids, they can be used as a source of branched-chain amino acids of the present invention. Since the amount of amino acids other than the branched chain amino acid increases as it is decomposed, it is preferable to concentrate the branched chain amino acid using an ion exchange column after the decomposition.
In addition, as shown in Table 7, various proteolysates can also be used as a source of branched chain amino acids of the present invention. It is used as it is or further decomposed, and more preferably a treatment for concentrating branched chain amino acids.

Comparative Example 1
For reference, the content of free amino acids and the content of free branched chain amino acids contained in the fry feeds of various companies currently on the market were measured. For the measurement of the amount of free amino acids in the feed, the amino acid solution extracted from the feed was analyzed with an amino acid automatic analyzer (Hitachi High-Speed Amino Acid Analyzer, L-8900, Hitachi). The analysis reagent used was an amino acid analysis kit ninhydrin reagent L-8500 set (Wako Pure Chemical Industries, 142-05051). In the method for extracting amino acids from the feed, the ground feed was homogenized with a polytron homogenizer in a 1% picric acid solution to remove protein. This was filtered through a filter paper and made up, and then subjected to a Dowex1 column to prepare a depicric acid solution. A solution obtained by filtering this solution with a syringe filter (Advantech Toyo Co., Ltd., Cellulose Acetate 0.45um) was put into a glass brown vial to obtain an amino acid analysis sample. Until analysis, it was stored at -80 ° C.
The amino acid automatic analysis method used the ninhydrin method in which each amino acid was separated by column chromatography using a cation exchange resin, and then the color was developed with ninhydrin and the absorbance was measured. Since α-amino acids including branched chain amino acids react with ninhydrin to produce a colored product having a maximum absorption at an absorbance of 570 nm, the peak area of this colored product is compared with the peak area of the sample and the amino acid concentration of the sample Was calculated.

  The results are shown in Table 8. Because there is no idea of containing only free branched chain amino acids at high concentrations in regular feed, the content of free branched chain amino acids in the feed is less than 0.2% per feed and 7% per free amino acid. It was less than about.

Comparative Example 2
In the same manner as in Example 1, feed prepared by adding 1% or 2% of aminosan gold shown in Table 7 to Nissui initial sample D-2 in terms of free amino acid was prepared, and reared in a 1t water tank. Went. As a control feed, Nissui initial sample D-2 was used. The test fish used was a juvenile yellowtail (Seriola Quinqueradiata) (average weight 7.0-7.1 g). As the number of breeding fish per tank increased with the growth, the weight of fish was measured and care was taken to maintain the average weight of each group. The breeding period was 40 each from the 0th to the 27th day, 30 each from the 28th to the 60th day, and 20 each from the 61st to the 92nd day. The breeding water temperature was 22.8 ° C on day 0, 24.5 ° C on day 28, and 24.5 ° C on day 61. For the first 27 days, a feed supplemented with 1% free amino acid was fed, but since no effect was observed, feed supplemented with 2% was fed until the 92nd day.

  As shown in Table 9, when the free amino acid was simply added instead of the free branched chain amino acid, the effect of enhancing the growth like the feed of the present invention was not recognized.

  ADVANTAGE OF THE INVENTION According to this invention, the feed for cultured fish with a high growth rate and feed efficiency can be provided. Moreover, the breeding method of the cultured fish with a high growth rate and feed efficiency can be provided.

Claims (10)

  A feed for cultured fish, comprising 0.2% to 5.0% of free branched chain amino acids per weight of feed.   A cultured fish feed in which 18% to 80% of free amino acids contained in the feed are free branched chain amino acids.   The cultured fish feed according to claim 1, wherein a free branched chain amino acid is added.   The feed for cultured fish according to claims 1 to 3, which is used from the juvenile stage to the breeding stage of the cultured fish.   A breeding method for cultured fish, characterized in that a free branched chain amino acid is orally ingested into a cultured fish at 0.1 to 15 mg / g body weight per day.   A method for raising cultured fish, characterized by feeding a feed for cultured fish containing 0.2% to 5.0% of free branched chain amino acids per weight of the feed.   A method for raising cultured fish, characterized in that 18% to 80% of free amino acids contained in the feed is fed with a feed for cultured fish.   A cultured fish bred by the method according to claim 5.   A fish growth promoter comprising a free branched chain amino acid as an active ingredient.   A fish liver-like growth factor-II production enhancer comprising a free branched chain amino acid as an active ingredient.

Images