JP2009222635A - Nucleic acid detection method - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a nucleic acid detection method for detecting a nucleic acid having a specific sequence with high sensitivity. <P>SOLUTION: The nucleic acid detection method is employed to detect a nucleic acid having a specific sequence in a specimen sample. The nucleic acid detection method includes: the bonding process for manufacturing a primer that has a specific sequence to a nucleic acid to be detected and has modified a substance that is immobilized to a solid phase for bonding to the nucleic acid to be detected; the extension reaction process for synthesizing the complementary strand of a nucleic acid to be detected by an enzyme; the bonding process for bonding an electrochemically active substance to a synthetic nucleic acid sample synthesized by the extension reaction process; the immobilization process for immobilizing the synthesized nucleic acid sample obtained by the bonding process to the solid phase; the cleaning process for recovering the synthesized nucleic acid sample immobilized to the solid phase by cleaning; and the detection process for detecting the electrochemically active substance bonded to the synthesized nucleic acid sample immobilized to the solid phase by an electrochemical measurement. <P>COPYRIGHT: (C)2010,JPO&INPIT

Description

  The present invention relates to a nucleic acid detection method for detecting a nucleic acid having a specific sequence in a specimen sample.

  In a conventional nucleic acid detection method, first, a probe immobilized on a solid phase such as a bead, a labeled probe labeled with an electrochemically active substance, and a nucleic acid sample are hybridized. Next, the solid phase is extracted from the reaction solution, and the solid phase is washed with a buffer or the like to remove the probe that has not formed a double strand. Then, the presence or absence of the target nucleic acid is detected by applying a voltage to the solid phase and detecting an electrochemical signal from the labeled probe bound to the nucleic acid sample (see, for example, Patent Document 1).

  Moreover, in patent document 1, a polymerase chain reaction is performed using the nucleotide which modified the substance couple | bonded with a solid phase to a substrate, and an amplification product is synthesize | combined. Next, the amplification product is denatured by heat denaturation and then hybridized with a labeled probe to form a double strand. The amplification product is immobilized on a solid phase and an electrochemical signal is measured to detect a target nucleic acid.

  In these methods, since the labeling agent is only bound to the 5 ′ end, 3 ′ end or both ends of the probe, the signal is weak and the target nucleic acid can be detected without amplification of the nucleic acid sample. There wasn't.

  In order to solve this problem, there is a technique for detecting a target nucleic acid with high sensitivity by binding a plurality of labeling agents by performing the following steps. First, a sample in which a nucleic acid sample and an electrochemically active substance are combined is prepared. Next, a probe called a capture probe, which has a base sequence complementary to the nucleic acid sample and whose end is modified so as to be immobilized on a solid phase, is prepared. The capture probe and the electrochemically active substance binding sample are hybridized to form a double strand. Thereafter, the target nucleic acid sample is detected by fixing to a solid phase and measuring an electrochemical signal derived from the electrochemically active substance (see, for example, Patent Document 2).

In this technique, since a plurality of labeling agents are labeled on the nucleic acid sample, the target nucleic acid can be detected without amplifying the nucleic acid sample.
JP 2002-34561 A JP 2007-304091 A

  However, in the case of directly measuring a living specimen, the conventional method cannot adjust the addition amount of the electrochemically active substance because the absolute amount of the target nucleic acid sample is unknown. Therefore, a large amount of electrochemically active substance may bind to the nucleic acid sample. When a large amount of this electrochemically active substance binds to the nucleic acid sample, the electrochemically active substance also binds to the binding site with the capture probe, resulting in steric hindrance and inhibition of double strand formation when hybridizing. . As a result, there has been a problem that the amount of nucleic acid sample recovered decreases and the measurement sensitivity decreases.

  The present invention solves the above-mentioned conventional problems, and even when the absolute amount of the target nucleic acid sample is unknown, the target nucleic acid is detected with high sensitivity without adjusting the amount of the electrochemically active substance added. An object of the present invention is to provide a nucleic acid detection method for the above.

  In order to solve the above-described conventional problems, the nucleic acid detection method of the present invention prepares a primer by modifying a substance having a specific sequence for a nucleic acid to be detected and which can be immobilized on a solid phase. A binding step for binding to the nucleic acid to be detected, an extension reaction step for synthesizing a complementary strand of the nucleic acid to be detected using an enzyme, and a binding step for binding an electrochemically active substance to the synthetic nucleic acid sample synthesized in the extension reaction step An immobilization step for immobilizing the synthetic nucleic acid sample obtained in the binding step on a solid phase, a washing step for recovering a synthetic nucleic acid sample immobilized on the solid phase by washing, and an immobilization step on the solid phase. And a detection step of detecting the electrochemically active substance bound to the synthesized nucleic acid sample by electrochemical measurement.

  Further, in a nucleic acid detection method for detecting a nucleic acid having a specific sequence in a specimen sample, a binding step for producing a primer having a specific sequence for the nucleic acid to be detected and binding the nucleic acid to be detected; An extension reaction step of synthesizing a complementary strand of the nucleic acid to be detected by an enzyme reaction using a substrate modified with a substance that can be immobilized on the substrate, and an electrochemically active substance bound to the synthetic nucleic acid sample synthesized in the extension reaction step A binding step, an immobilization step of immobilizing the synthetic nucleic acid sample obtained in the binding step on a solid phase, a washing step of recovering a synthetic nucleic acid sample immobilized on the solid phase by washing, and the solid phase It comprises a detection step of detecting the electrochemically active substance bound to the immobilized synthetic nucleic acid sample by electrochemical measurement.

  According to the nucleic acid detection method of the present invention, the nucleic acid synthesis is performed by synthesizing only a nucleic acid having a unique sequence in the extension step and using a primer modified with a substance that can be immobilized on a solid phase. Only the synthesized nucleic acid sample can be immobilized on the solid phase. This eliminates the need to immobilize the synthetic nucleic acid sample and the capture probe on the solid phase by hybridization, thereby improving the sample recovery rate. In addition, since the electrochemically active substance can be bound in a large amount to the synthetic nucleic acid sample without worrying about steric hindrance, the detection sensitivity is improved as compared with the conventional method.

(Embodiment 1)
Hereinafter, an embodiment of the nucleic acid detection method of the present invention will be described in detail with reference to FIG.

  In addition, the nucleic acid sample in the following embodiments refers to, for example, blood, leukocytes, serum, urine, feces, semen, saliva, cultured cells, tissue cells such as various organ cells, and any other sample containing nucleic acid. , Cells or cells are destroyed to release RNA or DNA. Alternatively, a nucleic acid fragment that is cleaved with a restriction enzyme and purified by electrophoresis separation or the like may be used.

(Step 1)
First, the primer shown in FIG. The primer used here has a sequence specific to the target nucleic acid. As this primer, a nucleic acid obtained by cleaving a nucleic acid extracted from a biological sample with a restriction enzyme and purifying it by separation by electrophoresis or the like can be used, but it is more reliable and preferable to prepare it by chemical synthesis.

(Step 2)
Next, as shown in FIG. 1B, in order to immobilize the primer on the solid phase, a functional group or an antigen is modified at the 5 ′ end. The type of the functional group at the end of the primer or the antigen is not particularly limited. For example, when the amino group is modified on the solid phase, the functional group is modified with a carboxylic acid or an aldehyde group. In the case where avidin is modified on the solid phase, the primer is modified with biotin. However, when a thiol group or amino group is used for the modification of the primer, it may be bound to a synthetic nucleic acid sample by a nucleophilic substitution reaction with a halogen described later, so it is better to avoid it as much as possible. In addition, since the method of modifying a primer with a functional group or an antigen is known, it is omitted here. As an example, FIG. 1B shows a primer modified with biotin.

(Step 3)
The primer, extension enzyme, substrate and buffer are added to the nucleic acid sample described above, and an arbitrary temperature is applied to bind the nucleic acid sample and the primer as shown in FIG. Thereafter, the primer is extended at an arbitrary temperature using the nucleic acid sample as a template to complete a synthetic nucleic acid sample which is a complementary strand of the nucleic acid sample, as shown in FIG. Since the primer has a sequence complementary to a specific sequence that only the nucleic acid to be detected has, an unintended nucleic acid sample does not bind to the primer and no extension reaction occurs.

(Step 4)
As shown in FIG. 1 (e), halogen is added to the base of the synthetic nucleic acid sample obtained by the extension reaction. The substance to which the halogen is added is not particularly limited, and any substance that can add a halogen to the base of the nucleic acid may be used. Examples thereof include chlorosuccinimide, bromosuccinimide, and iodosuccinimide. An appropriate amount of this halogen compound solution is added to the synthetic nucleic acid sample and gently stirred to allow halogen to bind to the base of the synthetic nucleic acid sample.

(Step 5)
Next, an electrochemically active substance (hereinafter referred to as “labeling agent”) is added, and as shown in FIG. 1 (f), the halogen bound to the synthetic nucleic acid sample is replaced with the labeling agent, and the labeling is performed. An agent is covalently bound to the synthetic nucleic acid sample.

  The labeling agent is not particularly limited as long as it is a substance having redox properties. For example, rubrene, anthracene, coronene, pyrene, fluoranthene, chrysene, phenanthrene, perylene, binaphthyl, octatetraene, ferrocene, catecholamine, viologen, quinone, trisbipyridine ruthenium complex, trisphenanthroline ruthenium complex, trisbipyridine osmium complex, And trisphenanthroline osmium complex.

  This labeling agent has a functional group that undergoes a nucleophilic substitution reaction with the halogen group bound to the base of the synthetic nucleic acid sample described above, and is not particularly limited, but includes amines, alcohols, ethers, thiols, and oxides. To be elected.

  The solution of the labeling agent is added to the halogen-bonded synthetic nucleic acid sample and stirred or allowed to stand at an arbitrary temperature, whereby a nucleophilic substitution reaction occurs and a labeling agent-bound synthetic nucleic acid sample is generated.

(Step 6)
The primer to which the labeling agent is bound, the substrate to which the labeling agent is bound, and the unreacted labeling agent are removed by washing, and the labeling agent-bound synthetic nucleic acid sample is extracted. Although this purification method is not particularly limited, for example, a method of aggregating a labeling agent-bound synthetic nucleic acid sample by adding a high-concentration salt to the sample and separating the sample using a silica gel column or the like, gel filtration, etc. A method for collecting a target labeling agent-bound synthetic nucleic acid sample based on the difference in molecular weight can be used.

(Step 7)
As shown in FIG. 1 (g), the extracted labeling agent-bound synthetic nucleic acid sample is immobilized on a solid phase.

  As described in (Step 2), when the functional group of the primer is a carboxylic acid or an aldehyde group, the immobilization method uses a substance whose surface is modified with an amino group and is labeled with an amide bond. An agent-bound synthetic nucleic acid sample is bound. When biotin is modified in the primer, a solid phase modified with avidin is used, and a labeled agent-bound synthetic nucleic acid sample is immobilized by avidin-biotin bond. As an example, in FIG. 1 (g), a labeling agent-bound synthetic nucleic acid sample is immobilized on a solid phase modified with avidin. After the labeling agent-bound synthetic nucleic acid sample is immobilized on the solid phase in this way, a washing process is performed to remove the nucleic acid sample and the like.

(Step 8)
Finally, the target nucleic acid can be detected by measuring an electrochemical signal derived from the labeling agent bound to the labeling agent-bound synthetic nucleic acid sample immobilized on the solid phase. As a result, it is not necessary to hybridize with the capture probe after binding the labeling agent, so that the sample recovery rate is improved. In addition, since a large amount of the labeling agent can be bound to the synthetic nucleic acid sample without worrying about steric hindrance, the target nucleic acid can be detected with higher sensitivity than the conventional method.

  The electrochemical signal derived from the labeling agent varies depending on the type to be added, but when a labeling agent that generates an oxidation-reduction current is used, it can be measured by a measurement system including a potentiostat, a function generator, and the like. On the other hand, when a labeling agent that generates electrochemiluminescence is used, measurement is possible using a photomultiplier or the like.

  Since the E. coli measurement was carried out by the method of Embodiment 1 (hereinafter referred to as Embodiment 1), the details of the procedure will be described.

(Nucleic acid sample extraction)
As the nucleic acid sample, one colony of E. coli was collected, cultured at 37 ° C. for 2 hours in a liquid medium, and then E. coli RNA extracted with a Promega RNA extraction kit was used.

(Preparation of primer)
As a positive control (positive) primer, a 20-base oligodeoxynucleotide having a CGTCAATGAGCAAAGGTATT (SEQ ID NO: 1) sequence from the 5 ′ end and modified with biotin via a phosphate group at the 5 ′ end was used. Since the primer sequence is a sequence complementary to positions 465 to 484 of E. coli 16S rRNA, a nucleic acid complementary to the E. coli nucleic acid sample can be synthesized by an extension reaction. This primer was prepared to 10 μM with pure water not containing RNase (RNase free water).

  In addition, as a negative control (negative), a 20-base oligodeoxynucleotide modified with biotin via a phosphate group at the 5 ′ end having the sequence AAAAAAAAAAAAAAAAAAA (SEQ ID NO: 2) was used as a primer. Since this primer is non-complementary to the nucleic acid sample of E. coli, no extension reaction occurs.

(Synthesis of synthetic nucleic acid sample)
A synthetic nucleic acid sample complementary to E. coli RNA was synthesized using the above-mentioned E. coli RNA as a template. For this synthesis, a kit (1st-strand cDNA) manufactured by TAKARA was used.

  First, 1.0 μL of the substrate (dNTP), which is a raw material prepared by adjusting the primer to 1.0 μL and 10 mM, 4.5 μL of the E. coli RNA, and 3.5 μL of RNase free water are added to the tube and added at 65 ° C. for 5 minutes. After warming, annealing was performed by cooling with ice for 5 minutes.

  Thereafter, 4.0 μL of the buffer attached to the kit, 0.5 μL of RNase inhibitor, 1.0 μL of reverse transcriptase, and 4.5 μL of RNase free water were further added to the tube, and the mixture was gently stirred. The extension reaction was performed for 1 hour. After the reaction, the enzyme was inactivated by heating at 95 ° C. for 5 minutes, and then a synthetic nucleic acid sample was obtained by cooling on ice.

(Synthesis of labeling agent)
The labeling agent (Chemical Formula 1) was obtained as follows. First, a solution of 2.50 g (13.5 mmol) of 4,4′-dimethyl-2,2′bipyridine dissolved in 60.0 mL of tetrahydrofuran was injected into a container in a nitrogen atmosphere, and then lithium diisopropylamide 2M. 16.9 mL (27.0 mmol) of the solution was added dropwise and stirred for 30 minutes while cooling with ice. On the other hand, 4.2 mL (41.1 mmol) of 1,3-dibromopropane and 10 mL of THF were added to a container that was similarly dried in a nitrogen stream, and stirred while cooling with ice. The previous reaction solution was slowly dropped into this container and allowed to react for 2.5 hours. The reaction solution was neutralized with 2N hydrochloric acid, and THF was distilled off, followed by extraction with chloroform. The crude product obtained by distilling off the solvent was purified with a silica gel column to obtain the product A (yield 47.2%).

  Next, 1.0 g (3.28 mmol) of the product A, 0.67 g (3.61 mmol) of potassium phthalimide, and 30.0 mL of dimethylformamide (dehydrated) were added to a container in a nitrogen atmosphere and refluxed in an oil bath for 18 hours. . After the reaction, the mixture was extracted with chloroform and washed with 50 mL of 0.2N sodium hydroxide and 200 mL of distilled water. The solvent was distilled off and recrystallization was performed from ethyl acetate and hexane to obtain the product B (yield 61.5%).

Ruthenium (III) chloride (2.98 g, 0.01 mol) and 2,2′-bipyridine (
After refluxing 3.44 g, 0.022 mol) in dimethylformamide (80.0 mL) for 6 hours, the solvent was distilled off. Then, acetone was added and the black precipitate obtained by cooling to 4 degreeC for 18 hours was extract | collected, 170 mL of ethanol aqueous solution (ethanol: water = 1: 1) was added, and it heated and refluxed for 1 hour. After filtration, 20 g of lithium chloride was added, ethanol was distilled off, and the mixture was further allowed to stand at 4 ° C. for 16 hours. The deposited black substance was collected by suction filtration to obtain a product C (yield 68.2%).

In a container purged with nitrogen, 0.50 g (1.35 mmol) of the product B, the product C0.
78 g (1.61 mmol) and 50 mL of ethanol were added. After refluxing in a nitrogen atmosphere for 9 hours, the solvent was distilled off, dissolved in distilled water, and precipitated with a 1.0 M aqueous perchloric acid solution.
This precipitate was collected and recrystallized with methanol to obtain a product D (yield 81.6%).

Further, 1.0 g (1.02 mmol) of the product D and 70.0 mL of methanol were refluxed for 1 hour. After cooling to room temperature, 0.21 mL (4.21 mm) of hydrazine monohydrate
ol) and refluxed again for 13 hours. After the reaction, 15 mL of distilled water was added and methanol was distilled off.

  Next, 5.0 mL of concentrated hydrochloric acid was added, and the reaction solution obtained by refluxing for 2 hours was allowed to stand at 4 ° C. for 16 hours, and the precipitated impurities were removed by natural filtration.

  After neutralizing this with sodium hydrogen carbonate, distilled water was distilled off and inorganic substances were removed with acetonitrile. The crude product obtained by distilling off the solvent was purified with a silica gel column to obtain the target labeling agent (Chemical Formula 1) (yield 71.4%).

  Table 1 shows 1H-NMR results of the labeling agent (Chemical Formula 1) obtained as described above.

(Binding of labeling agent to nucleic acid sample)
The base of the synthetic nucleic acid sample is prepared by adding 5.0 μL of N-bromosuccinimide (NBS) adjusted to 7.3 mM with a carbonate buffer and allowing to stand at 4 ° C. for 3 hours. The bromo group was modified.

  Next, 2.4 μL of a labeling agent solution adjusted to 10 mM with distilled water is added to the synthetic nucleic acid sample modified with the bromo group and allowed to stand at room temperature for 12 hours to bind the labeling agent to the synthetic nucleic acid sample. It was. After the reaction, a labeling agent-binding sample was extracted using a nucleic acid extraction kit manufactured by Promega (Wizard® SV Gel and PCR Clean-Up System).

(Labeling of labeling agent-bound nucleic acid sample with magnetic beads)
Magnetic beads were used for the solid phase. The magnetic beads used were CM01N / 5896 streptavidin magnetic beads manufactured by Bangs Laboratories (particle size: 0.35 μm). 5.0 μL of this magnetic bead solution was collected, added to the solution containing the labeling agent-bound nucleic acid sample, and gently stirred at 42 ° C. for 1 hour to immobilize the labeling agent-bound nucleic acid sample on the magnetic bead. After fixation, the sample-bound magnetic beads were washed with a phosphate buffer to remove residues such as nucleic acid samples.

(Measurement)
The labeling agent-bound nucleic acid sample immobilized on magnetic beads was immobilized on an electrode. A gold electrode was used as the electrode. The gold electrode was prepared by forming an electrode pattern on a glass substrate by forming a gold film with a thickness of 10 nm on a base with a sputtering apparatus (SH-350 made by ULVAC) and forming a gold film with a thickness of 200 nm. This electrode was placed on a hot plate heated to 60 ° C., and 2.0 μL of the magnetic beads were dropped on the working electrode and heated for 5 minutes to dry and fix the magnetic beads on the electrode.

  To this electrode, 80 μL of an electrolyte mixed with 0.1 M phosphate buffer and 0.1 M triethylamine was dropped. Thereafter, a voltage was applied to the electrode, and the electrochemiluminescence generated at this time was measured. The voltage was applied by scanning from 0 V to 1.3 V and performing electrochemical measurement for 3 seconds. The electrochemiluminescence amount was measured using a photomultiplier tube (H7360-01 manufactured by Hamamatsu Photonics), and the maximum luminescence amount during voltage scanning was measured.

  On the other hand, the conventional method used as a comparison object was the following process.

(Nucleic acid sample extraction)
As the nucleic acid sample by the conventional method, E. coli RNA extracted in the same manner as the E. coli measurement performed in the above-described Method 1 was used.

(Preparation of primer)
As a primer, a 20-base oligodeoxynucleotide having a CCCCGTCAATTCATTTGAG (SEQ ID NO: 3) sequence from the 5 ′ end was used. The primer sequence is complementary to the 910th to 929th positions of Escherichia coli 16S rRNA.

  This primer was prepared to 10 μM with pure water not containing RNase (RNase free water).

(Synthesis of synthetic nucleic acid sample)
Since the synthetic method of the synthetic nucleic acid sample is the same as that of the method 1, it is omitted here.

(Binding of labeling agent to synthetic nucleic acid sample)
Since the labeling agent binding to the synthetic nucleic acid sample was performed in the same manner as in the method 1, it is omitted here.

(Preparation of capture probe)
The positive capture probe uses a 20-base oligodeoxynucleotide having a sequence of AATACCTTGCCTCATTGACG (SEQ ID NO: 4) from the 5 ′ end and modified with biotin via a phosphate group at the 5 ′ end. To capture. The probe sequence is the 465th to 484th sequence of E. coli 16S rRNA. That is, since the sequence is complementary to the synthetic nucleic acid sample, it can form a double strand.

  Here, the oligodeoxynucleotide of SEQ ID NO: 2 shown in Embodiment 1 was used as a negative capture probe. Since this primer is non-complementary to the synthetic nucleic acid sample, it does not form a double strand. These primers were prepared to 10 μM with pure water.

(Hybridization reaction between labeling agent-bound nucleic acid sample and capture probe)
To the synthetic nucleic acid sample to which the above-mentioned labeling agent was bound, 1.0 μL of a capture probe adjusted to 9.5 μL and 10 μL of 5XSSC was added, and gently stirred at 44 ° C. for 18 hours. After the reaction, a synthetic nucleic acid sample was extracted using the nucleic acid extraction kit described above.
(Fixed to magnetic beads)
The nucleic acid sample was immobilized on magnetic beads. Collect 5.0 μL of the same magnetic beads as in Example 1, add it to the reaction solution of the synthetic nucleic acid sample, and allow to stand at 37 ° C. for 1 hour, so that the capture probe bound to the synthetic nucleic acid sample is applied to the magnetic beads. Fixed. After fixation, it was washed with 0.1 M phosphate buffer.

(Measurement)
The synthetic nucleic acid sample fixed to the magnetic beads was fixed to the electrode in the same manner as in Example 1. Thereafter, a voltage was applied to the electrode, and the maximum amount of generated electrochemiluminescence was measured.

  FIG. 2 shows the E. coli measurement results of Example 1 and the conventional method in this method. As shown in FIG. 2, in the conventional method, negative (measurement results using a capture probe that is non-complementary to the target synthetic nucleic acid sample) and positive (measurement results using a capture probe that is complementary to the target synthetic nucleic acid sample). ) Was not different. This is because a large amount of the labeling agent is bound to the synthetic nucleic acid sample synthesized by the extension reaction, and a plurality of labeling agents are bound to the binding site with the capture probe. It was because it did not form.

  On the other hand, in Method 1, positive and negative could be clearly identified. This is because a primer with a sequence that specifically binds to an E. coli nucleic acid sample can be used to synthesize a synthetic nucleic acid sample only for positive purposes, and the primer is modified with biotin so that the synthetic nucleic acid sample can be directly bound to magnetic beads. This is because only the target nucleic acid sample could be recovered in high yield without hybridization. Another factor is that the amount of luminescence is improved because a large amount of the labeling agent is bound to the target nucleic acid sample.

  From the above, even when the absolute amount of the target nucleic acid sample is unknown, the target nucleic acid can be detected with high sensitivity without adjusting the addition amount of the labeling agent.

(Embodiment 2)
Hereinafter, an embodiment of a nucleic acid detection method using a substrate in which a substance that can be immobilized on a solid phase is modified will be described with reference to FIG. The difference from Embodiment 1 is that, in Embodiment 1, a substance that can be immobilized on a solid phase is modified with a primer, but here it is modified with a substrate.

(Step 1)
Primers are prepared in the same manner as in the first embodiment. Since the manufacturing method has been described in detail in Embodiment 1, it is omitted here.

(Step 2)
A primer, an extension enzyme, a substrate, and a buffer are added to the nucleic acid sample, and the nucleic acid sample and the primer are bound at an arbitrary temperature as shown in FIG. 3A, and then the nucleic acid sample as shown in FIG. 3B. As a template, a primer is extended at an arbitrary temperature to synthesize a synthetic nucleic acid sample which is a complementary strand of the nucleic acid sample. Here, a substrate in which a functional group that can be immobilized on a solid phase is modified is used as a part of the substrate. The functional groups that can be immobilized on the solid phase are as described in Embodiment 1.

  As an example, in FIG. 3B, biotin was modified on the substrate. Since the primer has a sequence complementary to a specific sequence only in the nucleic acid to be detected, an unintended nucleic acid sample does not bind to the primer and no extension reaction occurs.

(Step 3)
Next, as shown in FIG. 3C, halogen is added to the base of the synthetic nucleic acid sample obtained by the extension reaction. Since the halogen addition reaction is described in (Embodiment 1), it is omitted here. Thereafter, a labeling agent is added to cause the nucleic acid sample to which the halogen is bound and the labeling agent to undergo a nucleophilic substitution reaction, thereby binding the labeling agent as shown in FIG. Since this combining method has also been described in detail in the first embodiment, it is omitted here.

(Step 4)
The probe to which the labeling agent is bound, the substrate to which the labeling agent is bound, and the unreacted labeling agent are removed by gel filtration or an extraction kit, and the labeling agent-bound synthetic nucleic acid sample to which the labeling agent is bound is extracted. Details are described in the first embodiment.

(Step 5)
After the extraction, as shown in FIG. 3E, the labeling agent-bound synthetic nucleic acid sample obtained by the above-described method is immobilized on a solid phase. Since the details of the immobilization method are described in Embodiment 1, they are omitted here.

(Step 6)
After washing the labeling agent-bound synthetic nucleic acid sample immobilized on the solid phase, the presence or absence of the target nucleic acid can be measured by measuring the electrochemical signal of the labeling agent. Since the details of the measurement method are described in Embodiment 1, they are omitted here.

  Since the E. coli measurement was performed by the method of Embodiment 2 below, the procedure will be described in detail.

(Nucleic acid sample extraction)
E. coli RNA shown in Example 1 was used as the nucleic acid sample.

(Preparation of primer)
First, a primer that binds to an E. coli nucleic acid sample is prepared as a positive control (positive). As this primer, a 20-base oligodeoxynucleotide having a sequence of CGTCAATGAGCAAAGGTATT (SEQ ID NO: 5) from the 5 ′ end was used. The primer sequence is complementary to the 465th to 484th positions of Escherichia coli 16S rRNA.

Further, a 20-base oligodeoxynucleotide having the sequence of CGTCAAAACAGCAAGGTATT (SEQ ID NO: 6) was used as a negative control (negative control) primer that does not cause an extension reaction. The primer sequence is complementary to the 465th to 484th positions of Pseudomonas aeruginosa 16S rRNA.
This primer was prepared to 10 μM with RNase free water.

(Synthesis of synthetic nucleic acid sample)
A synthetic nucleic acid sample complementary to E. coli RNA was synthesized using the above-mentioned E. coli RNA as a template. In this synthesis, a kit (1st-strand cDNA) manufactured by TAKARA was used in the same manner as in Example 1. In addition, biotin-modified dUTP (manufactured by Roche) was used as a substrate modified with a substance that can be immobilized on a solid phase.

  First, the substrate (dNTP), which is a raw material adjusted to 1.0 μL and 1 mM, is added to the substrate (1.0 μL), biotin-modified dUTP is 1.0 μL, and the E. coli RNA is added to a 4.5 μL tube and added at 65 ° C. for 5 minutes. After warming, annealing was performed by cooling with ice for 5 minutes.

  Thereafter, 4 μL of the buffer attached to the kit, 0.5 μL of RNase inhibitor, 1.0 μL of reverse transcriptase, and 4.5 μL of RNase free water were further added to the tube, and the mixture was gently agitated. A time extension reaction was performed. After the reaction, the enzyme was inactivated by heating at 95 ° C. for 5 minutes, and then a synthetic nucleic acid sample was obtained by cooling on ice.

(Synthesis of labeling agent)
Since the reagent described in Example 1 was used as the labeling agent, it is omitted here. Subsequent steps, labeling agent binding to the nucleic acid sample, fixation of the labeling agent-bound nucleic acid sample with the magnetic beads, and measurement are the same as in Method 1, and are therefore omitted.

  The E. coli measurement results in this method are shown in FIG. As shown in FIG. 4, the difference between positive and negative was clear. This is because part of the substrate (dUTP) is used so that a synthetic nucleic acid sample for positive only can be synthesized by a primer having a sequence that specifically binds to an E. coli nucleic acid sample, and the synthetic nucleic acid sample can be directly bound to magnetic beads. Biotin is modified to synthesize a nucleic acid sample using the biotin as a raw material. Therefore, only the target nucleic acid sample can be recovered in high yield without hybridization. Another reason is that the amount of luminescence is improved because the labeling agent is bound in a large amount to the target nucleic acid sample.

  From the above, even when the absolute amount of the target nucleic acid sample is unknown, the target nucleic acid can be detected with high sensitivity without adjusting the addition amount of the labeling agent.

  In the nucleic acid detection method according to the present invention, only a nucleic acid having a unique sequence is synthesized in the extension step, and nucleic acid synthesis is performed using a primer modified with a substance that can be immobilized on a solid phase. By binding a labeling agent to the synthesized nucleic acid, a specific nucleic acid present in the sample can be detected with high sensitivity, and can be applied to uses such as genetic diagnosis, infectious disease diagnosis, and genome drug discovery.

The figure which shows the nucleic acid detection method in Embodiment 1 of this invention. The figure which shows the colon_bacillus | E._coli measurement result using the nucleic acid detection method of Embodiment 1 of this invention The figure which shows the nucleic acid detection method in Embodiment 2 of this invention. The figure which shows the E. coli measurement result using the nucleic acid detection method of Embodiment 2 of this invention

Explanation of symbols

DESCRIPTION OF SYMBOLS 1 Primer 2 Biotin 3 Nucleic acid sample 4 Synthetic nucleic acid sample 5 Halogen 6 Electrochemically active substance 7 Avidin 8 Solid phase 9 Biotin 10 Synthetic nucleic acid sample

Claims (10)

A binding step in which a primer having a specific sequence for the nucleic acid to be detected and modified with a substance that can be immobilized on a solid phase is prepared and bound to the nucleic acid to be detected;
An extension reaction step of synthesizing a complementary strand of the nucleic acid to be detected using an enzyme;
A binding step of binding an electrochemically active substance to the synthetic nucleic acid sample synthesized in the extension reaction step;
An immobilization step of immobilizing the synthetic nucleic acid sample obtained in the binding step on a solid phase;
A washing step for recovering the synthetic nucleic acid sample immobilized on the solid phase by washing;
A detection step of detecting the electrochemically active substance bound to the synthetic nucleic acid sample immobilized on the solid phase by electrochemical measurement; and a nucleic acid detection for detecting a nucleic acid having a specific sequence in a specimen sample. Method. A binding step for preparing a primer having a specific sequence for the nucleic acid to be detected and binding the nucleic acid to be detected;
An extension reaction step of synthesizing a complementary strand of the nucleic acid to be detected by an enzymatic reaction using a substrate obtained by modifying a substance that can be immobilized on a solid phase;
A binding step of binding an electrochemically active substance to the synthetic nucleic acid sample synthesized in the extension reaction step;
An immobilization step of immobilizing the synthetic nucleic acid sample obtained in the binding step on a solid phase;
A washing step for recovering the synthetic nucleic acid sample immobilized on the solid phase by washing;
A detection step of detecting the electrochemically active substance bound to the synthetic nucleic acid sample immobilized on the solid phase by electrochemical measurement; and a nucleic acid detection for detecting a nucleic acid having a specific sequence in a specimen sample. Method. The binding step includes adding a halogen to a base in the synthetic nucleic acid sample, adding an electrochemically active substance, and adding the functional group contained in the electrochemically active substance to the base in the synthetic nucleic acid sample. The nucleic acid detection method according to claim 1, wherein the synthetic nucleic acid sample and the electrochemically active substance are combined by a nucleophilic substitution reaction. The binding between the synthetic nucleic acid sample and the solid phase in the immobilization step is any one of an amide bond, an ester bond, an ether bond, a thioether bond, a sulfide bond, a carbonyl bond, an imino bond, an antigen-antibody bond, and an avidin-biotin bond. The nucleic acid detection method according to claim 1 or 2. The nucleic acid detection method according to claim 1, further comprising an extraction step of extracting the obtained synthetic nucleic acid sample after the binding step. The nucleic acid detection method according to claim 1 or 2, wherein the electrochemically active substance is a compound having redox properties. The compound having a redox property is a metal complex having a heterocyclic compound as a ligand, rubrene, anthracene, coronene, pyrene, fluoranthene, chrysene, phenanthrene, perylene, binaphthyl, octatetraene, ferrocene, catecholamine, viologen, The nucleic acid detection method according to claim 6, which is any one of quinones. The gene detection method according to claim 7, wherein the metal complex having a heterocyclic compound as a ligand is a metal complex having a pyridine moiety as a ligand. The gene detection method according to claim 8, wherein the metal complex having a pyridine moiety in the ligand is either a metal bipyridine complex or a metal phenanthroline complex. The gene detection method according to claim 9, wherein the central metal of the metal complex having a heterocyclic compound as the ligand is ruthenium or osmium.

Images