CN108822173B - Fluorescence-labeled cleavable nucleotide, synthesis method and application thereof in DNA sequencing - Google Patents

Fluorescence-labeled cleavable nucleotide, synthesis method and application thereof in DNA sequencing Download PDF

Info

Publication number
CN108822173B
CN108822173B CN201810667769.7A CN201810667769A CN108822173B CN 108822173 B CN108822173 B CN 108822173B CN 201810667769 A CN201810667769 A CN 201810667769A CN 108822173 B CN108822173 B CN 108822173B
Authority
CN
China
Prior art keywords
compound
reaction
primer
nucleotide
dna fragment
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201810667769.7A
Other languages
Chinese (zh)
Other versions
CN108822173A (en
Inventor
余明辉
陈豪
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hefei Huana Biomedical Technology Co ltd
Original Assignee
Hefei Huana Biomedical Technology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hefei Huana Biomedical Technology Co ltd filed Critical Hefei Huana Biomedical Technology Co ltd
Priority to CN201810667769.7A priority Critical patent/CN108822173B/en
Publication of CN108822173A publication Critical patent/CN108822173A/en
Application granted granted Critical
Publication of CN108822173B publication Critical patent/CN108822173B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H19/00—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
    • C07H19/02—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
    • C07H19/04—Heterocyclic radicals containing only nitrogen atoms as ring hetero atom
    • C07H19/06—Pyrimidine radicals
    • C07H19/10—Pyrimidine radicals with the saccharide radical esterified by phosphoric or polyphosphoric acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H1/00—Processes for the preparation of sugar derivatives
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H19/00—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
    • C07H19/02—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
    • C07H19/04—Heterocyclic radicals containing only nitrogen atoms as ring hetero atom
    • C07H19/14—Pyrrolo-pyrimidine radicals
    • C—CHEMISTRY; METALLURGY
    • C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
    • C09K—MATERIALS FOR MISCELLANEOUS APPLICATIONS, NOT PROVIDED FOR ELSEWHERE
    • C09K11/00—Luminescent, e.g. electroluminescent, chemiluminescent materials
    • C09K11/06—Luminescent, e.g. electroluminescent, chemiluminescent materials containing organic luminescent materials
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • C—CHEMISTRY; METALLURGY
    • C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
    • C09K—MATERIALS FOR MISCELLANEOUS APPLICATIONS, NOT PROVIDED FOR ELSEWHERE
    • C09K2211/00—Chemical nature of organic luminescent or tenebrescent compounds
    • C09K2211/10—Non-macromolecular compounds
    • C09K2211/1003—Carbocyclic compounds
    • C09K2211/1007—Non-condensed systems
    • C—CHEMISTRY; METALLURGY
    • C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
    • C09K—MATERIALS FOR MISCELLANEOUS APPLICATIONS, NOT PROVIDED FOR ELSEWHERE
    • C09K2211/00—Chemical nature of organic luminescent or tenebrescent compounds
    • C09K2211/10—Non-macromolecular compounds
    • C09K2211/1018—Heterocyclic compounds
    • C09K2211/1025—Heterocyclic compounds characterised by ligands
    • C09K2211/1029—Heterocyclic compounds characterised by ligands containing one nitrogen atom as the heteroatom
    • C—CHEMISTRY; METALLURGY
    • C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
    • C09K—MATERIALS FOR MISCELLANEOUS APPLICATIONS, NOT PROVIDED FOR ELSEWHERE
    • C09K2211/00—Chemical nature of organic luminescent or tenebrescent compounds
    • C09K2211/10—Non-macromolecular compounds
    • C09K2211/1018—Heterocyclic compounds
    • C09K2211/1025—Heterocyclic compounds characterised by ligands
    • C09K2211/1044—Heterocyclic compounds characterised by ligands containing two nitrogen atoms as heteroatoms
    • C—CHEMISTRY; METALLURGY
    • C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
    • C09K—MATERIALS FOR MISCELLANEOUS APPLICATIONS, NOT PROVIDED FOR ELSEWHERE
    • C09K2211/00—Chemical nature of organic luminescent or tenebrescent compounds
    • C09K2211/10—Non-macromolecular compounds
    • C09K2211/1018—Heterocyclic compounds
    • C09K2211/1025—Heterocyclic compounds characterised by ligands
    • C09K2211/1044—Heterocyclic compounds characterised by ligands containing two nitrogen atoms as heteroatoms
    • C09K2211/1055—Heterocyclic compounds characterised by ligands containing two nitrogen atoms as heteroatoms with other heteroatoms
    • C—CHEMISTRY; METALLURGY
    • C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
    • C09K—MATERIALS FOR MISCELLANEOUS APPLICATIONS, NOT PROVIDED FOR ELSEWHERE
    • C09K2211/00—Chemical nature of organic luminescent or tenebrescent compounds
    • C09K2211/10—Non-macromolecular compounds
    • C09K2211/1018—Heterocyclic compounds
    • C09K2211/1025—Heterocyclic compounds characterised by ligands
    • C09K2211/1088—Heterocyclic compounds characterised by ligands containing oxygen as the only heteroatom
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P20/00—Technologies relating to chemical industry
    • Y02P20/50—Improvements relating to the production of bulk chemicals
    • Y02P20/55—Design of synthesis routes, e.g. reducing the use of auxiliary or protecting groups

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Materials Engineering (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a fluorescence labeling cleavable nucleotide which is characterized by having a structure shown in the following general formula (I); in the general formula (I): fluororescent represents a fluorophore; base represents a Base; r1～R8Each independently selected from hydrogen atom, C1～C10Alkyl of (C)1～C10An alkoxy group of (a), a PEG chain, a carboxylate, a substituted or unsubstituted phenyl; m is an integer of 0 to 10; n is an integer of 0 to 10. The invention also provides a preparation method of the fluorescence labeling cleavable nucleotide. The cleavable nucleotide based on the disulfide bond linkage unit provided by the invention has great potential and value in DNA sequencing; meanwhile, the synthesis method of the cleavable nucleotide has the characteristics of simple and convenient operation, low requirement on equipment, low cost, high equipment use efficiency and the like, and meets the requirement of large-scale production and application.

Description

Fluorescence-labeled cleavable nucleotide, synthesis method and application thereof in DNA sequencing
Technical Field
The invention relates to the technical field of DNA sequencing, in particular to fluorescence-labeled cleavable nucleotide, a synthesis method thereof and application thereof in DNA sequencing.
Background
Gene sequencing, i.e., techniques for sequencing DNA. In molecular biology research, sequence analysis of DNA is the basis for further research and engineering of genes of interest. Gene sequencing technology is regarded as being selfVaccineThe most important technological breakthrough for disease prevention since the birth of the world can not only greatly reduce the incidence of genetically related diseases and birth defects, but also realize the prevention of diseasesPreparation of MeasuringPrevention, early warning and individualized diagnosis and treatment; research shows that about 3 thousands of genes exist in human body, except trauma, human diseases are mostly related to the genes, and abnormal genes and damaged genes can cause the functional change of corresponding proteins or enzymes, thereby causing the diseases. GeneDetection ofThe technology is that DNA or RNA in blood and other body fluid or cells is detected, so that people can know the genetic information of themselves, predict the risk of diseases of the body, and avoid or delay the occurrence of the diseases by improving the living environment and the living habits. Relevant statistical data show that: at present, over 2500 diseases have corresponding gene detection methods and are imminent in the United statesBedLegal applications, even genetic testing, have become one of the routine means of disease prevention in the united states. In China, gene sequencing is widely known, and the non-invasive prenatal screening high-throughput sequencing project is used for comprehensively judging the risk degree of the fetus suffering from the Down syndrome by testing the blood of the pregnant woman and combining with other clinical information.
The advent of DNA sequencing technology, which is the most commonly used technique in molecular biology research, has greatly driven the development of biology. Mature DNA sequencing technology began in the mid-70 20 th century. Methods for determining DNA sequences by chemical degradation were reported by Maxam and Gilbert in 1977. In the same time, Sanger invented the dideoxy chain termination method. The two methods are very different in principle, but both methods are based on the principle that nucleotides start at a certain fixed point and randomly terminate at a certain specific base to generate a series of nucleotides with four groups of different lengths, namely A, T, C and G, and then the detection is carried out on a urea denaturing PAGE gel to obtain DNA sequences. So far, the era of DNA sequencing was initiated, and the fluorescent automatic sequencing technology appeared in the early 90 s of the 20 th century brought DNA sequencing into the era of automatic sequencing. These techniques are collectively referred to as first generation DNA sequencing techniques. The development of second generation DNA Sequencing technology (Sequencing By Synthesis) in recent years has made DNA Sequencing into a high throughput, low cost era. Sequencing By Synthesis (Sequencing By Synthesis) involves the addition of an engineered DNA polymerase and 4 fluorescently labeled dNTPs, the nucleotides of these particular structures being "reversible terminators" (reversible termination) because the 3' hydroxyl terminus carries a chemically cleavable moiety that allows only a single base to be incorporated per cycle. At this time, the laser is used to scan the surface of the reaction plate and read the nucleotide species polymerized by the first reaction of each template sequence. These groups are then chemically cleaved, restoring the 3' terminal viscosity, and the polymerization of the second nucleotide is continued. This continues until each template sequence is completely polymerized into double strands. Thus, the sequence of each template DNA fragment can be obtained by counting the fluorescence signals collected in each round.
In order to achieve the purpose of sequencing while synthesizing, the nucleotide has two sites which need to be reversible, namely a connecting unit for connecting a 3 '-hydroxyl group and a fluorescent group with the nucleotide, and the modification of the 3' -hydroxyl group is commonly called as a bridge, and has two structures: one is that the 3 '-hydroxyl linker is substituted with other groups, thereby depriving the 3' -hydroxyl group of the ability to attack the phosphate group and preventing extension of the next base; the second structure does not substitute for the 3 '-hydroxyl group, but utilizes the blocking effect of the group at other positions, such as steric hindrance, so that the 3' -hydroxyl group cannot attack the phosphate group.
In addition to the requirement for 3' -hydroxyl blocking, this type of specially structured nucleotide requires that the "bridge" linking unit be a cleavable group in order not to interfere with the incorporation and recognition of the next labeled nucleotide, and that the linking unit be cleaved under mild conditions prior to the incorporation of the next nucleotide to allow continued extension of the DNA strand and thereby read the DNA base sequence. The performance of the linker plays a crucial role in the efficiency and read length of DNA sequencing. It is stable under the action of a polymerase chain and is cleaved under relatively mild conditions.
At present, the reversible terminator (reversible termination) has several problems, one is that the condition for cutting the connection unit is not mild enough, so that the whole nucleotide structure is destroyed, or the cutting efficiency is not high, such as incomplete cutting of the fluorescent label, and the mutual interference of the fluorescence signals is caused, and the base with the 3 '-hydroxyl group being replaced is not easy to be identified by polymerase, or the cutting efficiency of the 3' -hydroxyl group is not high, so that the sequencing length and accuracy are influenced.
Therefore, designing and synthesizing a novel 'reversible terminator' capable of efficiently realizing shearing under mild conditions has great significance for developing a novel sequencing method.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provide a novel reversible terminator based on a disulfide bond connecting unit, namely fluorescence-labeled cleavable nucleotides, which can only extend one reversible terminator at a time in a DNA sequencing simulation environment, disulfide bonds are cleaved under the action of a mild reducing agent tris (2-carboxyethyl) phosphine (TCEP), so that the rapid and efficient cleavage of the reversible terminator is realized, and the cleaved nucleotide fragments can continue to extend under the action of polymerase, so that the reversible terminator based on the disulfide bond connecting unit has great potential and value in DNA sequencing; meanwhile, the synthesis method of the reversible terminator has the characteristics of simple operation, low requirement on equipment, low cost, high equipment use efficiency and the like, and meets the requirement of large-scale production and application.
Specifically, the fluorescence labeling cleavable nucleotide provided by the invention has a structure shown in the following general formula (I):
Figure RE-GDA0002840972120000031
in the general formula (I): fluororescent represents a fluorophore; the fluorescent group can be one or more of fluorescein series, rhodamine series, cyanine dye series, coumarin series, Bodipy series or Alexa Fluor series, or derivatives of the series. Specifically, the fluorescent group may be 6-ROX, Bodipy-FL-510, cyanine dye Cy3, cyanine dye Cy5, or cyanine dye Cy 7.
In the general formula (I): base represents a Base; the base of the present invention may be adenine, guanine, cytosine, thymine or uracil, or any of derivatives of the above.
Is shown in the general formula(I) The method comprises the following steps: r1～R8Each independently selected from hydrogen atom, C1～C10Alkyl of (C)1～C10An alkoxy group of (a), a PEG chain, a carboxylate, a substituted or unsubstituted phenyl; preferably, R1～R8Each independently selected from hydrogen atom, C1～C10Alkyl or C1～C10Alkoxy group of (2). The alkyl group may be methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl, or decyl; when the number of carbon atoms of the alkyl group is not less than 3, the alkyl group may be a straight-chain alkyl group or a branched-chain alkyl group. The alkoxy group may be methoxy, ethoxy, propoxy, butoxy, oxypentyl, hexyloxy, heptyloxy, octyloxy, nonyloxy or decyloxy; when the number of carbon atoms of the alkoxy group is not less than 3, the alkyl group may be a linear alkoxy group or a branched alkoxy group. Specifically, the R is1～R8May both be a hydrogen atom, or R1、R2、R5、R8Are all methoxy and R3、R4、R6、R7Are all hydrogen atoms, or R1、R2Are all butoxy, R5、R8Are all methoxy and R3、R4、R6、R7Are all hydrogen atoms, or R1、R2、R5、R8Are all methoxy and R3、R4、R6、R7Are all hydrogen atoms.
In the general formula (I): m is an integer of 0 to 10, preferably an integer of 1 to 5, such as 1,2, 3, 4 or 5; n is an integer of 0 to 10, preferably an integer of 1 to 5, such as 1,2, 3, 4 or 5. The values of m and n can be the same or different. In a preferred embodiment of the present invention, m and n are both 1.
In a preferred embodiment of the present invention, the fluorophore is 6-ROX, and the base is uracil or thymine.
In a preferred embodiment of the invention, the fluorophore is Bodipy-FL-510 and the base is cytosine.
In a preferred embodiment of the present invention, the fluorophore is cyanine dye Cy5, and the base is adenine.
In a preferred embodiment of the present invention, the fluorophore is cyanine dye Cy7, and the base is guanine.
As a preferred embodiment of the present invention, R1～R8Are all hydrogen atoms, m is 1 and n is 1.
As a preferred embodiment of the present invention, R1、R2、R5、R8Are all methoxy radicals, R3、 R4、R6、R7Are all hydrogen atoms, m is 1 and n is 1.
As a preferred embodiment of the present invention, R1、R2Are each butoxy, R5、R8Are all methoxy radicals, R3、R4、R6、R7Are all hydrogen atoms, m is 1 and n is 1.
As a preferred embodiment of the present invention, R1、R2、R5、R8Are all methoxy radicals, R3、 R4、R6、R7Are all hydrogen atoms, m is 1 and n is 1.
As a preferred embodiment of the present invention, the cleavable nucleotide is selected from one or more of the following structures:
Figure RE-GDA0002840972120000051
Figure RE-GDA0002840972120000061
in the four structures, m is an integer of 0-1, preferably an integer of 1-5, and more preferably 1; n is an integer of 0 to 1, preferably an integer of 1 to 5, and more preferably 1.
The invention relates to a fluorescence labeling cleavable nucleotide, which selects a disulfide bond as a cleavable group. Disulfide bonds, also known as S-S bonds, are bonds between sulfur atoms in the-S-S-form formed by oxidation of two-SH groups located at different positions. In the field of biochemistry, this generally refers to the bond in cysteine residues in peptide and protein molecules. This bond plays a certain important role in the formation of the three-dimensional structure of the protein molecule.
The disulfide bond is established and opened, and the chemical reaction mechanism is essentially a redox reaction. It is important that the reaction conditions required for the establishment and opening of disulfide bonds are mild, that is, the establishment of disulfide bonds is generally such that thiol groups form thermodynamically stable disulfide bonds upon oxidation with mild oxidizing agents such as air, dimethyl sulfoxide (DMSO), N-iodosuccinimide (NIS), etc., and that disulfide bonds are cleaved with mild reducing agents such as mercaptoethanol (b-ME), Dithiothreitol (DTT) or tris (2-carboxyethyl) phosphine (TCEP). The reaction conditions in the cracking process are extremely mild, other catalysts or auxiliary agents are not needed to participate, side reactions of the catalysts and other nucleotides cannot occur, and the polymerase in the sequencing process cannot be damaged or inhibited. Facilitates the sequencing of longer fragment DNA. The fluorescence-labeled cleavable nucleotide provided by the invention has important application value in second-generation and third-generation sequencing platforms.
The structure of the S-S connecting unit in the fluorescence labeling cleavable nucleotide is shown as the following formula:
Figure RE-GDA0002840972120000071
wherein R is1～R8Is one or more of alkyl, alkoxy, PEG chain, carboxylic ester and phenyl of H, C1-C10, m is any integer of 0-10, and n is any integer of 0-10.
When preference is given to scheme R1,R2,R3,R4,R5,R6,R7,R8Is H, m is 1, n is 1, and the structural formula is as follows:
Figure RE-GDA0002840972120000072
its disulfide-linked unit had a half-life of 7 seconds in 0.5mM TECP solution.
When preference is given to scheme R1,R2,R5,R8Is methoxy (-OCH)3)；R3,R4,R6,R7Is H, m is 1, n is 1, and the structural formula is as follows:
Figure RE-GDA0002840972120000073
its disulfide-linked unit had a half-life of 72 seconds in 0.5mM TECP solution.
When preference is given to scheme R1,R2Is butoxy (-OC)4H13)，R5,R8Is methoxy (-OCH)3)， R3，R4，R6，R7Is H, m is 1, n is 1, and the structural formula is as follows:
Figure RE-GDA0002840972120000074
its disulfide-linked unit had a half-life of 2480 seconds in 0.5mM TECP solution.
When preference is given to scheme R1,R2,R5,R8Is methoxy (-OC)4H13)；R3,R4,R6,R7Is H, m is 1, n is 1, and the structural formula is as follows:
Figure RE-GDA0002840972120000081
its disulfide-linked unit had a half-life of 7685 seconds in 0.5mM TECP solution.
The invention further provides a preparation method of the fluorescence labeling cleavable nucleotide, which comprises the following synthetic route:
Figure RE-GDA0002840972120000082
the method comprises the following specific steps:
(1) taking m-methylbenzoic acid derivative of the compound A and N-bromosuccinimide as raw materials, and carrying out bromination reaction to obtain a bromo-product compound B;
(2) reacting the brominated product compound B with thiourea to obtain a compound C;
(3) carrying out oxidation reaction on the compound C to obtain a compound D;
(4) reacting the compound D with N-hydroxysuccinimide in the presence of a condensing agent to generate a mono-activated ester compound D, and reacting with a mono-Boc protected alkoxy diamine compound E to obtain a compound F;
(5) reacting the compound F with N-hydroxysuccinimide in the presence of a condensing agent to generate an activated ester compound G;
(6) reacting the compound G with an amino alkyl acid compound H to obtain a compound I;
(7) removing a Boc protective group from the compound I, and carrying out condensation reaction with a fluorescent dye group J to obtain a derivative compound K marked by a fluorescent group;
(8) and reacting the compound K with an activating reagent to generate a derivative activated ester marked by a fluorescent group, and then carrying out a condensation reaction with a nucleotide derivative compound L to obtain a target product TM.
The preparation method comprises the following steps:
in the step (1): the reaction temperature is 0-75 ℃, and the reaction time is 1-8 hours; the reaction solvent is carbon tetrachloride, trichloromethane, Tetrahydrofuran (THF), benzene or diethyl ether, preferably carbon tetrachloride; the free radical initiator used in the reaction is cyclohexanone peroxide, dibenzoyl peroxide, tert-butyl hydroperoxide, azobisisobutyronitrile or azobisisoheptonitrile, preferably azobisisobutyronitrile.
In the step (2): the reaction temperature is 0-25 ℃, and the reaction time is 1-4 hours; the reaction solvent is acetonitrile, Tetrahydrofuran (THF), dioxane, DMF or acetone, preferably acetone.
In the step (3): the reaction solvent consists of DMSO and water in a ratio of 0.05-5: 1, preferably 0.3: 1; the pH value of the reaction system is 2-10, preferably 6-7.
In the step (4): the reaction temperature is 0-25 ℃, and the reaction time is 6-24 hours; the reaction solvent is dichloromethane, trichloromethane, Tetrahydrofuran (THF), dioxane or acetonitrile, preferably dichloromethane; the organic base used in the reaction is trimethylamine, triethylamine, tri-n-butylamine or diisopropylethylamine, and triethylamine is preferred.
In the step (5): the reaction solvent is dichloromethane, DMF, Tetrahydrofuran (THF), dioxane or acetonitrile, preferably DMF.
In the step (6): the organic base used in the reaction is organic amine which is trimethylamine, triethylamine, tri-n-butylamine or diisopropylethylamine, and triethylamine is preferred.
In the step (7): the reaction solvent is dichloromethane, DMF, Tetrahydrofuran (THF), dioxane or acetonitrile, preferably DMF; the acid adopted in the reaction is hydrochloric acid, sulfuric acid, methanesulfonic acid, acetic acid or trifluoroacetic acid, and preferably trifluoroacetic acid; the organic base used in the reaction is trimethylamine, triethylamine, tri-n-butylamine or diisopropylethylamine, preferably diisopropylethylamine.
In the step (8): the reaction solvent is DMSO, DMF, Tetrahydrofuran (THF), dioxane or acetonitrile, preferably DMF; the condensing agent used in the reaction is TSTU (O- (N-succinimide) -1,1,3, 3-tetramethyluronium tetrafluoroborate), HBTU (benzotriazole-N, N, N ', N ' -tetramethyluronium hexafluorophosphate), TBTU (2- (1H-benzotriazol L-1-yl) -1,1,3, 3-tetramethyluronium tetrafluoroborate), HATU (O- (7-azabenzotriazol-1-yl) -N, N, N ', N ' -tetramethyluronium hexafluorophosphate) or DSC (N, N ' -disuccinimidyl carbonate), preferably TSTU.
The invention further protects the application of the fluorescence labeling cleavable nucleotide in DNA sequencing. In practical application, the fluorescence-labeled cleavable nucleotide of the present invention contained in the sequencing system should at least simultaneously include nucleotides whose bases are adenine, guanine, cytosine, and thymine, respectively; to ensure the accuracy of sequencing, the fluorophores attached to the nucleotides of different bases should be different from each other and have no signal interference.
Specifically, the invention provides a method for DNA sequencing by using the fluorescence-labeled cleavable nucleotide, which comprises the following steps:
1) attaching primers to the modified slide or resin (to the 5' end of the primers);
2) hybridizing the target DNA fragment with the primer connected on the glass slide or the resin to form a primer/target DNA fragment hybrid complex;
3) putting the hybridization compound obtained in the step 2) into a mixed solution containing the fluorescence-labeled cleavable nucleotide, dNTP (including four of dTTP, dCTP, dATP and dGTP) and polymerase, wherein the bases of the fluorescence-labeled cleavable nucleotide are adenine, guanine, cytosine and thymine, and the fluorescent groups of the fluorescence-labeled cleavable nucleotide are different, and growing a primer chain in the compound through polymerase reaction to obtain a growth primer/target DNA fragment hybridization compound;
4) cleaning the growth primer/target DNA fragment hybrid compound obtained in the step 3);
5) identifying the sequence of the growth primer/target DNA fragment hybrid complex cleaned in the step 4) by capillary electrophoresis and a fluorescent primer chain program;
6) capping the unreacted DNA fragment and the primer in the growth primer/target DNA fragment hybridization complex of step 5);
7) washing the capped primer/target DNA fragment hybrid complex obtained in step 6);
8) placing the hybridization complex connected to the glass slide or the resin in the step 7) into a reducing agent for reaction so as to remove a terminating part in the primer segment of the complex;
9) putting the hybrid compound obtained in the step 8) into a covering agent for reaction so as to cover the sulfhydryl-SH existing on the hybrid compound after the reaction in the step;
10) washing the sheared primer/target DNA fragment hybridization complex obtained in the step 9);
11) repeating the steps 3) to 10) one or more times to identify a plurality of bases in the target DNA fragment.
In the sequencing method:
the primer and the target DNA fragment in the step 2) can be synchronously divided into a plurality of target fragments.
The polymerase in the step 3) is a combination of DNA polymerase, terminal transferase and reverse transcriptase; the concentration ratio of the fluorescence labeled nucleotide to the non-labeled nucleotide is 1: 1-50, preferably 1: 40.
The reducing agent adopted in the step 8) is mercaptoethanol (b-ME), Dithiothreitol (DTT) or tris (2-carboxyethyl) phosphine (TCEP), and preferably tris (2-carboxyethyl) phosphine (TCEP); the concentration of the reducing agent is 0.01mM-100mM, preferably 1 mM.
The covering agent in the step 9) is a solution of maleimide or a derivative thereof, preferably a maleimide solution.
The scheme provided by the invention has the following beneficial effects: (1) the invention synthesizes a new disulfide bond connecting unit, the connecting unit can regulate and control the breaking speed of the disulfide bond under the action of a reducing agent by adjusting the type and the position of a substituent group on an adjacent benzene ring, the breaking speed is important for DNA sequencing, reversible termination can be realized under a mild condition, and the breaking process has no interference on sequencing per se, so the fluorescence labeling cleavable nucleotide provided by the invention can be efficiently applied to the second generation and third generation gene sequencing technologies; (2) fluorescent labeled nucleotides (reversible terminals) are synthesized on the basis of disulfide bond connecting groups, and the cleavable nucleotides show excellent performance when used for DNA sequencing, particularly, the efficiency of participating in DNA chain extension reaction under the action of DNA polymerase reaches 100%, only one base can be extended at a time, the fragmentation efficiency is 100% under the condition of weak reducing agent after the reaction is finished, and after the fluorescent groups are cleaved, residual nucleotide fragments can continuously participate in DNA chain extension reaction under the action of DNA polymerase; (3) compared with the similar photosensitive and acid-sensitive nucleotides, the fluorescence-labeled cleavable nucleotide (reversible terminal) provided by the invention has greatly reduced dependency on structure, can adjust the cleavage rate through the structural modification of a nucleotide connecting group or the type and concentration of a reducing agent, does not cause any influence on a DNA chain, and can greatly improve the sequencing efficiency and sequencing read length; (4) the preparation method of the cleavable fluorescence-labeled nucleotide provided by the invention has the advantages that the raw materials are simple and easy to obtain, the raw materials are conventional chemical reactions, the preparation method has the characteristics of simple and convenient operation, low requirement on equipment, low cost, high equipment use efficiency and the like, and the requirements of large-scale production and application are met.
Detailed Description
The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.
The reagents used in the following examples, unless otherwise specified, were all commercially available as analytical grade and were not specifically purified prior to use.
The synthetic routes involved in the following examples 1 to 8 are as follows:
Figure RE-GDA0002840972120000131
the numbers in the above synthetic routes correspond to the numbers of the respective examples, and the final product, i.e., the compound TM obtained in example 8.
Example 1
1360 g of m-toluic acid and 20L of carbon tetrachloride were charged into a 50L glass reaction vessel equipped with a thermometer and a stirrer. The air in the reaction kettle is pumped out, nitrogen is introduced, the reaction system is gradually cooled to 0 ℃, 82.1 g of azobisisobutyronitrile (0.05eq) is added, 1858 g of N-bromosuccinimide (1.05eq, added in four batches, added after about 2 hours) is added in batches, the reaction system is heated to 75 ℃ after the addition, the reaction is continued for 4 hours, and a large amount of solid is observed to be precipitated from the system and adhered to the inner wall of the reaction kettle. Sampling detection shows that the conversion rate of m-methylbenzoic acid is more than 99 percent and the yield of m-bromomethylbenzoic acid is 78 percent as shown by a liquid phase chromatography result. Discharging the reaction system from a discharging hole at the lower layer of the reaction kettle, filtering, collecting filtrate, washing the filtrate with distilled water (10L X3) and drying an organic phase, and concentrating to obtain 1670 g of m-bromomethylbenzoic acid crude product, wherein the m-bromomethylbenzoic acid crude product is recrystallized by using n-hexane to obtain 1386 g of m-bromomethylbenzoic acid pure product with the yield of 64.7 percent and the purity of 98.2 percent.
The characterization information of the obtained product is as follows:
1H-NMR:(400MHz,CDCl3,ppm)δ:4.62(s,2H),7.412-7.437(m, 1H,J＝11.2),7.635-7.655(d,1H,J＝5.9),8.278-8.282(d,1H,J＝3.7),8. 31(s,1H),12.45-12.48(b,1H,J＝12.3).
ESI-MS(m/z):214,M+
example 2
1284 g of m-bromomethylbenzoic acid and 15L of acetone were charged into a 50L glass reaction vessel equipped with a thermometer and a stirrer. Pumping air in a reaction kettle, introducing nitrogen, gradually heating a reaction system to 25 ℃, carrying out hot melting for about 1 hour, completely dissolving solids in the system, slowly adding 479 g of thiourea (1.05eq) in batches, gradually changing the system into red, continuously reacting for 16 hours at 25 ℃, sampling and detecting, wherein the liquid phase chromatography result shows that the conversion rate of the M-bromomethylbenzoic acid is more than 99 percent, slowly adding a sodium hydroxide aqueous solution (720 g of sodium hydroxide is dissolved in 5L of distilled water) into the system, gradually changing the system into yellow emulsion, continuously reacting for 2 hours after the dropwise addition is finished, then changing the system into light yellow clarified liquid, then adjusting the pH value to 2 by 6M hydrochloric acid, extracting by dichloromethane (15LX3), combining filtrate, drying an organic phase and concentrating to obtain 978 g of a crude M-bromomercaptomethylbenzoic acid, recrystallizing the crude product by acetonitrile to obtain 736 g of a pure M-bromomercaptomethylbenzoic acid with the yield of 73 percent, the purity is 97.8%.
The characterization information of the obtained product is as follows:
1H-NMR:(400MHz,CDCl3,ppm)δ:3.73(s,2H),7.40-7.412(m,1H, J＝6.3),7.739-7.742(d,1H,J＝4.3),7.99(s,H),8.043-8.052(d,1H,J＝9.6), 12.62-12.78(b,1H,J＝11.7).
ESI-EI(m/z):168
example 3
672 g of m-bromomercaptomethylbenzoic acid, 2L of dimethyl sulfoxide and 3L of distilled water are added into a 10L glass reaction bottle with a thermometer and stirring, the pH value is adjusted to 6-7, the reaction system is gradually heated to 25 ℃, air is slowly introduced into the system, the reaction is continuously carried out for 4 hours at 25 ℃, sampling detection shows that the conversion rate of the m-bromomercaptomethylbenzoic acid is more than 99%, dichloromethane (3LX3) is added into the system for extraction, the filtrate is combined, an organic phase is dried and then concentrated, 668 g of a crude m-bromomercaptomethylbenzoic acid product is obtained, the crude product is recrystallized by ethanol to obtain 574 g of a pure m-bromomercaptomethylbenzoic acid product with the yield of 86% and the purity of 98.3%.
The characterization information of the obtained product is as follows:
1H-NMR:(400MHz,CDCl3,ppm)δ:3.71(s,4H),7.39-7.403(m,2H, J＝4.7),7.732-7.738(d,2H,J＝3.9),7.96(s,2H),8.056-8.062(d,2H,J ＝8.3),12.60-12.77(b,1H,J＝11.7).ESI-MS(M-H):333,M-
example 4
574 g of m-bromomercaptomethylbenzoic acid (1.72mol,4eq) and 97.4 g of cyclohexylcarbodiimide (DCC,0.473mol,1.1eq) are taken, 2L of anhydrous dichloromethane is added into a 5L glass reaction bottle with a thermometer and stirring, the stirring is carried out to fully dissolve the solid, after the solid is fully dissolved, the reaction system is gradually cooled to 0 ℃, N-hydroxysuccinimide (49 g, 0.43mol, 1eq) is slowly and dropwise added into 500ml of dichloromethane), the temperature is controlled to be not more than 5 ℃, after the addition, the reaction system gradually returns to the room temperature, the stirring is continuously carried out for 6 hours, the system gradually becomes turbid, sampling detection shows that the liquid phase chromatography result shows that the conversion rate of the N-hydroxysuccinimide is more than 99%, then single Boc protection 2,2' - (ethane-1, 2-diyl bis (oxy)) bis (ethane-1-amine) (107 g is added into the reaction system, 0.43mol,1eq is dissolved in 500ml of dichloromethane), the reaction is continued for 2 hours, the reaction system is gradually cooled to-20 ℃, the mixture is kept stand for 1 hour, the filtration is carried out, the filter residue is washed by dichloromethane (500ml of X2), the filtrate is combined, the organic phase is dried and concentrated, thus obtaining the mixture of m-bromomercaptomethylbenzoic acid and the crude product of the compound E, the mixture is purified by column chromatography (200-300 mesh silica gel, the number of tower plates is 5, eluent: dichloromethane/methanol 50/1-10/1) to recover 394 g of m-bromomercaptomethylbenzoic acid, thus obtaining 196 g of the compound E, the yield is 81 percent, and the purity is 97.4 percent.
The characterization information of the obtained product is as follows:
1H-NMR:(400MHz,CDCl3,ppm)δ:1.44(s,9H),3.042-3.048(t, 2H,J＝6.8),3.282-3.299(t,2H,J＝6.9),3.282-3.299(t,2H,J＝6.7), 3.671-3.678(t,2H,J＝7.3),3.712-3.718(t,2H,J＝6.8),6.71-6.837(b,1H, J＝10.2),7.36-7.412(m,2H,J＝5.7),7.740-7.765(d,2H,J＝4.9),7.99(s, 2H),8.058-8.065(d,2H,J＝8.6),8.716-8.827(b,1H,J＝11.2), 12.60-12.77(b,1H,J＝11.7).
ESI-MS(M-1):563,M-
example 5
Adding 5.64 g of compound E (10mmol,1eq) and 1.21 g of N-hydroxysuccinimide (10.5mmol,1.05eq)100ml of anhydrous dichloromethane into 250ml of a three-necked bottle with a thermometer and stirring, stirring to fully dissolve the solid, after fully dissolving the solid, gradually cooling the reaction system to 0 ℃, adding 2.27 g of cyclohexyl carbodiimide (DCC,11mmol,1.1eq), controlling the temperature not to exceed 5 ℃, after the addition is finished, gradually returning the reaction system to room temperature, continuously stirring for 6 hours, gradually becoming turbid, sampling and detecting, wherein the liquid phase chromatography result shows that the conversion rate of the compound E is more than 99%, gradually cooling the reaction system to-20 ℃,1 hour, filtering, washing filter residues with dichloromethane (20ml X2), merging filtrate, drying and concentrating an organic phase to obtain a crude compound F without further purification, directly put into the next step.
Example 6
Taking the crude compound F (10mmol,1eq calculated by yield 100%) obtained in example 5, 1.44G of 6-aminocaproic acid (10.5mmol,1.1eq) and 100ml of anhydrous DMF, adding into a 250ml three-neck flask with a thermometer and a stirrer, stirring to fully dissolve the solid, after the solid is fully dissolved, gradually cooling the reaction system to 0 ℃, adding 2.02G of triethylamine (11mmol,1.1eq) to continue to react for 2 hours, sampling and detecting, the result of liquid phase chromatography shows that the conversion rate of the compound F is more than 99%, removing the DMF under reduced pressure to obtain the crude compound G, purifying the crude compound G by column chromatography (200-300 mesh silica gel, the number of column plates is 6, and the eluent is dichloromethane/methanol 40/1-10/1) to obtain the compound G4.13G, the yield is 61%, and the purity is 97.2%.
The characterization information of the obtained product is as follows:
1H-NMR:(400MHz,CDCl3,ppm)δ:1.311～1.356(m,2H,J＝8.2), 1.45(s,9H),1.538～1.577(m,4H,J＝7.7),2.203-2.211(t,2H,J＝9.3), 3.042-3.048(t,2H,J＝6.8),3.258-3.299(m,6H,J＝11.9),3.672-3.677(t, 2H,J＝5.6),3.714-3.721(t,2H,J＝7.1),6.721-6.838(b,1H,J＝10.3), 7.37-7.414(m,2H,J＝9.7),7.741-7.760(d,4H,J＝6.9),7.82(s,2H), 8.636-8.727(b,1H,J＝12.1),12.60-12.77(b,2H,J＝11.7).
ESI-MS(M-1):676,M-
example 7
Adding 3.38G of the compound G (5mmol,1eq) obtained in example 6 and 25ml of anhydrous dichloromethane into a 50ml three-necked flask with a thermometer and a stirrer, stirring at room temperature (25 ℃) to fully dissolve the solid, introducing hydrogen chloride gas after the solid is fully dissolved, continuing to react for 2 hours, sampling and detecting, wherein the liquid phase chromatography result shows that the conversion rate of the compound G is more than 99%, stopping introducing the hydrogen chloride gas, concentrating and removing the dichloromethane solvent, adding 25ml of anhydrous dichloromethane, fully stirring, concentrating and removing the solvent, repeating the operation three times to completely remove the residual hydrogen chloride in the system, adding 10ml of anhydrous DMF, introducing argon for protection, stirring at room temperature (25 ℃) to fully dissolve the solid, adding DIPEA (1.29G,10mmol,2eq) under the protection of argon after the solid is fully dissolved, continuing to stir for 30 minutes, then adding 5-X-SE (3.156G) under the protection of ROAr, 5mmol,1eq) for 1 hour, sampling and detecting, and the result of liquid phase chromatography shows that the conversion rate of 5-ROX-SE is more than 99 percent, the reaction system is gradually added into 250ml of ether pre-cooled to 0 ℃, a large amount of red solid is generated, the reaction system is filtered, the filter cake is washed by ether (25ml of X2), and the crude compound H is obtained after drying, and the crude compound is purified by column chromatography (200-300 mesh silica gel, the number of column plates is 8, and the eluent is dichloromethane/methanol 30/1-10/1), so that 2.24 g of the compound H is obtained, the yield is 42 percent, and the purity is 98.6 percent.
The characterization information of the obtained product is as follows:
1H-NMR:(400MHz,CD3OD,ppm)δ:1.323～1.376(m,2H,J＝7.1), 1.49(s,9H),1.557～1.583(m,4H,J＝3.7),1.923～1.949(m,4H,J＝7.3), 2.091～2.119(m,4H,J＝7.5),2.213-2.221(t,2H,J＝9.3),2.661～2.692 (m,4H,J＝8.1),3.066～3.098(m,6H,J＝8.3),3.263-3.296(m,6H,J ＝7.5),3.491～3.569(m,8H,J＝12.3),3.678-3.723(m,4H,J＝9.7),6.601 (s,2H),7.37-7.414(m,2H,J＝9.7),7.450～7.470(d,1H,J＝3.2), 7.747-7.762(d,4H,J＝6.9),7.86(s,2H),8.382～8.406(m,1H,J＝5.3), 8.874～8.878(d,1H,J＝2.6)
TOF-MS(M+Na):1116
example 8
Adding 1.093g of the compound H (1mmol,1eq) obtained in example 7 and 7ml of anhydrous DMF into a 25ml three-neck flask with a thermometer and a stirrer, introducing argon for protection, stirring to fully dissolve the solid, adding TSTU (O- (N-succinimide) -1,1,3, 3-tetramethyluronium tetrafluoroborate) (0.337g, 1.1mmol,1.1eq) DIPEA (0.142g,1.1mmol,1.1eq) under the protection of argon after the solid is fully dissolved at room temperature (25 ℃), continuing to react for 2 hours, sampling and detecting, wherein the liquid phase chromatography result shows that the conversion rate of the compound H is more than 99%, then adding the compound I (0.518g,1mmol,1eq) under the protection of argon for continuing to react for 1 hour, sampling and detecting, the liquid phase chromatography result shows that the conversion rate of the compound I is more than 99%, gradually adding the reaction system into 250ml of isopropanol at 0 ℃, a large amount of red solid is generated, the red solid is filtered, a filter cake is washed by isopropanol (25ml X2) and dried to obtain a crude product of the compound TM, and the crude product is purified by a preparation liquid phase (C18 preparation column, monitored by UV-254 nm) to obtain 0.573 g of the compound TM, the yield is 36 percent and the purity is 99.1 percent.
The characterization information of the obtained product is as follows:
1H-NMR:(400MHz,CD3OD,ppm)δ:1.323～1.376(m,2H,J＝7.1), 1.49(s,9H),1.557～1.583(m,4H,J＝3.7),1.923～1.949(m,4H,J＝7.3), 2.091～2.119(m,4H,J＝7.5),2.213-2.221(t,2H,J＝9.3),2.661～2.692 (m,4H,J＝8.1),3.066～3.098(m,6H,J＝8.3),3.263-3.296(m,6H,J ＝7.5),3.491～3.569(m,8H,J＝12.3),3.678-3.723(m,4H,J＝9.7),6.601 (s,2H),7.37-7.414(m,2H,J＝9.7),7.450～7.470(d,1H,J＝3.2), 7.747-7.762(d,4H,J＝6.9),7.86(s,2H),8.382～8.406(m,1H,J＝5.3), 8.874～8.878(d,1H,J＝2.6)；
31P-NMR:(160MHz,CD3OD,ppm)δ:-10.169(m,2H,J＝7.1), -21.660(m,1H,J＝5.4)
TOF-MS(M+Na):1616.4
the synthetic routes involved in the following examples 9 to 10 are as follows:
Figure RE-GDA0002840972120000191
example 9
Adding 3.38G of the compound G (5mmol,1eq) obtained in example 6 and 25ml of anhydrous dichloromethane into a 50ml three-necked flask with a thermometer and a stirrer, stirring at room temperature (25 ℃) to fully dissolve the solid, introducing hydrogen chloride gas after the solid is fully dissolved, continuing to react for 2 hours, sampling and detecting, wherein the liquid phase chromatography result shows that the conversion rate of the compound G is more than 99%, stopping introducing the hydrogen chloride gas, concentrating and removing the dichloromethane solvent, adding 25ml of anhydrous dichloromethane, fully stirring, concentrating and removing the solvent, repeating the operation three times to completely remove the residual hydrogen chloride in the system, adding 10ml of anhydrous DMF, introducing argon for protection, stirring at room temperature (25 ℃) to fully dissolve the solid, adding DIPEA (1.29G,10mmol,2eq) under the protection of argon after the solid is fully dissolved, continuing to stir for 30 minutes, then adding Cy5-SE (3.686G) under the protection of argon, 5mmol,1eq) for 1 hour, sampling and detecting, wherein the liquid phase chromatography result shows that the conversion rate of Cy5-SE is more than 99%, the reaction system is gradually added into 250ml of ether pre-cooled to 0 ℃, a large amount of blue solid is generated, the reaction system is filtered, a filter cake is washed by ether (25ml X2), and the filter cake is dried to obtain a crude compound J, and the crude compound is purified by column chromatography (200-300 mesh silica gel, the number of tower plates is 9, and an eluent is dichloromethane/methanol 25/1-10/1) to obtain 3.04 g of the compound J, the yield is 35%, and the purity is 97.8%.
The characterization information of the obtained product is as follows:
1H-NMR:(400MHz,CD3OD,ppm)δ:1.242～1.281(m,5H,J＝7.1), 1.301～1.384(m,8H,J＝10.3),1.492～1.547(m,8H,J＝9.3),1.690.(s, 12H),2.134～2.213(m,6H,J＝11.5),3.240～3.282(m,6H,J＝8.7),3.523 (t,4H,J＝7.2),3.672(t,2H,J＝7.7),3.713～3.776(m,4H,J＝8.5),3.823 (s,4H),4.092～4.144(m,4H,J＝9.1),6.285～6.331(m,2H,J＝8.1), 6.571～6.592(m,1H,J＝6.7),7.313～7.374(m,4H,J＝9.7), 7.636～7.658(m,4H J＝9.2),7.811～7.858(m,6H J＝9.9),7.86(s,2H), 8.331～8.396(m,2H,J＝10.3)
TOF-MS(M+H):1216.44
example 10
Adding 1.215g of the compound J (1mmol,1eq) obtained in example 9 and 7ml of anhydrous DMF into a 25ml three-necked flask with a thermometer and a stirrer, introducing argon for protection, stirring to fully dissolve the solid, adding TSTU (O- (N-succinimide) -1,1,3, 3-tetramethyluronium tetrafluoroborate) (0.337g, 1.1mmol,1.1eq) DIPEA (0.142g,1.1mmol,1.1eq) under the protection of argon after the solid is fully dissolved at room temperature (25 ℃), continuing to react for 2 hours, sampling and detecting, wherein the conversion rate of the compound H is more than 99% as shown by liquid phase chromatography, then adding the compound K (0.540g,1mmol,1eq) under the protection of argon for continuing to react for 1 hour, sampling and detecting, wherein the conversion rate of the compound K is more than 99%, gradually adding the reaction system into 250ml of isopropanol precooled to 0 ℃, a large amount of blue solid is generated, the blue solid is filtered, a filter cake is washed by isopropanol (25ml X2) and dried to obtain a crude product of the compound TM-A, and the crude product is purified by a preparation liquid phase (C18 preparation column, UV-254nm monitoring) to obtain 0.563 g of the compound TM-A, the yield is 32 percent, and the purity is 99.1 percent.
The characterization information of the obtained product is as follows:
1H-NMR:(400MHz,D2O,ppm)δ:1.251(s,6H),1.284～1.323(m, 8H,J＝9.3),1.413～1.442(b,9H,J＝10.5),1.541～1.547(m,2H,J＝7.1), 1.613～1.619(m,2H,J＝6.9),2.116～2.133(b,5H,J＝11.8),2.358～2.366 (m,1H,J＝8.7)3.241～3.286(m,6H,J＝7.9),3.521-3.529(t,4H,J＝5.2), 3.652-3.673(m,4H,J＝7.7),3.713～3.720(t,2H,J＝6.5),3.823-3.851(m, 5H,J＝8.3),4.031～4.072(m,3H,J＝9.1),4.218～4.286(m,2H,J＝7.1), 4.401～4.408(m,1H,J＝7.3),5.951～5.958(m,1H,J＝6.3),6.255～6.331 (m,2H,J＝8.1,),6.551～6.572(m,2H,J＝6.7),7.193(s,1H), 7.331～7.374(m,7H,J＝6.8),7.491(s,1H),7.651～7.662(m,2H J＝9.2), 7.812～7.856(m,4H J＝9.6),8.27(s,1H),8.951～8.962(m,2H,J＝6.4)
31P-NMR:(160MHz,CD3OD,ppm)δ:-8.9(d,1H,J＝19.8),-10.6 (d,1H,J＝19.8),-22.2(d,1H,J＝19.8)；
TOF-MS(M+Na):1760.4
the synthetic routes involved in the following examples 11 to 12 are as follows:
Figure RE-GDA0002840972120000211
example 11
Adding 3.38G of the compound G (5mmol,1eq) obtained in example 6 and 25ml of anhydrous dichloromethane into a 50ml three-necked flask with a thermometer and a stirrer, stirring at room temperature (25 ℃) to fully dissolve the solid, introducing hydrogen chloride gas after the solid is fully dissolved, continuing to react for 2 hours, sampling and detecting, wherein the liquid phase chromatography result shows that the conversion rate of the compound G is more than 99%, stopping introducing the hydrogen chloride gas, concentrating and removing the dichloromethane solvent, adding 25ml of anhydrous dichloromethane, fully stirring, concentrating and removing the solvent, repeating the operation three times to completely remove the residual hydrogen chloride in the system, adding 10ml of anhydrous DMF, introducing argon for protection, stirring at room temperature (25 ℃) to fully dissolve the solid, adding DIPEA (1.29G,10mmol,2eq) under the protection of argon after the solid is fully dissolved, continuing to stir for 30 minutes, then adding BODIPY-SE (1.796G) under the protection of argon, 5mmol,1eq) for 1 hour, sampling and detecting, wherein the result of liquid phase chromatography shows that the conversion rate of BODIPY-SE is more than 99 percent, the reaction system is gradually added into 250ml of ether pre-cooled to 0 ℃, a large amount of solid is generated, the reaction system is filtered, a filter cake is washed by ether (25ml of X2), and the filter cake is dried to obtain a crude product of the compound L, and the crude product is purified by column chromatography (200-300-mesh silica gel, the number of column plates is 8, and an eluent is dichloromethane/methanol 30/1-15/1) to obtain 1.63 g of the compound L, the yield is 39 percent, and the purity is 97.3 percent.
The characterization information of the obtained product is as follows:
1H-NMR:(400MHz,CD3OD,ppm)δ:1.331～1.342(m,2H,J＝7.6), 1.541～1.546(m,4H,J＝5.1),2.071～2.123(m,2H,J＝7.8),2.207 ～2.213(d,2H,J＝6.7),3.240～3.282(m,6H,J＝8.4),3.521-3.528(t,4H,J ＝7.7),3.672～3.713(m,4H,J＝8.3),3.823～3.877(m,6H,J＝7.1), 5.711～5.718(d,1H,J＝6.3),6.021～6.029(m,1H,J＝7.2),6.633～6.638(d, 1H,J＝6.3),7.368～7.374(m,3H,J＝9.2),7.492(s,1H),7.652～7.658(m, 2H J＝8.1),7.811～7.858(m,4H J＝8.5),
TOF-MS(M+Na):860.3
example 12
Adding 0.838g of the compound L (1mmol,1eq) obtained in example 11 and 7ml of anhydrous DMF into a 25ml three-necked flask with a thermometer and a stirrer, introducing argon for protection, stirring to fully dissolve the solid, adding TSTU (O- (N-succinimide) -1,1,3, 3-tetramethyluronium tetrafluoroborate) (0.337g, 1.1mmol,1.1eq) DIPEA (0.142g,1.1mmol,1.1eq) under the protection of argon after the solid is fully dissolved at room temperature (25 ℃), continuing to react for 2 hours, sampling and detecting, wherein the conversion rate of the compound H is more than 99% as shown by liquid phase chromatography, then adding the compound M (0.517g,1mmol,1eq) under the protection of argon for continuing to react for 1 hour, sampling and detecting, wherein the conversion rate of the compound I is more than 99%, gradually adding the reaction system into 250ml of isopropanol precooled to 0 ℃, a large amount of solid is generated, the solid is filtered, a filter cake is washed by isopropanol (25ml X2) and dried to obtain a crude product of the compound TM-C, and the crude product is purified by a preparation liquid phase (C18 preparation column, UV-254nm monitoring) to obtain 0.494 g of the compound TM-C, the yield is 37 percent and the purity is 98.7 percent.
The characterization information of the obtained product is as follows:
1H-NMR:(400MHz,D2O,ppm)δ:1.328～1.341(m,2H,J＝7.8), 1.542～1.549(m,4H,J＝5.3),2.073～2.125(m,3H,J＝7.9),2.209 ～2.214(d,2H,J＝6.9),2.351～2.359(m,3H,J＝7.2),3.243～3.285(m,6H, J＝8.7),3.521-3.528(t,4H,J＝7.7),3.672～3.713(m,4H,J＝8.3), 3.821～3.878(m,7H,J＝7.3),3.972(s,2H),4.031～4.038(m,1H,J＝6.3), 4.296～4.401(m,2H,J＝12.3),5.712～5.719(d,1H,J＝6.4),6.023～6.031 (m,1H,J＝7.5),6.632～6.639(d,1H,J＝6.8),7.369～7.378(m,3H,J＝9.5), 7.495(s,1H),7.653～7.660(m,2H J＝8.1),7.812～7.859(m,4H J＝8.5), 8.702(s,1H)
31P-NMR:(160MHz,CD3OD,ppm)δ:-9.1(d,1H,J＝18.7),-10.8 (d,1H,J＝18.7),-22.4(d,1H,J＝18.7)；
TOF-MS(M+Na):1359.3
the synthetic routes involved in the following examples 13 to 14 are as follows:
Figure RE-GDA0002840972120000241
example 13
Adding 3.38G of the compound G (5mmol,1eq) obtained in example 6 and 25ml of anhydrous dichloromethane into a 50ml three-necked flask with a thermometer and a stirrer, stirring at room temperature (25 ℃) to fully dissolve the solid, introducing hydrogen chloride gas after the solid is fully dissolved, continuing to react for 2 hours, sampling and detecting, wherein the liquid phase chromatography result shows that the conversion rate of the compound G is more than 99%, stopping introducing the hydrogen chloride gas, concentrating and removing the dichloromethane solvent, adding 25ml of anhydrous dichloromethane, fully stirring, concentrating and removing the solvent, repeating the operation three times to completely remove the residual hydrogen chloride in the system, adding 10ml of anhydrous DMF, introducing argon for protection, stirring at room temperature (25 ℃) to fully dissolve the solid, adding DIPEA (1.29G,10mmol,2eq) under the protection of argon after the solid is fully dissolved, continuing to stir for 30 minutes, then adding 5-X-SE (3.156G) under the protection of ROAr, 5mmol,1eq) for 1 hour, sampling and detecting, and the result of liquid phase chromatography shows that the conversion rate of 5-ROX-SE is more than 99 percent, the reaction system is gradually added into 250ml of ether pre-cooled to 0 ℃, a large amount of red solid is generated, the reaction system is filtered, a filter cake is washed by ether (25ml of X2), and the filter cake is dried to obtain a crude compound H, and the crude compound is purified by column chromatography (200-300 mesh silica gel, the number of column plates is 8, and an eluent is dichloromethane/methanol 30/1-10/1) to obtain 2.24 g of a compound N, the yield is 42 percent, and the purity is 98.6 percent.
The characterization information of the obtained product is as follows:
1H-NMR:(400MHz,CD3OD,ppm)δ:1.243～1.286(m,5H,J＝7.3), 1.308～1.386(m,8H,J＝11.7),1.491～1.546(m,8H,J＝9.4),1.695.(s, 12H),2.131～2.215(m,6H,J＝11.7),3.243～3.286(m,6H,J＝8.9), 3.527～3.537(t,4H,J＝7.3),3.678～3.691(t,2H,J＝7.6),3.711～3.772(m, 4H,J＝10.5),3.828(s,4H),4.095～4.148(m,4H,J＝9.2),5.213～5.331(m, 2H,J＝10.2),6.512～6.556(m,5H,J＝7.8),7.312～7.370(m,4H,J＝8.9), 7.632～7.653(m,4H J＝9.2),7.812～7.857(m,6H J＝9.6),7.873(s,2H), 8.329～8.397(m,2H,J＝10.5)
TOF-MS(M+Na):1264.5
example 14
Adding 1.093g of the compound N (1mmol,1eq) obtained in example 13 and 7ml of anhydrous DMF into a 25ml three-neck flask with a thermometer and a stirrer, introducing argon for protection, stirring to fully dissolve the solid, adding TSTU (O- (N-succinimide) -1,1,3, 3-tetramethyluronium tetrafluoroborate) (0.337g, 1.1mmol,1.1eq) DIPEA (0.142g,1.1mmol,1.1eq) under the protection of argon after the solid is fully dissolved at room temperature (25 ℃), continuing to react for 2 hours, sampling and detecting, wherein the liquid phase chromatography result shows that the conversion rate of the compound H is more than 99%, then adding the compound I (0.518g,1mmol,1eq) under the protection of argon for continuing to react for 1 hour, sampling and detecting, the liquid phase chromatography result shows that the conversion rate of the compound I is more than 99%, gradually adding the reaction system into 250ml of isopropanol at 0 ℃, a large amount of red solid is generated, the red solid is filtered, a filter cake is washed by isopropanol (25ml X2) and dried to obtain a crude product of the compound TM-G, and the crude product is purified by a preparation liquid phase (C18 preparation column, UV-254nm monitoring) to obtain 0.573G of the compound TM-G, the yield is 36 percent and the purity is 99.1 percent.
The characterization information of the obtained product is as follows:
1H-NMR:(400MHz,D2O,ppm)δ:1.259～1.268(m,5H,J＝6.7), 1.327～1.383(m,8H,J＝77),1.483～1.524(m,8H,J＝8.3),1.713.(s,12H), 2.124～2.215(m,7H,J＝10.3),2.357～2.364(m,1H,J＝8.3),3.258～3.297 (m,6H,J＝8.9),3.538～3.549(t,4H,J＝7.2),3.687～3.701(t,2H,J＝7.5), 3.726～3.786(m,4H,J＝10.7),3.838～3.856(m,5H,J＝6.5),3.978(s,2H), 4.085～4.136(m,5H,J＝7.9),4.273～4.286(m,1H,J＝7.3),4.403～4.416 (m,1H,J＝7.8),5.232～5.441(m,2H,J＝10.1),5.951～5.963(m,1H,J ＝9.7),6.523～6.564(m,5H,J＝7.5),7.327～7.436(m,5H,J＝9.8), 7.651～7.675(m,4H J＝8.1),7.832～7.869(m,6H J＝9.4),7.896(s,2H), 8.332～8.412(m,2H,J＝11.7)
31P-NMR:(160MHz,CD3OD,ppm)δ:-10.238(m,2H,J＝7.2), -21.637(m,1H,J＝5.5)
TOF-MS(M+Na):1802.5
example 15
This example investigated the rate of cleavage of disulfide-linked units.
Preparation of a tris (2-carboxyethyl) phosphine (TCEP) solution: 0.29 g of tris (2-carboxyethyl) phosphine hydrochloride was dissolved in 1000 ml of deionized water to give a 1mM tris (2-carboxyethyl) phosphine (TCEP) solution, which is stable in properties but preferably ready for use.
Preparing a sample: each ligation unit sample was dissolved in an appropriate amount of DMF and prepared as a 100mM solution for use.
Fracture rate study: 10uL of the ligation unit sample solution was added to 990uL of freshly prepared 1mM tris (2-carboxyethyl) phosphine (TCEP) solution, shaken on a shaker for 2-3 seconds, and allowed to stand for 2-3 seconds until the cleavage was 1mM in sample concentration.
The structure of the S-S connecting unit in the fluorescence labeling cleavable nucleotide is shown as the following formula:
Figure RE-GDA0002840972120000261
when said R is1～R8All H, m is 1, n is 1, the structural formula is shown in the specification, and the half life of the disulfide bond connecting unit is 4 seconds when the disulfide bond connecting unit is in a 1mM TECP solution.
Figure RE-GDA0002840972120000271
When R is1、R2、R5、R8Is methoxy (-OCH)3)；R3、R4、R6、R7Is H, m is 1, n is 1, the structural formula is shown in the specification, and the disulfide bond connecting unit is in a 1mM TECP solutionThe half-life was 39 seconds.
Figure RE-GDA0002840972120000272
When R is1、R2Is butoxy (-OC)4H13)，R5、R8Is methoxy (-OCH)3)；R3、 R4、R6、R7The peptide is H, m is 1, n is 1, the structural formula is shown in the specification, and the half life of the disulfide bond connecting unit is 190 seconds when the disulfide bond connecting unit is in a 1mM TECP solution.
Figure RE-GDA0002840972120000273
When R is1、R2、R5、R8Is methoxy (-OC)4H13)；R3、R4、R6、R7The peptide is H, m is 1, n is 1, the structural formula is shown in the specification, and the half life of the disulfide bond connecting unit is 300 seconds when the disulfide bond connecting unit is in a 1mM TECP solution.
Figure RE-GDA0002840972120000274
Example 16
This example demonstrates the feasibility of fluorescently labeled cleavable nucleotides for sequencing.
Validation of gene sequence (PCR amplified to >10000 copies/ul):
sequence 1, human CYP2C19 gene sequence fragment rs4986893 (representing conventional gene):
AACATCAGGATTGTAAGCACCCCCTG[A/G]ATCCAGGTAAG GCCAAGTTTTTTGC；
the sequencing primers for the sequence were:
a forward primer: CCAGAGCTTGGCATATTGTATCT
Reverse primer: TCTTGGTGTTCTTTTACTTTCTC
Sequence 2, human ADRB1 gene sequence fragment rs1801253 (representing high GC sequence, > 70%:
CCCCGACTTCCGCAAGGCCTTCCAG[C/G]GACTGCTCTGCT GCGCGCGCAGGGC
the sequencing primers for the sequence were:
a forward primer: CTTCAACCCCATCATCTACTGC
Reverse primer: GTCGTCGTCGTCGTCCGAGGC
Sequence 3, human Y chromosome tandem repeat (STR) DYS 622: [ GAAA ]6AGAAG [ GAAA ] n
The sequencing primers for the sequence were:
a forward primer: GCCTCGGTGATAAGAGTG
Reverse primer TGTATGTCCCAGAAATGT
The fluorescent-labeled cleavable nucleotides of four different bases used for sequencing are provided in example 8, example 10, example 12 and example 14 respectively; and the four nucleotides provided by the four embodiments have four different fluorophores, and fluorescence spectra of the fluorophores do not interfere with each other.
Simple sequencing equipment: common PCR instrument and gene chip reader
And (3) verification procedure: preparing a sequencing chip (primers were ligated onto the modified slides) with 500 repeats of each primer; performing 200 cycles according to the above procedure, and reading the sequencing map with a gene chip reader after each extension; recording sequencing data; compared to sequence data in the NCBI database.
And (4) verification result: the total of three target gene sequence fragments is 1500 reads, each read has a reading length of 170-. This experiment demonstrates that the cleavable nucleotides provided by the present invention can be used for sequencing purposes.
Although the invention has been described in detail hereinabove by way of general description, specific embodiments and experiments, it will be apparent to those skilled in the art that many modifications and improvements can be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Claims (11)

1. A fluorescently labeled cleavable nucleotide having the structure of formula (I):
Figure FDA0002840972110000011
in the general formula (I):
fluororescent represents a fluorophore;
base represents a Base;
R1～R8are each a hydrogen atom;
m is an integer of 0 to 10;
n is an integer of 0 to 10.
2. The fluorescence labeling cleavable nucleotide according to claim 1, wherein the fluorescent group is any one or more of fluorescein series, rhodamine series, cyanine dye series, coumarin series, Bodipy series, and Alexa Fluor series;
and/or the base is any one of adenine, guanine, cytosine, thymine and uracil;
and/or m is an integer of 1-5;
and/or n is an integer of 1-5.
3. The fluorescently labeled cleavable nucleotide according to claim 1 or 2, wherein the fluorophore is 6-ROX, the base is uracil or thymine;
or, the fluorescent group is Bodipy-FL-510, and the base is cytosine;
or, the fluorescent group is cyanine dye Cy5, and the base is adenine;
or the fluorescent group is cyanine dye Cy7, and the base is guanine.
4. The fluorescent label cleavable according to claim 1 or 2Nucleotide, characterized in that R1～R8Are all hydrogen atoms, m is 1 and n is 1.
5. The fluorescently labeled cleavable nucleotide of claim 1, characterized by being selected from any one of the following compounds:
Figure FDA0002840972110000021
Figure FDA0002840972110000031
6. the method for preparing the fluorescent-labeled cleavable nucleotide according to any one of claims 1 to 5, characterized by comprising the following synthetic route:
Figure FDA0002840972110000032
the method comprises the following specific steps:
(1) taking m-methylbenzoic acid derivative of the compound A and N-bromosuccinimide as raw materials, and carrying out bromination reaction to obtain a bromo-product compound B;
(2) reacting the brominated product compound B with thiourea to obtain a compound C;
(3) carrying out oxidation reaction on the compound C to obtain a compound D;
(4) reacting the compound D with N-hydroxysuccinimide in the presence of a condensing agent to generate a mono-activated ester compound D, and reacting with a mono-Boc protected alkoxy diamine compound E to obtain a compound F;
(5) reacting the compound F with N-hydroxysuccinimide in the presence of a condensing agent to generate an activated ester compound G;
(6) reacting the compound G with an amino alkyl acid compound H to obtain a compound I;
(7) removing a Boc protective group from the compound I, and carrying out condensation reaction with a fluorescent dye group J to obtain a derivative compound K marked by a fluorescent group;
(8) and reacting the compound K with an activating reagent to generate a derivative activated ester marked by a fluorescent group, and then carrying out a condensation reaction with a nucleotide derivative compound L to obtain a target product TM.
7. The method of claim 6, wherein in step (1): the reaction temperature is 0-75 ℃, and the reaction time is 1-8 hours; the reaction solvent is carbon tetrachloride, chloroform, tetrahydrofuran, benzene or diethyl ether; the free radical initiator used in the reaction is cyclohexanone peroxide, dibenzoyl peroxide, tert-butyl hydroperoxide, azobisisobutyronitrile or azobisisoheptonitrile;
and/or, in the step (2): the reaction temperature is 0-25 ℃, and the reaction time is 1-4 hours; the reaction solvent is acetonitrile, tetrahydrofuran, dioxane, DMF or acetone;
and/or, in the step (3): the reaction solvent consists of DMSO and water in a ratio of 0.05-5: 1; the pH value of the reaction system is 2-10;
and/or, in the step (4): the reaction temperature is 0-25 ℃, and the reaction time is 6-24 hours; the reaction solvent is dichloromethane, trichloromethane, tetrahydrofuran, dioxane or acetonitrile; the organic base adopted in the reaction is trimethylamine, triethylamine, tri-n-butylamine or diisopropylethylamine;
and/or, in the step (5): the reaction solvent is dichloromethane, DMF, tetrahydrofuran, dioxane or acetonitrile;
and/or, in the step (6): the organic base adopted in the reaction is organic amine which is trimethylamine, triethylamine, tri-n-butylamine or diisopropylethylamine;
and/or, in the step (7): the reaction solvent is dichloromethane, DMF, tetrahydrofuran, dioxane or acetonitrile; the acid adopted in the reaction is hydrochloric acid, sulfuric acid, methanesulfonic acid, acetic acid or trifluoroacetic acid; the organic base adopted in the reaction is trimethylamine, triethylamine, tri-n-butylamine or diisopropylethylamine;
and/or, in the step (8): the reaction solvent is DMSO, DMF, tetrahydrofuran, dioxane or acetonitrile; the condensing agent adopted in the reaction is O- (N-succinimide) -1,1,3, 3-tetramethylurea tetrafluoroborate benzotriazole-N, N, N ', N ' -tetramethylurea hexafluorophosphate, 2- (1H-benzotriazol L-1-yl) -1,1,3, 3-tetramethylurea tetrafluoroborate, O- (7-azabenzotriazole-1-yl) -N, N, N ', N ' -tetramethylurea hexafluorophosphate or N, N ' -disuccinimidyl carbonate.
8. Use of the fluorescently labeled cleavable nucleotide of any one of claims 1 to 5 in DNA sequencing.
9. The use of claim 8, wherein the DNA sequencing system comprises fluorescently labeled cleavable nucleotides with bases adenine, guanine, cytosine, and thymine, respectively, and different fluorophores.
10. A method for DNA sequencing using the fluorescently labeled cleavable nucleotide of any one of claims 1 to 5,
the method comprises the following specific steps:
1) attaching a primer to the modified slide or resin, said slide or resin being attached to the 5' end of the primer;
2) hybridizing the target DNA fragment with the primer connected on the glass slide or the resin to form a primer/target DNA fragment hybrid complex;
3) putting the hybridization compound obtained in the step 2) into a mixed solution containing fluorescence-labeled cleavable nucleotides, dNTPs and polymerase, wherein the bases of the fluorescence-labeled cleavable nucleotides, the dNTPs and the polymerase are respectively adenine, guanine, cytosine and thymine, and the fluorescent groups of the fluorescence-labeled cleavable nucleotides are different, and growing a primer chain in the compound through polymerase reaction to obtain a growth primer/target DNA fragment hybridization compound;
4) cleaning the growth primer/target DNA fragment hybrid compound obtained in the step 3);
5) identifying the sequence of the growth primer/target DNA fragment hybrid complex cleaned in the step 4) by capillary electrophoresis and a fluorescent primer chain program;
6) capping the unreacted DNA fragment and the primer in the growth primer/target DNA fragment hybridization complex of step 5);
7) washing the capped primer/target DNA fragment hybrid complex obtained in step 6);
8) placing the hybridization complex connected to the glass slide or the resin in the step 7) into a reducing agent for reaction so as to remove a terminating part in the primer segment of the complex;
9) putting the hybrid compound obtained in the step 8) into a covering agent for reaction so as to cover the sulfhydryl-SH existing on the hybrid compound after the reaction in the step;
10) washing the sheared primer/target DNA fragment hybridization complex obtained in the step 9);
11) repeating the steps 3) to 10) one or more times to identify a plurality of bases in the target DNA fragment.
11. The method of claim 10, wherein the primer and the target DNA fragment are synchronized into a plurality of target fragments;
and/or the polymerase is a combination of a DNA polymerase, a terminal transferase and a reverse transcriptase; the concentration ratio of the fluorescence labeled nucleotide to the non-labeled nucleotide is 1: 1-50;
and/or, the reducing agent adopted in the step 8) is mercaptoethanol, dithiothreitol or tri (2-carboxyethyl) phosphine; the concentration of the reducing agent is 0.01mM-100 mM;
and/or, the covering agent in the step 9) is a solution of maleimide.
CN201810667769.7A 2018-06-26 2018-06-26 Fluorescence-labeled cleavable nucleotide, synthesis method and application thereof in DNA sequencing Active CN108822173B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810667769.7A CN108822173B (en) 2018-06-26 2018-06-26 Fluorescence-labeled cleavable nucleotide, synthesis method and application thereof in DNA sequencing

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810667769.7A CN108822173B (en) 2018-06-26 2018-06-26 Fluorescence-labeled cleavable nucleotide, synthesis method and application thereof in DNA sequencing

Publications (2)

Publication Number Publication Date
CN108822173A CN108822173A (en) 2018-11-16
CN108822173B true CN108822173B (en) 2021-04-02

Family

ID=64138789

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810667769.7A Active CN108822173B (en) 2018-06-26 2018-06-26 Fluorescence-labeled cleavable nucleotide, synthesis method and application thereof in DNA sequencing

Country Status (1)

Country Link
CN (1) CN108822173B (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1617937A (en) * 2001-12-04 2005-05-18 索雷克萨有限公司 Labelled nucleotides
CN103087131A (en) * 2013-01-15 2013-05-08 上海交通大学 Reversible terminal and synthesis and use in DNA synthesis sequencing thereof
CN103539697A (en) * 2013-09-30 2014-01-29 上海交通大学 Synthesis of reduced sensitive azo connection unit and application of azo connection unit in DNA (deoxyribonucleic acid) sequencing
CN105001292A (en) * 2015-07-14 2015-10-28 深圳市瀚海基因生物科技有限公司 Light-fractured fluorescence-labeling reversible terminal compound and use thereof in DNA (Deoxyribonucleic Acid) or RNA (Ribonucleic Acid) sequencing
CN106117288A (en) * 2015-05-08 2016-11-16 桑特里莱恩科技控股公司 The reversible terminator that disulfide bond connects

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101107315B1 (en) * 2009-09-29 2012-01-20 한국과학기술연구원 A DNA sequencing method using novel nucleoside triphosphates with a fluorescent 3'-O-blocking group as reversible terminators

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1617937A (en) * 2001-12-04 2005-05-18 索雷克萨有限公司 Labelled nucleotides
CN103087131A (en) * 2013-01-15 2013-05-08 上海交通大学 Reversible terminal and synthesis and use in DNA synthesis sequencing thereof
CN103539697A (en) * 2013-09-30 2014-01-29 上海交通大学 Synthesis of reduced sensitive azo connection unit and application of azo connection unit in DNA (deoxyribonucleic acid) sequencing
CN106117288A (en) * 2015-05-08 2016-11-16 桑特里莱恩科技控股公司 The reversible terminator that disulfide bond connects
CN105001292A (en) * 2015-07-14 2015-10-28 深圳市瀚海基因生物科技有限公司 Light-fractured fluorescence-labeling reversible terminal compound and use thereof in DNA (Deoxyribonucleic Acid) or RNA (Ribonucleic Acid) sequencing

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Highly Sensitive Detection of Target ssDNA Based on SERS Liquid Chip Using Suspended Magnetic Nanospheres as Capturing Substrates;Ju-Mei Li,et al.;《Langmuir》;20130423;第29卷;第6147-6155页 *

Also Published As

Publication number Publication date
CN108822173A (en) 2018-11-16

Similar Documents

Publication Publication Date Title
US11827932B2 (en) Methods and compositions for nucleic acid sequencing
US6902900B2 (en) Nucleic acid probes and methods to detect and/or quantify nucleic acid analytes
TWI701236B (en) Polymethine compounds and their use as fluorescent labels
JP7153140B2 (en) 3' protected nucleotide
US9650406B2 (en) Reversible terminator molecules and methods of their use
AU2024203744B2 (en) Linkers and methods for optical detection and sequencing
JP2004509613A (en) Asynchronous stimulus PCR
JP6574240B2 (en) Modified cytosine polynucleotide oligomers and methods
JP2010538673A (en) Nucleobase characterization
CN105348343A (en) Chromophore-modified deoxynucleoside phosphoramidite monomer compound, preparation method therefor and application thereof
CN104910229A (en) Poly phosphoric acid end fluorescent labeled nucleotide and application thereof
WO2014013954A1 (en) Nucleic acid probe, method for designing nucleic acid probe, and method for detecting target sequence
JP6574239B2 (en) Modified thymine polynucleotide oligomers and methods
CN108251516B (en) DNA single molecule sequencing method and sequencing system
CN108822173B (en) Fluorescence-labeled cleavable nucleotide, synthesis method and application thereof in DNA sequencing
CN108192957B (en) DNA (deoxyribonucleic acid) synthetic sequencing method and sequencing system
WO2003076412A1 (en) Novel hairpin polyamide
CN116284185A (en) Nucleotide analogs and their use in sequencing
CN107207480B (en) Coumarin-based compounds and related methods
KR102608609B1 (en) Compound based acridine, labeling dye, kit and contrast medium composition for biomolecule comprising the same
JP3649617B2 (en) Compound capable of cleaving double-stranded DNA and method of use thereof
RU2809712C2 (en) Modified rhodamine dye and its use in biological analysis
JP4467930B2 (en) Nucleotide labeling reagent and oligonucleotide derivative incorporating the same
CN117551082A (en) 2-arylthiomethyl-6-bromoindole compound and synthesis and application thereof
CN117567536A (en) Application of fluorescent labeled nucleotide in DNA synthesis sequencing and single molecule sequencing

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
PE01 Entry into force of the registration of the contract for pledge of patent right

Denomination of invention: A fluorescent labeled cleavable nucleotide, synthesis method, and its application in DNA sequencing

Granted publication date: 20210402

Pledgee: Hefei Xingtai Technology Micro-loan Co.,Ltd.

Pledgor: HEFEI HUANA BIOMEDICAL TECHNOLOGY Co.,Ltd.

Registration number: Y2024980030202

PE01 Entry into force of the registration of the contract for pledge of patent right