CN116284185A - Nucleotide analogs and their use in sequencing - Google Patents

Nucleotide analogs and their use in sequencing Download PDF

Info

Publication number
CN116284185A
CN116284185A CN202310076009.XA CN202310076009A CN116284185A CN 116284185 A CN116284185 A CN 116284185A CN 202310076009 A CN202310076009 A CN 202310076009A CN 116284185 A CN116284185 A CN 116284185A
Authority
CN
China
Prior art keywords
unsubstituted
substituted
group
sequencing
nucleotide analogue
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310076009.XA
Other languages
Chinese (zh)
Inventor
徐杰成
刘二凯
陈德遐
王谷丰
赵陆洋
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shenzhen Sailu Medical Technology Co ltd
Original Assignee
Shenzhen Sailu Medical Technology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shenzhen Sailu Medical Technology Co ltd filed Critical Shenzhen Sailu Medical Technology Co ltd
Priority to CN202310076009.XA priority Critical patent/CN116284185A/en
Publication of CN116284185A publication Critical patent/CN116284185A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H1/00—Processes for the preparation of sugar derivatives
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H1/00—Processes for the preparation of sugar derivatives
    • C07H1/06—Separation; Purification
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H19/00—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
    • C07H19/02—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
    • C07H19/04—Heterocyclic radicals containing only nitrogen atoms as ring hetero atom
    • C07H19/06—Pyrimidine radicals
    • C07H19/10—Pyrimidine radicals with the saccharide radical esterified by phosphoric or polyphosphoric acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H21/04—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H23/00—Compounds containing boron, silicon, or a metal, e.g. chelates, vitamin B12
    • C—CHEMISTRY; METALLURGY
    • C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
    • C09K—MATERIALS FOR MISCELLANEOUS APPLICATIONS, NOT PROVIDED FOR ELSEWHERE
    • C09K11/00—Luminescent, e.g. electroluminescent, chemiluminescent materials
    • C09K11/06—Luminescent, e.g. electroluminescent, chemiluminescent materials containing organic luminescent materials
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/26—Preparation of nitrogen-containing carbohydrates
    • C12P19/28—N-glycosides
    • C12P19/30—Nucleotides
    • C12P19/34—Polynucleotides, e.g. nucleic acids, oligoribonucleotides
    • C—CHEMISTRY; METALLURGY
    • C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
    • C09K—MATERIALS FOR MISCELLANEOUS APPLICATIONS, NOT PROVIDED FOR ELSEWHERE
    • C09K2211/00—Chemical nature of organic luminescent or tenebrescent compounds
    • C09K2211/10—Non-macromolecular compounds
    • C09K2211/1003—Carbocyclic compounds
    • C09K2211/1007—Non-condensed systems
    • C—CHEMISTRY; METALLURGY
    • C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
    • C09K—MATERIALS FOR MISCELLANEOUS APPLICATIONS, NOT PROVIDED FOR ELSEWHERE
    • C09K2211/00—Chemical nature of organic luminescent or tenebrescent compounds
    • C09K2211/10—Non-macromolecular compounds
    • C09K2211/1018—Heterocyclic compounds
    • C09K2211/1025—Heterocyclic compounds characterised by ligands
    • C09K2211/1044—Heterocyclic compounds characterised by ligands containing two nitrogen atoms as heteroatoms
    • C—CHEMISTRY; METALLURGY
    • C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
    • C09K—MATERIALS FOR MISCELLANEOUS APPLICATIONS, NOT PROVIDED FOR ELSEWHERE
    • C09K2211/00—Chemical nature of organic luminescent or tenebrescent compounds
    • C09K2211/10—Non-macromolecular compounds
    • C09K2211/1018—Heterocyclic compounds
    • C09K2211/1025—Heterocyclic compounds characterised by ligands
    • C09K2211/1088—Heterocyclic compounds characterised by ligands containing oxygen as the only heteroatom
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P20/00—Technologies relating to chemical industry
    • Y02P20/50—Improvements relating to the production of bulk chemicals
    • Y02P20/55—Design of synthesis routes, e.g. reducing the use of auxiliary or protecting groups

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Materials Engineering (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Nucleotide analogs and their use in sequencing are disclosed. In a first aspect of the present application, there is provided a compound having the structural formula shown in formula (I). The compound introduces orthogonal breaking groups on nucleotide, so that when the compound is used as a substitute of a reversible terminator to be doped into a primer for extension, the orthogonal breaking groups serving as protecting groups can be rapidly excised through an anti-electron demand Diels-Alder (IEDDA) reaction, so that 3' -OH is exposed for carrying out the next round of biochemical reaction, the reaction time in the sequencing process is greatly shortened, the phasing value is reduced, the error rate in the sequencing process can be reduced, and the sequencing accuracy is improved.

Description

Nucleotide analogs and their use in sequencing
Technical Field
The present application relates to the field of nucleotide technology, in particular to nucleotide analogs and their use in sequencing.
Background
Second generation sequencing (Next-generation sequencing, NGS), also known as High throughput sequencing (High-throughput sequencing), is a DNA sequencing technology developed based on PCR and gene chips. Second generation sequencing originally introduced a reversible terminator, allowing sequencing-while-synthesis (Sequencing by Synthesis). The basic principle is that the sequence of DNA is determined by capturing a special label (typically a fluorescent molecular label) carried by a newly added base during DNA replication. In order to realize detection of only one base per cycle, the addition process of the base requires the use of a labeled nucleotide analogue containing a blocking group as a reversible terminator, so that the nucleotide analogue is subjected to biochemical reaction with target nucleic acid and DNA polymerase, the target nucleic acid is used as a template extension primer to be doped into the nucleotide analogue, and the nucleotide analogue with the blocking group can terminate the next extension of the primer until a deblocking reagent is added, so that the next biochemical reaction can be performed. The cycle is repeated a plurality of times, and the special mark carried by the target nucleic acid is detected in each cycle, and the sequence of the target nucleic acid is obtained through analysis. For example, a nucleotide analogue obtained by introducing azidomethyl into a nucleotide as a blocking group to protect the 3' -OH of the nucleotide can block the incorporation of the next base in the process of participating in the extension of a target nucleic acid, and after optical detection and analysis, adding a trivalent phosphorus reagent to cleave the azidomethyl, and then carrying out the next round of biochemical reaction, thus cycling for a plurality of times, and detecting in each cycle, thereby obtaining the nucleic acid sequence.
In the second generation sequencing process, phasing refers to the complete incorporation of a portion of the DNA strand into a cluster by the polymerase during sequencing-by-synthesis due to incomplete removal of the 3' terminator and fluorophore. The predetermined phase (Pre-phase) is the incorporation of the nucleotide analogue in the absence of a potent 3' terminator, and the incorporation process is performed 1 cycle in advance. Taking the azidomethyl protected fluorescent labeled nucleotide as an example, the azido group requires sodium azide for use in the synthesis process, which is explosive. Meanwhile, as an organic azide, the azide is poor in thermal stability at the temperature of a sequencing biochemical reaction, and the azide methyl is easy to fall off to expose 3' -OH, so that the next round of biochemical reaction in the sequencing is caused, and the Pre-phasing value is higher. In addition, the organic azide is susceptible to reducing agents during storage and transfer; and reducing agents such as trivalent phosphorus reagents which are easy to oxidize are needed for removing the azidomethyl. In addition, when using excision reagent, excision time and excision efficiency influence next biochemical reaction, excision incompletely can influence the phasing value too high, excision reaction time overlength, and inefficiency can influence sequencing biochemical reaction time, increases sequencing cost scheduling problem. Therefore, it is necessary to provide a nucleotide analogue for sequencing, which can reduce the reaction time in the sequencing process, reduce the phasing value in the sequencing process, and finally reduce the error rate and improve the accuracy.
Disclosure of Invention
The present application aims to solve at least one of the technical problems existing in the prior art. Therefore, the application provides a nucleotide analogue and application thereof in sequencing, wherein the nucleotide analogue is used as a substitute of a reversible terminator in sequencing, can be rapidly excised to expose 3' -OH, reduces the reaction time in the sequencing process, reduces the phasing value in the sequencing process, can reduce the error rate and improve the accuracy.
In a first aspect of the present application, there is provided a nucleotide analogue having the structural formula shown in formula (i):
Figure BDA0004066171060000021
wherein R is 1 Comprising an optional orthogonal cleavage group;
R 2 including bases;
R 3 including any of hydroxyl, phosphate groups;
R 4 comprising hydrogen, OR 5 Any one of R 5 Is an optional orthogonal cleavage group;
R 1 、R 2 、R 3 、R 4 a detectable label is also attached to at least one of the two.
The compound according to the embodiment of the application has at least the following beneficial effects:
the compound provided by the embodiment of the application introduces the orthogonal breaking groups on the nucleotide, so that when the compound is used as a substitute of a reversible terminator to be doped into a primer for extension, the orthogonal breaking groups serving as protecting groups can be rapidly excised through an anti-electron demand Diels-Alder (IEDDA) reaction, so that 3' -OH is exposed for carrying out the next round of biochemical reaction, the reaction time in the sequencing process is greatly shortened, the phasing value can be reduced, the error rate in the sequencing process can be reduced, and the sequencing accuracy can be improved.
The orthogonal cleavage group refers to a group with bioorthogonality and controllable bond cleavage property based on a bioorthogonal cleavage (click to release) principle.
In some embodiments of the present application, the orthogonal cleavage group is a dienophile group. Through the dienophile group as the orthogonal fracture joint, the anti-electron demand Diels-Alder (IEDDA) click reaction occurs, so that the orthogonal fracture group as the protecting group can be rapidly released from the 3' -OH position, the shorter excision time and higher excision efficiency are achieved, and the time required by sequencing is reduced.
In some embodiments of the present application, the orthogonal cleavage group is-L-R 6 ；
Wherein L is selected from any one of absent, substituted or unsubstituted C1-C10 alkylene, substituted or unsubstituted C1-C10 heteroalkylene, substituted or unsubstituted C1-C10 cycloalkylene, substituted or unsubstituted C1-C10 heterocycloalkylene, substituted or unsubstituted C6-C10 arylene, and substituted or unsubstituted C6-C10 heteroarylene;
R 6 selected from the group consisting of a substituted or unsubstituted trans-cyclooctene group, a substituted or unsubstituted norbornene group,A substituted or unsubstituted benzonorbornene group, a substituted or unsubstituted vinyl group, a substituted or unsubstituted cyano group, a substituted or unsubstituted azidophenyl group.
In some embodiments of the present application, L or R as described above 6 The substituent of the group in (a) may optionally be at least one selected from halogen, haloalkyl, cyano, amino, nitro, carboxyl, mercapto, sulfonic acid, acyl, amide, sulfonyl, carbonyl, unsubstituted alkyl, unsubstituted heteroalkyl, unsubstituted alkoxy, unsubstituted heterocycloalkyl, unsubstituted aryl, and unsubstituted heteroaryl.
Heteroatoms in the heteroalkyl, heteroalkylene, heteroaryl, heteroarylene, heterocycloalkyl, heterocycloalkylene groups include, but are not limited to, O, N, P, S, si, etc., while the number of heteroatoms may be at least one.
In some embodiments of the present application, L is selected from any one of absent, substituted or unsubstituted C1-C8 alkylene, substituted or unsubstituted C1-C8 heteroalkylene, substituted or unsubstituted C1-C8 cycloalkylene, substituted or unsubstituted C1-C8 heterocycloalkylene, substituted or unsubstituted C6-C8 arylene, and substituted or unsubstituted C6-C8 heteroarylene.
In some embodiments of the present application, L is selected from any one of absent, substituted or unsubstituted C1-C6 alkylene, substituted or unsubstituted C1-C6 heteroalkylene, substituted or unsubstituted C1-C6 cycloalkylene, substituted or unsubstituted C1-C6 heterocycloalkylene, substituted or unsubstituted C6-C8 arylene, and substituted or unsubstituted C6-C8 heteroarylene.
In some embodiments of the present application, L is selected from any one of absent, substituted or unsubstituted C1 to C6 alkylene, substituted or unsubstituted C1 to C6 heteroalkylene, substituted or unsubstituted C1 to C6 cycloalkylene, substituted or unsubstituted C1 to C6 heterocycloalkylene, substituted or unsubstituted phenylene, and substituted or unsubstituted heteroarylene.
In some embodiments of the present application, L is selected from any one of absent, substituted or unsubstituted C1-C4 alkylene, substituted or unsubstituted C1-C4 heteroalkylene, substituted or unsubstituted C1-C4 cycloalkylene, and substituted or unsubstituted C1-C4 heterocycloalkylene.
In some embodiments of the present application, L is selected from any one of absent, substituted or unsubstituted C1-C2 alkylene, substituted or unsubstituted C1-C2 heteroalkylene, substituted or unsubstituted C1-C2 cycloalkylene, and substituted or unsubstituted C1-C2 heterocycloalkylene.
In some embodiments of the present application, R 6 Is a substituted or unsubstituted trans-cyclooctene group.
In some embodiments of the present application, the orthogonal cleavage group is selected from any of the following structures:
Figure BDA0004066171060000031
wherein L is 1 、L 2 、L 3 Each independently is any one of the absence, ester group, ether group, C1-C6 alkylene group;
R 6 is hydrogen or a boric acid group.
In some embodiments of the present application, L 1 Is selected from any one of non-existence, ester group and ether group.
In some embodiments of the present application, L 2 Is absent.
In some embodiments of the present application, L 3 Is any one of C1-C6 alkylene groups. In some embodiments, any of C1-C3 alkylene.
In some embodiments of the present application, the orthogonal cleavage group is selected from any one of the following:
Figure BDA0004066171060000041
in some embodiments of the present application, R 3 The phosphate groups in (a) may be mono-or polyphosphate groups (e.g. 2 or more).
In a second aspect of the present application, there is also provided the use of a nucleotide analogue as described above in the synthesis or sequencing of nucleic acids. In some embodiments of the present application, the synthesis of the nucleic acid includes any one of enzymatic synthesis, chemical synthesis.
In some embodiments of the present application, the synthesis of the nucleic acid includes any one of enzymatic synthesis, chemical synthesis of DNA.
In some embodiments of the present application, enzymatic synthesis of nucleic acids refers to the completion of synthesis with the aforementioned compounds as synthesis substrates, with a system of DNA templates and enzymes, in a set reaction procedure including temperature conditions, reaction time. In some of these embodiments, the enzyme within the system comprises a DNA polymerase, and in some embodiments optionally an enzyme that can catalyze a template dependent DNA polymerization reaction, such as Taq DNA polymerase, pfu DNA polymerase, and the like.
In some embodiments of the present application, chemical synthesis of nucleic acids refers to the completion of the synthesis process using the aforementioned compounds as synthesis starting materials by protecting the non-reactive groups prior to reaction, activating the reactive groups, coupling, and deprotection after reaction. In some embodiments, the chemical synthesis of the nucleic acid comprises at least one of a phosphodiester linkage, a phosphotriester linkage, a phosphoramidite linkage, and the like. In some of these embodiments, the chemical synthesis of the nucleic acid is solid phase synthesis, i.e., the synthesis reaction is performed on a solid support.
In some embodiments of the present application, the nucleic acid comprises more than 2 nucleotides, further more than 10, 20, 30, 50, 100, 200, 500, 1000 nucleotides.
In a third aspect of the present application, there is provided a sequencing method comprising the steps of:
s1: contacting the template, polymerase, any of the foregoing nucleotide analogs, and primer to incorporate the nucleotide analogs into the primer in a set order for extension; the nucleotide analogs comprise four different tags depending on the base type;
s2: identifying the incorporated nucleotide analog based on the type of tag on the incorporated nucleotide analog of the primer;
s3: cleaving the nucleotide analog using a cleavage reagent to expose the 3' -OH;
repeating the steps S1-S3, and determining the sequence of the template.
In some embodiments of the present application, the cleavage agent comprises a tetrazine compound.
In some embodiments of the present application, the tetrazine compound has the general formula (ii):
Figure BDA0004066171060000051
wherein R is 7 、R 8 Independently selected from the group consisting of hydrogen, substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C1-C10 heteroalkyl, substituted or unsubstituted C1-C10 cycloalkyl, substituted or unsubstituted C1-C10 heterocycloalkyl, substituted or unsubstituted C6-C10 aryl, and substituted or unsubstituted C1-C10 heteroaryl.
In some embodiments of the present application, R 7 And R is 8 Not both hydrogen.
In some embodiments of the present application, the substituents for C1-C10 alkyl, C1-C10 heteroalkyl, C1-C10 cycloalkyl, C1-C10 heterocycloalkyl, C6-C10 aryl, and C1-C10 heteroaryl are optionally selected from at least one of amino, carboxy.
In some embodiments of the present application, R 7 Is hydrogen, R 8 Any one selected from amino and/or carboxyl substituted C1-C10 alkyl, amino and/or carboxyl substituted C1-C10 heteroalkyl, amino and/or carboxyl substituted C1-C10 cycloalkyl, amino and/or carboxyl substituted C1-C10 heterocycloalkyl, amino and/or carboxyl substituted C6-C10 aryl and amino and/or carboxyl substituted C1-C10 heteroaryl.
In some embodiments of the present application, the detectable label is a fluorescent group.
In some embodiments of the present application, specific examples of fluorophores include, but are not limited to FAM, HEX, TAMRA, cy, cy3.5, cy5, cy5.5, cy7, texas, ROX, JOE, R6G, EDANS, IFluor, alexa Fluor, FITC, and the like.
In some embodiments of the present application, the nucleotide analogs used for sequencing typically have four different bases, with the different base types having different detectable labels for the nucleotide analogs to determine a particular base type. For example, when the detectable label is a fluorophore, the nucleotide analogs of different base types have distinct differences in the emission wavelength of the fluorophore. It will be appreciated that the detectable label may also be any other label known in the art that is capable of distinguishing between different base types by at least one of physical, chemical, biological means.
During the sequencing described above, cleavage reactions employ the elimination of pyridazines initiated by the IEDDA reaction, which upon reaction of tetrazine with dienophile groups (e.g. trans-cyclooctene) form a dihydropyridazine intermediate which can spontaneously lead to the release of groups at the allylic position by 1, 4-elimination. The dienophile group, particularly the trans-cyclooctene group, has better stability than the existing azide protecting group. Meanwhile, in the Diels-Alder reaction process of tetrazine compound and dienophile group, especially trans-cyclooctene, nitrogen can be released, tension of trans-cyclooctene ring is reduced, thus further shortening excision time, improving excision efficiency, and reducing time required by sequencing. In C 2 For example, when the optimized tetrazine compound containing amino or carboxyl as a guiding group is used for excision, the half-life period is only 1.9 seconds, and the excision efficiency can be 99.7% in 40 seconds.
In a fourth aspect of the present application, there is also provided a method for synthesizing a nucleic acid, the method comprising using the aforementioned nucleotide analogue as a synthesis raw material.
In some embodiments of the present application, the synthetic method is a chemical synthesis of a nucleic acid or an enzymatic synthesis of a nucleic acid.
In a fourth aspect of the present application, there is also provided a composition comprising a nucleotide analogue as hereinbefore described.
In some embodiments of the present application, the composition includes a sequencing reagent.
In some embodiments of the present application, the composition includes a polymerization reagent.
In some embodiments of the present application, the composition includes a polymerization reagent and a cleavage reagent. The polymerization reagents include the aforementioned compounds, and the excision reagents include excision reagents.
In some embodiments of the present application, the composition includes a polymerization reagent and a cleavage reagent. The polymeric reagent includes orthogonal cleavage groups selected from
Figure BDA0004066171060000061
Any of the aforementioned compounds, wherein the cleavage reaction reagent comprises a tetrazine compound.
In some embodiments of the present application, the polymerization reagents further comprise a polymerase.
Additional aspects and advantages of the application will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the application.
Detailed Description
The conception and technical effects produced by the present application will be clearly and completely described below in connection with the embodiments to fully understand the objects, features and effects of the present application. It is apparent that the described embodiments are only some embodiments of the present application, but not all embodiments, and that other embodiments obtained by those skilled in the art without inventive effort based on the embodiments of the present application are within the scope of the present application.
The following detailed description of embodiments of the present application is exemplary and is provided merely for purposes of explanation and not to be construed as limiting the application.
In the description of the present application, the meaning of a plurality means one or more, the meaning of a plurality means two or more, and the meaning of greater than, less than, exceeding, etc. is understood to exclude the present number, and the meaning of above, below, within, etc. is understood to include the present number, and the meaning of about means within the range of ±20%, 10%, 8%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.2%, 0.1% etc. of the present number. The description of the first and second is for the purpose of distinguishing between technical features only and should not be construed as indicating or implying relative importance or implicitly indicating the number of technical features indicated or implicitly indicating the precedence of the technical features indicated.
In the description of the present application, a description with reference to the terms "one embodiment," "some embodiments," "illustrative embodiments," "examples," "specific examples," or "some examples," etc., means that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the present application. In this specification, schematic representations of the above terms do not necessarily refer to the same embodiments or examples. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples.
Example 1
This example provides a nucleotide analogue (compound 5) which is synthesized as follows:
Figure BDA0004066171060000071
the method comprises the following specific steps:
(1) Nucleoside (compound 1) was taken and reacted with t-butyldimethylchlorosilane (TBSCl) and imidazole in N, N-Dimethylformamide (DMF) at room temperature for 24 hours, whereby a TBS protecting group was added to 5' -OH to give compound 2.
(2) Under the protection of nitrogen at room temperature, triphenylphosphine (PPh) is weighed 3 ) And trans-cyclooctene-2' -OH is added into a round bottom flask, tetrahydrofuran (THF) is added as a solvent, stirring is carried out, diethyl azodicarbonate (DEAD) is slowly added dropwise within 5min, then the compound 2 dissolved in the tetrahydrofuran is slowly added into the mixed solution, the reaction is tracked and observed by TLC, after the compound 2 is completely reacted, the reaction solvent is removed by a rotary evaporator, and the compound 3 is purified by a forward silica gel chromatographic column, so as to obtain a white solid of the intermediate compound 3.
(3) Weighing compound 3 under the protection of room temperature nitrogenIn a round bottom flask, anhydrous THF was added to dissolve, and then triethylamine hydrochloride (Et) was slowly added dropwise 3 N-HF), stirring the reaction, TLC followed by observation of the reaction until all the starting materials were completely reacted, removal of the reaction solvent by rotary evaporator, dissolution in ethyl acetate, extraction and separation with saturated aqueous sodium bicarbonate, extraction of the ethyl acetate layer, extraction with saturated sodium chloride, drying over anhydrous sodium sulfate, filtration and removal of ethyl acetate by rotary evaporator, the resulting yellow oily liquid was purified by forward silica gel chromatography to give a white solid of intermediate compound 4.
(4) Weighing compound 4 and proton sponge in two bottles for drying, and extracting air for ventilation by using N 2 Displacing for three times, adding 20ml trimethyl phosphate, ultrasonic dissolving, adding into ice water bath, and slowly dripping POCl under ice water bath 3 Stirring and reacting for 2 hours in ice bath; taking the other two-mouth bottle for drying, weighing ammonium pyrophosphate, and exhausting and ventilating by using N 2 Displacing for three times, adding 20ml of DMF for ultrasonic dissolution, adding DIPEA, placing in an ice water bath, then adding the reaction solution of the first step of monophosphate into the solution, and keeping the ice water bath for reaction for 2 hours; after 2 hours, 10ml of 1M TEAB was added dropwise to the solution in an ice-water bath to quench the reaction, and after 1 hour, the reaction was analyzed by HPLC. Purifying by DEAE ion exchange chromatography and preparative HPLC to obtain target molecular compound 5, and purifying by 1 H NMR was characterized error-free.
Example 2
This example provides a nucleotide analogue (compound 9) which is synthesized as follows:
Figure BDA0004066171060000081
the method comprises the following specific steps:
(1) Compound 2 was weighed into a round bottom flask under nitrogen at room temperature, anhydrous DMF was added as solvent, then anhydrous Dichloromethane (DCM) and 4-Dimethylaminopyridine (DMAP) were added, stirred at room temperature until a homogeneous liquid formed, then carbonyldiimidazole was added rapidly, the reaction was resealed and stirred at room temperature for 2 hours until all starting materials were consumed. The reaction mixture was filtered through silica gel and the filter cake was washed with ethyl acetate. The solvent was removed by rotary evaporator to give crude compound 6, which was used in the next reaction.
(2) The crude product of the compound 6 is weighed into a round bottom flask under the protection of nitrogen at room temperature, trans-cyclooctene-2' -OH and triethylamine are added, the mixture is stirred for 2 hours, after the compound 6 is completely reacted, the reaction solvent is removed by a rotary evaporator, and the mixture is purified by a forward silica gel chromatographic column to obtain a white solid of the intermediate compound 7.
(3) Compound 7 was weighed into a 100mL round bottom flask under the protection of nitrogen at room temperature, anhydrous THF was added to dissolve, then, hydrogen fluoride triethylamine was slowly added dropwise to react under stirring, the reaction was observed by TLC tracking until all the raw materials were completely reacted, the reaction solvent was removed by rotary evaporator, dissolved in ethyl acetate, and extracted and separated with saturated aqueous sodium bicarbonate solution, the ethyl acetate layer was extracted and then added with saturated sodium chloride to extract, then dried over anhydrous sodium sulfate, filtered and ethyl acetate was removed by rotary evaporator, and the resulting yellow oily liquid was purified by forward silica gel column chromatography to give a white solid of intermediate compound 8.
(4) Weighing intermediate compound 8 and proton sponge in a 100mL two-port bottle, and performing air suction and ventilation by using N 2 Displacing for three times, adding 20mL trimethyl phosphate, ultrasonic dissolving, adding into ice water bath, and slowly dripping POCl under ice water bath 3 Stirring and reacting for 2 hours in ice bath; taking the other two-mouth bottle for drying, weighing ammonium pyrophosphate, and exhausting and ventilating by using N 2 Displacing for three times, adding 20mL of DMF for ultrasonic dissolution, adding DIPEA, placing in an ice water bath, then adding the reaction solution of the first step of monophosphate into the solution, and keeping the ice water bath for reaction for 2 hours; after 2 hours, 10mL of 1M TEAB was added dropwise to the solution in an ice-water bath to quench the reaction, and after 1 hour, the reaction was analyzed by HPLC. Purification by DEAE ion exchange chromatography and preparative HPLC to give target molecular Compound 9 by 1 H NMR was characterized error-free.
Example 3
This example provides a tetrazine compound 11 for use in cleavage reactions, which is synthesized as follows:
Figure BDA0004066171060000091
the preparation process comprises the following steps:
into a round bottom flask was charged n-boc-b-cyano-l-alanine (compound 10) (600 mg,2.8 mmol), formamidine acetate (1.46 g,14 mmol), zn (OTf) 2 (255 mg,0.7 mmol), dioxane (8.4 mL,98 mmol) and hydrazine monohydrate (6.8 mL,140 mmol) were mixed well and sealed immediately. Stirred at 30℃for 72 hours and then poured into 50ml of ice-water. Adding NaNO 2 (3.9 g,56 mmol) and acidify the solution with 2N aqueous HCI (60 mL). The mixture was extracted with ethyl acetate (5X 70 mL) and the organic layer was taken over MgSO 4 Drying, filtering and concentrating. By preparative reverse phase column chromatography (C18, H 2 O/MeCN, gradient elution, 0.1% formic acid) to afford tetrazine (Compound 11) by 1 H NMR was characterized error-free.
Example 4
This example provides a tetrazine compound 13 for use in cleavage reactions, which is synthesized as follows:
Figure BDA0004066171060000092
the preparation process comprises the following steps:
3-Cyanopropionic acid (Compound 12,1g,8.26 mmol), formamidine acetate (4.3 g,41.3 mmol), zn (OTf) were placed in a round bottom flask 2 (0.9 g,2.5 mmol) and hydrazine monohydrate (10 mL,206 mmol) were mixed well and sealed immediately. Stirring at 60deg.C for 60 min, adding NaNO 2 (2.3 g,33 mmol), acidifying the solution with 2N aqueous HCI, then extracting the mixture with ethyl acetate (6X 150 mL), collecting the organic layer over MgSO 4 Drying, filtering and concentrating. Reversed phase column chromatography (H) 2 O/MeCN, gradient elution, 0.1% formic acid) to give tetrazine (Compound 13), by 1 H NMR was characterized error-free.
Example 5
This example provides a nucleotide analogue whose synthetic route differs from that of example 1 in that 2.fwdarw.3 is replaced by 2.fwdarw.14.fwdarw.15 as follows, and then compound 15 is used in place of compound 3 to participate in steps (3) to (4) of example 1:
Figure BDA0004066171060000101
the specific preparation process of 2- > 14- > 15 is as follows:
(1) Dissolving compound 2 in acetonitrile (MeCN) under nitrogen protection at room temperature, adding dibromoethane and K 2 CO 3 Stirring at 80deg.C overnight, cooling to room temperature, adding deionized water, quenching, extracting with diethyl ether, washing the organic layer with brine, and concentrating under reduced pressure (MgSO) 4 Drying and removing volatile substances under reduced pressure. The crude product was purified using column chromatography (30% etoac/heptane) to give intermediate 14 as a white solid.
(2) Intermediate 14 was dissolved in dry DMSO, N 2 Purging for 10 minutes. Potassium tert-butoxide (t-BuOK) was added slowly in portions and the mixture was stirred for 10 minutes. The mixture was then diluted with EtOAc and quenched with ice water. The layers were separated, the organic layer was washed with deionized water, brine, and dried over MgSO 4 Drying. Volatiles were removed under reduced pressure and the product was dissolved in MeOH. Sodium borohydride (NaBH) was added in portions 4 ) The mixture was stirred for 1.5 hours. By H 2 The reaction was quenched with O and the pH was adjusted to 7 with 0.1M HCl. Then washed with EtOAc, brine and dried over MgSO 4 Drying. The volatiles were removed and the crude product was purified using column chromatography (30% etoac/heptane) to give compound 15 by 1 H NMR was characterized error-free.
Example 6
This example provides a nucleotide analogue whose synthetic route differs from that of example 1 in that 2.fwdarw.3 is replaced by 2.fwdarw.16.fwdarw.17.fwdarw.18.fwdarw.19 as follows, and then compound 19 is used in place of compound 3 to participate in steps (3) to (4) of example 1:
Figure BDA0004066171060000111
the preparation process comprises the following steps:
a) Weighing compound 2, dissolving in DMF, adding K 2 CO 3 . Trichloroethylene was added dropwise at 70℃overnight, cooled to room temperature, quenched with deionized water, the product extracted with diethyl ether, the combined organic layers washed with brine and Na 2 SO 4 Drying and removing volatile substances under reduced pressure. The extraction, washing, and drying steps were repeated to give compound 16.
b) Compound 16 was dissolved in diethyl ether and n-BuLi was added dropwise. Stirring was carried out at-78℃for 1 hour, then heated to-40℃for 1 hour and stirred again for 1 hour. Quenching with deionized water, extracting the product with diethyl ether, and combining the organic layers with saturated NH 4 Cl and brine, and washed with Na 2 SO 4 And (5) drying. The volatiles were removed under reduced pressure and the crude product was purified using column chromatography (1% etoac/heptane) to give compound 17.
c) Compound 17 was dissolved in toluene, N 2 Purging for 10 minutes. Adding Pinacolborane (Pinacolborane) and RuHClCO (PPh) 3 ) 3 Stirred overnight at 50 ℃, cooled to room temperature and then volatiles were removed under reduced pressure. The crude product was dissolved in diethyl ether, saturated NaHCO 3 And brine, and washed with Na 2 SO 4 After drying and removal of volatiles under reduced pressure, the crude product was purified by column chromatography (30-40% etoac/heptane) to give compound 18 by 1 H NMR was characterized error-free.
d) Hydrolysis of compound 18 in PBS afforded compound 19.
Example 7
This example provides a set of four nucleotide analogs with different detectable labels, including nucleotide analog dATP, dCTP, dGTP and dTTP. Taking dCTP as an example, it differs from the nucleotide analog of example 1 in that a detectable label, specifically an optional fluorescent group Fluor, is modified at the base by a linker group of the formula:
Figure BDA0004066171060000121
similar to dCTP, dATP, dGTP and dTTP are each modified with a fluorescent group by a linking group on the base, and the excitation bands of these fluorescent groups are different.
Example 8
This example provides a set of four nucleotide analogs with different detectable labels, including nucleotide analog dATP, dCTP, dGTP and dTTP. Taking dCTP as an example, it differs from example 2 in that a detectable label, in particular an optional fluorescent group Fluor, is modified on the base by a linker of the formula:
Figure BDA0004066171060000122
similar to dCTP, dATP, dGTP and dTTP are each modified with a fluorescent group by a linking group on the base, and the excitation bands of these fluorescent groups are different.
Example 9
This example provides a set of four nucleotide analogs with different detectable labels, including nucleotide analog dATP, dCTP, dGTP and dTTP. Taking dCTP as an example, it differs from example 5 in that a detectable label, in particular an optional fluorescent group Fluor, is modified on the base by a linker of the formula:
Figure BDA0004066171060000131
similar to dCTP, dATP, dGTP and dTTP are each modified with a fluorescent group by a linking group on the base, and the excitation bands of these fluorescent groups are different.
Example 10
This example provides a set of four nucleotide analogs with different detectable labels, including nucleotide analog dATP, dCTP, dGTP and dTTP. Taking dCTP as an example, it differs from example 6 in that a detectable label, in particular an optional fluorescent group Fluor, is modified on the base by a linker of the formula:
Figure BDA0004066171060000132
similar to dCTP, dATP, dGTP and dTTP are each modified with a fluorescent group by a linking group on the base, and the excitation bands of these fluorescent groups are different.
Example 11: thermal stability test
The nucleotide analogs prepared in examples 1, 2, 5 and 6 were prepared in 0.1mM PBS (pH=9) solution, heated at 60℃for 5s to 10min, sampled at a plurality of different time points therein, and analyzed by HPLC for the formation ratio of 3' -OH unblocked nucleotides, R in examples 1, 2, 5 and 6 was determined based on the retention time of HPLC, peak height, peak area 1 Stability of the protecting group. R of nucleotide analogues according to the results of thermal stability reflected by degradation rates of the nucleotide analogues at different time points 1 The protecting group has good thermal stability, and the stability is 3.4 times higher than that of the nucleotide protected by adopting the azidomethyl group under the same condition, so that the nucleotide analogue provided by the embodiment of the application can ensure smooth polymerization reaction and signal acquisition in a sequencing cycle, and reduce the phasing value, so that the template can be sequenced with high accuracy.
Example 12: comparison of ablation efficiency
Cleavage of comparative example 1 (azidomethyl protected nucleotide analog) using THPP as a deprotection reagent, and cleavage of the nucleotide analogs prepared in examples 1, 2, 5, and 6 using tetrazine compound 11 and compound 13 prepared in examples 5 and 6 as a deprotection reagent, the respective half-retention rates were compared. The principle of the tetrazine cleavage reaction is shown in the following route:
Figure BDA0004066171060000141
the results show that the half-retention time for excision of the azidomethyl protected nucleotide at room temperature was 6.4min at five equivalents of THPP, whereas the half-retention rate for excision of the nucleotide analogs of examples 1, 2, 5, 6 with compounds 11 and 13 was significantly higher than for excision of the nucleotide analog of comparative example 1 with THPP using 5 equivalents of tetrazine compound for excision of 4.1 min. Therefore, the primer extension by using the nucleotide analogs provided in the above examples and the deprotection by using the corresponding tetrazine compounds can greatly accelerate the progress of the excision reaction and shorten the sequencing time.
Example 13: sequencing examples
The embodiment provides a sequencing method of human genome, which comprises the following specific processes:
1. sequencing library construction
(1) Nucleic acid extraction, the extraction and purification of genomic DNA of the sample was performed using a rapid DNA extraction kit (TIANGEN, KG 203), and the specific operation was described in the following.
(2) Library construction libraries were constructed using the general library construction kit of Northenan VAHTS Universal Plus DNA Library Prep Kit for Illumina (cat# ND 617-02), the specific procedures of which are described in the description of the procedures.
(3) And (3) controlling the quality of the library, and detecting the concentration and controlling the fragment length quality of the enriched library.
By the above procedure, about 50nM of library sample of about 1-1000bp in length was obtained.
2. Preparation of sequencing chip on machine
Library denaturation, library loading and chip surface amplification are performed by using a Miseq sequencer of Illumina company and a sequencing kit (MiSeq Reagent Kit v 3) matched with the Miseq sequencer, so that a DNA amplified cluster is obtained, a sequencing primer ACACTCTTTCCCTACACGACGCTCTTCCGATC (SEQ ID No. 1) is added, and after hybridization is completed, the DNA amplified cluster with the hybridized sequencing primer is fixed in a sequencing chip flow tank, and the next sequencing reaction is waited.
3. Sequencing
(1) Sequencing reagent preparation
Preparing a polymerization reaction solution containing a DNA polymerase and Mg 2+ Nucleotide analogs in example 7dATP, dCTP, dGTP and dTTP each 1. Mu.M; and elution buffer, pre-wash buffer and excision reaction solution comprising compound 11.
(2) Sequencing reaction cycle
And pumping pre-washing buffer solution and polymerization reaction solution into the amplified chip in sequence to start polymerization reaction. And after the reaction of the polymerization reaction liquid is finished, collecting signals of the whole sequencing chip, and determining the type of the base combined by the primer chain on each amplified cluster. After the signal acquisition is finished, the elution buffer solution and the excision reaction solution are pumped in sequence to react, and then the elution buffer solution is pumped in to wash.
The above steps are repeated to perform the next cycle sequencing. A total of 100 sequencing cycles were performed.
Comparative example 2: a sequencing method of human genome was provided, which was different from example 13 in that the nucleotide analogs in the polymerization reaction solution were replaced with corresponding azidomethyl-protected 3' -OH nucleotides, and that compound 11 in the excision reaction solution was thPP.
The results of comparing the phasing value, pre-phasing value, and Q30 reflecting sequencing quality for the different samples of example 13 and comparative example 2, respectively, are shown in Table 1:
TABLE 1 results of testing different samples according to the methods of example 13 and comparative example 2
Figure BDA0004066171060000151
From the above results, it can be seen that the nucleotide analogs used in the examples were complete in excision, the phasing value and the pre-phasing value were both significantly lower than those of the comparative examples, and the sequencing quality Q30 was also significantly higher than that of the comparative examples, so that the higher accuracy of the sequencing could be maintained in example 12.
Example 14
This example provides a sequencing method that differs from example 13 in that the nucleotide analogs used in the polymerization reaction solution are a set of four nucleotide analogs as in example 8.
Example 15
This example provides a sequencing method that differs from example 13 in that the nucleotide analogs used in the polymerization reaction solution are a set of four nucleotide analogs as in example 9.
Example 16
This example provides a sequencing method that differs from example 13 in that the nucleotide analogs used in the polymerization reaction solution are a set of four nucleotide analogs as in example 10.
The cleavage reagent in examples 14-16 was similar to example 13 in both its phasing and pre-phasing values, and was lower than in corresponding comparative example 2, and Q30 was similar to example 13, and was higher than in comparative example 2, and will not be described again.
By combining the above examples, it can be seen that the nucleotide analogs provided in the examples of the present application serve as a substitute for a reversible terminator, and can stably protect 3'-OH under the condition of a sequencing reaction, and rapidly cleave off to expose 3' -OH after contacting with a cleavage reagent, thereby not only reducing the phasing value in the sequencing process, but also eventually reducing the error rate, improving the accuracy, and greatly shortening the sequencing time.
Examples 17 to 20
This example provides a chemical synthesis method of DNA, which is based on phosphoramidite solid phase chemical synthesis method, and uses the nucleotides of examples 7-10 as reaction raw materials or their precursor compounds on DNA chip to synthesize DNA sequences with a certain length through the reaction steps of deblocking, activated coupling, capping, oxidation, etc.
The present application has been described in detail with reference to the embodiments, but the present application is not limited to the embodiments described above, and various changes can be made within the knowledge of one of ordinary skill in the art without departing from the spirit of the present application. Furthermore, embodiments of the present application and features of the embodiments may be combined with each other without conflict.

Claims (10)

1. A nucleotide analogue of formula (i):
Figure FDA0004066171050000011
wherein R is 1 Comprising an optional orthogonal cleavage group;
R 2 including bases;
R 3 including any of hydroxyl, phosphate groups;
R 4 comprising hydrogen, OR 5 Any one of R 5 Is an optional orthogonal cleavage group;
preferably, said R 1 、R 2 、R 3 、R 4 A detectable label is also attached to at least one of the two.
2. The nucleotide analogue according to claim 1, wherein the orthogonal cleavage groups are dienophile groups.
3. The nucleotide analogue according to claim 1, wherein the orthogonal cleavage group is-L-R 6 ；
Wherein L is selected from any one of absent, substituted or unsubstituted C1-C10 alkylene, substituted or unsubstituted C1-C10 heteroalkylene, substituted or unsubstituted C1-C10 cycloalkylene, substituted or unsubstituted C1-C10 heterocycloalkylene, substituted or unsubstituted C6-C10 arylene, and substituted or unsubstituted C6-C10 heteroarylene;
R 6 selected from the group consisting of a substituted or unsubstituted trans-cyclooctene group, a substituted or unsubstituted norbornene group, a substituted or unsubstituted benzonorbornene group, a substituted or unsubstituted vinyl group, a substituted or unsubstituted cyano group, and a substituted or unsubstituted azidophenyl group.
4. A nucleotide analogue according to claim 2 or 3, wherein the orthogonal cleavage group is selected from any one of the following:
Figure FDA0004066171050000012
wherein L is 1 、L 2 、L 3 Each independently is any one of the absence, ester group, ether group, C1-C6 alkylene group;
R 6 is hydrogen or a boric acid group.
5. A nucleotide analogue according to claim 2 or 3, wherein the orthogonal cleavage group is selected from any one of the following:
Figure FDA0004066171050000021
6. use of the nucleotide analogue according to any one of claims 1 to 5 in the sequencing or synthesis of nucleic acids.
7. A sequencing method, comprising the steps of:
s1: contacting a template, a polymerase, the nucleotide analogue of any one of claims 1 to 5, and a primer such that the nucleotide analogue is incorporated into the primer in a set order for extension; the nucleotide analogue is connected with four different detectable labels according to the different base types;
s2: identifying the incorporated nucleotide analogue based on the tag type on the nucleotide analogue incorporated into the primer;
s3: cleaving the nucleotide analog using a cleavage reagent to expose the 3' -OH;
repeating the steps S1-S3, and determining the sequence of the template.
8. The sequencing method of claim 7, wherein said cleavage reagent comprises a tetrazine compound;
preferably, the tetrazine compound has a general formula as shown in formula (II):
Figure FDA0004066171050000022
wherein R is 7 、R 8 Each independently selected from any one of hydrogen, substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C1-C10 heteroalkyl, substituted or unsubstituted C1-C10 cycloalkyl, substituted or unsubstituted C1-C10 heterocycloalkyl, substituted or unsubstituted C6-C10 aryl, and substituted or unsubstituted C6-C10 heteroaryl.
9. A method for synthesizing a nucleic acid, characterized by comprising using the nucleotide analog according to any one of claims 1 to 5 as a synthesis raw material;
preferably, the synthetic method is chemical synthesis or enzymatic synthesis.
10. A composition comprising a nucleotide analogue according to any one of claims 1 to 5.
CN202310076009.XA 2023-02-07 2023-02-07 Nucleotide analogs and their use in sequencing Pending CN116284185A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310076009.XA CN116284185A (en) 2023-02-07 2023-02-07 Nucleotide analogs and their use in sequencing

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310076009.XA CN116284185A (en) 2023-02-07 2023-02-07 Nucleotide analogs and their use in sequencing

Publications (1)

Publication Number Publication Date
CN116284185A true CN116284185A (en) 2023-06-23

Family

ID=86796857

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310076009.XA Pending CN116284185A (en) 2023-02-07 2023-02-07 Nucleotide analogs and their use in sequencing

Country Status (1)

Country Link
CN (1) CN116284185A (en)

Similar Documents

Publication Publication Date Title
US10988806B2 (en) Methods for indexing samples and sequencing multiple polynucleotide templates
TWI639614B (en) Nucleotide analogues
US7795423B2 (en) Polynucleotide labeling reagent
US7078499B2 (en) Nucleotide analogues comprising a reporter moiety and a polymerase enzyme blocking moiety
US7807376B2 (en) Modified oligonucleotides and applications thereof
EP1926829B2 (en) Labelled modified guanine-containing nucleosides and nucleotides comprising a fluorophore attached to the base through a linking group comprising a polyethylene glycol spacing group and methods for their use
US7759470B2 (en) Labeling reagent
WO2019105421A1 (en) Nucleoside analogue, preparation method and application
US20110014611A1 (en) Design and synthesis of cleavable fluorescent nucleotides as reversible terminators for dna sequences by synthesis
AU2001262495A1 (en) Nucleotide analogues comprising a reporter moiety and a polymerase enzyme blocking moiety
IE75726B1 (en) 3' - amino - or thiol-modified fluorescent dye-coupled nucleoside and oligonucleotide a process for their preparation and their use
CN110650968B (en) Modified nucleosides or nucleotides
US4808520A (en) Labelling of oligonucleotides
CN113105516A (en) Photocleavable fluorescent labeling compounds and uses
CN108251516B (en) DNA single molecule sequencing method and sequencing system
CN108192957B (en) DNA (deoxyribonucleic acid) synthetic sequencing method and sequencing system
CN110506121A (en) The cutting reagent of sulfur-bearing hydroxyl and oxidation rinsing agent
CN116284185A (en) Nucleotide analogs and their use in sequencing
US7759469B2 (en) Labeling reagent
KR20230107259A (en) Modified Nucleoside or Nucleotide
US7164014B2 (en) Protected linker compounds
EP1700922B1 (en) 3-Substituted 5-Nitroindole derivatives and labeled oligonucleotide probes containing them
CN108822173B (en) Fluorescence-labeled cleavable nucleotide, synthesis method and application thereof in DNA sequencing
WO2020102980A1 (en) Preparation method for nucleotide for sequencing
CN117567536A (en) Application of fluorescent labeled nucleotide in DNA synthesis sequencing and single molecule sequencing

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination