JP2009201402A - Method for detecting target nucleic acid, and substrate body for detecting target nucleic acid - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a substrate body for detecting target nucleic acids by which the plurality of target nucleic acids can simultaneously be detected in a small number of detecting sections, and to provide a method for detecting the target nucleic acids using the substrate body. <P>SOLUTION: The method for detecting the target nucleic acids comprises a feeding step of feeding a nucleic acid sample to the substrate body for detecting the target nucleic acids provided with a substrate, a plurality of nucleic acid probes complementary to each of the plurality of mutually different target nucleic acids, and the detecting sections which are provided on the substrate with the plurality of nucleic acid probes immobilized in different amounts of immobilization in the same region, respectively, a hybridization step of hybridizing the nucleic acid sample to the nucleic acid probes, and affording a hybrid chain, a detection step of detecting amounts of signals derived from the hybrid chain from the detecting sections, and a determining step of determining the presence or absence of the target nucleic acids contained in the nucleic acid sample from the amounts of the signals. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to a target nucleic acid detection method and a target nucleic acid detection substrate.

  Amid various advances in genetic engineering, various nucleic acid detection methods have been devised (see, for example, Patent Document 1). Among them, detection of nucleic acids using a target nucleic acid detection substrate (for example, a DNA chip) is particularly excellent because many types of target nucleic acids can be detected simultaneously.

  The target nucleic acid detection substrate is widely used in various fields such as medical, forensic medicine, agriculture, livestock, fishery and forestry. In particular, in the medical field, a DNA chip is a powerful tool for genetic diagnosis. For example, the pharmacological effect and side effects of a drug can be predicted for each patient by analyzing the SNP of each patient. Some tailor-made medical treatments that provide optimal treatment to individuals are being realized by analyzing SNPs using DNA chips.

  In the target nucleic acid detection substrate, one type of nucleic acid probe having a sequence complementary to the target sequence is fixed to each of a plurality of different detection sections on the substrate. When the nucleic acid sample is hybridized with the nucleic acid probe on the detection section, a signal derived from the hybridization strand is generated. By detecting this, the presence or absence of the target nucleic acid in the nucleic acid sample becomes clear.

The target nucleic acid detection method using such a target nucleic acid detection substrate mainly includes fluorescence detection and electrochemical detection (see, for example, Patent Document 2). Since the detection by fluorescence can visually recognize the result, it is possible to prevent an erroneous determination of the detection result. On the other hand, since the electrochemical detection can be performed only by the current value, the apparatus can be downsized, the inspection cost can be reduced, and the inspection time can be shortened.
JP 2004-24035 A No. 2004-011643

  As the role of target nucleic acid detection substrates in the medical field and the like increases, it is expected that more types of target nucleic acids need to be detected on the same substrate than ever before. However, since the number of detection sections that can be arranged on a substrate having a certain area is limited, when detecting many types of target nucleic acids, a plurality of substrates must be used, and the inspection may be complicated. is there. In particular, in the case of electrochemical detection, in order to obtain a necessary current value, an electrode area larger than a certain value is required, so the number of detection sections that can be arranged on one substrate is necessarily limited. The

  Therefore, when multiple types of target nucleic acids must be detected, detection must be performed using a plurality of substrates, or the number of detection sections can be increased by increasing the area of the substrate, which complicates the inspection operation. Or the miniaturization of the substrate is hindered and the convenience is inferior.

  The present invention is intended to solve such problems of existing substrates, and a target nucleic acid detection substrate capable of simultaneously detecting a large number of target nucleic acids with a small number of detection sections and a target using the substrate. It aims at providing the detection method of a nucleic acid.

  The first gist of the present invention uses a target nucleic acid detection substrate in which two or more kinds of nucleic acid probes are immobilized in different amounts in the same detection section of the substrate. Using this substrate, hybridization with a nucleic acid sample is performed in the same manner as before, and the amount of signal derived from hybridization is measured from each detection section. At this time, there is a correspondence between the signal amount obtained from the detection section and the fixed amount of each nucleic acid probe. Therefore, it can be determined to which nucleic acid probe the nucleic acid sample has hybridized from the signal amount obtained from the detection section. Thereby, two or more types of target nucleic acids can be identified within one detection section without increasing the number of detection sections.

  In addition, the second gist of the present invention uses a nucleic acid detection substrate in which two or more kinds of nucleic acid probes showing different Tm values are fixed in the same detection section of the substrate. Using this substrate, hybridization with a nucleic acid sample is performed a plurality of times at different reaction temperatures, and the amount of signal derived from hybridization is measured from the detection compartment at each reaction temperature. At this time, there is a relationship between the Tm value of each nucleic acid probe and the amount of signal obtained from the detection section for each temperature. Therefore, it can be determined to which nucleic acid probe the nucleic acid sample has hybridized from the signal amount obtained from the detection section. Thereby, two or more types of target nucleic acids can be identified within one detection section as described above.

  That is, the present invention provides a substrate, a plurality of nucleic acid probes complementary to a plurality of different target nucleic acids, and the substrate, wherein the plurality of nucleic acid probes are fixed in different amounts in the same region. A supply step of supplying a nucleic acid sample to a target nucleic acid detection substrate comprising: a detection zone; a hybridization step of hybridizing the nucleic acid sample to the nucleic acid probe to obtain a hybrid chain; and the hybrid from the detection zone Provided is a method for detecting a target nucleic acid, comprising performing a detection step for detecting a signal amount derived from a chain and a determination step for determining the presence or absence of a target nucleic acid contained in the nucleic acid sample from the signal amount.

  The present invention also provides a substrate, a plurality of types of nucleic acid probes that are complementary to different target nucleic acids and exhibit different Tm values, and the plurality of types of nucleic acid probes provided on the substrate, in the same region. A supply step of supplying a nucleic acid sample to a target nucleic acid detection substrate provided with a detection section, wherein all types of nucleic acid probes of the plurality of types of nucleic acid probes form hybrid chains with the target nucleic acid. A reaction step of reacting the nucleic acid sample with the target nucleic acid detection substrate at a temperature to be maintained and each temperature at which each nucleic acid probe dissociates the target nucleic acid among the plurality of types of nucleic acid probes; Detection step for detecting the amount of signal obtained in each reaction step at the temperature of and the presence or absence of the target nucleic acid contained in the nucleic acid sample from the amount of signal obtained in the detection step It provides a method for detecting a target nucleic acid and performing a that determination step.

  Furthermore, the present invention provides a substrate, a plurality of nucleic acid probes complementary to a plurality of different target nucleic acids, and the substrate, wherein the plurality of nucleic acid probes are fixed in different amounts in the same region. And a target nucleic acid detection substrate comprising a detection compartment.

  Furthermore, the present invention provides a substrate, first and second nucleic acid probes that are complementary to a plurality of different target nucleic acids, each having a different Tm value, and provided on the substrate, in the same region. A target nucleic acid detection substrate comprising: a detection section on which the first and second nucleic acid probes are fixed.

  According to the present invention, a large number of target nucleic acids can be detected simultaneously even with a substrate having a small number of detection sections. Therefore, the detection substrate can be downsized, or the detection operation can be simplified.

  Hereinafter, embodiments of the present invention will be described with reference to the drawings.

1. First Embodiment (1) Target Nucleic Acid Detection Substrate (Basic Configuration)
FIG. 1 is a schematic diagram of a target nucleic acid detection substrate 1 in the first embodiment. The target nucleic acid detection substrate 1 includes a substrate 2 and a detection section 3, and one or more detection sections 3 are aligned on the substrate 2. In the case of electrochemical detection, one electrode is arranged in each detection section 3, and each electrode is connected to a pad 4 for taking out an electrochemical signal.

  The target nucleic acid detection substrate 1 may be enclosed in, for example, a plastic container into which a nucleic acid sample solution can be injected. The plastic container is provided with an inlet through which a nucleic acid sample solution can be injected. When the nucleic acid sample solution is injected from the inlet, the target nucleic acid detection substrate 1 is immersed in the nucleic acid sample solution in the plastic container. It has a structure.

  Any material can be used for the substrate 2, but preferably a silica-containing substrate such as silicon, glass, quartz glass and quartz, and a plastic substrate such as polyacrylamide, polystyrene and polycarbonate are used. The substrate 2 can have any shape including a plate or a sphere, but can preferably be a plate substrate called an array or a chip.

  The detection section 3 is one reaction system independent of other reaction systems. The signals obtained from each detection zone are completely independent without interfering with each other.

  In the case of detection by fluorescence, one type of fluorescent substance is used in one detection section 3, and one type of fluorescent signal can be obtained in one reaction. In the case of electrochemical detection, one electrode is arranged in one detection section 3, and one current value can be obtained in one reaction. The number, shape, and arrangement pattern of the detection sections can be freely changed by those skilled in the art as needed.

  There is no restriction | limiting in particular in the area of each detection division, It can design to arbitrary magnitude | sizes. In the case of electrochemical detection, as described above, one electrode is arranged in each detection section 3. When the area of the electrode is reduced, the obtained current value is reduced, and the influence of noise is relatively increased. In order to avoid this noise, measures such as shielding the cord or providing an enclosure for blocking the influence of surrounding electromagnetic waves can be considered, but there is a problem that the configuration of the apparatus becomes complicated accordingly. On the other hand, since the substrate in the first embodiment has two or more types of target nucleic acids immobilized on a single electrode, the number of types of target nucleic acids that can be detected is increased without reducing the electrode area. Can do. Therefore, more types of target nucleic acids can be detected than before without complicating the configuration of the apparatus.

  Specifically, for example, in the case of a circular electrode, an electrode having a diameter of 100 μm or more, preferably 200 μm or more, and most preferably 500 μm or more is used. However, since the lower limit of the electrode area varies greatly depending on the reaction system, detection environment, etc., the electrode area is not limited to the lower limit described above.

In the case of electrochemical detection, the electrodes installed in each detection section are not particularly limited. For example, graphite, glassy carbon, pyrolytic graphite, carbon paste, carbon fiber, etc. Carbon electrode, noble metal electrode such as platinum, platinum black, gold, palladium, rhodium, oxide electrode such as titanium oxide, tin oxide, manganese oxide, lead oxide, Si, Ge, ZnO, CdS, TiO ₂ , GaAs Such a semiconductor electrode, titanium or the like can be used. These electrodes may be coated with a conductive polymer or a monomolecular film, and may be treated with other surface treatment agents as desired.

  Further, a counter electrode and / or a reference electrode may be provided. When installing the reference electrode, for example, a general reference electrode such as a silver / silver chloride electrode or a mercury / mercury chloride electrode can be used.

  The length of the nucleic acid probe immobilized on the detection compartment can be appropriately selected as long as it is immobilized on the substrate and hybridized, and may be set shorter than the target nucleic acid. Specifically, it can be, for example, about 3 to about 1000 bp, preferably about 10 to about 200 bp.

  The base sequence of the nucleic acid probe is set so as to have a sequence complementary to the base sequence of the target nucleic acid. Here, “complementary” means complementary in the range of, for example, 50% to 100%, preferably 70% to 100%, and most preferably 80% to 100%.

  As used herein, the term “nucleic acid” includes nucleic acids, nucleic acid analogs and nucleic acid derivatives, and more specifically, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), peptide nucleic acid (PNA), Any oligonucleotide and polynucleotide such as methyl phosphonate nucleic acid, S-oligo, cDNA and cRNA are included. These nucleic acids may be naturally occurring or artificially synthesized.

  The nucleic acid probe may be fixed by a known means. The nucleic acid probe may be fixed directly to the detection zone, or the nucleic acid probe may be fixed to the detection zone via a spacer. Alternatively, a nucleic acid probe solution prepared in advance may be added to the detection compartment and fixed. When the nucleic acid probe is immobilized on the electrode in the detection compartment, it is desirable to add a thiol group to the end of the nucleic acid probe. The nucleic acid probe is immobilized on the detection compartment by covalently bonding the thiol group to the electrode disposed in the detection compartment.

(Specific configuration)
Furthermore, the target nucleic acid detection substrate in the first embodiment will be described.

FIG. 2 is a cross-sectional view taken along line AA in FIG. Two or more types of nucleic acid probes are immobilized in the same detection section 3 in different amounts.

  The number of types of nucleic acid probes is not particularly limited, but is preferably 2 to 10 types, more preferably 2 to 5 types, and most preferably 2 to 3 types. In FIG. 2, for convenience of explanation, three different nucleic acid probes a, b, and c are fixed to the detection section 3 in different amounts. Here, “different amount” means that the fixed amounts of the nucleic acid probes a, b and c are different. When the amount of nucleic acid probes a, b and c immobilized differs, the amount of signal obtained from each nucleic acid probe differs. That is, the amount of signal increases as the amount of fixation increases, and the amount of signal decreases as the amount of fixation decreases. Therefore, by detecting the signal amount obtained from one detection section, it is possible to identify which of the nucleic acid probes a, b and c the signal amount is derived from. As a result, three types of target nucleic acids can be detected in one detection section.

  Similarly, if the three types of nucleic acid probes are immobilized in different amounts in the other detection sections, the target substrate can detect three times as many types of target nucleic acids as compared to the conventional case.

  More specifically, for example, in the case of a conventional substrate having 40 detection sections, it is necessary to use at least three substrates when detecting 120 types of target nucleic acids. However, if the substrate in the first embodiment, in particular, the substrate on which three types of nucleic acid probes are fixed for each detection section described above, one substrate with 40 detection sections is arranged with 120 types. The target nucleic acid can be detected simultaneously.

  The ratio of the fixed amount of the nucleic acid probe fixed in each detection section is not particularly limited, but it is necessary to be able to identify the presence or absence of each nucleic acid probe from the obtained signal amount. For example, by making a difference of 1.5 times or more, preferably 2 times or more, most preferably 3 times or more to the fixed amount of each nucleic acid probe, the presence or absence of each nucleic acid probe can be accurately determined from the obtained signal amount. Can be identified. Further, by suppressing the difference in the amount of fixation between the largest amount of nucleic acid probe and the smallest amount of nucleic acid probe to 100 times or less, preferably 20 times or less, most preferably 10 times or less, the smallest amount of fixation The smallest current value obtained from each of the nucleic acid probes can be reliably identified.

  In order to vary the amount of two or more types of nucleic acid probes contained in one detection zone, in the step of fixing each nucleic acid probe, mixed solutions containing each nucleic acid probe at different concentrations are prepared, and this is added to the detection zone. To fix the nucleic acid probe. For example, in order to achieve the binding state of FIG. 2, a mixed solution containing nucleic acid probes a, b and c at a concentration ratio of 3: 2: 1 is prepared and added to the detection compartment, thereby Probes a, b and c can be fixed in the detection compartment in a quantity ratio of 3: 2: 1.

(2) Target Nucleic Acid Detection Method in the First Embodiment Hereinafter, a target nucleic acid detection method using the target nucleic acid detection substrate in the first embodiment will be described.

  First, a nucleic acid sample solution containing a target nucleic acid is supplied onto the substrate. The target nucleic acid supplied on the substrate is hybridized with a nucleic acid probe immobilized in advance in each detection section, thereby forming a hybrid chain of the target nucleic acid and the nucleic acid probe. At this time, a signal derived from the hybrid chain is obtained. For example, in the case of detection by fluorescence, the target nucleic acid is previously labeled with a fluorescent substance. Since the target nucleic acid that has formed a hybrid chain with the nucleic acid probe remains in the detection compartment even after washing, fluorescence emission is obtained (hereinafter simply referred to as a signal from the nucleic acid probe). On the other hand, in the case of electrochemical detection, for example, by adding a molecule having electrochemical activity after hybridization, the molecule binds to the hybrid strand of each nucleic acid probe and the target nucleic acid, and a potential is applied. Causes a current derived from the molecule to flow to the electrode (hereinafter simply referred to as a signal from a nucleic acid probe). Furthermore, the presence or absence of the target nucleic acid corresponding to each nucleic acid probe can be identified from the obtained signal amount.

  The nucleic acid sample is collected from the test subject. For example, human blood is collected and subjected to necessary treatment to prepare a nucleic acid sample solution. The nucleic acid collected from the sample may be used as it is. However, the collected nucleic acid is subjected to treatment such as reverse transcription, extension, amplification and / or enzyme treatment as necessary, and is immobilized on the detection compartment. A sufficient amount of target nucleic acid is ensured relative to the amount of probe, and substances that adversely affect the reaction are decomposed and removed. Examples of the amplification include PCR, LAMP, ICAN and the like. It should be noted that the amount of each target nucleic acid contained in the nucleic acid sample solution needs to be sufficiently larger than the amount of the nucleic acid probe.

  At this time, the length of the target nucleic acid can be designed to an arbitrary length by appropriately designing the primer. Specifically, for example, the length may be set to about 10 to 1000 bp, preferably about 20 to 700 bp, and most preferably about 30 to 500 bp.

  The target nucleic acid may have an arbitrary structure such as a linear structure or a loop structure. By appropriately selecting the length and structure of the target nucleic acid, the efficiency of hybridization with the nucleic acid probe can be increased.

  After supplying the nucleic acid sample onto the substrate, the reaction conditions are adjusted so that appropriate hybridization is possible. Appropriate reaction conditions can be appropriately selected by those skilled in the art depending on various conditions such as the type of base contained in the base sequence of the target nucleic acid and the type of nucleic acid probe immobilized on the substrate.

  The hybridization reaction can be performed, for example, under the following conditions. For the hybridization reaction solution, a buffer solution having an ionic strength of 0.01 to 5 and a pH of 5 to 10 is used. To this solution, dextran sulfate, which is a hybridization accelerator, salmon sperm DNA, bovine thymus DNA, EDTA, and a surfactant may be added. A nucleic acid sample solution is added to this solution and heat-denatured at 90 ° C. or higher in advance. Immediately after denaturation of the nucleic acid or after rapid cooling, this solution is added to the target nucleic acid detection substrate.

  During the hybridization reaction, the reaction rate may be increased by an operation such as stirring or shaking. The hybridization reaction temperature and reaction time are appropriately selected. The hybridization step in the first embodiment may include a washing step. The detection accuracy can be improved by removing the hybridization solution after the hybridization step, washing the substrate as necessary, and newly adding a washing solution into the detection compartment for washing. As the washing solution, for example, a buffer solution having an ionic strength of 0.01 to 5 and a pH of 5 to 10 is used. Impurities are removed by the washing step, and only the target nucleic acid present in the nucleic acid sample is hybridized with the corresponding nucleic acid probe, and the formation of a hybrid chain between the target nucleic acid and the nucleic acid probe is maintained.

  In the case of detection by fluorescence, a nucleic acid sample is previously labeled with a fluorescent substance. For example, a target nucleic acid is PCR amplified using a primer labeled with a fluorescent substance. Alternatively, a second nucleic acid may be used to detect the target nucleic acid. Any known fluorescent material can be used, and for example, FITC, Cy3, Cy5, rhodamine or the like is used. Luminescence of the fluorescent material can be detected using a fluorescence detector. Since the obtained fluorescence emission amount correlates with the fixed amount of each nucleic acid probe, the presence or absence of the target nucleic acid corresponding to each nucleic acid probe can be identified from the obtained fluorescence emission amount.

  On the other hand, in the case of electrochemical detection, for example, a molecule having electrochemical activity is used. A molecule having electrochemical activity means a molecule that binds to a hybrid chain and emits electrons when a potential is applied. Any known molecule can be used, for example, Hoechst 33258 (registered trademark) (available from CALBIOCHEM), acridine orange, quinacrine, dounomycin, metallointercalator, bisacridine and the like. A bisintercalator, a tris intercalator, a polyintercalator, etc. are used. Particularly preferably, Hoechst 33258 is used. Hoechst 33258 is a molecule composed of the chemical substance p- (5- (5- (4-methylpiperazin-1-yl) benzimidazol-2-yl) benzimidazol-2-yl) phenol. Furthermore, these intercalators may be modified with an electrochemically active metal complex such as ferrocene (dicyclopentadienyl iron), viologen, or the like. The concentration of the molecule is appropriately selected, but is generally in the range of 1 ng / mL to 1000 ng / mL. At this time, a buffer solution having an ionic strength of 0.01 to 5 and a pH of 5 to 10 can be used.

  The molecule recognizes and intercalates with the hybrid chain. Here, when a potential is applied to the electrode, an oxidation-reduction reaction occurs, electrons are emitted from the intercalated molecules, and a current flows. At this time, the potential may be swept at a constant speed, applied with a pulse, or a constant potential may be applied. The potential sweep rate is in the range of 10 to 1000 mV / sec. In measurement, for example, the current and voltage may be controlled using a device such as a potentiostat, a digital multimeter, and a function generator. Since the current value derived from the molecule has a correlation with the fixed amount of the nucleic acid probe, the presence or absence of the target nucleic acid corresponding to each nucleic acid probe can be identified from the obtained current value.

FIG. 3 shows the amount of signal from the nucleic acid probe obtained when the substrate of the first embodiment is used. As described above, the amount of signal obtained corresponds to the amount of each nucleic acid probe immobilized in the detection compartment, and the amount of signal obtained increases as the amount of immobilization increases. In FIG. 3, for convenience of explanation, the signal amount from the nucleic acid probe a having the largest fixed amount is 1.0, the signal amount from the nucleic acid probe b having the second largest fixed amount is 0.6, and the signal amount from the nucleic acid probe c having the smallest fixed amount is shown. The amount of signal was 0.3.

  First, when there is no nucleic acid that hybridizes to the nucleic acid probes a, b, and c in the sample solution, no signal is detected.

  When one of the three types of target nucleic acid is present, the signal amount corresponding to each nucleic acid probe is detected. That is, when the target nucleic acid a is present, the signal amount is 1.0, when the target nucleic acid b is present, the signal amount is 0.6, and when the target nucleic acid c is present, the signal amount is 0.3.

  When two of the three types of target nucleic acids are present in the nucleic acid sample solution, the signal amount is approximately the same as the sum of the numerical values when any one of the above is present. That is, when the target nucleic acids a and b are present (a + b), the signal amount is 1.6, when the target nucleic acids b and c are present (b + c), the signal amount is 0.9, and when the target nucleic acids a and c are present (a + c) The signal amount is 1.3.

  Furthermore, when all three types of target nucleic acids are present in the nucleic acid sample solution, the signal amount is approximately the same as the sum of the numerical values when any one of the above is present. That is, when the target nucleic acids a, b and c are present (a + b + c), the signal amount is 1.9.

  Actually, when determining the presence or absence of each target nucleic acid contained in the nucleic acid sample to be examined, it is necessary to set a signal standard amount in advance. For setting the signal standard amount, a known nucleic acid sequence having a sequence complementary to each nucleic acid probe immobilized in the detection compartment is used. The amount of signal obtained from the detection section after supplying a nucleic acid sequence with a known sequence to the target nucleic acid detection substrate and performing hybridization is referred to as a “signal standard amount”. Obtain all signal standards in the presence of the target nucleic acid. Then, the target nucleic acid-signal standard correspondence table is completed by specifying these signal standard amounts and information on the presence or absence of the target nucleic acid corresponding to each signal standard amount.

  The first signal amount obtained from the detection section after the nucleic acid sample to be tested was supplied to the target nucleic acid detection substrate and hybridization was performed, and the signal standard shown in the “target nucleic acid-signal standard correspondence table”. The presence or absence of each target nucleic acid is determined by determining the signal standard amount that most closely approximates the first signal amount from among the signal standard amounts shown in the “target nucleic acid-signal standard correspondence table”. Can be determined.

(3) Modification of the first embodiment In order to increase the reliability of the test result, the type of the nucleic acid probe to be immobilized may be the same in a plurality of detection sections. For example, if there are three types of nucleic acid probes immobilized on the detection compartment and two detection compartments for immobilizing the same type of nucleic acid probe are provided, the entire substrate should be subjected to a double test for each target sequence. Therefore, a large number of target nucleic acids can be detected simultaneously and accurately.

  In this case, the determination step is a double determination test. That is, each of the two detection sections (hereinafter referred to as the first detection section and the second detection section) is compared with the signal standard amount shown in the “target nucleic acid-signal standard correspondence table”, and is most approximated. Determine the standard amount of signal to perform. If the signal standard amounts determined in the first and second detection compartments are the same, the results can be evaluated as very reliable. If the signal standard amounts determined in the first and second detection sections are different, it can be determined that the result is likely to be a false positive.

  Further, in order to further increase the accuracy of the double test, each amount of the nucleic acid probe may be different for each detection section. For example, when preparing two detection sections to which the nucleic acid probes a, b and c of FIG. 2 are fixed, the fixed amount ratio of the first detection section and the fixed amount ratio of the second detection section are made different. For example, the immobilization ratio of the nucleic acid probes a, b, and c immobilized on the first detection section is adjusted to 1: 3: 10, and the nucleic acid probes a, b, and c immobilized on the second detection section are immobilized. Conversely, the volume ratio is adjusted to 10: 3: 1.

  In this case, since the information obtained from each signal standard amount is different, the first “target nucleic acid-signal standard correspondence table” corresponding to the first detection section and the second “target” corresponding to the second detection section Each "Nucleic acid-signal standard correspondence table" must be prepared separately. Then, the signal standard amount closest to the signal amount obtained in the first and second detection sections is determined using the first and second “target nucleic acid-signal standard correspondence tables”, respectively, and each detection section is determined. The presence or absence of the target nucleic acid is determined every time. If the determination results are the same, the results can be evaluated as extremely reliable, and if the determination results are different, it can be determined that the possibility of false positive is high.

  Substrates having different immobilization ratios of nucleic acid probes in the first and second detection sections further increase the reliability of test results as compared to substrates having the same immobilization ratio. Therefore, if the nucleic acid sample to be tested contains many polymorphic sequences, or if the sequence homology between each nucleic acid probe immobilized in the detection compartment is high, a test that is highly likely to yield a false positive result In this case, it is possible to take re-tests and review the design of the nucleic acid probe without overlooking the false positive results, and it is extremely effective in the medical field where the reliability of the test results is strongly required. To do.

  Of course, three or more detection sections for fixing the same type of nucleic acid probe are provided, and for example, a substrate corresponding to a triple test or a quadruple test can be used.

  In addition, although deviating from the first embodiment, when it is sufficient to simply detect the presence or absence of a certain target nucleic acid, two or more types of nucleic acid probes may be immobilized in the same compartment in the same amount. “Similar amount” means that the target nucleic acid cannot be distinguished from the resulting signal. Even in this case, it is possible to determine whether there is at least one target nucleic acid corresponding to each nucleic acid probe from the presence or absence of a signal.

2. Second Embodiment (1) Target Nucleic Acid Detection Substrate Hereinafter, a target nucleic acid detection substrate in a second embodiment and a target nucleic acid detection method using the substrate will be described. Its basic configuration and operational effects are the same as those of the target nucleic acid detection substrate in the first embodiment, and only the differences from the first embodiment will be described. Each member, substance, reaction solution, and the like used in the second embodiment are as described in the first embodiment unless otherwise specified.

FIG. 4 is a schematic diagram showing a fixed state of the nucleic acid probe in the second embodiment, and is a cross-sectional view taken along line AA in FIG. Two or more kinds of nucleic acid probes showing different Tm values are fixed in the detection section.

  The number of types of nucleic acid probes is not particularly limited, but is preferably 2 to 10 types, more preferably 2 to 5 types, and most preferably 2 to 3 types. In FIG. 4, for convenience of explanation, three types of nucleic acid probes a, b, and c are fixed to the detection section 3. Unlike the first embodiment, the amount of each nucleic acid probe immobilized is approximately equal.

  The nucleic acid probes a, b and c each have a different Tm value. “Different” Tm values mean Tm values that can distinguish the hybridization of a target nucleic acid to each nucleic acid probe by adjusting the reaction temperature.

  The Tm value is an index of stability of a double-stranded nucleic acid, and is a temperature at which 50% of all hybridized double strands dissociate at a certain double-stranded nucleic acid concentration and a certain ionic strength. The Tm value is calculated by, for example, the Nearest Neighbor method, Wallace method, GC% method, or the like. A person skilled in the art can freely design a nucleic acid probe having an arbitrary Tm value by using known technical means. The Tm value varies depending on various conditions such as the length of the nucleic acid sequence to be hybridized, the GC content, and the reaction solution composition. In particular, the point that the nucleic acid probe of the present invention is immobilized in the detection compartment is greatly different from the calculation condition of the Tm value in which the nucleic acid is in a floating state in a solution. Therefore, the Tm value does not indicate the dissociation temperature, but is only an index indicating the relative stability of a plurality of different double-stranded nucleic acids.

  Since the Tm values of the nucleic acid probes a, b and c are different from each other, the hybridization reaction and / or washing between each nucleic acid probe and the target nucleic acid is performed at different reaction temperatures, and the signal amount at each reaction temperature is combined, The presence or absence of the target nucleic acid corresponding to each nucleic acid probe can be identified. Similar to the substrate in the first embodiment, since a plurality of target nucleic acids can be identified in one detection section, the entire substrate can detect more target nucleic acids than the conventional substrate.

  More specifically, in the case of a conventional substrate having 40 detection sections, it is necessary to use at least three substrates when detecting 120 types of target nucleic acids. However, if the substrate in the second embodiment, particularly the substrate on which three types of nucleic acid probes are immobilized in each detection section described above, the detection reaction is performed at a reaction temperature corresponding to the Tm value of each nucleic acid probe. By performing the process once, 120 types of target nucleic acids can be detected simultaneously with one substrate having 40 detection sections.

  In the second embodiment, since it is necessary to perform the reaction multiple times at different reaction temperatures, the target nucleic acid can be detected compared to the first embodiment in which the target nucleic acid can be detected by a single reaction. Although time is required, the detection sensitivity is high and useful.

(2) Target Nucleic Acid Detection Method in Second Embodiment Hereinafter, a target nucleic acid detection method using the target nucleic acid detection substrate in the second embodiment will be described. The basic method is the same as the target nucleic acid detection method in the first embodiment, and only the parts different from the first embodiment will be described.

  First, a nucleic acid sample is supplied to the substrate (supplying step). The target nucleic acid in the nucleic acid sample supplied to the substrate is hybridized to a plurality of types of nucleic acid probes immobilized in advance in each detection zone at a first temperature to form a hybrid chain of the target nucleic acid and the nucleic acid probe. (First reaction step).

  Here, the first temperature is a temperature at which all of the plurality of types of nucleic acid probes can maintain the formation of a hybrid chain with the target nucleic acid. The first temperature can be determined through an experimental verification operation based on the Tm value of each nucleic acid probe. As described above, the Tm value is merely an index indicating the relative stability of a plurality of different double-stranded nucleic acids, and the first temperature cannot be uniquely determined from the Tm value. However, the Tm value of each nucleic acid probe clearly indicates the relative ability to maintain hybridization of each nucleic acid probe, and those skilled in the art will use this Tm value as an index to determine the first temperature through the verification work by experiment. Can be easily determined.

  The first reaction step means a hybridization step and / or a washing step. When performing the hybridization step, the detection compartment may be left at the first temperature.

On the other hand, when the washing process is performed, the first reaction process includes a hybridization process and a washing process. That is, first, the hybridization step is performed at a temperature (temperature T ₀ ) at which all target nucleic acids contained in the nucleic acid sample added in the supplying step can hybridize with the corresponding nucleic acid probe. Thereafter, the hybridization solution in the detection compartment is removed, and a washing solution is newly added to the detection compartment while shaking the substrate as necessary at a first temperature, thereby free impurities. Is removed from within the detection compartment. Although the temperature T ₀ and the first temperature are both temperatures capable of maintaining all the hybrid chains, the reaction solution composition is different between the hybridization step and the washing step, and therefore the temperatures are different.

  Since all target nucleic acids are bound to the nucleic acid probe at the first temperature, the first washing step is performed mainly to remove unbound target nucleic acid and other impurities due to overdose. It is. Impurities are mainly non-nucleic acid substances and nucleic acid debris that are not involved in the reaction. When the washing step is performed in the first reaction step, an excessive amount of target nucleic acid and impurities that are not involved in the reaction can be removed in advance, so that false binding or the like can be prevented and the accuracy of each subsequent detection step can be improved.

  Next, the amount of signal obtained in the first reaction step is detected (first detection step). Since the first reaction step is performed at the first temperature, all of the target nucleic acids corresponding to each nucleic acid probe can maintain a hybrid chain with each nucleic acid probe. Therefore, when all kinds of target nucleic acids corresponding to each nucleic acid probe are contained in the nucleic acid sample, signals are obtained from all the nucleic acid probes. On the other hand, when signals are not obtained from all the nucleic acid probes, it can be seen that at least one type of target nucleic acid among the target nucleic acids corresponding to each nucleic acid probe is not contained in the nucleic acid sample. Since the signal is obtained as the sum of the signal amounts from the respective nucleic acid probes, the target nucleic acid that is not contained in the nucleic acid sample cannot be specified in the first detection step.

  Subsequently, the reaction is performed at the second temperature (second reaction step). Here, the second temperature is a temperature at which one specific type of nucleic acid probe dissociates the target nucleic acid among the plurality of types of nucleic acid probes. Similar to the first temperature, the second temperature can also be easily determined by those skilled in the art through an experimental verification operation based on the Tm value of each nucleic acid probe. The second reaction step means a hybridization step and / or a washing step. When performing the hybridization step, the detection compartment may be left at the second temperature. On the other hand, when performing the washing step, the hybridization solution in the detection compartment is removed, and the washing solution is newly added to the detection compartment while shaking the substrate as necessary at the second temperature. The target nucleic acid in a free state is removed from the detection compartment. In the washing step, the target nucleic acid in a free state is removed from the detection compartment, and the possibility of false binding is reduced.

  Then, the signal amount obtained in the second reaction step is detected (second detection step). Since the second reaction step is performed at the second temperature, it becomes impossible to maintain a hybrid chain with the target nucleic acid in one specific type of nucleic acid probe among the plurality of types of nucleic acid probes. Dissociate from the nucleic acid probe. As a result, no signal is detected from this nucleic acid probe.

  When three or more types of nucleic acid probes are immobilized in one region of each detection section, the second reaction step and the second detection step are repeated (hereinafter, the nth reaction step and the nth detection step ( Where n is a natural number). At this time, although the nth reaction step performs the reaction at the nth temperature, the nth temperature is higher than the (n-1) th temperature. This is because, like the second temperature, the nth temperature is also a temperature at which one specific type of nucleic acid probe dissociates the target nucleic acid among the plurality of types of nucleic acid probes. This is because the probe needs to be one of the nucleic acid probes that maintain the formation of the hybrid chain in the (n-1) th reaction step.

  When n types of nucleic acid probes are immobilized in one region of each detection section, it is necessary to perform the first to nth reaction steps and the first to nth detection steps. In the n-th reaction step at the n-th temperature, only the nucleic acid probe exhibiting the highest Tm value can maintain the formation of a hybrid chain with the target nucleic acid. It is not necessary to perform the (n + 1) th reaction step at the (n + 1) th temperature at which the nucleic acid probe exhibiting the highest Tm value cancels the formation of the hybrid strand with the target nucleic acid. However, the (n + 1) th reaction step and the (n + 1) th detection step may be performed to dissociate all the target nucleic acids and finally confirm that no signal is detected.

  Each time the reaction process and detection process proceed, the target nucleic acid dissociates from the nucleic acid probe that exhibits the lowest Tm value among the nucleic acid probes that maintain the formation of hybrid strands at each time point. The presence or absence of the target nucleic acid corresponding to each nucleic acid probe can be determined by combining the signal amounts obtained in the detection steps at each stage (determination step).

  Hereinafter, in order to clarify the second embodiment, a description will be given with reference to FIG.

FIG. 5 shows the amount of signal obtained at each reaction temperature in the second embodiment. A signal is obtained when a target nucleic acid corresponding to each nucleic acid probe exists and a hybrid chain between the nucleic acid probe and the target nucleic acid is formed. In FIG. 5, for convenience of explanation, the nucleic acid probe showing the highest Tm value is designated as the nucleic acid probe c, the nucleic acid probe showing the second highest Tm value as the nucleic acid probe b, and the nucleic acid probe showing the lowest Tm value as the nucleic acid probe a. .

  Since the nucleic acid probe a has the lowest Tm value, the target nucleic acid corresponding to the nucleic acid probe a is dissociated from the nucleic acid probe at the second and third reaction temperatures that are higher than the first reaction temperature. As a result, a signal is detected only at the first reaction temperature (a in FIG. 5). Since the target nucleic acid corresponding to the nucleic acid probe b is dissociated from the nucleic acid probe only at the highest third reaction temperature, a signal is detected at the first and second reaction temperatures (b in FIG. 5). The target nucleic acid corresponding to the nucleic acid probe c having the highest Tm value can maintain the formation of the hybrid chain at all the first to third reaction temperatures, and as a result, the signal at all the first to third reaction temperatures. Is detected (c in FIG. 5).

  When two types of the three types of target nucleic acids are present, it is approximately the same as the sum of the signal amounts of the respective target nucleic acids. For example, target nucleic acids corresponding to the nucleic acid probes a and b (hereinafter referred to as target nucleic acid a and target nucleic acid b) form a hybrid chain with the nucleic acid probe together with the target nucleic acid a and the target nucleic acid b at the first reaction temperature. Since a signal is obtained from each hybrid chain, the signal amount approximates the sum of the target nucleic acid a and the target nucleic acid b. However, at the second reaction temperature, the target nucleic acid a is dissociated from the nucleic acid probe a, and only the signal of the target nucleic acid b is detected. At the third reaction temperature, both the target nucleic acid a and the target nucleic acid b are dissociated from the nucleic acid probe, and no signal is detected (a + b in FIG. 5).

  Similarly, when target nucleic acids corresponding to the nucleic acid probes b and c are present (b + c in FIG. 5), and when target nucleic acids corresponding to the nucleic acid probes a and c are present (a + c in FIG. 5), they are shown in FIG. Signal is obtained.

  Finally, when there are three types of target nucleic acids a, b, and c, at the first reaction temperature, the target nucleic acid a, the target nucleic acid b, and the target nucleic acid c form a hybrid chain, and the signal amount is It approximates the sum of a, target nucleic acid b and target nucleic acid c. At the second reaction temperature, the target nucleic acid a is dissociated from the nucleic acid probe a, and a signal approximate to the sum of the target nucleic acid b and the target nucleic acid c is obtained. At the third reaction temperature, the target nucleic acid b is also dissociated from the nucleic acid probe b, and only the target nucleic acid c maintains a hybrid chain with the nucleic acid probe c, so that a signal of only the target nucleic acid c is obtained (FIG. 5). A + b + c).

  Actually, when determining the presence or absence of each target nucleic acid contained in the nucleic acid sample to be examined, it is necessary to prepare a “target nucleic acid-signal standard correspondence table” in advance. In the second embodiment, since it is necessary to carry out a plurality of detection reactions at different reaction temperatures, it is necessary to prepare a “target nucleic acid-signal standard correspondence table” at each reaction temperature separately. In the “target nucleic acid-signal standard correspondence table”, as shown in FIG. 5, a signal standard amount at each reaction temperature and information on the presence or absence of a target nucleic acid corresponding to each signal standard amount are specified.

  For example, when the “target nucleic acid-signal standard correspondence table” as shown in FIG. 5 is used, when a signal amount of 2.1 is obtained at the first reaction temperature, from the closest signal standard amount 2.0, It can be determined that the target nucleic acid is any of the target nucleic acids a + b, b + c or a + c. Next, when a signal amount of 0.9 is obtained at the second reaction temperature, the target nucleic acid in the nucleic acid sample is determined to be the target nucleic acid a + b or the target standard amount 1.0 from the closest signal standard and the determination result at the first reaction temperature. It can be determined that either a + c. Finally, when a signal amount of 0.8 is obtained at the third reaction temperature, the target nucleic acid in the nucleic acid sample is determined from the most approximate signal standard amount 1.0 and the determination results at the first and second reaction temperatures. The target nucleic acid a + c can be uniquely determined.

(3) Modified example of the second embodiment As in the first embodiment, in order to increase the reliability of the test result, the type of the nucleic acid probe to be fixed may be the same in a plurality of detection sections. In order to further increase the accuracy of the double test, each Tm value of the nucleic acid probe may be different for each detection section. For example, when preparing two detection sections to which the nucleic acid probes a, b and c in FIG. 2 are fixed, the Tm value of the first detection section and the Tm value of the second detection section are made different. For example, the Tm values of the nucleic acid probes a, b and c immobilized on the first detection compartment are adjusted to 60 ° C., 50 ° C. and 40 ° C., respectively, and the nucleic acid probes a, b immobilized on the second detection compartment The Tm values of c and c are adjusted to 40 ° C, 50 ° C and 60 ° C. The double test in the first and second detection sections having different Tm values further increases the reliability of the detection result, and an extremely accurate detection result can be obtained.

  In this case, since the information obtained from each signal standard amount is different, the first “target nucleic acid-signal standard correspondence table” corresponding to the first detection section and the second “target” corresponding to the second detection section It is necessary to prepare “Nucleic acid-signal standard correspondence table” separately. As described above, the first and second “target nucleic acid-signal standard correspondence tables” clearly indicate the signal standard amount at each reaction temperature and the presence or absence of the target nucleic acid corresponding to each signal standard amount. Has been. Then, the presence or absence of the target nucleic acid is determined for each detection section, and if the determination results are the same, the results can be evaluated as extremely reliable, and if the determination results are different, false positive It is possible to determine that there is a high possibility.

  Therefore, if the nucleic acid sample to be tested contains many polymorphic sequences, or if the sequence homology between each nucleic acid probe immobilized in the detection compartment is high, a test that is highly likely to yield a false positive result In this case, it is possible to take re-tests and review the design of the nucleic acid probe without overlooking the false positive results, and it is extremely effective in the medical field where the reliability of the test results is strongly required. To do.

  Of course, three or more detection sections for fixing the same type of nucleic acid probe are provided, and for example, a substrate corresponding to a triple test or a quadruple test can be used.

Example 1 (first embodiment)
Hereinafter, an example in which three types of target nucleic acids are detected in the first embodiment will be described. As the target nucleic acid detection substrate, a substrate in which an electrode is arranged in each detection section was used, and the target nucleic acid was detected electrochemically.

<Nucleic acid sample>
The following target nucleic acids 1 to 3 were prepared as nucleic acid samples.

Target nucleic acid 1 (5 '→ 3')
TCTGATGCCCAAATATTCAATAAACCTTATTGGT
Target nucleic acid 2 (5 '→ 3')
TCCCAATTATTTAATAAACCGTACTGGTTACAA
Target nucleic acid 3 (5 '→ 3')
TGCCCAGGTACAGGAGACTGTGTAGAAGCA
First, nucleic acid samples 1 to 7 were prepared. Nucleic acid sample 1 is a nucleic acid sample containing target nucleic acid 1, nucleic acid sample 2 is a nucleic acid sample containing target nucleic acid 2, nucleic acid sample 3 is a nucleic acid sample containing target nucleic acid 3, nucleic acid sample 4 is a target nucleic acid 1 and 2 is a nucleic acid sample containing target nucleic acids 1 and 3, nucleic acid sample 6 is a nucleic acid sample containing target nucleic acids 2 and 3, and nucleic acid sample 7 is a target nucleic acid 1, 2 and 3 is a nucleic acid sample. As a control, a nucleic acid sample 8 containing no target nucleic acid was prepared.

<Nucleic acid probe>
The following nucleic acid probes were prepared as nucleic acid probes.

Nucleic acid probe 1 (5 '→ 3')
ACCAATAAGGTTTATTGAATATTTGGGCATCAGA (Tm value: 71.5 ℃)
Nucleic acid probe 2 (5 '→ 3')
TTGTAACCAGTACGGTTTATTAAATAATTGGGA (Tm value: 68.0 ℃)
Nucleic acid probe 3 (5 '→ 3')
TGCTTCTACACAGTCTCCTGTACCTGGGCA (Tm value: 75.6 ℃)
The nucleic acid probes 1, 2 and 3 have complementary sequences to the target nucleic acids 1, 2 and 3, respectively. Nucleic acid probes 1, 2, and 3 were set so that the Tm values were comparable, and the influence of the reaction temperature on the detection result was excluded. The Tm value of the nucleic acid probe was calculated by the Nearest Neighbor method using values of 50 mM Na ⁺ concentration (Na ⁺ = 50 × 10 ⁻³ ) and 0.5 μM oligonucleotide concentration (Ct = 0.5 × 10 ⁻⁶ ). .

  Nucleic acid probes 1, 2, and 3 were blended at a ratio of 1: 3: 9, respectively, to prepare a nucleic acid probe mixed solution. The mixed solution was added to a single electrode arranged in the detection compartment, thereby producing one detection compartment in which the nucleic acid probes 1, 2 and 3 were fixed at a fixed amount ratio of 1: 3: 9, respectively.

<Detection of target nucleic acid>
Each nucleic acid sample was added to the detection compartment, and hybridization was performed at 50 ° C. for 20 minutes. Thereafter, a washing step was performed at 30 ° C. for 20 minutes. Since the Tm value is a relative index, there is no problem that it differs from the actual temperature condition.

  After washing, Hoechst 33258 was added to the detection compartment, and the potential was swept to the electrode arranged in the detection compartment. Hoechst 33258 recognizes the hybrid strand of the nucleic acid probe fixed to the detection compartment and the target nucleic acid, and is inserted into the hybrid strand. When the potential is swept across the electrode, a current flows due to the redox reaction of Hoechst 33258 inserted into the hybrid chain. This current can be detected as a current value (nA).

<Experimental result>
The results are shown in Table 1 below.

  Similarly, the results are shown as a bar graph in FIG.

  When nucleic acid sample 8 (Negative control) containing no target nucleic acid was added, no current value was detected.

  When nucleic acid samples 1, 2, and 3 each containing target nucleic acids 1, 2, and 3 were added, current values of 6.1 nA, 28.2 nA, and 41.5 nA were detected, respectively. As a result, the target nucleic acid binds to the nucleic acid probe immobilized in different amounts in the single detection section, and a current value depending on the fixed amount ratio is obtained. In the single detection section, three types of different target nucleic acids are obtained. Means that it could be identified. Similarly, the electric current value at the time of adding the nucleic acid samples 4-7 containing several target nucleic acids among the target nucleic acids 1, 2, or 3 was detected. A current value of 34.3 nA is obtained when nucleic acid sample 4 is added, 45.9 nA when nucleic acid sample 5 is added, 71.7 nA when nucleic acid sample 6 is added, and 77.9 nA when nucleic acid sample 7 is added. It was. Each current value was a numerical value approximately the same as the sum of the current values obtained from each target nucleic acid. This result means that even when a plurality of target nucleic acids are present among the target nucleic acids 1, 2 or 3, they can be identified.

  From the above results, it was possible to quickly and accurately identify a plurality of target nucleic acids in the same detection section by using a substrate on which nucleic acid probes having different sequences in the same detection section were immobilized at different concentrations.

Example 2 (second embodiment)
Hereinafter, an example in which two types of target nucleic acids are detected in the second embodiment will be described. As the target nucleic acid detection substrate, a substrate in which an electrode is arranged in each detection section was used, and the target nucleic acid was detected electrochemically.

<Nucleic acid sample>
The following target nucleic acids 1 and 2 were prepared as nucleic acid samples.

Target nucleic acid 1 (5 '→ 3')
TACCACATCATC C ATATAACTGAAAGC
Target nucleic acid 2 (5 '→ 3')
TACCACATCATC T ATATAACTGAAAGC
Target nucleic acids 1 and 2 differ only in the 13th base from the 5 ′ end side (target nucleic acid 1 is C, target nucleic acid 2 is T, and underlined), and other base sequences are completely identical. . Such target nucleic acids 1 and 2 are the most difficult combination to distinguish.

  A nucleic acid sample containing the target nucleic acid 1, a nucleic acid sample containing the target nucleic acid 2, and a nucleic acid sample containing the target nucleic acids 1 and 2 were prepared. As a control, a nucleic acid sample not containing the target nucleic acid was prepared.

<Nucleic acid probe>
The following nucleic acid probes were prepared as nucleic acid probes.

Nucleic acid probe 1 (5 '→ 3')
GCTTTCAGTTATAT G GATGATGTGGTA (Tm value: 64.6 ℃)
Nucleic acid probe 2 (5 '→ 3')
AGTTATAT A GATGAT (Tm value: 49.0 ℃)
Nucleic acid probes 1 and 2 are complementary to target nucleic acids 1 and 2, respectively. Bases corresponding to the different base sequences are underlined. Also, the probe length of the nucleic acid probe 2 is set to be short so that the nucleic acid probes 1 and 2 show different Tm values, and the Tm value (49.0 ° C.) of the nucleic acid probe 2 is calculated from the Tm value (64.6 ° C.) of the nucleic acid probe 1 Was set too low. The Tm values of the nucleic acid probes 1 and 2 are 50 mM Na ⁺ concentration (Na ⁺ = 50 × 10 ⁻³ ) and 0.5 μM oligonucleotide concentration (Ct = 0.5 × 10 ⁻⁶ ) by Nearest Neighbor method. Calculated.

  A detection solution in which nucleic acid probes 1 and 2 are immobilized is prepared by preparing a mixed solution containing equal amounts of nucleic acid probes 1 and 2 and adding the mixed solution to a single electrode disposed in the detection compartment. Was made.

<Reaction under reaction conditions 1 and 2>
The nucleic acid sample was added to the detection compartment, and hybridization was performed at 50 ° C. for 20 minutes. Thereafter, under reaction condition 1, the washing step was performed at 30 ° C. for 20 minutes, and under reaction condition 2, the washing step was carried out at 40 ° C. for 20 minutes. Each reaction condition is shown below.

[Reaction condition 1]
Hybridization: 20 minutes at 50 ° C Washing: 20 minutes at 30 ° C [Reaction condition 2]
Hybridization: 20 minutes at 50 ° C. Washing: 20 minutes at 40 ° C. In Example 2, each washing step is performed independently under reaction conditions 1 and 2. When the washing step is performed independently, the second washing step is also performed after the hybridization as in the first washing step. Therefore, in the step of performing the second washing step, a false bond or the like is included in the reaction solution. Contains a large amount of impurities that may cause Therefore, it is necessary to consider the possibility of false bonding after the second washing step. On the other hand, when the cleaning process is performed continuously, the second cleaning process is performed after the first cleaning process. Therefore, in the stage of performing the second cleaning process, there is a possibility of causing a false bond or the like. Some impurities are removed from the reaction solution. Therefore, compared with the case where the washing process is performed independently, it is less necessary to consider the possibility of false bonding after the second washing process. In other words, it is expected that the mode in which the cleaning process is performed independently is a severe condition in the second embodiment. The reason why Example 2 was performed under such severe conditions is to strictly evaluate the feasibility of the present invention. That is, if the presence or absence of the target nucleic acids 1 and 2 which are the most difficult combinations described above can be identified in an independent washing step, the feasibility of the second embodiment has been sufficiently proved. Become.

  The hybridization temperature is higher than the washing temperature because the concentration of the nucleic acid sample solution and the composition of the reaction solution are different. At the hybridization temperature, all target nucleic acids in the nucleic acid sample are transferred to the nucleic acid probe. It can hybridize. Moreover, since the Tm value is a relative index, there is no problem that it differs from the actual temperature condition.

  After washing, Hoechst 33258 was added to the detection compartment, and the potential was swept to the electrode arranged in the detection compartment. Hoechst 33258 recognizes the hybrid strand of the nucleic acid probe fixed to the detection compartment and the target nucleic acid, and is inserted into the hybrid strand. When the potential is swept across the electrode, a current flows due to the redox reaction of Hoechst 33258 inserted into the hybrid chain. This current can be detected as a current value increase (nA).

<Experimental result>
The amount of increase in current value when each target nucleic acid is reacted is shown in Table 2 below. The amount of increase in current value means the difference between the obtained current value and the background current value.

  Similarly, the results are shown as a bar graph in FIG.

  When a nucleic acid sample not containing the target nucleic acid (control) was added, no increase in current value was detected in either reaction condition 1 or 2.

  When a nucleic acid sample containing the target nucleic acid 1 was added, a current value increase of 17.0 nA was detected under reaction conditions 1 and 2. This result means that the hybrid chain between the nucleic acid probe 1 having a high Tm value and the target nucleic acid 1 was maintained under any reaction conditions.

  When a nucleic acid sample containing the target nucleic acid 2 was added, an increase in current value of 16.5 nA was detected under reaction condition 1, but was hardly detected under reaction condition 2. This result means that the target nucleic acid 2 was dissociated from the nucleic acid probe 2 having a low Tm value under the higher temperature reaction condition 2.

  When a nucleic acid sample containing target nucleic acids 1 and 2 was added, an increase in current value of 26.3 nA was detected under reaction condition 1, and an increase in current value of 18.8 nA was detected under reaction condition 2. This result means that, under the reaction condition 1, both the target nucleic acids 1 and 2 maintain a hybrid chain with the nucleic acid probe, and a current value close to the sum of the current values of the target nucleic acids 1 and 2 is detected. . Moreover, under the reaction condition 2, it means that the target nucleic acid 2 is dissociated from the nucleic acid probe 2 having a low Tm value, and the current value derived from the target nucleic acid 2 is hardly obtained.

  From the above results, the presence / absence of the target nucleic acids 1 and 2 present in the nucleic acid sample could be quickly and accurately identified by combining the current values of the reaction conditions 1 and 2.

The target nucleic acid detection substrate in the first and second embodiments. Sectional drawing along line AA of FIG. 1 in 1st Embodiment. The schematic diagram showing the signal amount in 1st Embodiment. Sectional drawing along line AA of FIG. 1 in 2nd Embodiment. The schematic diagram showing the signal amount in 2nd Embodiment. The bar graph which shows the result of the electric current value in 1st Embodiment. The bar graph which shows the result of the electric current value in 2nd Embodiment.

Explanation of symbols

DESCRIPTION OF SYMBOLS 1 ... Base for target nucleic acid detection, 2 ... Base, 3 ... Detection section, electrode, 4 ... Pad, a ... Nucleic acid probe a, b ... Nucleic acid probe b, c ... -Nucleic acid probe c.

Claims (20)

A substrate, a plurality of nucleic acid probes complementary to a plurality of different target nucleic acids, and a detection section provided on the substrate, wherein the plurality of nucleic acid probes are fixed in different fixed amounts in the same region, Supplying a nucleic acid sample to a target nucleic acid detection substrate provided;
A hybridization step of hybridizing the nucleic acid sample to the nucleic acid probe to obtain a hybrid chain;
A detection step of detecting a signal amount derived from the hybrid chain from the detection compartment;
And a determination step of determining the presence or absence of the target nucleic acid contained in the nucleic acid sample from the signal amount.   The determination step was obtained from the detection section after performing hybridization by supplying a known nucleic acid sample having a sequence complementary to the signal amount and the plurality of nucleic acid probes to the target nucleic acid detection substrate. The detection method according to claim 1, wherein the detection method is performed by comparing the signal standard amount. The detection step includes
Attaching a molecule having electrochemical activity to the hybrid chain;
The method according to claim 1, further comprising: applying a potential to an electrode provided in the detection section to detect a current derived from the molecule. The target nucleic acid detection substrate comprises a plurality of the detection sections, and the same kind of nucleic acid probes are fixed to the plurality of detection sections,
The detection step detects the signal amount from each of the plurality of detection sections,
The detection method according to claim 1, wherein the determination step determines from a plurality of signal amounts obtained from the plurality of detection sections.   The detection method according to claim 4, wherein the amount of each of the plurality of nucleic acid probes fixed to the plurality of detection sections is different for each detection section. A substrate, a plurality of types of nucleic acid probes that are complementary to different target nucleic acids and exhibit different Tm values, and a detection section provided on the substrate and having the plurality of types of nucleic acid probes fixed in the same region Supplying a nucleic acid sample to a target nucleic acid detection substrate comprising:
A temperature at which all types of nucleic acid probes of the plurality of types of nucleic acid probes maintain hybrid chain formation with the target nucleic acid, and each of the plurality of types of nucleic acid probes dissociates the target nucleic acid. A reaction step of reacting the nucleic acid sample with the target nucleic acid detection substrate at a temperature;
A detection step of detecting a signal amount obtained in each reaction step at the plurality of temperatures;
And a determination step of determining the presence or absence of the target nucleic acid contained in the nucleic acid sample from the signal amount obtained in the detection step. A first nucleic acid probe capable of forming a hybrid strand with a substrate, a first target nucleic acid, a second nucleic acid capable of forming a hybrid strand, and a Tm value different from that of the first nucleic acid probe. A supply step of supplying a nucleic acid sample to a target nucleic acid detection substrate comprising two nucleic acid probes and a detection section provided on the substrate and having the first and second nucleic acid probes fixed in the same region;
A hybridization step of hybridizing at a temperature T ₀ to hybridize the first target nucleic acid to the first nucleic acid probe and to hybridize the second target nucleic acid to the second nucleic acid probe;
The detection zone at a first temperature that maintains the formation of a hybrid strand of the first target nucleic acid and the first nucleic acid probe and maintains the formation of a hybrid strand of the second target nucleic acid and the second nucleic acid probe A first cleaning step for cleaning
A first detection step for detecting a signal amount obtained from the detection section after the first washing step;
Washing the detection compartment at a second temperature that maintains the formation of a hybrid strand of the first target nucleic acid and the first nucleic acid probe and dissociates the second target nucleic acid from the second nucleic acid probe; A cleaning process;
From the second detection step for detecting the signal amount obtained from the detection section after the second washing step, the signal amount obtained in the first detection step, and the signal amount obtained in the second detection step, the nucleic acid sample And a determination step of determining the presence or absence of the target nucleic acid contained in the target nucleic acid. A first nucleic acid probe capable of forming a hybrid strand with a substrate, a first target nucleic acid, a second nucleic acid capable of forming a hybrid strand, and a Tm value different from that of the first nucleic acid probe. A supply step of supplying a nucleic acid sample to a target nucleic acid detection substrate comprising two nucleic acid probes and a detection section provided on the substrate and having the first and second nucleic acid probes fixed in the same region;
A first hybridization step of hybridizing at a first temperature to hybridize a first target nucleic acid to a first nucleic acid probe and to hybridize a second target nucleic acid to a second nucleic acid probe;
A first detection step of detecting a signal amount obtained from the detection section after the first hybridization step;
Second hybridization for maintaining hybridization at a second temperature that maintains the formation of a hybrid strand between the first target nucleic acid and the first nucleic acid probe and dissociates the second target nucleic acid from the second nucleic acid probe. Process,
A second detection step of detecting a signal amount obtained from the detection section after the second hybridization step;
A determination step of determining the presence or absence of a target nucleic acid contained in the nucleic acid sample from the signal amount obtained in the first detection step and the signal amount obtained in the second detection step. Detection method.   In the determination step, a known nucleic acid sample having a sequence complementary to each of the signal amounts obtained in the first and second detection steps and the first and / or second nucleic acid probe is used as the target nucleic acid. 8. The method according to claim 7, wherein the detection is performed by comparing the signal standard amount obtained from the detection section after being supplied to the detection substrate and performing hybridization or washing at the first and second temperatures. 9. The detection method according to 8. The detection step includes
Attaching a molecule having electrochemical activity to the hybrid chain;
The detection method according to any one of claims 6 to 8, wherein a potential is applied to an electrode provided in the detection section and a current derived from the molecule is detected. The target nucleic acid detection substrate comprises a plurality of the detection sections, and the same kind of nucleic acid probes are fixed to the plurality of detection sections,
The detection step detects the signal amount from each of the plurality of detection sections,
The detection method according to any one of claims 6 to 8, wherein the determination step is performed based on a plurality of signal amounts obtained from the plurality of detection sections.   The detection method according to claim 11, wherein each Tm value of the plurality of nucleic acid probes fixed to the detection section is different for each detection section.   A substrate, a plurality of nucleic acid probes complementary to a plurality of different target nucleic acids, and a detection section provided on the substrate, wherein the plurality of nucleic acid probes are fixed in different fixed amounts in the same region, A target nucleic acid detection substrate provided.   14. A substrate according to claim 13, wherein the detection compartment comprises an electrode for electrochemical detection.   14. The substrate according to claim 13, wherein the target nucleic acid detection substrate comprises a plurality of the detection sections, and nucleic acid probes of the same type are fixed to the plurality of detection sections.   The substrate according to claim 15, wherein the amount of each of the plurality of nucleic acid probes fixed to the plurality of detection sections is different for each detection section.   A substrate, a first and a second nucleic acid probe that are complementary to each of a plurality of different target nucleic acids and each exhibit a different Tm value; and the first and second nucleic acid probes provided on the substrate and in the same region A target nucleic acid detection substrate comprising: a detection section on which a nucleic acid probe is fixed.   The substrate of claim 17, wherein the detection compartment comprises an electrode for electrochemical detection.   18. The substrate according to claim 17, wherein the target nucleic acid detection substrate includes a plurality of the detection sections, and nucleic acid probes of the same type are fixed to the plurality of detection sections. The detection method according to claim 19, wherein Tm values of the plurality of nucleic acid probes fixed to the detection section are different for each detection section.

Images