JP2009136294A - NEUTROKINE alpha - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide an isolated nucleic acid molecule containing polynucleotide at least 95% homology with a new cytokine comprising a specific sequence. <P>SOLUTION: The specific sequences are; (a) a sequence encoding neutrokine α polypeptide having a complete amino acid sequence, (b) a sequence encoding neutrokine α having a complete amino acid sequence encoded by cDNA clone included in deposition to the ATCC on 22nd October 1996, (c) a sequence encoding neutrokine α polypeptide extracellular domain, (d) a sequence encoding neutrokine α polypeptide transmembrane domain, (e) a sequence encoding neutrokine α polypeptide intracellular domain, (f) a sequence encoding soluble neutrokine α polypeptide deleted of transmembrane domain, and (g) a sequence complementary to optional sequence of (a), (b), (c), (d), (e) or (f). <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to a novel cytokine expressed by neutrophils, which is therefore referred to as Neutrokine alpha protein ("Neutrokine alpha"). In particular, an isolated nucleic acid molecule encoding a Neutrokine alpha protein is provided. Neutrokine alpha polypeptides are also provided as vectors, host cells, and recombinant methods for producing them.

(Related technology)
Human tumor necrosis factor (TNF-α) and (TNF-β, or lymphotoxin) are related members of a broad class of polypeptide mediators, including interferons, interleukins, and growth factors, collectively known as cytokines (Beutler, B. and Cerami, A. Annu. Ret., Immunol., 7: 625-655 (1989)). Cytokine receptor sequence analysis defines several subfamilies of the following membrane proteins: (1) Ig superfamily, (2) hematopoietin (cytokine receptor superfamily), and (3) tumor necrosis factor (TNF) / Nerve growth factor (NGF) receptor superfamily (for a review of the TNF superfamily, see Gruss and Dower, Blood 85 (12): 3378-3404 (1995), and Aggarwal and Natarajan, Eur. Cytokine Netw., 7 (2). : 93-124 (1996)). The TNF / NGF receptor superfamily includes at least 10 different proteins. Gruss and Dower, supra. The ligands for these receptors have been identified and belong to at least two cytokine superfamily. Gruss and Dower, supra.

  Tumor necrosis factor (mixture of TNF-α and TNF-β) was originally discovered as a result of its anti-tumor activity, but now it is involved in apoptosis, cell activation and cell proliferation of several transformed cell lines. It is recognized as a multifaceted cytokine capable of numerous biological activities, including mediation and also playing an important role in immune regulation and inflammation.

  To date, known members of the TNF ligand superfamily include TNF-α, TNF-β (lymphotoxin-α), LT-β, OX40L, Fas ligand, CD30L, CD27L, CD40L, and 4-IBBL. TNF ligand superfamily ligands are acidic, TNF-like molecules with about 20% sequence homology in the extracellular domain (ranging from 12% to 36%), and organisms that are trimer / multimeric complexes It exists mainly as a membrane-bound form with a biologically active form. Soluble forms of the TNF ligand superfamily have so far only been identified for TNF, LT, β, and Fas ligands (for a general review, Gruss, H. and Dower, SK, Blood, 85 (12): 3378-3404 (1995), which is incorporated herein by reference in its entirety). These proteins are involved in the regulation of cell proliferation, activation and differentiation, including control of cell survival or cell death by apoptosis or cytotoxicity (Armitage, RJ, Curr. Opion. Immunol. 6: 407 (1994), and Smith, CA, Cell 75: 959 (1994)).

  Tumor necrosis factor-α (TNFα; also referred to as cachectin; hereinafter “TNF”) is a monocyte in response to endotoxin or other stimuli such as a soluble homotrimer of 17 kD protein subunits. And are secreted mainly by macrophages (Smith, RA, et al., J. Biol. Chem. 262: 6951-6954 (1987)). A membrane-bound 26 kD precursor form of TNF has also been described (Kriegler, M. et al., Cell 53: 45-53 (1988)).

  Accumulated evidence indicates that TNF is a regulatory cytokine with pleiotropic biological activity. These activities include: inhibition of lipoprotein lipase synthesis (“cachectin” activity) (Beutler, B. et al. Nature 316: 552 (1985)), activation of polymorphonuclear leukocytes (Klebanoff, SJ). Et al., J. Immunol. 136: 4220 (1986); Perussia, B et al., J. Immunol. 138: 765 (1987)), inhibition of cell proliferation or stimulation of cell proliferation (Vilcek, J. et al., J. Exp). Med. 163: 632 (1986); Sugarman, B. J. et al., Science 230: 943 (1985); Lachman, LB et al., J. Immunol. 138: 2913 (1987)), specific transformations. Cytotoxic activity in cell types (Lac man, LB et al., supra; Darzynkiewicz, Z. et al., Canc. Res. 44:83 (1984)), antiviral activity (Kohase, M. et al., Cell 45: 659 (1986); HW et al., Nature 323: 819 (1986)), bone resorption stimulation (Bertolini, DR et al., Nature 319: 516 (1986); Saklatvala, J., Nature 322: 547 (1986)). , Stimulation of collagenase and prostaglandin E2 production (Dayer, J.-M. et al., J. Exp. Med. 162: 2163 (1985)); and immunoregulatory effects (T cells (Yokota, S. et al., J. Biol.). Immunol.140: 531 (1988)), B cells Kehrl, JH et al., J. Exp. Med. 166: 786 (1987)), monocytes (Philip, R. et al., Nature 323: 86 (1986)), thymocytes (Ranges, GE et al.). , J. Exp. Med. 167: 1472 (1988)) and stimulation of cell surface expression of tumor histocompatibility complex (MHC) class I and class II molecules (Collins, T. et al., Proc. Natl. Acad.Sci.USA 83: 446 (1986); Pujol-Borrel, R. et al., Nature 326: 304 (1987)).

  TNF has been shown for its pro-inflammatory effects resulting in tissue wounds such as the following: induction of procoagulant activity in vascular endothelial cells (Pober, JS et al., J. Immunol. 136: 1680 (1986). ), Enhanced adhesion of neutrophils and lymphocytes (Pober, JS et al., J. Immunol. 138: 3319 (1987)), and platelet activating factor from macrophages, neutrophils and vascular endothelial cells (Camussi, G. et al., J. Exp. Med. 166: 1390 (1987)).

  Recent evidence indicates that TNF has been associated with many infections (Cerami, A. et al., Immunol. Today 9:28 (1988)), immune disorders, neoplastic symptoms (eg, in cachexia with some malignancy) ( Olif. A. et al., Cell 50: 555 (1987)), and autoimmune and graft-versus-host symptoms (Piget, P.-F. et al., J. Ecp. Med. 166: 1280 (1987)). Associate with. The association of TNF with cancer and infectious symptoms often correlates with host metabolic status. The main problem for cancer patients is weight loss, usually associated with eating disorders. The large-scale weakness that occurs is known as “cachexia” (Kern, KA, et al., J. Parent. Enter. Nutr. 12: 286-298 (1988)). Cachexia includes a progressive decline in body weight in response to progressive weight loss, eating disorders, and malignant growth. Thus, cachexia is associated with significant mortality and is responsible for numerous cancer mortality. Numerous studies suggest that TNF is an important mediator of cachexia in cancer, infectious symptoms, and other metabolic conditions.

TNF is a gram-negative sepsis and endotoxin shock, including fever, malaise, eating disorders, and cachexia (Michie, HR et al., Br. J. Surg. 76: 670-671 (1989); Debetes, JM H. et al., Second, Vienna Shock Forum, 463-466 (1989); Simpson, S. Q. et al., Crit. Care Clin. 5: 27-47 (1989)). It is thought to play a central role in the results. Endotoxins are potent monocyte / macrophage activators, which produce and secrete TNF (Kornblue, SK, et al., J. Immunol. 137: 2585-2591 (1986)), as well as other cytokines. stimulate. It was concluded that TNF is a central mediator capable of responding to clinical signs of endotoxin-related diseases because it can mimic many biological effects of endotoxins. TNF and other monocyte-inducible cytokines mediate metabolic and neurohormonal responses to endotoxins (Michie, HR et al., N. Eng. J. Med. 318: 1481-1486 (1988)). . Administration of endotoxin to human volunteers results in sudden illness with influenza-like symptoms including fever, tachycardia, increased metabolic rate, and stress hormone release (Revhaug, A. et al. Arch. Surg. 123: 162-170 ( 1988)). Elevated levels of circulating TNF have also been found in patients with Gram-negative sepsis (Waage, A. et al., Lancet 1: 355-357 (1987); Hammerle, A. F. et al., Second Vienna
Shock Forum 715-718, (1989); Devets, J. et al. M.M. H. Et al., Crit. Care Med. 17: 489-497 (1989); Calandra, T .; Et al. Infec. Dis. 161: 982-987 (1990)).

  Passive immunotherapy directed at neutralization of TNF may have toxic effects on Gram-negative sepsis and endotoxin based on increased TNF production and elevated TNF levels in these pathological states as described above. An antibody against a “modulator” substance characterized as cachectin (which was later found to be identical to TNF) was disclosed by Cerami et al. (European Patent Publication No. 0,212,489, March 4, 1987). . Such antibodies were said to be useful in diagnostic immunoassays and in samples of shock in bacterial infections. Rubin et al. (European Patent Publication No. 0,218,868, Apr. 22, 1987) describe moniclonal antibodies against human TNF, hybridomas that secrete such antibodies, methods for producing such antibodies, and immunization of TNF. The use of such antibodies in the assay has been disclosed. Yone et al. (European Patent Publication No. 0,288,088, Oct. 26, 1988) describes anti-TNF antibodies (including mAbs) and their utility in immunoassay diagnosis of symptoms (especially Kawasaki disease symptoms and bacterial infections). Disclosed. Body fluids of patients with symptoms of Kawasaki disease (pediatric acute fever mucocutaneous lymph node syndrome; Kawasaki, T., Allergy 16: 178 (1967); Kawasaki, T., Shonica (Pediatrics) 26: 935 (1985)) It was said to have elevated TNF levels associated with symptom progression (Yone et al., Supra).

Other researchers have described mAbs specific for recombinant human TNF that have neutralized in vitro activity (Liang, CM et al., Biochem. Biophys. Res. Comm. 137; 847-854 (1986). Meager, A. et al., Hybridoma 6: 305-311 (1987); Fendly et al., Hybridoma 6: 359-369 (1987); Bringman, TS et al., Hybridoma 6: 489-507 (1987); J. Immunol. Meth. 96: 57-62 (1987); Moller, A. et al (Cytokine).
2: 162-169 (1990)). Some of these mAbs map human TNF epitopes and develop enzyme immunoassays (Fendly et al., Supra; Hiral et al., Supra; Moller et al., Supra) and in the purification of recombinant TNF Used to aid (Bringman et al., Supra). However, these studies neutralize antibodies that can be used for in vivo diagnostic use or therapeutic use in humans due to immunogenicity, lack of specificity, and / or pharmaceutical compatibility. It does not provide a basis for producing TNF.

Neutralizing antisera or mAbs to TNF have been shown to eliminate deleterious physiological changes and prevent death after lethal challenge in experimental endotoxia and bacteremia in non-human mammals Has been. This effect has been demonstrated, for example, in rodent lethality assays and in primate pathology model systems (Mathison, JC, et al., J. Clin. Invest. 81: 1925-1937 (1988); Beutler, B. et al., Science 229: 869-871 (1985); Tracey, KJ et al., Nature 330: 662-664 (1987); Shimamoto, Y. et al., Immunol. Lett. 1988); Silva, A. T. et al., J. Infect. Dis. 162: 421-427 (1990) Opal, S. M. et al., J. Infect. Dis. 161: 1148-1152 (1990); LB et al., Circ.
Shock 60: 279-292 (1990)).

  To date, experience with anti-TNF mAb treatment in humans is limited, but has shown useful therapeutic results (eg, arthritis and sepsis). For example, Elliott, M. et al. J. et al. Et al., Bailieres Clin. Rheumatol. 9: 633-52 (1995); Feldmann M et al., Ann. N. Y. Acad. Sci. USA 766: 272-8 (1995); van der Poll, T .; Et al., Shock 3: 1-12 (1995); Werry et al., Crit. Care. Med. 21: S436-40 (1993); Tracey K. et al. J. et al. Et al., Crit. Care Med. 21 S415-22 (1993).

  Mammalian development depends on both cell proliferation and differentiation and programmed cell death that occurs during apoptosis (Walker et al., Methods Achiev. Exp. Pathol. 13:18 (1988)). Apoptosis plays an important role in the destruction of immune thymocytes that recognize self-antigens. This lack of normal ablation process may play a role in autoimmune diseases (Gammon et al., Immunology Today 12: 193 (1991)).

  Itoh et al. (Cell 66: 233 (1991)) describe a cell surface antigen, Fas / CD23, that mediates apoptosis and is involved in clonal deletion of T cells. Fas is expressed in activated T cells, B cells, neutrophils in adult mice and in thymus, liver, heart, and lung and ovary in addition to activated T cells, B cells, neutrophils (Watanabe-Fukunaga et al., J. Immunol. 148: 1274 (1992)). In experiments where monoclonal Abs crosslink to Fas, apoptosis is induced (Yonehara et al., J. Exp. Med. 169: 1747 (1989); Traut et al., Science 245: 301 (1989)). In addition, there are examples in which binding of monoclonal Ab to Fas is stimulatory to T cells under certain conditions (Alderson et al., J. Exp. Med. 178: 2231 (1993)).

  The Fas antigen is a cell surface protein with a relative molecular weight of 45 Kd. Both the human and mouse genes of Fas have been cloned by Watanabe-Fukunaga et al. (J. Immunol. 148: 1274 (1992) and Itoh et al. (Cell 66: 233 (1991)). Both membranes with structural homology to the nerve growth factor / tumor necrosis factor receptor superfamily (including two TNF receptors, the low affinity nerve growth factor receptor, and CD40, CD27, CD30, and OX40) It is a penetrating protein.

  Recently, a Fas ligand has been described (Suda et al., Cell 75: 1169 (1993)). This amino acid sequence indicates that the Fas ligand is a type II transmembrane protein belonging to the TNF family. Thus, the Fas ligand polypeptide contains three major domains: a short intracellular domain at the amino terminus and a long extracellular domain at the carboxy terminus joined by a hydrophobic transmembrane domain. Fas ligand is expressed in spleen cells and thymocytes, consistent with T cell-mediated cytotoxicity. Purified Fas ligand has a molecular weight of 40 kD.

  Recently, it has been shown that Fas / Fas ligand interaction is required for apoptosis following T cell activation (Ju et al., Nature 373: 444 (1995); Brunner et al., Nature 373: 441 (1995). )). Activation of T cells induces both proteins on the cell surface. Subsequent interactions between the ligand and receptor result in cellular apoptosis. This supports a possible regulatory role on apoptosis induced by Fas / Fas ligand interactions during normal immune responses.

  Therefore, there is a need to provide cytokines similar to TNF that are involved in pathological conditions. Such novel cytokines can be used to create new antibodies or other antagonists that bind these TNF-like cytokines to the treatment of disorders associated with TNF-like cytokines.

(Summary of the Invention)
The present invention provides an isolated nucleic acid molecule comprising a polynucleotide encoding a cytokine that is structurally similar to TNF and related cytokines and is believed to have similar biological effects and activities. This cytokine is named Neutrokine α and the present invention is encoded by at least the amino acid sequence in FIG. 1 (SEQ ID NO: 2) or a cDNA clone deposited in a bacterial host as an ATCC deposit on October 22, 1996. A Neutrokine alpha polypeptide having a portion of the amino acid sequence. The nucleotide sequence determined by sequencing the deposited Neutrokine α clone (shown in FIG. 1 (SEQ ID NO: 1)) is N-terminal methionine, a putative intracellular domain of about 46 amino acid residues, about 26 It contains an open reading frame encoding a complete polypeptide of 285 amino acid residues, including a predicted transmembrane domain of amino acids, a predicted extracellular domain of approximately 213 amino acids, and a predicted molecular weight for the complete protein of approximately 31 kDa. For other type II transmembrane proteins, the soluble form of Neutrokine alpha is a polypeptide comprising all or part of the extracellular domain cleaved from the transmembrane domain and a complete Neutrokine alpha polypeptide lacking the transmembrane domain ( That is, it includes an extracellular domain bound to an intracellular domain.

  Accordingly, one aspect of the invention provides an isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence selected from the group consisting of: (a) in FIG. 1 (SEQ ID NO: 2) or A nucleotide sequence encoding a Neutrokine alpha full-length polypeptide having the complete amino acid sequence as encoded by the cDNA clone contained in the ATCC deposit on October 22, 1996; (b) in FIG. 1 (SEQ ID NO: 2); Or a nucleotide sequence encoding a putative extracellular domain of a Neutrokine alpha polypeptide having amino acid sequence 73-285 as encoded by a cDNA clone contained in the ATCC deposit on October 22, 1996; (c) Neutro Encodes a polypeptide containing the intracellular domain of Cain α Nucleotide sequence (from about position 1 to about position 46 in FIG. 1 (SEQ ID NO: 2) or as encoded by the cDNA clone included in the ATCC deposit on October 22, 1996); (d) Neutro Amino acid residues in the nucleotide sequence encoding the polypeptide containing the transmembrane domain of Cain alpha (Figure 1 (SEQ ID NO: 2)) or as encoded by the cDNA clone included in the ATCC deposit on October 22, 1996 (E) a nucleotide sequence encoding a soluble Neutrokine alpha polypeptide having an extracellular domain and an intracellular domain but lacking a transmembrane domain; and (f) (a), (b), (above) c) a nucleotide sequence complementary to any of the nucleotide sequences in (d) or (e) .

  A further embodiment of the invention is at least 90% identical to any of the nucleotide sequences in (a), (b), (c), (d), (e) or (f) above, and More preferably, a polynucleotide having the same nucleotide sequence of 95%, 96%, 97%, 98%, or 99%, or the above (a), (b), (c), (d), (e) Or an isolated nucleic acid molecule comprising a polynucleotide that hybridizes under stringent hybridization conditions to the polynucleotide in (f). This polynucleotide that hybridizes does not hybridize under stringent hybridization conditions to a polynucleotide having a nucleotide sequence consisting of only A or T residues. A further nucleic acid embodiment of the present invention provides the amino acid sequence of the epitope-bearing portion of a Neutrokine alpha polypeptide having the amino acid sequence in (a), (b), (c), (d), or (e) above. It relates to an isolated nucleic acid molecule comprising an encoding polynucleotide.

  The invention also provides a recombinant vector comprising an isolated nucleic acid molecule of the invention, a host cell comprising the recombinant vector, and methods and recombinant techniques for producing such vectors and host cells. It relates to methods of using these for the production of Caine alpha polypeptides or peptides.

  The present invention further provides an isolated Neutrokine alpha polypeptide comprising an amino acid sequence selected from the group consisting of: (a) shown in FIG. 1 (SEQ ID NO: 2) or October 1996 The amino acid sequence of Neutrokine alpha full-length polypeptide having the complete amino acid sequence as encoded by the cDNA clone contained in the 22 day ATCC deposit; (b) in FIG. 1 (SEQ ID NO: 2) or as of October 1996 The amino acid sequence of the deduced extracellular domain of Neutrokine α polypeptide having amino acid sequence 73 to 285 as encoded by the cDNA clone included in the ATCC deposit of Japan; (c) the amino acid of the intracellular domain of Neutrokine α In the sequence (FIG. 1 (SEQ ID NO: 2) or on October 22, 1996) (D) in the amino acid sequence of the predicted transmembrane domain of Neutrokine alpha (FIG. 1 (SEQ ID NO: 2)) as encoded by the cDNA clone included in the TCC deposit; Or amino acid residues from about position 47 to about position 72 as encoded by the cDNA clone contained in the ATCC deposit on October 22, 1996); and (e) each of these domains is defined as above An amino acid sequence of a soluble Neutrokine alpha polypeptide having an extracellular domain and an intracellular domain but lacking a transmembrane domain.

  The polypeptide of the present invention also has at least 90% similarity to the amino acid sequence described in (a), (b), (c), (d), or (e) above, and more preferably , Polypeptides having amino acid sequences with at least 95% similarity, and at least 80% identical, more preferably at least 90% identical, and even more preferably 95%, 96%, 97%, 98 to the amino acid sequences described above %, Or a polypeptide having an amino acid sequence that is 99% identical.

  A further embodiment of this aspect of the invention is an epitope-bearing portion of a Neutrokine alpha polypeptide having the amino acid sequence set forth in (a), (b), (c), (d), or (e) above It relates to a peptide or polypeptide having the amino acid sequence of A peptide or polypeptide having an amino acid sequence of an epitope-bearing portion of a Neutrokine alpha polypeptide of the invention comprises such an amino acid comprising at least 6 or 7, preferably at least 9, and more preferably at least about 30 amino acids to about 50 amino acids. Also encompassed by the present invention are epitope-bearing polypeptides of any length that comprise a portion of a polypeptide, but up to and including the entire amino acid sequence of a polypeptide of the invention described above. In another embodiment, the present invention provides an isolation that specifically binds to a polypeptide having the amino acid sequence described in (a), (b), (c), (d), or (e) above. Provided antibodies.

  The present invention further provides a method of isolating an antibody that specifically binds to a Neutrokine alpha polypeptide having an amino acid sequence as described herein. Such antibodies are useful diagnostically or therapeutically as described below.

  The present invention also provides a pharmaceutical composition comprising a soluble Neutrokine alpha polypeptide, particularly a human Neutrokine alpha polypeptide. Soluble Neutrokine alpha polypeptides treat, for example, tumors and tumor metastases, infection by bacteria, viruses, or other parasites, immunodeficiencies, inflammatory diseases, lymphadenomas, autoimmune diseases, graft-versus-host diseases And can be used to stimulate peripheral tolerance, destroy several transformed cell lines, mediate cell activation and proliferation, and functionally as the first mediator of immune regulation and inflammatory responses It is connected.

  The invention further provides a composition comprising a Neutrokine alpha polynucleotide or Neutrokine alpha polypeptide for administration to a cell in vitro, to a cell ex vivo, and to a cell in vivo, or to a multicellular organism. In certain particularly preferred embodiments of this aspect of the invention, the composition comprises a Neutrokine alpha polynucleotide for expression of Neutrokine alpha polypeptide in a host organism for the treatment of disease. Particularly preferred in this regard is expression in human patients for the treatment of dysfunction associated with abnormal endogenous activity of the Neutrokine alpha gene.

  The present invention also includes contacting a candidate compound with a cell expressing Neutrokine, assaying a cellular response, and a standard cellular response (where the standard is made in the absence of the candidate compound). Provides a screening method for identifying compounds that can enhance or inhibit the cellular response induced by Neutrokine alpha, including comparing the cellular response to Assayed when contacted in the absence of compound. Here, an enhanced cellular response over the standard indicates that the compound is an agonist, and a reduced cellular response over the standard indicates that the compound is an antagonist.

  In another aspect, methods are provided for identifying Neutrokine alpha receptors, and screening assays for agonists and antagonists that use such receptors. This assay involves determining the influence of a candidate compound on Neutrokine alpha binding to Neutrokine alpha receptor. In particular, the method comprises contacting a Neutrokine alpha receptor with a Neutrokine alpha polypeptide and a candidate compound, and increasing the Neutrokine alpha polypeptide binding to the Neutrokine alpha receptor due to the presence of the candidate compound or Determining whether to decrease. Antagonists can be used to prevent septic shock, inflammation, cerebral malaria, HIV virus activation, graft host rejection, bone resorption, rheumatoid arthritis, and cachexia (waste or oligotrophic).

  The present inventors have confirmed that Neutrokine α is not only neutrophil but also kidney, lung, peripheral leukocyte, bone marrow, T cell lymphoma, B cell lymphoma, activated T cell, gastric cancer, smooth muscle, macrophage, umbilical cord It was found that it is also expressed in blood tissues. Many of these tissue and cell disorders (eg, tumors and tumor metastases, bacterial, viral, and other parasite infections, immunodeficiency, septic life shock, inflammation, cerebral malaria, HIV virus activation, graft pairs For host rejection, bone resorption, rheumatoid arthritis, and cachexia (waste or oligotrophic), "standard" Neutrokine alpha gene expression levels (ie, in tissues or fluids from non-injury solids Significantly higher or lower levels of Neutrokine alpha gene expression compared to Neutrokine alpha expression levels) (eg, bone marrow) or body fluids (eg, bone marrow) , Serum, plasma, urine, synovial fluid, or cerebrospinal fluid). Diagnostic methods that are useful during are included, including: (a) assaying the level of Neutrokine alpha gene expression in an individual's cells or fluid; (b) the level of Neutrokine alpha gene expression; An increase or decrease in the assayed Neutrokine α gene expression level compared to a standard Neutrokine α gene expression level and thereby compared to the standard expression level is indicative of the disorder.

  A further aspect of the present invention is a method for treating an individual in need of elevated levels of Neutrokine α activity in the body, comprising a therapeutically effective amount of an isolated Neutrokine α polypeptide of the present invention or its It relates to a method comprising administering a composition comprising an agonist to such an individual.

  A still further aspect of the present invention is a method for treating an individual in need of reduced levels of Neutrokine alpha activity in the body, wherein a composition comprising a therapeutically effective amount of a Neutrokine alpha antagonist is included in such an individual. To a method comprising the step of: Preferred antagonists for use in the present invention are Neutrokine alpha specific antibodies.

  The present invention provides the following.

(1) An isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence that is at least 95% identical to a sequence selected from the group consisting of:
(A) a nucleotide sequence encoding a Neutrokine α polypeptide having the complete amino acid sequence (SEQ ID NO: 2) in FIG. 1;
(B) a nucleotide sequence encoding Neutrokine alpha having the complete amino acid sequence encoded by the cDNA clone included in the ATCC deposit on October 22, 1996;
(C) a nucleotide sequence encoding a Neutrokine alpha polypeptide extracellular domain;
(D) a nucleotide sequence encoding a Neutrokine alpha polypeptide transmembrane domain;
(E) a nucleotide sequence encoding a Neutrokine alpha polypeptide intracellular domain;
(F) a nucleotide encoding a soluble Neutrokine alpha polypeptide comprising an extracellular domain and an intracellular domain but lacking a transmembrane domain;
(G) A nucleotide sequence complementary to any nucleotide sequence in (a), (b), (c), (d), (e), or (f) above.

  (2) The nucleic acid molecule according to item (1), wherein the polynucleotide has the complete nucleotide sequence (SEQ ID NO: 1) in FIG.

  (3) The item according to item (1), wherein the polynucleotide has the nucleotide sequence (SEQ ID NO: 1) in FIG. 1 encoding the Neutrokine α polypeptide having the complete amino acid sequence (SEQ ID NO: 2) in FIG. Nucleic acid molecule.

  (4) The nucleic acid molecule according to item (1), wherein the polynucleotide has a nucleotide sequence (SEQ ID NO: 2) encoding soluble Neutrokine α containing the extracellular domain shown in FIG.

(5) An isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence at least 95% identical to a sequence selected from the group consisting of:
(A) a nucleotide sequence encoding a polypeptide having an amino acid sequence consisting of residues n to 285 of SEQ ID NO: 2, wherein n is an integer ranging from 2 to 190;
(B) a nucleotide sequence encoding a polypeptide having an amino acid sequence consisting of residues 1 to m of SEQ ID NO: 2, wherein m is an integer in the range of 274 to 284;
(C) a nucleotide sequence encoding a polypeptide having an amino acid sequence consisting of residues n to m of SEQ ID NO: 2, wherein n and m are defined in (a) and (b) above, respectively An array that is an integer;
(D) a nucleotide sequence encoding a polypeptide consisting of a portion of the complete Neutrokine alpha amino acid sequence encoded by the cDNA clone contained in the ATCC deposit on October 22, 1996, wherein the portion is A nucleotide sequence that does not include 1-190 amino acids from the amino terminus and 1-11 amino acids from the C-terminus of the complete amino acid sequence.

  (6) The nucleic acid molecule according to item (1), wherein the polynucleotide has the complete nucleotide sequence of a cDNA clone included in the ATCC deposit on October 22, 1996.

  (7) In item (1), the polynucleotide has a nucleotide sequence encoding a Neutrokine α polypeptide having the complete amino acid sequence encoded by the cDNA clone included in the ATCC deposit on October 22, 1996 The described nucleic acid molecule.

  (8) Item (1), wherein the polynucleotide has a nucleotide sequence encoding a soluble Neutrokine α polypeptide comprising an extracellular domain encoded by a cDNA clone included in the ATCC deposit on October 22, 1996 The nucleic acid molecule according to.

  (9) A stringent high level of a polynucleotide having a nucleotide sequence identical to the nucleotide sequence in (a), (b), (c), (d), (e), or (f) of item (1) An isolated nucleic acid molecule comprising a polynucleotide that hybridizes under hybridization conditions, wherein the hybridizing polynucleotide has a nucleotide sequence consisting of only A or T residues An isolated nucleic acid molecule that does not hybridize under stringent conditions.

  (10) The amino acid sequence of the epitope-bearing portion of the Neutrokine α polypeptide having the amino acid sequence of (a), (b), (c), (d), (e), or (f) of item (1) An isolated nucleic acid molecule comprising an encoding polynucleotide.

  (11) The isolated nucleic acid molecule according to item (10), which encodes an epitope-bearing portion of a Neutrokine α polypeptide selected from the group consisting of: about Phe 115 to about Leu 147 amino acid residues ( A polypeptide comprising an amino acid residue of about Ile 150 to about Tyr 163 (SEQ ID NO: 2); an amino acid residue of about Ser 171 to about Phe 194 (SEQ ID NO: 2) A polypeptide comprising about Glu 223 to about Tyr 247 amino acid residues (SEQ ID NO: 2); and a polypeptide comprising about Ser 271 to about Phe 278 amino acid residues (SEQ ID NO: 2).

  (12) A method for producing a recombinant vector, comprising a step of inserting the isolated nucleic acid molecule according to item (1) into a vector.

  (13) A recombinant vector produced by the method according to item (12).

  (14) A method for producing a recombinant host cell, comprising the step of introducing the recombinant vector according to item (13) into the host cell.

  (15) A recombinant host cell produced by the method according to item (14).

  (16) A recombinant method for producing a Neutrokine α polypeptide, the recombinant according to item (15), under conditions such that the polypeptide is expressed and the polypeptide is recovered. Culturing a host cell.

(17) An isolated Neutrokine α polypeptide comprising an amino acid sequence at least 95% identical to a sequence selected from the group consisting of:
(A) the amino acid sequence of Neutrokine alpha having the complete amino acid sequence in FIG. 1 (SEQ ID NO: 2);
(B) the amino acid sequence of Neutrokine alpha having the complete amino acid sequence encoded by the cDNA clone contained in the ATCC deposit on October 22, 1996;
(C) the amino acid sequence of the Neutrokine alpha polypeptide extracellular domain;
(D) the amino acid sequence of the Neutrokine α polypeptide transmembrane domain;
(E) the amino acid sequence of the Neutrokine α polypeptide intracellular domain;
(F) the amino acid sequence of a soluble Neutrokine α polypeptide comprising a domain; and (g) any of the polypeptides of (a), (b), (c), (d), (e), or (f) Or the amino acid sequence of one epitope-bearing part.

  (18) The isolated polypeptide according to item (17), comprising an epitope-bearing portion of Neutrokine alpha, wherein said portion is selected from the group consisting of: about Phe 115 to about Leu A polypeptide comprising 147 amino acid residues (SEQ ID NO: 2); a polypeptide comprising about Ile 150 to about Tyr 163 amino acid residues (SEQ ID NO: 2); about Ser 171 to about Phe 194 amino acid residues A polypeptide comprising a group (SEQ ID NO: 2); a polypeptide comprising about Glu 223 to about Tyr 247 amino acid residues (SEQ ID NO: 2); and about Ser 271 to about Phe 278 amino acid residues (SEQ ID NO: 2). A polypeptide comprising.

  (19) An isolated antibody that specifically binds to the Neutrokine α polypeptide according to item (17).

  (20) A pharmaceutical composition comprising the polypeptide of item (17) and a pharmaceutically acceptable carrier.

(21) An isolated nucleic acid molecule comprising a polynucleotide having a sequence at least 95% identical to a sequence selected from the group consisting of:
(A) the nucleotide sequence of clone HSOAD55R (SEQ ID NO: 7);
(B) the nucleotide sequence of clone HSLAH84R (SEQ ID NO: 8);
(C) nucleotide sequence of clone HLTBM08R (SEQ ID NO: 9);
(D) the nucleotide sequence of the portion of the sequence shown in FIG. 1 (SEQ ID NO: 1), wherein said portion comprises at least 30 consecutive nucleotides from nucleotide 1 to nucleotide 809; and (e ) A nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), (c) or (d) above.

FIG. 1 shows the nucleotide sequence (SEQ ID NO: 1) and deduced amino acid sequence (SEQ ID NO: 2) of Neutrokine alpha protein. Amino acids 1-46 represent the intracellular domain, amino acids 47-72 represent the transmembrane domain (underlined sequence), and amino acids 73-285 represent the extracellular domain (remaining sequence). FIG. 2 shows Neutrokine alpha protein and TNF-alpha (SEQ ID NO: 3), TNF-beta (lymphotoxin) (SEQ ID NO: 4) as determined by the "Megalign" routine (which is part of a computer program called "DNAStar"). ), And the region of identity between the amino acid sequences of the FAS ligand (SEQ ID NO: 5). FIG. 3 shows the analysis of Neutrokine alpha amino acid sequence. α, β, turn and coil regions; hydrophilic and hydrophobic; amphiphilic regions; flexible regions; antigen index and surface probability. The “Antigen Index—Jameson-Wolf” graph shows the location of the highly antigenic region of the Neutrokine alpha protein, ie the region where the epitope-bearing peptide of the invention can be obtained. FIG. 4A shows the related human cDNA clones of the present invention of the Neutrokine alpha nucleotide sequence determined from the human cDNA deposited at the ATCC deposit on October 22, 1996 (these are HSOAD55R (SEQ ID NO: 7), HSLAH84R ( Alignment with SEQ ID NO: 8) and HLTBM08R (designated SEQ ID NO: 9). FIG. 4B shows the related human cDNA clones of the present invention of the Neutrokine alpha nucleotide sequence determined from the human cDNA deposited at the October 22, 1996 ATCC deposit (these are HSOAD55R (SEQ ID NO: 7), HSLAH84R ( Alignment with SEQ ID NO: 8) and HLTBM08R (designated SEQ ID NO: 9). FIG. 4C shows the related human cDNA clones of the present invention of the Neutrokine alpha nucleotide sequence determined from the human cDNA deposited at the ATCC deposit on October 22, 1996 (these are HSOAD55R (SEQ ID NO: 7), HSLAH84R ( Alignment with SEQ ID NO: 8) and HLTBM08R (designated SEQ ID NO: 9).

(Detailed explanation)
The present invention includes an isolation comprising a polynucleotide encoding a Neutrokine α polypeptide having the amino acid sequence shown in FIG. 1 (SEQ ID NO: 2), determined by sequencing cloned cDNA Neutrokine α. Provided nucleic acid molecules. The nucleotide sequence shown in FIG. 1 (SEQ ID NO: 1) was obtained by sequencing the HNEDU15 clone deposited on October 22, 1996 in the American Type Culture Collection, 12301 Park Lawn Drive, Rockville, Maryland. The deposited clone is contained in the pBluescript SK (−) plasmid (Stratagene, La Jolla, Calif.).

  The Neutrokine α protein of the present invention shares sequence homology with the translation products of human mRNAs of TNF-α, TNF-β, and Fas ligand (FIG. 2). As mentioned above, TNFα plays a role in the regulation of cytotoxicity, necrosis, apoptosis, costimulation, proliferation, lymph node formation, immunoglobulin class switch, differentiation, antiviral activity, adhesion molecules and other cytokines and growth factors. It is thought to be an important cytokine to fulfill.

(Nucleic acid molecule)
Unless otherwise indicated, all nucleotide sequences determined by sequencing DNA molecules herein are determined using an automated DNA sequencer (eg, Model 373 from Applied Biosystems, Inc.). And all amino acid sequences of the polypeptides encoded by the DNA molecules determined herein were predicted by translation of the DNA sequences determined as described above. Thus, as is known in the art for any DNA sequence determined by this automated approach, any nucleotide sequence determined herein can contain some errors. The nucleotide sequence determined by automation is typically at least about 90% identical to the actual nucleotide sequence of the DNA molecule being sequenced, more typically at least about 95% to at least about 99.9. % Identical. The actual sequence can be more accurately determined by other approaches including manual DNA sequencing methods well known in the art. As is also known in the art, a single insertion or deletion in the determined nucleotide sequence compared to the actual sequence causes a frameshift in the translation of the nucleotide sequence, resulting in a determined nucleotide sequence. The predicted amino acid sequence encoded is completely different from the amino acid sequence actually encoded by the DNA molecule being sequenced starting at a point such as an insertion or deletion.

  Depending on the “nucleotide sequence” of a nucleic acid molecule or polynucleotide, the sequence of deoxyribonucleotides for a DNA molecule or polynucleotide and the corresponding sequence of ribonucleotides (A, G, C, and U) for an RNA molecule or polynucleotide ( Each thymidine deoxyribonucleotide (T) in the deoxyribonucleotide sequence identified herein is intended to be replaced by the ribonucleotide uridine (U)).

  Using the information provided herein (eg, the nucleotide sequence of FIG. 1), a nucleic acid molecule of the invention encoding a Neutrokine alpha polypeptide can be used as a standard cloning and screening procedure (eg, as a starting material). a procedure for cloning cDNA using mRNA). As an example of the present invention, the nucleic acid molecule described in FIG. 1 (SEQ ID NO: 1) was discovered in a neutrophil derived cDNA library. An expressed sequence tag corresponding to a portion of the Neutrokine α cDNA was also found in neutrophils.

  The Neutrokine α gene has about 285 amino acid residues (an intracellular domain of about 46 amino acids (almost 1 to about 46 amino acid residues of FIG. 1 (SEQ ID NO: 2)), a transmembrane domain of about 26 amino acids (FIG. 1 ( Open reading encoding a protein of approximately 47 to approximately 72 amino acid residues of SEQ ID NO: 2), an extracellular domain of approximately 213 amino acids (approximately 73 to approximately 285 amino acid residues of FIG. 1 (SEQ ID NO: 2))) Including the frame; and an estimated molecular weight of about 31 kDa. The Neutrokine α protein shown in FIG. 1 (SEQ ID NO: 2) is about 20% similar and about 10% identical to human TNF-α, which can be accessed as GenBank accession number 337964.

  As will be appreciated by those skilled in the art, due to the possibility of sequencing errors described above, the actual complete Neutrokine alpha polypeptide (including about 285 amino acids) encoded by the deposited cDNA is somewhat May be smaller. In particular, the determined Neutrokine alpha coding sequence includes a second methionine codon that can serve as a selective initiation codon for translation of the open reading frame at nucleotide positions 210-213 in FIG. 1 (SEQ ID NO: 1). . More generally, the actual open reading frame is in the range of ± 20 amino acids, predicted from either the first or second methionine codon from the N-terminus shown in FIG. 1 (SEQ ID NO: 1), It is likely that somewhere in the range of ± 10 amino acids. Depending on the analytical criteria used to identify the various functional domains, the exact “address” of the extracellular, intracellular, and transmembrane domains of Neutrokine alpha polypeptide varies slightly. It is further understood that For example, the exact location of the Neutrokine alpha extracellular domain in FIG. 1 (SEQ ID NO: 2) can vary slightly depending on the criteria used to define the domain (eg, the address is approximately 1 To about 20 residues, more likely about 1 to about 5 residues can be "shifted"). In this case, the end of the transmembrane domain and the start of the extracellular domain are predicted based on the identification of the hydrophobic amino acid sequence at the above position, as shown in FIG. In any event, as will be discussed further below, the present invention further relates to polypeptides in which various residues have been deleted from the N-terminus of the complete polypeptide (the soluble extracellular form of Neutrokine alpha protein). Comprising a polypeptide that deletes one or more amino acids from the N-terminus of the extracellular domain described herein, which constructs the domain).

  As indicated, the nucleic acid molecules of the invention are in the form of RNA (eg, mRNA) or in the form of DNA (eg, including cDNA and genomic DNA obtained by cloning or synthetically produced). obtain. DNA can be double-stranded or single-stranded. Single-stranded DNA or RNA can be the coding strand (also known as the sense strand) or it can be the non-coding strand (also known as the antisense strand).

  By “isolated” nucleic acid molecule (s) is intended a nucleic acid molecule (DNA or RNA) that has been removed from its natural environment. For example, recombinant DNA molecules contained in a vector are intended to be isolated for the purposes of the present invention. Further examples of isolated DNA molecules include recombinant DNA molecules maintained in heterologous host cells, or (partially or substantially) purified DNA molecules in solution. Isolated RNA molecules include in vivo or in vitro RNA transcripts of the DNA molecules of the present invention. Nucleic acid molecules isolated according to the present invention further include such molecules as are produced synthetically.

  Isolated nucleic acid molecules of the invention include DNA molecules comprising an open reading frame (ORF) having a start codon at positions 147-149 of the nucleotide sequence shown in FIG. 1 (SEQ ID NO: 1). In addition, isolated nucleic acid molecules of the present invention include DNA molecules that differ substantially from the sequences described above, but still contain sequences encoding Neutrokine alpha protein due to the degeneracy of the genetic code. Of course, the genetic code is well known in the art. Therefore, it is routine for those skilled in the art to generate the above degenerate variants. In another aspect, the present invention provides an isolated nucleic acid molecule encoding a Neutrokine alpha polypeptide having an amino acid sequence encoded by a cDNA contained in a plasmid deposited on October 22, 1996. Preferably, the nucleic acid molecule comprises a sequence encoding the extracellular domain of the polypeptide encoded by the deposited cDNA clone.

  The present invention further provides a nucleic acid molecule having the nucleotide sequence shown in FIG. 1 (SEQ ID NO: 1), or the Neutrokine α cDNA contained in the deposited clone, or a sequence complementary to one of the above sequences. To do. Such isolated molecules, particularly DNA molecules, are useful as probes for gene mapping by in situ hybridization with chromosomes and for detecting the expression of Neutrokine alpha gene in human tissues, for example by Northern blot analysis. is there.

  The invention further relates to nucleic acid molecules that encode portions of the nucleotide sequences described herein, as well as fragments of the isolated nucleic acid molecules described herein. Specifically, the present invention provides a polynucleotide having a nucleotide sequence (consisting of positions 1 to 1001 of SEQ ID NO: 1) representing a portion of SEQ ID NO: 1.

  Furthermore, the present invention provides a sequence that is at least 95% identical to any portion of at least about 30 contiguous nucleotides, preferably at least about 50 nucleotides, of the sequence from nucleotide 1 to nucleotide 809 of FIG. 1 (SEQ ID NO: 1). A polynucleotide comprising

  More generally, a diagnostic probe as discussed herein by the nucleotide sequence of the deposited cDNA or by a fragment of an isolated nucleic acid molecule having the nucleotide sequence shown in FIG. 1 (SEQ ID NO: 1) Also contemplated are fragments that are at least about 15 nt, and more preferably at least about 20 nt, even more preferably at least about 30 nt, and even more preferably at least about 40 nt in length, useful as primers. Of course, larger fragments of 50-300 nt length according to the invention are also useful. This is because these fragments are most, if not all, of the deposited cDNA or nucleotide sequence as shown in FIG. 1 (SEQ ID NO: 1). For example, by a fragment of at least 20 nt in length, a fragment comprising 20 or more contiguous bases of the deposited cDNA or from the nucleotide sequence as shown in FIG. 1 (SEQ ID NO: 1) is contemplated. Preferred nucleic acid fragments of the invention include nucleic acid molecules that encode the epitope-bearing portion of a Neutrokine alpha polypeptide as identified in FIG. 1 and described in more detail below.

  In another aspect, the present invention provides for one of the polynucleotides in the above-described nucleic acid molecule of the present invention (eg, a cDNA clone contained in the ATCC deposit on October 22, 1996) under stringent hybridization conditions. An isolated nucleic acid molecule comprising a polynucleotide that hybridizes to a portion is provided. Depending on “stringent hybridization conditions”, the solution in parentheses (50% formamide, 5 × SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 × Denhardt It is intended to wash the filter in 0.1 × SSC at about 65 ° C. overnight incubation at 42 ° C. in solution, 10% dextran sulfate, and 20 g / ml denatured sheared salmon sperm DNA).

  Depending on the polynucleotide that hybridizes to a “portion” of the polynucleotide, at least about 15 nucleotides (nt) of the reference polynucleotide, and more preferably at least about 20 nt, even more preferably at least about 30 nt, and even more preferably about A polynucleotide (either DNA or RNA) that hybridizes to 30-70 (eg, 50) nt is contemplated. These are useful as diagnostic probes and primers as discussed in more detail above and below.

  For example, by a portion of a polynucleotide of “at least 20 nt long”, the nucleotide sequence of the reference polynucleotide (eg, the deposited cDNA or the nucleotide sequence as shown in FIG. 1 (SEQ ID NO: 1)) More than 20 consecutive nucleotides are contemplated. Of course, only the poly A sequence (eg, the 3 ′ end poly (A) region of Neutrokine α cDNA shown in FIG. 1 (SEQ ID NO: 1)), or the complementary region of the T (or U) residue only. Hybridizing polynucleotides are not included in the polynucleotides of the invention used to hybridize to portions of the nucleic acids of the invention. This is because such polynucleotides hybridize to any nucleic acid molecule comprising a poly (A) region or its complement (eg, particularly any double stranded cDNA clone).

  As indicated, nucleic acid molecules of the invention that encode Neutrokine alpha polypeptide may include, but are not limited to, nucleic acid molecules that encode: the amino acid sequence of the extracellular domain of the polypeptide by itself; And coding sequences and additional sequences of the extracellular domain of the polypeptide (eg intracellular and transmembrane domain sequences, or preprotein or proprotein sequences or sequences encoding preproprotein sequences); Or coding sequence for the extracellular domain of a polypeptide not.

  Also encoded by the nucleic acids of the invention are the protein sequences described above with additional non-coding sequences, such as introns and non-coding 5 ′ and 3 ′ sequences (eg, roles in transcription, mRNA processing (eg, ribosomes) Transcribed untranslated sequences responsible for binding and mRNA stability (including splicing and polyadenylation signals)); including but not limited to additional coding sequences encoding additional amino acids such as sequences that provide additional functionality Not.

  Thus, a sequence encoding a polypeptide can be fused to a marker sequence (eg, a sequence encoding a peptide that facilitates purification of the fused polypeptide). In certain preferred embodiments of this aspect of the invention, the marker amino acid sequence is inter alia a tag provided in a hexa-histidine peptide (eg, a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91111). Many of them are commercially available. For example, Gentz et al., Proc. Natl. Acad. Sci. USA 86: 821-824 (1989), hexahistidine provides convenient purification of the fusion protein. The “HA” tag is another peptide useful for purification corresponding to an epitope derived from influenza hemagglutinin protein, which is described by Wilson et al., Cell 37: 767 (1984). As discussed below, other such fusion proteins include Neutrokine alpha fused to Fc at the N or C terminus.

(Modified and mutant polynucleotides)
The present invention further relates to variants of the nucleic acid molecules of the present invention that encode portions, analogs, or derivatives of Neutrokine alpha protein. Variants can occur naturally, such as natural allelic variants. By “allelic variant” is intended one of several alternative forms of a gene occupying a given locus on the chromosome of an organism. Genes II, Lewin, B.E. Hen, John Wiley & Sons, New York (1985). Non-naturally occurring variants can be generated using mutagenesis techniques known in the art.

  Such variants include those produced by nucleotide substitutions, deletions or additions. Substitutions, deletions, or additions can include one or more nucleotides. Variants can be altered in the coding region, non-coding region, or both. Changes in the coding region can result in conservative or non-conservative amino acid substitutions, deletions or additions. Especially preferred among these are silent substitutions, additions and deletions that do not alter the properties and activities of the Neutrokine alpha protein, or portions thereof. Also particularly preferred in this regard is conservative substitution.

  Most preferably, it is a nucleic acid molecule encoding the extracellular domain of a protein having the amino acid sequence shown in FIG. 1 (SEQ ID NO: 2) or the extracellular domain of the Neutrokine alpha amino acid sequence encoded by the deposited cDNA clone . A further embodiment is a polynucleotide having a nucleotide sequence that is at least 90% identical, and more preferably at least 95%, 96%, 97%, 98%, or 99% identical to a polynucleotide selected from the group consisting of: An isolated nucleic acid molecule comprising: (a) a nucleotide sequence encoding a Neutrokine alpha polypeptide having the complete amino acid sequence in FIG. 1 (SEQ ID NO: 2); (b) in FIG. 1 (SEQ ID NO: 2) Nucleotide sequence encoding the deduced extracellular domain of Neutrokine alpha polypeptide having an amino acid sequence at positions 73 to 285; (c) the complete amino acid encoded by the cDNA clone contained in the ATCC of 22 October 1996 Nucleotide sequence encoding a Neutrokine alpha polypeptide having a sequence (D) a nucleotide sequence encoding the extracellular domain of a Neutrokine alpha polypeptide having an amino acid sequence encoded by a cDNA clone contained in the ATCC deposit of October 22, 1996; and (e) the above (a ), (B), (c), or a nucleotide sequence complementary to any of the nucleotide sequences of (d).

  A polynucleotide having a nucleotide sequence that is at least, for example, 95% “identical” to a reference nucleotide sequence encoding a Neutrokine α polypeptide, such that the polynucleotide sequence is each 100 nucleotides of the reference nucleotide sequence encoding a Neutrokine α polypeptide. It is intended that the nucleotide sequence of the polynucleotide is identical to the reference sequence, except that it may contain up to 5 point mutations per round. In other words, to obtain a polynucleotide having a nucleotide sequence that is at least 95% identical to the reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence can be deleted or replaced with another nucleotide, or the reference Multiple nucleotides up to 5% of all nucleotides in the sequence can be inserted into the reference sequence. These variations of the reference sequence are either at the 5 ′ or 3 ′ terminal position of the reference nucleotide sequence, either individually in the nucleotides in the reference sequence, or in one or more consecutive groups in the reference sequence Can occur anywhere between these end positions.

  In practice, any particular nucleic acid molecule is at least 90%, 95%, 96%, 97%, 98%, or 99%, eg, in the nucleotide sequence shown in FIG. 1 or the nucleotide sequence of the deposited cDNA clone. Whether it is the same, the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix (registered trademark), Genetics Computer Group 11, University Research Park, i 75 And can be determined conventionally. Bestfit is published in Smith and Waterman, Advances in Applied Materials. 2: 482-489 (1981) to find the optimal segment of homology between two sequences. When using Bstfit or any other sequence alignment program to determine whether a particular sequence is, for example, 95% identical to a reference sequence according to the present invention, the parameters are of course the percent identity. Set to be calculated over the entire length of the reference nucleotide sequence and to allow gaps in homology up to 5% of the total number of nucleotides in the reference sequence.

  The present application, regardless of whether it encodes a polypeptide having Neutrokine alpha activity, is at least 90%, 95% of the nucleic acid sequence shown in FIG. 1 (SEQ ID NO: 1) or the deposited cDNA. It relates to nucleic acid molecules that are 96%, 97%, 98%, or 99% identical. This is because, even if a particular nucleic acid molecule does not encode a polypeptide having Neutrokine alpha activity, one skilled in the art will know how to make a nucleic acid molecule, for example, a hybridization probe or a polymerase chain reaction (PCR) primer. This is because it still knows what to use as. Uses of the nucleic acid molecules of the present invention that do not encode a polypeptide having Neutrokine alpha activity include, among others, (1) isolating the Neutrokine alpha gene or allelic variant thereof in a cDNA library; (2) Verma et al. , Human Chromosomes: In situ hybridization to metaphase chromosomal expansions to provide the exact chromosomal location of the Neutrokine alpha gene as described in A Manual of Basic Techniques, Pergamon Press, New York (1988) (eg, FISH). And (3) Northern blot analysis to detect Neutrokine alpha mRNA expression in specific tissues.

  In practice, however, at least 90%, 95%, 96%, 97%, or at least 90%, 95%, 96%, 97% of the nucleic acid sequence shown in FIG. 1 (SEQ ID NO: 1) encoding the polypeptide having Neutrokine alpha protein activity or deposited cDNA, Nucleic acid molecules having sequences that are 98% or 99% identical are preferred. Similar to the activity of the extracellular domain or full-length Neutrokine alpha protein of the present invention as measured by a "polypeptide having Neutrokine alpha activity" in a particular biological assay (but not necessarily Polypeptides that exhibit (not identical) activity are contemplated. For example, the Neutrokine alpha protein of the present invention regulates cell proliferation, cytotoxicity, and cell death. In vitro cell proliferation assays, cytotoxicity assays, and cell death assays for measuring protein effects on specific cells are well known and commonly used in the art to detect cell replication and / or cell death This can be done by using possible reagents. For example, a number of such assays for TNF-related protein activity are described in various references in the background section of this disclosure above. Briefly, such an assay involves collecting human or animal (eg, mouse) cells and (1) a transfected host cell supernatant containing a Neutrokine alpha protein (or candidate polypeptide), or (2) Mixing with untransfected host cell supernatant control, and measuring the effect on cell number or viability after incubation for a specified period of time. Such cell growth regulatory activity, as can be measured in this type of assay, is useful for the treatment of tumors, tumor metastases, infections, autoimmune disease inflammation, and other immune related diseases.

  Neutrokine alpha regulates cell proliferation and differentiation in a dose dependent manner in the above assay. Thus, a “polypeptide having Neutrokine alpha protein activity” also includes polypeptides that exhibit any of the same cellular regulatory (particularly immunomodulatory) activities in a dose-dependent manner in the above assay. The degree of dose-dependent activity need not be the same as that of Neutrokine α protein, but preferably a “polypeptide having Neutrokine α protein activity” is substantially in a given activity compared to Neutrokine α protein. (Ie, the candidate polypeptide exhibits about 25-fold greater or less activity, and preferably about 10-fold less activity compared to the reference Neutrokine alpha protein) ).

  Like other members of the TNF family, Neutrokine alpha exhibits activity against leukocytes including, for example, monocytes, lymphocytes, and neutrophils. This is why Neutrokine alpha is active in directing the proliferation, differentiation and mobilization of these cell types. Such activity is useful for immune enhancement or suppression, bone marrow protection, stem cell mobilization, control of acute and chronic inflammation, and treatment of leukemia. Assays for measuring such activity are known in the art. See, for example, Peters et al., Immun. Today 17: 273 (1996); Young et al. , J. et al. Exp. Med. 182: 1111 (1995); Caux et al., Nature 390: 258 (1992); and Santiago-Shwarz et al., Adv. Exp. Med. Biol. 378: 7 (1995).

  Of course, due to the degeneracy of the genetic code, one of ordinary skill in the art will have at least 90%, 95%, 96%, 97%, 98% of the deposited cDNA nucleic acid sequence or the nucleic acid sequence shown in FIG. 1 (SEQ ID NO: 1). It is immediately recognized that a large number of nucleic acid molecules having a sequence that is% or 99% identical encodes a polypeptide “having Neutrokine alpha protein activity”. In fact, since all degenerate variants of these nucleotide sequences encode the same polypeptide, this will be apparent to those skilled in the art even without performing the above-described comparative assay. It is further recognized in the art that for such nucleic acid molecules that are not degenerate variants, a reasonable number also encodes a polypeptide having Neutrokine alpha protein activity. This is, as described further below, for those skilled in the art that either amino acid substitutions that are less likely or less likely to significantly affect protein function (e.g., This is because they completely know the substitution of one aliphatic amino acid with a second aliphatic amino acid.

(Vector and host cell)
The invention also relates to vectors containing the isolated DNA molecules of the invention, host cells genetically engineered with recombinant vectors, and production of Neutrokine alpha polypeptides or fragments thereof by recombinant techniques. The vector can be, for example, a phage vector, a plasmid, a viral vector, or a retroviral vector. Retroviral vectors can be replicable or replication defective. In the latter case, viral propagation generally occurs only in complementary host cells. The polynucleotide can be linked to a vector containing a selectable marker for growth in a host cell. In general, plasmid vectors are introduced in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid. If the vector is a virus, the vector can be packaged in vitro using an appropriate packaging cell line and then transduced into host cells.

  DNA inserts are suitable promoters (eg, phage λPL promoter, E. coli lac promoter, trp promoter, phoA promoter, and tac promoter, SV40 early and late promoters, and retroviral LTR promoters, to name a few). ) Should be operatively coupled to. Other suitable promoters are known to those skilled in the art. The expression construct further includes a site for transcription initiation, transcription termination, and a ribosome binding site for translation in the transcription region. The coding portion of the extracellular domain of the transcript expressed by the construct preferably includes a transcription start at the beginning of the polypeptide to be translated and a suitably placed stop codon (UAA, UGA, or UAG at the end). )including.

  As indicated, the expression vector preferably includes at least one selectable marker. Such markers include dihydrofolate reductase, G418, or neomycin resistance for eukaryotic cell culture, and E. coli. Examples of culture in E. coli and other bacteria include a tetracycline resistance gene, a kanamycin resistance gene, or an ampicillin resistance gene. Representative examples of suitable hosts include bacterial cells (eg, E. coli cells, Streptomyces cells, and Salmonella typhimurium cells); fungal cells (eg, yeast cells); insect cells (eg, Drosophila S2 cells and Spodoptera Sf9 cells) ); Animal cells (eg, CHO cells, COS cells, 293 cells, and Bowes melanoma cells); and plant cells. Suitable culture media and conditions for the above host cells are known in the art.

  Among the preferred vectors for use in bacteria are pQE70, pQE60, and pQE-9 (available from QIAGEN, Inc., supra); pBS vector, Pagescript vector, Bluescript vector, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene As well as ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (available from Pharmacia). Among preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXT1, and pSG (available from Stratagene); and pSVK3, pBPV, pMSG, and pSVL (available from Pharmacia). Other suitable vectors will be readily apparent to those skilled in the art.

  Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE dextran mediated transfection, cationic lipid mediated transfection, electroporation, transduction, infection or other methods. Such methods are described in many standard laboratory manuals such as Davis et al., Basic Methods In Molecular Biology (1986).

  The polypeptide can be expressed in a modified form, such as a fusion protein, and can include additional heterologous functional regions as well as secretion signals. For example, a region of additional amino acids, particularly charged amino acids, can be added to the N-terminus of a polypeptide to improve stability and persistence in a host cell, during purification, or during subsequent manipulation and storage. Can be added. Peptide moieties can also be added to the polypeptide to facilitate purification. Such regions can be removed prior to final preparation of the polypeptide. In particular, the addition of peptide moieties to polypeptides to produce secretion or excretion, to improve stability, and to facilitate purification is well known in the art and is a routine technique . Preferred fusion proteins comprise a heterologous region derived from immunoglobulin useful for protein stabilization and purification. For example, EP-A-0 464 533 (Canadian counterpart application 2045869) discloses a fusion protein comprising various portions of the constant region of an immunoglobulin molecule along with another human protein or portion thereof. In many cases, the Fc portion in the fusion protein is quite advantageous for use in therapy and diagnosis, thus for example resulting in improved pharmacokinetic properties (EP-A 0232 262). On the other hand, for some uses it is desirable that the Fc portion be deleted after the fusion protein has been expressed, detected and purified in the advantageous manner described. This is the case when the Fc portion proves to be a hindrance to use in therapy and diagnosis (eg when the fusion protein is used as an antigen for immunization). In drug discovery, human proteins such as, for example, hIL-5 are fused with the Fc portion for the purpose of high-throughput screening assays to identify hIL-5 antagonists. D. Bennett et al., J. MoI. Molecular Recognition 8: 52-58 (1995), and K.M. Johanson et al. Biol. Chem. 270: 9459-9471 (1995).

  Neutrokine alpha protein can be subjected to ammonium sulfate precipitation or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography, and lectin chromatography. It can be recovered from recombinant cell culture and purified by well-known methods including. Most preferably, high performance liquid chromatography (“HPLC”) is used for purification. The polypeptides of the present invention are naturally purified products, products of chemical synthesis procedures, and prokaryotic or eukaryotic hosts (including, for example, bacterial cells, yeast cells, higher plant cells, insect cells, and mammalian cells). Including products produced by recombinant technology. Depending on the host used in the recombinant production procedure, the polypeptides of the invention may be glycosylated or non-glycosylated. Furthermore, the polypeptides of the present invention may also include an initiating modified methionine residue in some cases as a result of host-mediated processes.

(Neutrokine α polypeptide and fragment)
The invention further provides an amino acid sequence encoded by the deposited cDNA, or an isolated Neutrokine α polypeptide having the amino acid sequence of FIG. 1 (SEQ ID NO: 2), or a peptide comprising a portion of the polypeptide or A polypeptide is provided.

(Modified and mutant polypeptides)
Protein manipulation can be used to improve or modify the characteristics of the Neutrokine alpha polypeptide. Recombinant DNA technology known to those skilled in the art can be used to create new mutant proteins or “muteins or fusion proteins containing single or multiple amino acid substitutions, deletions, additions”. Such modified polypeptides can exhibit, for example, enhanced activity or increased stability. In addition, they can be purified in high yield and exhibit better solubility than the corresponding natural polypeptides at least under certain purification and storage conditions.

(N-terminal deletion mutant and C-terminal deletion mutant)
For example, for many proteins containing the extracellular domain or mature form of a secreted protein, one or more amino acids can be deleted from the N-terminus or C-terminus without substantial loss of biological function. Known in the art. For example, Ron et al. Biol. Chem. , 268: 2984-2988 (1993) reported a modified KGF protein with heparin binding activity even though 3, 8, or 27 amino terminal amino acid residues were lost.

  In this case, since the protein of the present invention is a member of the TNF polypeptide family, deletion of the N-terminal amino acid up to the Gly (G) residue at position 191 in FIG. It may retain activity (eg, cytotoxicity against appropriate target cells).

  Polypeptides with additional N-terminal deletions containing Gly (G) residues are not expected to retain such biological activity. This is because this residue is the beginning of a conserved domain required for biological activity in TNF-related polypeptides. However, even if deletion of one or more amino acids from the N-terminus of the protein resulted in alteration of loss of one or more biological functions of the protein, other biological activities can still be retained. Thus, a truncated protein's ability to induce and / or bind an antibody that recognizes the complete or extracellular domain of a protein generally has N residues less than the majority of the complete or extracellular domain of the protein. If removed from the end, it is retained. Whether a particular polypeptide lacking the N-terminal residue of the complete protein retains such immunological activity is known in the routine methods described herein and elsewhere in the art. It can be easily determined by routine methods.

  Accordingly, the present invention further comprises a polypeptide having one or more residues from the amino terminus to Gly191 residues from the amino terminus of the amino acid sequence of Neutrokine α shown in FIG. 1 (SEQ ID NO: 2), and Polynucleotides encoding such polypeptides are provided. In particular, the present invention provides a polypeptide having the amino acid sequence of residues n to 190 of SEQ ID NO: 2, wherein n is an integer ranging from 2 to 190, and 191 is a Neutrokine alpha protein Is the position of the first residue from the N-terminus of the complete Neutrokine alpha polypeptide (shown in SEQ ID NO: 2) that is thought to be required for the activity of More particularly, the present invention provides a polynucleotide encoding a polypeptide having the amino acid sequence of the following residues of SEQ ID NO: 2.

Polynucleotides encoding these polypeptides are also provided.

  Similarly, many examples of biologically functional C-terminal deletion muteins are known. For example, interferon gamma exhibits up to 10-fold higher activity by deleting 8-10 amino acid residues from the carboxy terminus of this protein (Doebeli et al., J. Biotechnology 7: 199-216 (1988)). . Since the protein is a member of the TNF polypeptide family, deletion of the C-terminal amino acid up to Leu at position 284 results in most if not all biological activities (eg, modulation of receptor binding and cell replication). ). Polypeptides with deletions of up to about 10 additional C-terminal residues may also retain some activity (eg, receptor binding), but such polypeptides are conserved TNF beginning approximately at Leu284. It lacks the domain part. However, even if the deletion of one or more amino acids at the C-terminus of the protein modifies the loss of one or more biological functions of the protein, other biological activities can still be retained. Thus, the ability of a truncated protein to induce and / or bind an antibody that recognizes a complete or mature protein generally retains when fewer than most residues of the complete or mature protein are removed from the C-terminus. Is done. Whether a particular polypeptide lacking the C-terminal residue of the complete protein retains such immunological activity is known in the routine methods described herein and other art-recognized. It can be easily determined by routine methods.

  Accordingly, the present invention further provides a polypeptide having from one or more residues from the carboxy terminus to Gly 274 residues from the carboxy terminus of the amino acid sequence of Neutrokine α shown in FIG. 1 (SEQ ID NO: 2), and Polynucleotides encoding such polypeptides are provided. In particular, the invention provides a polypeptide having residues 1-m of the amino acid sequence of SEQ ID NO: 2, wherein m is any integer in the range of 274-284. More particularly, the present invention relates to residues 1-274, 1-275, 1-276, 1-277, 1-278, 1-279, 1-280, 1-281, 1-282 of SEQ ID NO: 2. , 1-283, and polynucleotides encoding polypeptides having 1-284 amino acid sequences. Polynucleotides encoding these polypeptides are also provided.

  Also provided is a polypeptide in which one or more amino acids have been deleted from both the amino terminus and the carboxy terminus, which generally has residues nm of the amino acid sequence of SEQ ID NO: 2, wherein n And m can be described as being an integer as described above. Also, a polypeptide consisting of a portion of the complete Neutrokine α-amino acid sequence encoded by the cDNA clone contained in the ATCC deposit on October 22, 1996, wherein this portion is contained in the deposited clone Poly excluded from the complete amino acid sequence encoded by the cDNA from 1 to 190 amino acids from the amino terminus or from 1 to 11 amino acids from the C terminus (or any combination of these N and C terminal deletions) Nucleotide sequences that encode the peptides are also included. Polynucleotides encoding the above deletion polypeptides are also provided.

(Other mutants)
In addition to the terminally deleted forms of the proteins described above, one of skill in the art will recognize that some amino acid sequences of Neutrokine alpha polypeptides can be altered without having a significant effect on the structure or function of the protein. . If such sequence differences are intended, it should be recalled that there are important regions of the protein that determine activity.

Accordingly, the invention further includes variants of Neutrokine α polypeptide that exhibit substantial Neutrokine α polypeptide activity or that include regions of Neutrokine α protein (eg, the protein portion discussed below). Such variants include deletions, insertions, inversions, repeats, and type substitutions selected according to general rules known in the art to have little effect on activity. For example, further guidance on creating phenotypically silent amino acid substitutions can be found in Bowie, J. et al. U. “Deciphering the Message in Protein Sequences:
Tolerance to Amino Acid Substitutions ”, Science 247: 1306-1310 (1990). Here, the authors show that there are two main approaches to study the tolerance of amino acid sequences to changes. The first method is by an evolutionary process, where mutations are either accepted or rejected by natural selection. The second approach uses genetic engineering to introduce amino acid changes at specific positions in the cloned gene, and sequences that retain functionality are identified by selection or screening.

  According to the author, these studies revealed that proteins are surprisingly tolerant of amino acid substitutions. The authors further indicate which amino acid substitutions appear to be tolerated at specific positions in the protein. For example, most buried amino acid residues require nonpolar side chains, while surface side chain features are generally rarely conserved. Other such phenotypically silent substitutions are described in Bowie, J. et al. U. Et al., Cited above and in the references cited therein. Commonly seen as conservative substitutions are substitutions of one amino acid for another in the aliphatic amino acids Ala, Val, Leu, and Ile; exchange of hydroxyl residues Ser and Thr, acidic residues Asp and Glu exchange, substitution between amide residues Asn and Gln, exchange of basic residues Lys and Arg, and substitution between aromatic residues Phe, Tyr.

  Thus, a fragment, derivative, or analog of the polypeptide of FIG. 1 (SEQ ID NO: 2) or the polypeptide encoded by the deposited cDNA is: (i) one or more amino acid residues are conservative or non-conservative amino acids Are substituted with residues, preferably conservative amino acid residues, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) One or more amino acid residues containing a substituent, or (iii) the extracellular domain of a polypeptide is fused with another compound, such as a compound that increases the half-life of the polypeptide (eg, polyethylene glycol). Or (iv) an additional amino acid is an IgG Fc fusion region peptide or leader or secretory sequence or polypeptide Which is fused to the extracellular domain of the polypeptide, such as a tide or a proprotein sequence of an extracellular sequence used for purification domain may be. Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.

  Accordingly, the Neutrokine alpha of the present invention may include one or more amino acid substitutions, deletions, or additions derived from either natural mutations or artificial manipulations. As indicated, non-critical changes in properties are preferred, such as conservative amino acid substitutions that do not significantly affect protein folding or activity (see Table 1).

  Amino acids in the Neutrokine alpha protein of the invention that are essential for function can be identified by methods known in the art, such as site-directed mutagenesis or alanine scanning mutagenesis (Cunningham and Wells, Science 244: 1081). -1085 (1989)). The latter procedure induces a single alanine mutation at every residue in the molecule. The resulting mutant molecules are then tested for biological activity such as receptor binding or in vitro or in vivo proliferative activity.

Of particular concern is the substitution of a charged amino acid with another charged or neutral amino acid. This can result in proteins with improved properties that are highly desirable (eg, less aggregation). Aggregation is a problem not only because it can result in decreased activity, but also because aggregates can be immunogenic when preparing pharmaceutical formulations (Pinkcard et al., Clin. Exp. Immunol. 2: 331-340). (1967); Robbins et al., Diabetes 36: 838-845 (1987); Cleland et al., Crit.
Rev. Therapeutic Drug Carrier Systems 10: 307-377 (1993)).

  Amino acid substitutions can also change the selectivity of ligand binding to cell surface receptors. For example, Ostade et al., Nature 361: 266-268 (1993) describe specific mutations that result in selective binding of TNFα to only one of the two known types of TNF receptors. Since neurokine alpha is a member of the TNF polypeptide family, a mutation similar to that of TNF-alpha appears to have a similar effect on neurocaine alpha.

  Sites important for ligand-receptor binding can also be determined by structural analysis such as crystallization, nuclear magnetic resonance, or photoaffinity labeling (Smith et al., J. Mol. Biol. 224: 899-904 (1992)). And de Vos et al., Science 255: 306-312 (1992)). Since neurokine alpha is a member of the TNF-related protein family, preferably the mutation encodes an amino acid of the TNF conserved domain in order to modulate rather than completely eliminate the biological activity of neurokine alpha. Created within the sequence (ie, positions 191 to 284 of FIG. 1 (SEQ ID NO: 2)), more preferably at residues in this region that are not conserved by all members of the TGF family. By making specific mutations in Neutrokine alpha at positions where such conserved amino acids are typically found in related TNF, Neutrokine alpha acts as an antagonist, thereby possessing angiogenic activity. To do. Accordingly, the polypeptides of the present invention include neurokine alpha mutants. Such a Neutrokine α variant consists of the full length or preferably the extracellular domain of the Neutrokine α amino acid sequence shown in FIG. 1 (SEQ ID NO: 2). Furthermore, the forming part of the present invention is also an isolated polynucleotide comprising a nucleic acid sequence encoding the Neutrokine alpha variant described above.

  The polypeptides of the present invention are preferably provided in an isolated form and are preferably substantially purified. A recombinantly produced form of Neutrokine alpha polypeptide can be substantially purified by a one-step method as described in Smith and Johnson, Gene 67: 31-40 (1988).

  The polypeptide of the present invention comprises the complete polypeptide encoded by the deposited cDNA, including the intracellular domain, the transmembrane domain, and the extracellular domain of the polypeptide encoded by the deposited cDNA. Extracellular domain minus domain and transmembrane domain, complete polypeptide of FIG. 1 (SEQ ID NO: 2), extracellular domain of FIG. 1 (SEQ ID NO: 2) minus intracellular domain and transmembrane domain, and Polypeptides having at least 90% similarity to polypeptides, more preferably at least 95% similarity, and even more preferably at least 96%, 97%, 98%, or 99% similarity.

  Further polypeptides of the invention are at least 80% identical, more preferably at least 90% or 95% identical, even more preferably to the polypeptide encoded by the deposited cDNA or the polypeptide of FIG. 1 (SEQ ID NO: 2). It includes polypeptides that are at least 96%, 97%, 98%, or 99% identical, and also includes portions of such polypeptides having at least 30 amino acids, and more preferably at least 50 amino acids.

  The Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix (R), Genetics Computer5 Group5, University Research 75, University Research 75, University Research 75) A similarity value resulting from comparing the amino acid sequences of two polypeptides using a default setting to determine is contemplated. Bestfit uses the local homology algorithm of Smith and Waterman (Advanceds in Applied Mathematics 2: 482-489 (1981)) to find the optimal segment of similarity between two sequences.

  A polypeptide sequence having at least, for example, a 95% “identical” amino acid sequence to a reference amino acid sequence of a Neutrokine α polypeptide results in a polypeptide sequence of up to 5 for every 100 amino acids of the Neutrokine α polypeptide reference amino acid sequence. The amino acid sequence of the polypeptide is intended to be identical to the reference sequence, except that it may contain the following amino acid changes. In other words, to obtain a polypeptide having an amino acid sequence that is at least 95% identical to the reference amino acid sequence, up to 5% of amino acid residues in the reference sequence can be deleted or replaced with another amino acid, Alternatively, multiple amino acids of up to 5% total amino acid residues in the reference sequence can be inserted into the reference sequence. These reference sequence modifications are dispersed either at the amino-terminal position or the carboxy-terminal position of the reference amino acid sequence, or individually between residues of the reference sequence or within one or more adjacent groups within the reference sequence Can occur somewhere between the end positions to be made.

  In fact, any particular polypeptide may be at least 90%, 95%, for example, relative to the amino acid sequence shown in FIG. 1 (SEQ ID NO: 2), or the amino acid sequence encoded by the deposited cDNA clone, Whether it is 96%, 97%, 98%, or 99% identical is bestfit program (Wisconsin Sequence Analysis Package, Unix (R) Version 8, Genetics Computer Park Group, University Research 75, University Research 75). Can be determined routinely using known computer programs such as WI 53711). When using Bestfit or any other sequence alignment program to determine whether a particular sequence is, for example, 95% identical to a reference sequence of the invention, it will be appreciated that the percent identity is the reference amino acid sequence. The parameters are set such that gaps in homology of up to 5% of the total number of amino acid residues in the reference sequence are allowed.

  The polypeptides of the present invention can be used as molecular weight markers in SDS-PAGE gels or molecular sieve gel filtration columns using methods well known to those skilled in the art.

  As described in detail below, the polypeptides of the present invention are also useful in assays for detecting Neutrokine alpha protein expression, as described below, or agonists that can enhance or inhibit Neutrokine alpha protein function. And as an antagonist, it can be used to raise polyclonal and monoclonal antibodies. In addition, such polypeptides can be used in a yeast two-hybrid system to “capture” Neutrokine alpha protein binding proteins that are also candidate agonists and antagonists of the present invention. The yeast two-hybrid system is described in Fields and Song, Nature 340: 245-246 (1989).

(Epitope holding part)
In another aspect, the present invention provides a peptide or polypeptide comprising an epitope-bearing portion of the polypeptide of the present invention. The epitope portion of this polypeptide is the immunogenic or antigenic epilope of the polypeptide of the invention. An “immunogenic epitope” is defined as the part of a protein that elicits an antibody response when the entire protein is an immunogen. On the other hand, the region of a protein molecule to which an antibody can bind can be defined as an “antigenic epitope”. The number of immunogenic epitopes in a protein is generally less than the number of antigenic epitopes. See, for example, Geysen et al., Proc. Natl. Acad. Sci.
USA 81: 3998-4002 (1983).

For the selection of peptides or polypeptides carrying antigenic epitopes (ie including regions of the protein molecule to which the antibody can bind), relatively short synthetic peptides that mimic part of the protein sequence were partially mimicked It is well known in the art that antisera that react with proteins can be routinely induced. For example, Sutcliffe, J. et al. G. Shinnick, T .; M.M. Green, N .; And Learner, R .; A. (1983) "Antibodies that react with predetermined"
sites on proteins. Science 219: 660-666 ". Peptides capable of inducing protein-reactive sera are frequently present in the primary sequence of proteins and can be characterized by a simple set of chemical rules and immunity of intact proteins (ie, immunogenic epitopes) Neither the dominant region nor the amino terminus or carboxyl terminus is restricted. The antigenic epitope-bearing peptides and polypeptides of the invention are therefore useful for raising antibodies, including monoclonal antibodies that specifically bind to the polypeptides of the invention. See, for example, Wilson et al., Cell 37: 767-778 (1984) 777.

  The antigenic epitope-bearing peptides and polypeptides of the present invention are preferably comprised of at least 7, more preferably at least 9, and most preferably about 15 to about 30 amino acids within the amino acid sequence of the polypeptides of the present invention. Contains an array. Non-limiting examples of antigenic polypeptides or peptides that can be used to produce Neutrokine-specific antibodies include the following: The amino acid residues from about Phe115 to about Leu147 of FIG. 1 (SEQ ID NO: 2) A polypeptide containing the amino acid residue of about Ile150 to about Tyr163 of FIG. 1 (SEQ ID NO: 2); a polypeptide containing the amino acid residue of about Ser171 to about Phe194 of FIG. 1 (SEQ ID NO: 2) A polypeptide containing about Glu223 to about Tyr247 amino acid residues of FIG. 1 (SEQ ID NO: 2); a polypeptide containing about Ser271 to about Leu278 amino acid residues of FIG. 1 (SEQ ID NO: 2). These polypeptide fragments were determined to possess the antigenic epitope of Neutrokine alpha protein by analysis of the Jameson-Wol antigenicity index as shown in FIG. 3 above.

  The epitope-bearing peptides and polypeptides of the present invention can be produced by any convenient means. For example, Houghten, R .; A. (1985) General method for the rapid solid-phase synthesis of large numbers of peptide IDs: specificity of antigenicity-influence interaction. Proc. Natl. Acad. Sci. USA 82: 5131-5135; this “multiple peptide synthesis (SMPS)” process is further described in US Pat. No. 4,631,211 to Houghten et al. (1986).

  The epitope-bearing peptides and polypeptides of the present invention are used to induce antibodies by methods well known in the art. See, for example, Sutcliffe et al., Supra; Wilson et al., Supra; Et al., Proc. Natl. Acad. Sci. USA 82: 910-914; and Bittle, F .; J. et al. Et al. Gen. Virol. 66: 2347-2354 (1985). The immunogenic epitope-bearing peptide of the invention (ie, the portion of the protein that elicits an antibody response) is identified according to methods known in the art when the entire protein is the immunogen. For example, Geysen et al., Supra. Still further, Geysen (1990) US Pat. No. 5,194,392 is a topological equivalent of an epitope that is complementary to a particular paratope (antigen binding site) of the antibody of interest, ie, a “mimotope”. A general method for detecting or determining the sequence of a monomer (amino acid or other compound) is described. More generally, Geysen (1989) US Pat. No. 4,433,092 describes a sequence of monomers that are topological equivalents of a ligand that is complementary to the ligand binding site of a particular receptor of interest. Describes how to detect or determine. Similarly, Houghten, R. in Perkylated Oligopeptide Mixtures. A. (1996) U.S. Pat. No. 5,480,971 is preferential over linear C1-C7-alkyl peralkylated oligopeptides and sets and libraries of such peptides and acceptor molecules of interest. Disclosed is a method of using such oligopeptide sets and libraries to determine the sequence of hyperalkylated oligopeptides that bind to each other. Thus, non-peptide analogs of the epitope-bearing peptides of the invention can also be made routinely by these methods.

(Fusion protein)
As those skilled in the art will appreciate, the Neutrokine alpha polypeptides of the present invention, as well as those epitope-bearing fragments described above, can bind to a portion of the constant domain of an immunoglobulin (IgG), resulting in a chimeric peptide. These fusion proteins facilitate purification and show an increased half-life in vivo. This has been shown, for example, for chimeric proteins consisting of the first two domains of a human CD4-polypeptide and various domains of the constant region of a mammalian immunoglobulin heavy or light chain (EP A 394,827; Traunecker et al., Nature 331: 84-86 (1988)). Fusion proteins having a disulfide-linked dimer structure with an IgG moiety may also be more effective than monomeric Neutrokine alpha protein or protein fragment alone in binding and neutralizing other molecules (Fontoulakis et al., J. Biochem. 270: 3958). -3964 (1995)).

(Diagnosis of immune system related disorders)
We have discovered that Neutrokine alpha is expressed in a variety of tissues and particularly neutrophils. For a number of immune system related disorders, substantially compared to “standard” neurokine alpha gene expression levels (ie, Neutrokine alpha expression levels in immune system tissues or fluids from individuals without immune system disorders) Altered (increased or decreased) levels of Neutrokine alpha gene expression may result in immune system tissues or other cells or body fluids (eg, serum, plasma, urine, synovial fluid, or Cerebrospinal fluid). Thus, the present invention provides a useful diagnostic method during the diagnosis of system disorders, which involves the expression level of a gene encoding Neutrokine alpha protein in an immune system tissue or other cell or body fluid from an individual. Measuring and comparing the measured gene expression level with a standard Neutrokine alpha gene expression level, whereby an increase or decrease in gene expression level compared to a standard is indicative of an immune system disorder.

  In particular, Neutrokine alpha protein, and significantly increased or decreased levels of mRNA encoding Neutrokine alpha protein, when a particular tissue in a mammal with immune cancer is compared to the corresponding "standard" level Is considered to be expressed. In addition, enhanced or suppressed levels of Neutrokine alpha protein, when compared to sera from mammals of the same species that do not have cancer, certain body fluids (eg, serum, Plasma, urine, and cerebrospinal fluid).

  Thus, the present invention provides a useful diagnostic method during the diagnosis of immune system disorders (including cancers of this system). The method comprises measuring the expression level of a gene encoding Neutrokine alpha protein in an immune system tissue or other cell or body fluid from an individual, and determining the measured gene expression level and the standard Neutrokine alpha gene expression level. An increase or decrease in gene expression level compared to a standard is indicative of an immune system disorder.

  If the diagnosis of a disorder in the immune system (including tumor diagnosis) has already been made according to conventional methods, the present invention is useful as a prognostic indicator, thereby enhancing or suppressing Neutrokine alpha gene expression. The patients shown will experience worse clinical results compared to patients expressing this gene at levels closer to the standard level.

  By “assaying the expression level of a gene encoding a Neutrokine alpha protein” directly (eg, by determining or assessing absolute protein or mRNA levels) or relative in a first biological sample Of the level of Neutrokine alpha protein or the level of mRNA encoding Neutrokine alpha protein either manually (eg, by comparison with Neutrokine alpha protein protein level or mRNA level in a second biological sample) Intended for quantitative or quantitative measurement or evaluation. Preferably, the Neutrokine alpha protein level or mRNA level in the first biological sample is measured or evaluated and compared to a standard Neutrokine alpha protein level or mRNA level. The standard can be obtained from a second biological sample obtained from an individual without the disorder or can be determined by an average level from a population of individuals without an immune system disorder. As assessed in the art, once a standard Neutrokine alpha protein level or mRNA level is known, it can be used repeatedly as a standard for comparison.

  By “biological sample” is intended any biological sample obtained from an individual, body fluid, cell line, tissue culture, or other source including Neutrokine alpha protein or mRNA. As shown, the biological sample is a bodily fluid (eg, serum, plasma, urine, synovial fluid, and cerebrospinal fluid) that contains the free extracellular domain of Neutrokine alpha protein, immune system tissue, and complete or free The extracellular domain of the Neutrokine alpha protein or other tissue source found to express Neutrokine alpha receptor. Methods for obtaining tissue biopsies and body fluids from mammals are well known in the art. If the biological sample contains mRNA, tissue biopsy is the preferred source.

  The present invention is useful for the diagnosis or treatment of various immune system related disorders in mammals (preferably humans). Such disorders include tumors and tumor metastases, infection by bacteria, viruses and other parasites, immunodeficiencies, inflammatory diseases, lymphadenopathy, autoimmune diseases, and graft versus host disease. However, it is not limited to these.

  Total cellular RNA can be obtained using any suitable technique (eg, the one-step guanidine-thiocyanate-phenol-chloroform method described in Chomczynski and Sacchi, Anal. Biochem. 162: 156-159 (1987)). It can be isolated from a biological sample. The level of mRNA encoding Neutrokine alpha protein is then assayed using any suitable method. These include Northern blot analysis, S1 nuclease mapping, polymerase chain reaction (PCR), reverse transcription combined with polymerase chain reaction (RT-PCR), and reverse transcription combined with ligase chain reaction (RT-LCR).

An assay for Neutrokine alpha protein levels in a biological sample can occur using antibody-based techniques. For example, Neutrokine alpha protein expression in tissues can be studied by classical immunohistological methods (Jalkanen, M. et al., J. Cell. Biol. 101: 976-985 (1985); Jalkanen, M. et al. J. Cell.Biol.105: 3087-3096 (1987)). Other antibody-based methods useful for detecting Neutrokine alpha protein gene expression include immunoassays such as enzyme-linked immunosorbent assay (ELISA) and radioimmunoassay (RIA). Suitable antibody assay labels are known in the art and include glucose oxidase and radioisotopes (eg, iodine ( ¹²⁵ I, ¹²¹ I), carbon ( ¹⁴ C), sulfur ( ³⁵ S), tritium ( ³ H), indium ( ¹¹¹ In), and technetium ( ^99m Tc)), as well as fluorescent labels (eg, fluorescein and rhodamine) and enzymes, labels such as biotin.

  In addition to assaying Neutrokine alpha protein levels in a biological sample obtained from an individual, Neutrokine alpha protein can also be detected in vivo by image analysis. Antibody labels or markers for in vivo image analysis of Neutrokine alpha protein include those detectable by radiography, NMR, or ESR. For radiography, suitable labels include radioactive isotopes such as barium or cesium that emit detectable radiation but are not clearly harmful to the subject. Suitable markers for NMR and ESR include those with a detectable characteristic rotation, such as deuterium, that can be incorporated into antibodies by labeling the relevant hybridoma nutrients.

Labeled with a suitable detectable image analysis moiety, such as a radioisotope (eg, ¹³¹ I, ¹¹¹ In, ^99m Tc), a radio-opaque substrate, or a substance detectable by nuclear magnetic resonance A Neutrokine alpha protein-specific antibody or antibody fragment is introduced (eg, parenterally, subcutaneously, or intravenously) into a mammal to be tested for immune system disorders. It will be understood in the art that the size of the subject and the image analysis system used will determine the amount of image analysis portion required to produce a diagnostic image. In the case of a radioisotope moiety, for a human subject, the amount of radioactivity injected is ^99m Tc, usually in the range of about 5-20 millicuries. The labeled antibody or antibody fragment then accumulates preferentially at the location of the cell containing Neutrokine alpha protein, respectively. In vivo tumor image analysis is W. Burchiel et al., “Immunopharmacologicals of Radiolabeled Antibodies and Their Fragments” (Tumming Imaging Chapter 13: The Radiodetection of. Yes.

(antibody)
Neutrokine alpha protein-specific antibodies for use in the present invention can be raised against the complete Neutrokine alpha protein or antigenic polypeptide fragment thereof. This can be presented to an animal system (eg, rabbit or mouse) with a carrier protein such as albumin or without a carrier if it is long enough (at least about 25 amino acids).

As used herein, the term “antibody” (Ab) or “monoclonal antibody” (Mab) refers to complete molecules and antibody fragments (eg, Fab and F) that can specifically bind to Neutrokine alpha protein. (Ab ') ₂ ). Fab and F (ab ′) ₂ fragments lack the Fc fragment of the complete antibody, are removed more rapidly by circulation, and have little to no nonspecific tissue binding of the complete antibody (Wahl et al., J Nucl.Med. 24: 316-325 (1983)). These fragments are therefore preferred.

  The antibodies of the present invention can be prepared by any of a variety of methods. For example, cells expressing Neutrokine alpha protein or antigenic fragment thereof can be administered to animals to induce the production of serum containing polyclonal antibodies. In a preferred method, a Neutrokine alpha protein preparation is prepared and purified as described above, so that it is substantially free of natural contaminants. Such preparations are then introduced into animals to produce a more specific activity polyclonal antisera.

In the most preferred method, the antibody of the invention is a monoclonal antibody (or a Neutrokine alpha protein binding fragment thereof). Such monoclonal antibodies can be synthesized using hybridoma technology (Kohler et al., Nature 256: 495 (1975); Kohler et al., Eur. J. Immunol. 6: 511 (1976); Kohler et al., Eur. J. Immunol. 6: 292 ( 1976); Hammerling et al .: Monoclonal Antibodies and T-Cell.
Hybridomas, Elsevier, N .; Y. (1981) pp 563-681). In general, such a procedure involves immunizing an animal (preferably a mouse) with a Neutrokine alpha protein antigen, or more preferably with a Neutrokine alpha protein expressing cell. Suitable cells can be recognized by their ability to bind anti-Neutrokine alpha protein antibodies. Such cells can be cultured in any suitable tissue culture medium; however, supplemented with 10% fetal calf serum (inactivated at about 56 ° C.) and about 10 g / l non-essential amino acid, about 1 Cells are preferably cultured in Earle's modified Eagle's medium supplemented with 1,000,000 U / ml penicillin and about 100 μg / ml streptomycin. Such mouse splenocytes are extracted and fused with an appropriate myeloma cell line. Any suitable myeloma cell line can be used in accordance with the present invention; however, it is preferred to use the parent myeloma cell line (SP2O) available from the American Type Culture Collection, Rockville, Maryland. After fusion, the resulting hybridoma cells are selectively maintained in HAT medium and then cloned by limiting dilution as described in Wands et al. (Gastroenterology 80: 225-232 (1981)). The hybridoma cells obtained by such selection are then assayed to identify clones that secrete antibodies that can bind to Neutrokine alpha protein antigen.

  Alternatively, additional antibodies that can bind to Neutrokine alpha protein antigen can be produced in a two-step procedure through the use of anti-idiotype antibodies. Such a method uses the fact that an antibody is itself an antigen, and thus it is possible to obtain an antibody that binds to a secondary antibody. In accordance with this method, Neutrokine alpha protein specific antibodies are used to immunize animals (preferably mice). The splenocytes of such animals are then used to produce hybridoma cells, and the hybridoma cells are antibodies whose ability to bind to Neutrokine alpha protein-specific antibodies can be blocked by Neutrokine alpha protein antigens, respectively. Are screened to identify clones producing. Such antibodies include anti-idiotype antibodies against Neutrokine alpha protein-specific antibodies and can be used to immunize animals to induce the formation of additional Neutrokine alpha protein-specific antibodies.

It will be appreciated that Fab fragments and F (ab ′) ₂ fragments and other fragments of the antibodies of the present invention may be used in accordance with the methods disclosed herein. Such fragments are typically produced by proteolytic cleavage using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F (ab ′) ₂ fragments). Alternatively, Neutrokine alpha protein binding fragments can be generated through the application of recombinant DNA technology or through synthetic chemistry.

For diagnosis in humans, it may be preferable to use “humanized” chimeric monoclonal antibodies when in vivo imaging is used to detect enhanced levels of Neutrokine alpha protein. Such antibodies can be generated using genetic constructs derived from hybridoma cells that produce the monoclonal antibodies described above. Methods for producing chimeric antibodies are known in the art. For reviews, see Morrison, Science 229: 1202 (1985); Oi et al., BioTechniques 4: 214 (1986); Cabilly et al., US Pat. No. 4,816,567;
Taniguchi et al., EP 17196; Morrison et al., EP 173494; Neuberger et al., WO 8601533; Robinson et al.,
See WO 8702671; Boulianne et al., Nature 312: 643 (1984); Neuberger et al., Nature 314: 268 (1985).

(Treatment of immune system related disorders)
As noted above, Neutrokine alpha polynucleotides and polypeptides are useful for diagnosing conditions involving abnormally high or low expression of Neutrokine alpha activity. Given the cells and tissues in which Neutrokine alpha is expressed, and the activity regulated by Neutrokine alpha, a substantially altered (increased or decreased) level of Neutrok in an individual compared to a standard or “normal” level The expression of Cain α results in a pathological condition associated with the body system in which Neutrokine α is expressed and / or active.

  Since the Neutrokine alpha protein of the present invention is a member of the TNF family, the extracellular domain of the protein can be released in soluble form from cells expressing Neutrokine alpha by proteolytic cleavage, and therefore Neutrokine alpha protein ( It is also noted that when a soluble form of the extracellular domain) is added from an exogenous source to an individual's cell, tissue or body, the protein also exerts its modulating activity in any target cell of the individual. Understandable by the contractor In addition, cells expressing this type II transmembrane protein can be added to a cell, tissue or body of an individual, whereby the added cells bind to cells expressing the receptor for Neutrokine alpha, thereby Cells expressing cain alpha can cause an action (eg, cytotoxicity) in receptor-bearing target cells.

  Therefore, a condition caused by a decrease in normal or normal levels of Neutrokine alpha activity in an individual (especially an immune system disorder) is caused by Neutrokine alpha protein (a form of soluble extracellular domain or a cell that expresses the complete protein). It is understood that can be treated by administration of Thus, the present invention also provides a method of treating an individual in need of increased levels of Neutrokine alpha. This method involves administering to such an individual a pharmaceutical composition containing an amount of an isolated Neutrokine alpha polypeptide of the present invention effective to increase the level of Neutrokine alpha activity in such an individual. Process.

  Since Neutrokine alpha belongs to the TNF superfamily, it should also regulate angiogenesis. In addition, Neutrokine alpha inhibits immune cell function and thus has a wide range of anti-inflammatory activities. Neutrokine alpha is an anti-angiogenic factor for treating solid phase tumors by stimulating the invasion and activation of host defense cells (eg, cytotoxic T cells and macrophages) and inhibiting tumor angiogenesis Can be used as Those skilled in the art are aware of other non-cancerous signs in which vascular growth is not desired. They can also be used to increase host defense against resistant chronic and acute infections, such as mycobacterial infection through the attraction and activation of bactericidal leukocytes. Neutrokine alpha can also be used to inhibit T cell proliferation by inhibiting IL-2 biosynthesis for the treatment of T cell mediated autoimmune diseases and lymphocytic leukemia. Neutrokine alpha can also be used to stimulate wound healing through both debris removal and the recruitment of connective tissue promoting inflammatory cells. In this same manner, Neutrokine alpha can also be used to treat other fibrotic disorders, including cirrhosis, osteoarthritis, and pulmonary fibrosis. Neutrokine alpha also increases the presence of eosinophils with the unique function of killing parasite larvae that invade tissues in cases such as schistosomiasis, trichinosis, and roundworms. For example, it can be used to regulate hematopoiesis by regulating the activation and differentiation of various hematopoietic progenitors to release mature leukocytes from the bone marrow after chemotherapy (ie, in stem cell mobilization). Neutrokine alpha can also be used to treat sepsis.

(Prescription)
Neutrokine alpha polypeptide compositions (particularly including polypeptides that are soluble forms of the extracellular domain) can affect the clinical status of individual patients (particularly the side effects of treatment with Neutrokine alpha polypeptide alone), Neutrokine alpha poly It will be formulated and dispensed in a manner consistent with good medical practice, taking into account the delivery site of the peptide composition, the method of administration, the administration schedule, and other factors known to the practitioner. Thus, an “effective amount” of Neutrokine alpha polypeptide for purposes herein is determined by such considerations.

  As a general suggestion, the total pharmaceutically effective amount of Neutrokine alpha polypeptide administered parenterally per dose ranges from about 1 μg / kg / day to 10 mg / kg / day per patient body weight, As noted above, this is subject to therapeutic discretion. More preferably, this dose is at least 0.01 mg / kg / day, and most preferably about 0.01-1 mg / kg / day in hormones for humans. When given sequentially, Neutrokine alpha polypeptide is typically injected at 1 to 4 injections per day at a dose rate of about 1 μg / kg / hour to about 50 μg / kg / hour, or, for example, It is administered by either continuous subcutaneous infusion using a minipump. An intravenous bag solution may also be used. The length of treatment required to observe the change, and the interval until response occurs after the treatment appears to vary according to the desired effect.

  The pharmaceutical composition comprising the Neutrokine alpha polypeptide of the present invention may be administered by oral, rectal, parenteral, intracisternally, intravaginally, intraperitoneally, topically (powder, ointment, eye drops, or transdermal patch). A) or buccal or as an oral or intranasal spray. “Pharmaceutically acceptable carrier” means any type of non-toxic solid, semi-solid, or liquid excipient, diluent, encapsulating material, or formulation aid. The term “parenteral” as used herein refers to modes of administration including intravenous and intramuscular, intraperitoneal, substernal, subcutaneous, and intraarticular injections and infusions.

Neutrokine alpha polypeptides are also suitably administered by a sustained release system. Suitable examples of sustained release compositions include a semipermeable polymer matrix in the form of a shaped article (eg, a film or microcapsule). Sustained release matrices include polylactide (US Pat. No. 3,773,919, EP 58,481), a copolymer of L-glutamic acid and γ-ethyl-L-glutamate (Sidman, U., et al., Biopolymers 22: 547-556. (1983)), poly (2-hydroxyethyl methacrylate) (R. Langer et al., J. Biomed Mater. Res. 15: 167-277 (1981) and R. Langer, Chem. Tech. 12: 98-105 (1982). )), Ethylene vinyl acetate (R. Langer et al., Ibid), or poly-D-(-)-3-hydroxybutyric acid (EP 133,988). The sustained release Neutrokine alpha polypeptide composition also includes Neutrokine alpha polypeptide encapsulated in liposomes. Liposomes containing Neutrokine alpha polypeptide are prepared by methods known per se (DE 3,218,121; Epstein et al., Proc. Natl. Acad. Sci. (USA) 82: 3688-3692 (1985). Hwang et al., Proc. Natl.
Sci. (USA) 77: 4030-4034 (1980); EP 52,322; EP 36,676; EP 88,046; EP 143,949; EP
142, 641; Japanese Patent Application No. 83-118008; US Pat. Nos. 4,485,045 and 4,544,545; and EP 102,324). Usually, liposomes are of a small (about 200-800 angstrom) monolayer type, where the fat content is about 30 mol. Above% cholesterol, the selected ratio is adjusted for optimal Neutrokine alpha polypeptide therapy.

  For parenteral administration, in one embodiment, the Neutrokine alpha polypeptide is generally in a unit dosage injectable form (solution, suspension, or emulsion) with the desired degree of purity. Of this polypeptide with a pharmaceutically acceptable carrier (ie, a carrier that is non-toxic to the recipient and compatible with the other ingredients of the formulation) at the dosages and concentrations employed. It is prescribed by. For example, the formulation preferably does not include oxidizing agents and other compounds that are known to be deleterious to polypeptides.

  In general, formulations are prepared by contacting Neutrokine alpha polypeptide uniformly and directly with a liquid carrier or a finely divided solid carrier or both. Then, if necessary, the product is shaped into the desired formulation. Preferably, the carrier is a parenteral carrier, more preferably a solution that is isotonic with the blood of the recipient. Examples of such carrier vehicles include water, saline, Ringer's solution, and dextrose solution. Non-aqueous vehicles such as fixed oils and ethyl oleate, as well as liposomes are useful herein.

  The carrier suitably contains minor amounts of additives such as substances that enhance isotonicity and chemical stability. Such substances are non-toxic to recipients at the dosages and concentrations used, and buffers such as phosphoric acid, citric acid, succinic acid, acetic acid, and other organic acids or their salts; Antioxidants such as ascorbic acid; low molecular weight (less than about 10 residues) polypeptides (eg, polyarginine or tripeptides); proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic properties such as polyvinylpyrrolidone Polymers; amino acids such as glycine, glutamic acid, aspartic acid, or arginine; monosaccharides, disaccharides, and other carbohydrates including cellulose or derivatives thereof, glucose, mannose, or dextrin; chelating agents such as EDTA; mannitol Or a sugar alcohol such as sorbitol; Counterions such as sodium; and / or polysorbate, including non-ionic surfactants such as Porookisama (poloxamer) or PEG.

  The Neutrokine alpha polypeptide is typically formulated in such vehicles at a pH of about 3-8 at a concentration of about 0.1 mg / ml to 100 mg / ml, preferably 1-10 mg / ml. It will be appreciated that the use of certain of the above-described excipients, carriers, or stabilizers will result in a formulation of Neutrokine alpha polypeptide salt.

  The Neutrokine alpha polypeptide used for therapeutic administration must be sterile. Sterilization is readily achieved by filtration through a sterile filtration membrane (eg, a 0.2 micron membrane). The therapeutic Neutrokine alpha polypeptide composition is typically placed in a container having a sterile doorway (eg, a vial with a stopper through which an intravenous solution bag or hypodermic needle can penetrate).

  Neutrokine alpha polypeptides are usually stored in unit dose or multi-dose containers (eg, sealed ampoules or vials) as aqueous solutions or lyophilized formulations for reconstitution. As an example of a lyophilized formulation, a 10 ml vial is filled with 5 ml of sterile filtered 1% (w / v) aqueous Neutrokine α polypeptide solution and the resulting mixture is lyophilized. Injection solutions are prepared by reconstitution of lyophilized Neutrokine alpha polypeptide with bacteriostatic distilled water for injection.

  The invention also provides pharmaceutical packs and kits comprising one or more containers filled with one or more ingredients of the pharmaceutical composition of the invention. In such containers, precautionary statements in a form prescribed by a government agency that regulates the manufacture, use or sale of drugs or biological products, the manufacture, use of products for human administration, Or it may be accompanied by a note reflecting the approval by the sales agency. Furthermore, the polypeptides of the present invention can be used in combination with other therapeutic compounds.

Agonists and antagonists-assays and molecules
The invention also provides a method of screening compounds to identify compounds that enhance or block Neutrokine alpha action (eg, interaction with Neutrokine alpha binding molecules such as receptor molecules) in cells. Agonists are compounds that increase the natural biological function of Neutrokine alpha or function in a manner similar to Neutrokine, while antagonists reduce or eliminate such function.

  In another aspect of this embodiment, the present invention provides a method for identifying a receptor protein or ligand binding protein that specifically binds to a Neutrokine alpha polypeptide. For example, cell compartments (eg, membranes or preparations thereof) can be prepared from cells that express molecules that bind Neutrokine alpha. The preparation is incubated with labeled Neutrokine alpha, and the Neutrokine alpha complex bound to the receptor or other binding protein is isolated according to routine methods known in the art and characterized. Attached. Alternatively, Neutrokine alpha polypeptide can be bound to a solid support, as binding molecules solubilized from cells bind to the column and are then eluted and characterized according to routine methods.

  In the assays of the invention for agonists or antagonists, a cellular compartment (eg, a membrane or preparation thereof) expresses a molecule that binds to Neutrokine alpha (eg, a signal transduction or regulatory pathway molecule regulated by Neutrokine alpha). Can be prepared from cells. This preparation is incubated with labeled Neutrokine alpha in the absence or presence of candidate molecules that may be Neutrokine alpha agonists or antagonists. The ability of the candidate molecule to bind to the binding molecule is reflected in decreased binding of the labeled ligand. Molecules that bind without reason (ie, without inducing the effects of Neutrokine alpha on binding Neutrokine alpha binding molecules) are almost good antagonists. Molecules that bind well and elicit effects that are identical or closely related to Neutrokine alpha are agonists.

  Neutrokine alpha-like effects of potential agonists and antagonists can be determined, for example, by determining the activity of a second messenger system after interaction of a candidate molecule with a cell or appropriate cell preparation, and Neutrokine alpha or can be measured by comparing to the effect of molecules that induce the same effect as Neutrokine alpha. Second messenger systems that may be useful in this regard include, but are not limited to, AMP guanylate cyclase, ion channels, or phosphoinositide hydrolyzed second messenger systems.

  Another example of an assay for a Neutrokine alpha antagonist is a competition that combines Neutrokine alpha with a potential antagonist having a membrane bound receptor molecule or a recombinant Neutrokine alpha receptor molecule under conditions appropriate for a competitive inhibition assay. Assay. Neutrokine alpha can be labeled, eg, by radioactivity, so that the number of Neutrokine alpha molecules that bind to the receptor molecule can be accurately determined to assess the effects of potential antagonists.

  Potential antagonists include small organic molecules, peptides, polypeptides, and antibodies that bind to a polypeptide of the invention and thereby inhibit or deactivate its activity. Potential antagonists also bind to the same site on a binding molecule (eg, a receptor molecule) without inducing Neutrokine alpha-inducing activity, thereby preventing Neutrokine alpha from binding. It can be a small organic molecule, peptide, polypeptide, such as a closely related protein or antibody that prevents the action of

  Other potential antagonists include antisense molecules. Antisense technology can be used to control gene expression through antisense DNA or RNA, or through triple helix formation. Antisense technology is described, for example, in Okano, J. et al. Neurochem. 56: 560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988). Triple helix formation is described, for example, by Lee et al., Nucleic. Acids Research 6: 3073 (1979); Cooney et al., Science 241: 456 (1988); and Dervan et al., Science 251: 1360 (1991). The method is based on the binding of polynucleotides to complementary DNA or RNA. For example, the 5 'coding portion of a polynucleotide encoding the extracellular domain of a polypeptide of the invention can be used to design an antisense RNA oligonucleotide of about 10-40 base pairs in length. DNA oligonucleotides are designed to be complementary to gene regions involved in transcription, thereby preventing transcription and production of Neutrokine alpha. Antisense RNA oligonucleotides hybridize to mRNA in vivo and block translation of mRNA molecules into Neutrokine alpha polypeptides. The oligonucleotides described above can also be delivered to cells so that antisense RNA or DNA can be expressed in vivo and inhibit the production of Neutrokine alpha.

  Agonists and antagonists can be used in compositions having a pharmaceutically acceptable carrier, eg, as described above.

  Antagonists are, for example, macrophages and their precursors, as well as neutrophils, basophils, B lymphocytes, and some T cell subsets (eg, in certain autoimmune and chronic inflammatory and infectious diseases, Can be used to inhibit Neutrokine alpha chemotaxis and activity of activated CD8 cytotoxic T cells and natural killer cells). Examples of autoimmune diseases include multiple sclerosis and insulin dependent diabetes. Antagonists can also be used to treat infectious diseases (including silicosis, sarcoidosis, idiopathic pulmonary fibrosis) by preventing monocyte phagocyte recruitment and activation. They can also be used to treat hypereosinophilic syndrome by preventing eosinophil production and migration. Endotoxin shock can also be treated with antagonists by preventing macrophage migration and production of the human chemokine polypeptides of the invention. Antagonists can also be used to treat atherosclerosis by preventing monocyte infiltration in the arterial wall. Antagonists also include histamine-mediated allergic reactions and immunological disorders (late allergic reactions, chronic urticaria, and atopic dermatitis by inhibiting the release of chemokine-induced mast cells and eosinophil degranulation and histamine ) Can be used. IgE-mediated allergic reactions such as allergic asthma, rhinitis, and eczema can also be treated. Antagonists can also be used to treat chronic and acute inflammation by preventing the attraction of monocytes to the wound area. They can also be used to control normal pulmonary macrophage populations. This is because chronic and acute inflammatory pulmonary diseases are associated with mononuclear phagocyte necrotic separation in the lung. Antagonists can also be used to treat rheumatoid arthritis by preventing the attraction of monocytes into the joint fluid in the patient's joint. Monocyte influx and activation plays a significant role in the pathogenesis of both degenerative and inflammatory arthropathy. Antagonists can be used to prevent deleterious cascades primarily due to IL-1 and TNF, which prevent the biosynthesis of other inflammatory cytokines. In this way, antagonists can be used to prevent inflammation. Antagonists can also be used to inhibit prostaglandin-dependent heat induced by chemokines. Antagonists can also be used to treat cases of bone marrow failure (eg, aplastic anemia and myelodysplastic syndromes). Antagonists can also be used to treat asthma and allergies by preventing eosinophil accumulation in the lung. Antagonists can also be used to treat subepithelial basement membrane fibrosis, a hallmark of asthmatic lung.

  Antibodies to Neutrokine alpha can be used to bind Neutrokine alpha and inhibit Neutrokine alpha activity and treat ARDS by preventing neutrophil infiltration into the lung after injury. Antagonists can be used in compositions having a pharmaceutically acceptable carrier, for example as described herein below.

(Chromosome assay)
The nucleic acid molecules of the present invention are also useful for chromosome identification. A sequence can be specifically targeted to and hybridized to a particular location on an individual human chromosome. Furthermore, there is currently a need to identify specific sites on the chromosome. Currently, most chromosome labeling reagents based on actual sequence data (repetitive polymorphisms) are not available for labeling chromosome positions. Mapping of DNA to chromosomes according to the present invention is an important first step in correlating these sequences with genes associated with disease.

  In certain preferred embodiments in this regard, the cDNA disclosed herein is used to clone genomic DNA of a Neutrokine alpha protein gene. This can be accomplished using a variety of well-known techniques and commonly available libraries. The genomic DNA is then used for in situ chromosome mapping using well known techniques for this purpose.

  Further, in some cases, sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from cDNA. Computer analysis of the 3 'untranslated region of the gene is used to rapidly select primers that do not span more than one exon in the genomic DNA and thus complicate the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Fluorescence in situ hybridization (“FISH”) of cDNA clones to metaphase chromosome spreads can be used to provide accurate chromosomal location in one step. This technique can be used with probes derived from cDNAs as short as 50 or 60 bp. For a review of this technology, see Verma et al., Human Chromosomes: A Manual Of Basic Technologies, Pergamon Press, New York (1988).

  Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data is, for example, V.I. Found in McKusick, Mendelian Inheritance In Man (available online from Johns Hopkins University, Welch Medical Library). The relationship between the gene mapped to the same chromosomal region and the disease is then identified by linkage analysis (co-inheritance of physically adjacent genes).

  Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals. If the mutation is observed in some or all affected individuals but not in any normal individual, the mutation appears to be a causative agent of the disease.

  Although the present invention has been generally described, the present invention is more readily understood by reference to the following examples, which are provided by way of illustration and are not intended to be limiting.

Example 1a: Expression and purification of “His-tagged” Neutrokine α in E. coli
The bacterial expression vector pQE9 (pD10) is used for bacterial expression in this example. (QUIAGEN, Inc. supra). pQE9 encodes ampicillin antibiotic resistance (“Ampr”), bacterial origin of replication (“ori”), IPTG-inducible promoter, ribosome binding site (“RBS”), QIAGEN, Inc. , Six codons encoding histidine residues that allow affinity purification using the nickel-nitrilo-triacetic acid (“Ni-NTA”) affinity resin sold by the above, and appropriate single restriction enzyme cleavage Including sites. These elements are such that the insert DNA fragment encoding the polypeptide expresses a polypeptide having six His residues covalently attached to the amino terminus of the polypeptide (ie, a “6 × His tag”). Aligned.

  The DNA sequence encoding the desired part of Neutrokine alpha protein, including the extracellular domain sequence, is in the deposited amino acid sequence of the desired part of Neutrokine alpha protein and in the deposited construct 3 'to the cDNA coding sequence. Amplified from the deposited cDNA clone using PCR oligonucleotide primers that anneal to the sequence. Additional nucleotides containing restriction sites that facilitate cloning in the pQE9 vector are added to the 5 'and 3' primer sequences, respectively.

In order to clone the extracellular domain of the protein, the 5 'primer is the sequence 5'
It has GTG GGATCCA GCCTCCGGGGCAGAGCTG 3 ′ (SEQ ID NO: 10), which contains the underlined BamHI restriction site followed by 18 nucleotides of the amino terminal coding sequence of the extracellular domain of Neutrokine alpha sequence in FIG. Of course, one of ordinary skill in the art will recognize a DNA segment encoding any desired portion of the complete Neutrokine alpha protein that is shorter or longer than the form of the extracellular domain at which the 5 'primer begins in the protein coding sequence. Understand that it can be modified to amplify. The 3 ′ primer has the sequence 5 ′ GTG AAGCTT TTATTTACAGCAGTTTCAATGCACC 3 ′ (SEQ ID NO: 11), which is the underlined Hind III restriction site, followed by two stop codons, and the Neutrokine alpha DNA sequence in FIG. Contains 18 nucleotides complementary to the 3 'end of the coding sequence.

  The amplified Neutrokine alpha DNA fragment and vector pQE90 are digested with BamHI and HindIII, and the digested DNA is then ligated together. Insertion of Neutrokine alpha DNA into the restricted pQE90 vector places the coding region of Neutrokine alpha protein downstream of the IPTG inducible promoter and in-frame at the start AUG and 6 histidine codons.

The ligation mixture was purified using competent E. coli using standard procedures. E. coli cells are transformed. Such procedures are described in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N. Y. (1989). E. coli containing multiple copies of the plasmid pREP4, which expresses the lac repressor and also confers resistance to kanamycin (“Kan ^r ”). E. coli strain M15 / rep4 is used in carrying out the illustrative examples described herein. This strain, which is the only of many strains that are suitable for expressing Neutrokine alpha protein, is QIAGEN, Inc. Commercially available from above. Transformants are identified by their ability to grow on LB plates in the presence of ampicillin and kanamycin. Plasmid DNA is isolated from resistant colonies and the identity of the cloned DNA is confirmed by restriction analysis, PCR, and DNA sequencing. Clones containing the desired construct are grown overnight (“O / N”) in liquid culture in LB medium supplemented with both ampicillin (100 μg / ml) and kanamycin (25 μg / ml). O / N cultures are used to inoculate large scale cultures at a dilution of about 1:25 to 1: 250. Cells are grown to an absorbance at 600 nm (“OD600”) of between 0.4 and 0.6. Isopropyl-BD-thiogalactopyranoside (“IPTG”) is then added to a final concentration of 1 mM to induce transcription from the lac repressor sensitive promoter by inactivating the lacI repressor. Cells are subsequently incubated for an additional 3-4 hours. Cells are then harvested by centrifugation according to standard methods.

The cells are then agitated in 6M guanidine HCl, pH 8 for 3-4 hours at 4 ° C. Cell debris is removed by centrifugation and the supernatant containing Neutrokine alpha is loaded onto a nickel nitrilotriacetic acid ("Ni-NTA") affinity resin column (available from QIAGEN, Inc., supra). A protein with a 6 × His tag is bound to Ni-NTA resin with high affinity, and a single one-step procedure (for details, see The QIAexpressionist, 1995, QIAGEN, Inc.,
The above can be purified. Briefly, the supernatant is washed with 10 volumes of 6M guanidine-HCl, pH 8, the column is first loaded in 6M guanidine HCl, pH 8, then washed with 10 volumes of 6M guanidine HCl, pH 6, and finally Neutro. Elute with Cain α with 6M guanidine HCl, pH 5.

The purified protein is then regenerated by dialyzing against phosphate buffered saline (PBS) or 50 mM Na-acetate, pH 6 buffer plus 200 mM NaCl. Alternatively, the protein can be successfully refolded while immobilized on a Ni-NTA column. The recommended conditions are as follows: Regenerate in 500 mM NaCl, 20% glycerol, 20 mM Tris / HCl, pH 7.4 (containing protease inhibitors) using a linear 6M-1M urea gradient. Regeneration should be done for a period of at least 1.5 hours. After regeneration, the protein can be eluted by the addition of 250 mM imidazole. Imidazole is added to PBS or 50 mM sodium acetate (pH
6) Remove by a final dialysis step against buffer plus 200 mM NaCl. The purified protein is stored at 4 ° C or frozen at -80 ° C.

Example 1b: Expression and purification of Neutrokine alpha in E. coli
The bacterial expression vector pQE60 is used for bacterial expression in this example. (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91111). pQE60 encodes ampicillin antibiotic resistance (“Ampr”) and replicates bacterial origin (“ori”), IPTG-inducible promoter, ribosome binding site (“RBS”), QIAGEN, Inc. 6 codons encoding histidine residues that allow affinity purification using a nickel nitrilotriacetic acid ("Ni-NTA") affinity resin commercially available from (supra), and an appropriate single restriction enzyme cleavage site. Such an element produces a polypeptide in which a DNA fragment encoding the polypeptide has six His residues covalently attached to the carboxy terminus of the peptide (ie, a “6 × His tag”). So that it can be inserted in such a manner. However, in this example, the polypeptide coding sequence is inserted such that translation of the six His codons is prevented, and thus the polypeptide is produced without the 6 X His tag.

  A DNA sequence encoding the desired part of Neutrokine alpha protein including the extracellular domain sequence is obtained from the deposited cDNA clone from the amino terminal sequence of the desired part of Neutrokine alpha protein, and 3 'to the cDNA coding sequence. Amplify using PCR oligonucleotide primers that anneal to the sequences in the deposited construct. Additional nucleotides containing restriction sites to facilitate cloning into the pQE60 vector are added to each of the 5 'and 3' sequences.

To clone the extracellular domain of the protein, the 5 ′ primer contains an underlined BspH restriction site followed by 17 nucleotides of the amino terminal coding sequence of the extracellular domain of the Neutrokine alpha sequence of FIG. It has 'GTG TCATGA GCCTCCGGGCAGAGCTTG 3' (SEQ ID NO: 12). The skilled artisan will understand that the point in the protein coding sequence where the 5 ′ primer begins can of course be varied to amplify the desired portion of the complete protein that is shorter or longer than the form of the extracellular domain. To do. The 3 ′ primer is a sequence 5′GTG AAGCTT containing the underlined HindIII restriction site followed by two stop codons and 18 nucleotides complementary to the 3 ′ end of the coding sequence in the Neutrokine αDNA sequence of FIG. TTATTACAGCAGGTTCAATGCACC 3 ′ (SEQ ID NO: 13).

  The amplified Neutrokine alpha DNA fragment and vector pQE60 are digested with BspHI and HindIII, and the digested DNA is then ligated together. Insertion of Neutrokine alpha DNA into the restricted pQE60 vector places the Neutrokine alpha protein coding region, including its associated stop codon, downstream from the IPTG inducible promoter and in frame with the initiation AUG. The accompanying stop codon prevents translation of the six histidine codons downstream of the insertion point.

  The ligation mixture was prepared using standard procedures such as those described in Sambrook et al., Molecular Cloning: a Laboratory Manual, 2nd Edition; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989). E. transform into E. coli cells. E. coli containing multiple copies of plasmid pREP4 that expresses the lac repressor and confers resistance to kanamycin ("Kanr"). E. coli strain M15 / rep4 is used to carry out the exemplary examples described herein. This strain, which is the only one among many suitable for expressing Neutrokine alpha protein, is QIAGEN, Inc. (Supra). Transformants are identified by their ability to grow on LB plates in the presence of ampicillin and kanamycin. Plasmid DNA is isolated from resistant colonies and the identity of the clonal DNA is confirmed by restriction analysis, PCR, and DNA sequencing.

  Clones containing the desired construct are grown overnight (“O / N”) in liquid culture in LB medium supplemented with both ampicillin (100 μg / ml) and kanamycin (25 μg / ml). O / N cultures are used to inoculate large cultures at a dilution of about 1:25 to 1: 250. Cells are grown to an optical density at 600 nm (“OD600”) of between 0.4 and 0.6. Isopropyl-bD-thiogalactopyranoside ("IPTG") is then added to a final concentration of 1 mM to induce transcription from the lac repressor sensitive promoter by inactivating the lacI repressor. Subsequently, the cells are further incubated for 3-4 hours. Cells are then harvested by centrifugation.

The cells are then stirred in 6M guanidine HCl (pH 8) at 4 ° C. for 3-4 hours. Cell debris is removed by centrifugation and the supernatant containing Neutrokine alpha is dialyzed against 50 mM sodium acetate buffer (pH 6) supplemented with 200 mM NaCl. Alternatively, the protein is 500 mM NaCl, 20% glycerol, 25 mM
It can be successfully refolded by dialyzing against Tris / HCl, pH 7.4 (containing protease inhibitors). After regeneration, the protein can be purified by ion exchange chromatography, hydrophobic interaction chromatography, and size exclusion chromatography. Alternatively, affinity chromatography steps such as antibody columns can be used to obtain pure Neutrokine alpha protein. Purified protein is stored at 4 ° C or frozen at -80 ° C.

(Example 2: Cloning and expression of Neutrokine α protein in baculovirus expression system)
In this illustrative example, plasmid shuttle vector pA2 GP was used to clone cloned DNA encoding the extracellular domain of a protein lacking its naturally associated intracellular and transmembrane sequences. Baculovirus Reader and Summers et al., A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Procedures, Texas Agricultural Experimental Stul. 1555 (1987) is used to express the extracellular domain of Neutrokine alpha protein. This expression vector is a convenient polyhedrin promoter of Autographa californica nuclear polyhedrosis virus (AcMNPV), followed by the secretion signal peptide (leader) of baculovirus gp67 protein, and convenient such as BamHI, XbaI, and Asp718 Contains restriction sites. The polyadenylation site of simian virus 40 (“SV40”) is used for efficient polyadenylation. For easy selection of recombinant viruses, the plasmid is E. coli under the control of the weak Drosophila promoter in the same orientation. contains the β-galactosidase gene from E. coli followed by the polyadenylation signal of the polyhedrin gene. The inserted gene is flanked on both sides by viral sequences for cell-mediated homologous recombination with wild-type viral DNA to produce viable viruses that express the cloned polynucleotide.

  Many other baculovirus vectors have been constructed in which constructs are properly positioned for transcription, translation, secretion, etc. (signal peptides and in-frame AUG, if necessary), as will be readily understood by those skilled in the art. Can be used instead of the vectors described above (eg, pAc373, pVL941, and pAcIM1). Such vectors are described, for example, in Luckow et al., Virology 170: 31-39 (1989).

A cDNA sequence encoding the extracellular domain of the deposited clone Neutrokine alpha protein and lacking the AUG initiation codon and the naturally associated intracellular and transmembrane domain sequences shown in FIG. 1 (SEQ ID NO: 2). Amplify using PCR oligonucleotide primers corresponding to the 5 'and 3' sequences of the gene. The 5 ′ primer contains an underlined BamHI restriction enzyme site followed by 18 nucleotides of the sequence of the extracellular domain of Neutrokine alpha protein shown in FIG. 1 (starting at the indicated end of the extracellular domain of the protein) It has the sequence 5 ′ GTG GGATCC CCGGGCAGAGCTGCAGGGC 3 ′ (SEQ ID NO: 14). The 3 ′ primer is a sequence containing the underlined BamHI restriction site followed by two termination codons and 18 nucleotides complementary to the 3 ′ coding sequence of FIG. 1 5 ′ GTG GGATCC TTATTACAGCAGTTTCAATGCACC 3 ′ (SEQ ID NO: 15) Have

  Amplified fragments are isolated from a 1% agarose gel using a commercially available kit (“Geneclean”, BIO 101 Inc., La Jolla, Ca.). The fragment is then digested with BamHI and purified again on a 1% agarose gel. This fragment is designated herein as F1.

  The plasmid can be digested with the restriction enzyme BamHI and optionally dephosphorylated using bovine intestinal phosphatase using routine procedures known in the art. The DNA is then isolated from a 1% agarose gel using a commercially available kit (“Geneclean” BIO 101 Inc., La Jolla, Ca.). This vector DNA is designated herein as “V1”.

  Fragment F1 and dephosphorylated plasmid V1 are ligated together with T4 DNA ligase. E. coli HB101 or other suitable E. coli. E. coli hosts (eg, XL-1 Blue (Stratagene Cloning Systems, La Jolla, Calif.) cells) were transformed with the ligation mixture and expanded on culture plates. Bacteria containing plasmids with the human Neutrokine alpha gene are identified by digesting DNA from individual colonies using BamHI and then analyzing the digestion products by gel electrophoresis. The sequence of the cloned fragment is confirmed by DNA sequencing. This plasmid is designated herein as pA2GP Neutrokine alpha.

5 μg of plasmid pA2GP Neutrokine α was obtained from Felgner et al., Proc.
Natl. Acad. Sci. USA, 84: 7413-7417 (1987), using 1.0 μg of commercially available linearized baculovirus DNA (“BaculoGold ^™ baculovirus DNA”,
Pharmingen, San Diego, CA. ) At the same time. 1 μg BaculoGold ^™ viral DNA and 5 μg plasmid pA2GP Neutrokine α are mixed in aseptic wells of a microtiter plate containing 50 μl serum-free Grace's medium (Life Technologies Inc., Gaithersburg, MD). Then 10 μl Lipofectin and 90 μl Grace's medium are added, mixed and incubated for 15 minutes at room temperature. The transfection mixture is then added dropwise to Sf9 insect cells (ATCC CRL 1711) seeded in 35 mm tissue culture plates with 1 ml of serum-free Grace's medium. The plate is then incubated for 5 hours at 27 ° C. The transfection solution is then removed from the plate and 1 ml of Grace insect medium supplemented with 10% fetal calf serum is added. Subsequently, the culture is continued at 27 ° C. for 4 days.

  After 4 days, the supernatant is collected and a plaque assay is performed as described in Summers and Smith (supra). An agarose gel with “Blue Gal” (Life Technologies Inc., Gaithersburg) is used to allow easy identification and isolation of gal expression clones producing blue stained plaques. (A detailed description of this type of “plaque assay” can also be found in the insect cell culture and baculovirology user's guide (pages 9-10) distributed by Life Technologies Inc., Gaithersburg). After appropriate incubation, the blue-stained plaque is picked up with a micropipette (Eppendorf) tip. The agar containing the recombinant virus was then resuspended in a microcentrifuge tube containing 200 μl Grace's medium and the suspension containing the recombinant baculovirus was used to seed Sf9 cells seeded in 35 mm dishes. Infect. After 4 days, the supernatants of these culture dishes are collected and then stored at 4 ° C. This recombinant virus is referred to as V-neutrokine α.

To assess Neutrokine alpha gene expression, Sf9 cells supplemented with 10% heat-inactivated FBS are grown in Grace's medium. Cells are infected with recombinant baculovirus V-neutrokine alpha at a multiplicity of infection ("MOI") of about 2. If radiolabeled protein is desired, the medium is removed after 6 hours and replaced with SF900II medium without methionine and cysteine (available from Life Technologies Inc., Rockville, MD). After 42 hours, 5 μCi of ³⁵ S methionine and 5 μCi of ³⁵ S cysteine (available from Amersham) are added. Cells are further incubated for 16 hours and then harvested by centrifugation. Proteins in the supernatant and intracellular proteins are analyzed by SDS-PAGE followed by autoradiography (if radiolabeled).

  Microsequencing of the amino-terminal amino acid sequence of the purified protein can be used to determine the amino-terminal sequence of the extracellular domain of the protein and thus the cleavage point and length of the secretory signal peptide.

(Example 3: Cloning and expression of Neutrokine α in mammalian cells)
A typical mammalian expression vector contains a promoter element (which mediates the initiation of transcription of mRNA), a protein coding sequence, and signals necessary for transcription termination and transcript polyadenylation. Additional elements include enhancers, Kozak sequences, and intervening sequences flanked by donor and acceptor sites for RNA splicing. Very effective transcription can be achieved with early and late promoters from SV40, long terminal repeats (LTR) from retroviruses (eg, RSV, HTLVI, HIVI), and the early promoter of cytomegalovirus (CMV). However, cellular elements can also be used (eg, the human actin promoter). Expression vectors suitable for use in the practice of the present invention include vectors such as pSVL and pMSG (Pharmacia, Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146), and pBC12MI (ATCC 67109). Can be mentioned. Mammalian host cells that can be used include human Hela, 293, H9 and Jurkat cells, mouse NIH3T3 and C127 cells, Cos1, Cos7 and CV1, quail QC1-3 cells, mouse L cells, and Chinese hamster ovary (CHO) cells. Is mentioned.

  Alternatively, the gene can be expressed in stable cell lines that contain the gene integrated into the chromosome. Co-transfection with a selectable marker (eg dhfr, gpt, neomycin, hygromycin) allows the identification and isolation of the transfected cells.

  The transfected gene can also be amplified to express large amounts of the encoded protein. DHFR (dihydrofolate reductase) markers are useful markers for developing cell lines with hundreds or thousands of copies of the gene of interest. Another useful selectable marker is the enzyme glutamine synthase (GS) (Murphy et al., Biochem J. 227: 277-279 (1991); Bebbington et al., Bio / Technology 10: 169-175 (1992)). Using these markers, mammalian cells are grown in selective media and the cells with the highest resistance are selected. These cell lines contain the amplified gene (s) that are incorporated into the chromosome. Chinese hamster ovary (CHO) cells and NSO cells are often used for protein production.

  Expression vectors pC1 and pC4 are the Rous sarcoma virus strong promoter (LTR) (Cullen et al., Molecular and Cellular Biology, 438-447 (March 1985)) and a fragment of CMV-enhancer (Boshart et al., Cell 41: 521). -530 (1985)). Multiple cloning sites (eg, restriction enzyme cleavage sites BamHI, XbaI, and Asp718) facilitate cloning of the gene of interest. The vector further includes the 3 'intron, polyadenylation, and termination signal of the rat preproinsulin gene.

(Example 3 (a): Cloning and expression in COS cells)
Cloning the expression plasmid p Neutrokine α HA into the expression vector pcDNAI / Amp or pcDNAIII (available from Invitrogen, Inc.) the portion of the deposited cDNA encoding the extracellular domain of Neutrokine α protein To make. To produce a soluble, secreted form of the polypeptide, the extracellular domain is fused to the secretory leader sequence of the human IL-6 gene.

  The expression vector pcDNAI / amp is as follows: E. coli effective for growth in E. coli and other prokaryotic cells. (2) Ampicillin resistance gene for selection of plasmid-containing prokaryotic cells; (3) SV40 replication origin for propagation in eukaryotic cells; (4) CMV promoter, polylinker, SV40 intron; 5) Includes several codons encoding a hemagglutinin fragment (ie, an “HA” tag that facilitates purification) followed by a termination codon and a sequenced polyadenylation signal so that the cDNA is conveniently It can be under controlled expression of the promoter and operably linked to the SV40 intron and polyadenylation signal by restriction sites in the polylinker. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein described by Wilson et al., Cell 37: 767 (1984). The fusion of the HA tag to the target protein allows easy detection and recovery of the recombinant protein using an antibody that recognizes the HA epitope. pcDNAIII further contains a selectable neomycin marker.

A DNA fragment encoding the extracellular domain of Neutrokine alpha polypeptide is cloned into the polylinker region of the vector so that recombinant protein expression is driven by the CMV promoter. The plasmid construction strategy is as follows. The deposited clone Neutrokine α cDNA was obtained from the E. coli strain described above. As with the construction of the vector for expression of Neutrokine alpha in E. coli, amplification is performed using primers containing convenient restriction sites. Suitable primers used in this example include: The 5 ′ primer comprising the underlined BamHI site, the Kozak sequence, the AUG initiation codon, the sequence encoding the secretory leader peptide from the human IL-6 gene, and 18 nucleotides of the 5 ′ coding region of the extracellular domain of Neutrokine alpha protein and it has the following sequence: 5 'GCGGGATCC GCCACC ATGAACTCCTTCTCCACAAGCGCCTTCGGTCCAGTTGCCTTCTCCCTGGGGCTGCTCCTGGTGTTGCCTGCTGCCTTCCCTGCCCCAGTTGTGAGACAAGGGGACCTGGCCAGC 3' ( SEQ ID NO: 16). The underlined BamHI restriction site, the 3 ′ primer containing 18 of nucleotides complementary to the 3 ′ coding sequence immediately before the stop codon, has the following sequence: 5 ′ GTG GGATCC TTACAGCAGGTTCAATGCACC 3 ′ (SEQ ID NO: 17).

  The PCR amplified DNA fragment and the vector pcDNAI / Amp are digested with BamHI and then ligated. The ligation mixture is obtained from E. E. coli strain SURE (available from Stratagene Cloning Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037), and the transformed culture is then incubated to allow the growth of ampicillin resistant colonies. Plate on plate. Plasmid DNA is isolated from resistant colonies and tested by restriction analysis or other means for the presence of fragments encoding Neutrokine alpha extracellular domain.

  For the expression of recombinant Neutrokine alpha, COS cells are described in, for example, Sambrook et al., Molecular Cloning: a Laboratory Manual, Cold Spring Laboratory Press, Cold Spring Harbor, New York, DE, described in TR-E (1989) E Transform with an expression vector as described above. Cells are incubated under conditions for expression of Neutrokine alpha by the vector.

Expression of Neutrokine α-HA fusion protein is described, for example, in Harlow et al., Antibodies: A Laboratory Manual, 2nd Edition; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York using the labeling method (1988) (1988). And detected by immunoprecipitation. To achieve this goal, cells are labeled 2 days after transfection by incubating for 8 hours in medium containing ³⁵ S-cysteine. Cells and media are collected and cells are washed, and detergent-containing RIPA buffer as described in Wilson et al. (Cited above): 150 mM NaCl, 1% NP-40, 0.1% Dissolve in SDS, 0.5% DOC, 50 mM TRIS, pH 7.5. Proteins are precipitated from cell lysates and culture media using HA specific monoclonal antibodies. The precipitated protein is then analyzed by SDS-PAGE and autoradiography. The expected size of the expression product is observed in the cell lysate, which is not observed in the negative control.

(Example 3 (b): Cloning and expression in CHO cells)
Vector pC4 is used for the expression of Neutrokine alpha protein. Plasmid pC4 is a derivative of plasmid pSV2-dhfr (ATCC accession number 37146). To produce a soluble, secreted form of the Neutrokine alpha polypeptide, the portion of the deposited cDNA encoding the extracellular domain is fused to the secretory leader sequence of the human IL-6 gene. This vector plasmid contains the mouse DHFR gene under the control of the SV40 early promoter. Chinese hamster ovary cells transformed with these plasmids or other cells lacking dihydrofolate activity are selected by growing the cells in selective medium supplemented with the chemotherapeutic agent methotrexate (α minus MEM, Life Technologies). Can be done. Amplification of the DHFR gene in cells resistant to methotrexate (MTX) is well documented (eg, Alt, FW, Kellems, RM, Bertino, JR, and Schimke, RT). , 1978, J Biol.Chem.253: 1357-1370, Hamlin, JL and Ma, C., Biochem. Et Biophys. Acta, 1097: 107-143 (1990), Page, M.J. See Sydenham, MA, Biotechnology 9: 64-68 (1991)). Cells grown in increasing concentrations of MTX develop resistance to the drug by overproducing the target enzyme DHFR as a result of amplification of the DHFR gene. When the second gene is linked to the DHFR gene, it is usually co-amplified and overexpressed. It is known in the art that this approach can be used to develop cell lines with more than 1,000 copies of the amplified gene (s). Subsequently, when methotrexate is removed, the cell line is obtained as a cell line containing the amplified gene that is incorporated into the host cell chromosome (s).

  Plasmid pC4 is a gene for the strong promoter of the long terminal repeat (LTR) of Rous sarcoma virus (Cullen et al., Molecular and Cellular Biology, March 1985: 438-447), and human cytomegalovirus (CMV) ( Including expression of a fragment of an isolated gene from the enhancer of the early genes of Boshart et al., Cell 41: 521-530 (1985)). Downstream of the promoter are the following single restriction enzyme cleavage sites that allow gene uptake: BamHI, XbaI and Asp718. Behind these cloning sites, the plasmid contains the 3 'intron and polyadenylation site of the rat preproinsulin gene. Other high efficiency promoters may also be used for long terminal repeats from expression (eg, human β-actin promoter, SV40 early or late promoter, or other retroviruses (eg, HIV and HTLVI). Clontech's Tet. -Off and Tet-On gene expression systems and similar systems can be used to express Neutrokine alpha in a regulated manner in mammalian cells (Gossen, M. and Bujard, H. 1992, Proc Natl. Aci. Sci. USA 89: 5547-5551) Other signals (eg, from human growth hormone or globin genes) can be used for polyadenylation of mRNA as well. Stable cell lines that also have -Option markers (e.g., gpt, G418, or hygromycin) may be selected based on co-transfection with. Two or more selected markers in the initiation, eg, G418 plus methotrexate it is useful to use.

  Plasmid pC4 is digested with the restriction enzyme BamHI and then dephosphorylated using bovine intestinal phosphatase by procedures known in the art. The vector is then isolated from a 1% agarose gel.

The DNA sequence encoding the extracellular domain of Neutrokine alpha protein (including the leader sequence) is amplified using PCR oligonucleotide primers corresponding to the 5 'and 3' sequences of the gene. Contains the underlined BamHI site, followed by the Kozak sequence, the AUG initiation codon, the sequence encoding the secretory leader peptide from the human IL-6 gene, and 18 nucleotides of the 5 'coding region of the extracellular domain of Neutrokine alpha protein The 5 ′ primer includes the following sequence: 5 ′ GCGGGATCC GCCACC ATGAACTCCCTTCCCACAAGGCGCTTCGGTCCCAGTGCCCTTCCCCTGGGCTGCTCCTGGGTCTGCCCTGGTCGATC3 The underlined BamHI and the 3 ′ primer containing 18 of nucleotides complementary to the 3 ′ coding sequence immediately before the termination codon include the following sequence: 5 ′ GTG GGATCC TTACAGCAGGTTCAATGCACC 3 ′ (SEQ ID NO: 17).

The amplified fragment is digested with the endonuclease BamHI and then purified again on a 1% agarose gel. The isolated fragment and dephosphorylated vector are then ligated with T4 DNA ligase. Then E. E. coli HB101 cells or XL-1
Blue cells are transformed and bacteria containing the fragment inserted into plasmid pC4 are identified using, for example, restriction enzyme analysis.

  Chinese hamster ovary cells lacking an active DHFR gene are used for transfection. 5 μg of expression plasmid pC4 is co-transfected with 0.5 μg of plasmid pSV-neo using Lipofectin (Felner et al., Supra). Plasmid pSV2-neo contains a dominant selectable marker (neo gene from Tn5 encoding an enzyme that confers resistance to a group of antibiotics including G418). Cells are seeded in alpha minus MEM supplemented with 1 mg / ml G418. Two days later, cells are trypsinized and seeded in hybridoma cloning plates (Greiner, Germany) in alpha minus MEM supplemented with 10, 25, or 50 ng / ml methotrexate and 1 mg / ml G418. After about 10-14 days, single clones are trypsinized and then seeded in 6-well petri dishes or 10 ml flasks with different concentrations of methotrexate (50 nM, 100 nM, 200 nM, 400 nM, 800 nM). The clones growing at the highest concentration of methotrexate are then transferred to new 6-well plates containing higher concentrations of methotrexate (1 μM, 2 μM, 5 μM, 10 μM, 20 μM). The same procedure is repeated until clones are obtained that grow at a concentration of 100-200 μM. Expression of the desired gene product is analyzed, for example, by SDS-PAGE and Western blot analysis or by reverse phase HPLC analysis.

(Example 4: Tissue distribution of Neutrokine α mRNA expression)
Northern blot analysis was performed to test the expression of the Neutrokine alpha gene in human tissues, inter alia using the method described by Sambrook et al. (Cited above). A cDNA probe (SEQ ID NO: 1) containing the complete nucleotide sequence of Neutrokine alpha protein was prepared using a rediprime ^™ DNA labeling system (Amersham Life).
Science) and labeled with ³² P according to the manufacturer's instructions. After labeling, the probe was purified using a CHROMA SPIN-100 ^™ column (Clontech Laboratories, Inc.) according to the manufacturer's protocol number PT1200-1. The purified labeled probe was then used to examine various human tissues for Neutrokine alpha mRNA.

Multi-tissue northern (MTN) blots containing various human tissues (H) or human immune system tissues (IM) are obtained from Clontech and using ExpressHyb ^™ hybridization solution (Clontech), manufacturer's protocol number PT1190- Tested with labeled probe according to 1. Following hybridization and washing, blots were attached and exposed to film overnight at −70 ° C., and the film was developed according to standard procedures.

  It will be clear that the invention may be practiced otherwise than as particularly described in the foregoing description and examples. Many modifications and variations of the present invention are possible in light of the above teachings and, therefore, are within the scope of the appended claims.

  The disclosures of all publications (including patents, patent applications, journal literature, laboratory manuals, books, or other documents) cited herein are hereby incorporated by reference.

Claims (1)

An isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence that is at least 95% identical to a sequence selected from the group consisting of:
(A) a nucleotide sequence encoding a Neutrokine α polypeptide having the complete amino acid sequence set forth in SEQ ID NO: 1.

Images