JP2007222174A - Neutrokine-alpha - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide isolated nucleic acids encoding a neutrokine-α protein. <P>SOLUTION: The invention relates to the isolated nucleic acid molecule at least having 95% of homology with the following sequences. (a) A sequence encoding neutrokine-α polypeptide having complete amino acid sequence in figure 1. (b) A sequence encoding neutrokine-α having complete amino acid sequence encoded by cDNA clone included in deposition to the ATCC on October 22, 1996. (c) A sequence encoding neutrokine-α polypeptide extracellular domain. (d) A sequence encoding neutrokine-α polypeptide transmembrane domain. (e) A sequence encoding neutrokine-α polypeptide intracellular domain. (f) A sequence encoding soluble neutrokine-α polypeptide deleted of transmembrane domain. (g) A complementary sequence to an optional sequence of (a), (b), (c), (d), (e), or (f). <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

The present invention relates to a novel cytokine expressed by neutrophils, which is therefore referred to as Neutrokine alpha protein ("Neutrokine alpha"). In detail
An isolated nucleic acid molecule encoding a Neutrokine alpha protein is provided. Neutrokine alpha polypeptides are also provided as vectors, host cells, and recombinant methods for producing them.

(Related technology)
Human tumor necrosis factor (TNF-α) and (TNF-β, or lymphotoxin) are related members of a broad class of polypeptide mediators, including interferons, interleukins, and growth factors, collectively known as cytokines (Beutler, B. and Cerami, A. Annu. Ret., Im
munol. 7: 625-655 (1989)). Sequence analysis of cytokine receptors defines several subfamilies of the following membrane proteins: (1) Ig superfamily, (2) hematopoietin (cytokine receptor superfamily), and (3) tumor necrosis factor (TNF) / Nerve growth factor (NGF) receptor superfamily (For a review of the TNF superfamily, see Gruss and Dower, Bl
ood 85 (12): 3378-3404 (1995), and Aggarwal and Natarajan, Eur. Cytokine Netw. , 7 (2): 9
3-124 (1996)). The TNF / NGF receptor superfamily includes at least 10 different proteins. Gruss and Dower, supra.
The ligands for these receptors have been identified and belong to at least two cytokine superfamily. Gruss and Dower, supra.

Tumor necrosis factor (mixture of TNF-α and TNF-β) was originally discovered as a result of its anti-tumor activity, but now it is involved in apoptosis, cell activation and cell proliferation of several transformed cell lines. It is recognized as a multifaceted cytokine capable of numerous biological activities, including mediation and also playing an important role in immune regulation and inflammation.

To date, known members of the TNF ligand superfamily include TNF-α, T
NF-β (lymphotoxin-α), LT-β, OX40L, Fas ligand, CD30L
CD27L, CD40L, and 4-IBBL. The TNF ligand superfamily of ligands is about 20% sequence homology (12% to
TNF-like molecules with a range of 36%) and exist mainly as membrane-bound forms with biologically active forms that are trimer / multimeric complexes. Soluble forms of the TNF ligand superfamily have so far only been identified for TNF, LT, β, and Fas ligands (for general review, Gruss, H. and Dower, S.K.
. , Blood, 85 (12): 3378-3404 (1995), which is incorporated herein by reference in its entirety). These proteins are involved in the regulation of cell proliferation, activation and differentiation, including control of cell survival or cell death by apoptosis or cytotoxicity (Armitage, RJ, Curr. Op).
ion. Immunol. 6: 407 (1994), and Smith, C.I. A.
, Cell 75: 959 (1994)).

Tumor necrosis factor-α (TNFα; also referred to as cachectin; hereinafter “TNF”)
Is secreted primarily by monocytes and macrophages in response to other stimuli such as endotoxin, or a soluble homotrimer of the 17 kD protein subunit (Smit
h, R.R. A. Et al. Biol. Chem. 262: 6951-6954 (19
87)). A membrane bound 26 kD precursor form of TNF has also been described (Kriegler).
, M.M. Et al., Cell 53: 45-53 (1988)).

Accumulated evidence indicates that TNF is a regulatory cytokine with pleiotropic biological activity. These activities include: inhibition of lipoprotein lipase synthesis ("cachectin" activity) (Butler, B. et al. Nature 316: 552 (1985).
)), Activation of polymorphonuclear leukocytes (Klebanoff, SJ et al., J. Immuno
l. 136: 4220 (1986); Perussia, B et al., J. MoI. Immuno
l. 138: 765 (1987)), inhibition of cell proliferation or stimulation of cell proliferation (Vilc
ek, J. et al. Et al. Exp. Med. 163: 632 (1986); Sugar
man, B.M. J. et al. Et al., Science 230: 943 (1985); Lachma
n, L.L. B. Et al. Immunol. 138: 2913 (1987)), cytotoxic activity in certain transformed cell types (Lachman, LB et al., Supra; D
argynkiewicz, Z. Et al., Canc. Res. 44:83 (1984)
), Antiviral activity (Kohase, M. et al., Cell 45: 659 (1986);
Wong, G.G. H. W. Et al., Nature 323: 819 (1986)), bone resorption stimulation (Bertolini, DR et al., Nature 319: 516 (1986)).
Saklatvala, J .; , Nature 322: 547 (1986)), stimulation of collagenase and prostaglandin E2 production (Dayer, J.-M. et al., J
. Exp. Med. 162: 2163 (1985)); and immunomodulatory action (T cells (Yokota, S. et al., J. Immunol. 140: 531 (1988)).
B cells (Kehrl, JH, et al., J. Exp. Med. 166: 786 (1
987)), monocytes (Philip, R. et al., Nature 323: 86 (1986).
), Thymocytes (Ranges, GE et al., J. Exp. Med. 167: 14).
72 (1988)) and stimulation of cell surface expression of tumor histocompatibility complex (MHC) class I and class II molecules (Collins, T. et al., Proc. Nat
l. Acad. Sci. USA 83: 446 (1986); Pujol-Bor
rel, R.R. Et al., Nature 326: 304 (1987))).

TNF has been shown for its pro-inflammatory effects resulting in tissue wounds such as:
Induction of procoagulant activity in vascular endothelial cells (Pober, JS et al., J. Immu
nol. 136: 1680 (1986)), enhanced adhesion of neutrophils and lymphocytes (P
ober, J .; S. Et al. Immunol. 138: 3319 (1987)),
And stimulation of the release of platelet activating factor from macrophages, neutrophils, and vascular endothelial cells (Camussi, G. et al., J. Exp. Med. 166: 1390 (19
87)).

Recent evidence indicates that TNF has been associated with many infections (Cerami, A. et al., Immunol.
Today 9:28 (1988)), immune disorders, neoplastic symptoms (eg, in cachexia with some malignancy) (Olip. A. et al., Cell 50: 555 (1987).
) Pathogens, and autoimmune and graft-versus-host symptoms (Piget, P.-F)
. Et al. Ecp. Med. 166: 1280 (1987)). The association of TNF with cancer and infectious symptoms often correlates with host metabolic status. The main problem for cancer patients is weight loss, usually associated with eating disorders. The massive breakdown that occurs is "cachexia"
(Kern, KA, et al., J. Parent. Enter. Nu
tr. 12: 286-298 (1988)). Cachexia includes a progressive decline in body weight in response to progressive weight loss, eating disorders, and malignant growth. Thus, cachexia is associated with significant mortality and is responsible for numerous cancer mortality. Numerous studies suggest that TNF is an important mediator of cachexia in cancer, infectious symptoms, and other metabolic conditions.

TNF is gram-negative sepsis and endotoxic shock (Michie, HR et al., Br. J. Surg. 7), including fever, malaise, eating disorders, and cachexia.
6: 670-671 (1989); Debetes, J. et al. M.M. H. , Secon
d, Vienna Shock Forum, 463-466 (1989); Si
mpson, S.M. Q. Et al., Crit. Care Clin. 5: 27-47 (1
989))) is considered to play a central role in the pathophysiological results. Endotoxin is a potent monocyte / macrophage activator that produces and secretes TNF (Kornblue, SK et al., J. Immunol. 137: 25).
85-2591 (1986)), as well as other cytokines. It was concluded that TNF is a central mediator capable of responding to clinical signs of endotoxin-related diseases because it can mimic many biological effects of endotoxins. TNF and other monocyte-induced cytokines mediate metabolic and neurohormonal responses to endotoxins (Michie, HR et al., N. Eng. J. Med. 318: 148).
1-1486 (1988)). Administration of endotoxin to human volunteers results in sudden illness with influenza-like symptoms including fever, tachycardia, increased metabolic rate, and stress hormone release (Revhaug, A. et al. Arch. Surg. 123: 162-1
70 (1988)). Increased levels of circulating TNF have also been found in patients with Gram-negative sepsis (Waage, A. et al., Lancet 1: 355).
357 (1987); Hammerle, A .; F. , Second Vienna
Shock Forum 715-718, (1989); Devets, J. et al.
M.M. H. Et al., Crit. Care Med. 17: 489-497 (1989);
Calandra, T .; Et al. Infec. Dis. 161: 982-987
(1990)).

Passive immunotherapy directed at neutralization of TNF may have toxic effects on Gram-negative sepsis and endotoxin based on increased TNF production and elevated TNF levels in these pathological states as described above. Antibodies against “modulator” substances characterized as cachectin (which was later found to be identical to TNF)
(European Patent Publication 0,212,489, March 4, 1987). Such antibodies were said to be useful in diagnostic immunoassays and in samples of shock in bacterial infections. Rubin et al. (European Patent Publication 0,218,868, 1
Apr. 22, 987) disclosed a monoclonal antibody to human TNF, hybridomas secreting such antibodies, methods of producing such antibodies, and the use of such antibodies in TNF immunoassays. Yone et al. (European Patent Publication 0,288,08)
8, October 26, 1988) disclosed anti-TNF antibodies (including mAbs) and their utility in immunoassay diagnosis of symptoms (especially Kawasaki disease symptoms and bacterial infections). Body fluid of patients with symptoms of Kawasaki disease (pediatric acute fever mucocutaneous lymph node syndrome; Kawasak
i, T.M. Allergy 16: 178 (1967); Kawasaki, T .;
, Shonica (Pediatrics) 26: 935 (1985)) was said to have elevated TNF levels associated with symptom progression (Yone et al., Supra).

Other researchers have described mAbs specific for recombinant human TNF that have neutralized in vitro activity (Liang, CM et al., Biochem. Biophys. Res. C).
omm. 137; 847-854 (1986); Hybri
doma 6: 305-311 (1987); Fendly et al., Hybridoma 6
: 359-369 (1987); Bringman, TS et al., Hybridoma
6: 489-507 (1987); Hirai, M .; Et al. Immunol. M
eth. 96: 57-62 (1987); Moller, A.M. Et al (Cytokine
2: 162-169 (1990)). Some of these mAbs map epitopes of human TNF and develop enzyme immunoassays (Fendly et al., Supra; Hir
al et al., supra; Moller et al., supra) and to assist in the purification of recombinant TNF (Bringman et al., supra). However, these studies neutralize antibodies that can be used for in vivo diagnostic use or therapeutic use in humans due to immunogenicity, lack of specificity, and / or pharmaceutical compatibility. It does not provide a basis for producing TNF.

Neutralizing antisera or mAbs to TNF have been shown to eliminate deleterious physiological changes and prevent death after lethal challenge in experimental endotoxemia and bacteremia in non-human mammals Has been. This effect has been demonstrated, for example, in rodent lethality assays and in primate pathology model systems (Mathison, J.C.
. Et al. Clin. Invest. 81: 1925-1937 (1988); B
eutler, B.E. Science 229: 869-871 (1985); Tr
acey, K.M. J. et al. Et al., Nature 330: 662-664 (1987); Shi
mamoto, Y. et al. Et al., Immunol. Lett. 17: 311-318 (19
88); Silva, A .; T.A. Et al. Infect. Dis. 162: 42
1-427 (1990) Opal, S .; M.M. Et al. Infect. Dis.
161: 1148-1152 (1990); Hinshaw, L .; B. Et al., Circ.
Shock 60: 279-292 (1990)).

To date, humans have limited experience with anti-TNF mAb treatments, but have shown useful therapeutic results (eg, arthritis and sepsis). For example, Elliott, M. et al. J
. Et al., Bailieres Clin. Rheumatol. 9: 633-52 (
1995); Feldmann M et al., Ann. N. Y. Acad. Sci.
USA 766: 272-8 (1995); van der Poll, T .; Et Sh
ock 3: 1-12 (1995); Werry et al., Crit. Care. Med
. 21: S436-40 (1993); Tracey K. et al. J. et al. Et al., Crit. C
are Med. 21 S415-22 (1993).

Mammalian development depends on both cell proliferation and differentiation and programmed cell death that occurs during apoptosis (Walker et al., Methods Achiev.
Exp. Pathol. 13:18 (1988)). Apoptosis plays an important role in the destruction of immune thymocytes that recognize self-antigens. This deletion of normal ablation process may play a role in autoimmune disease (Gammon et al., Immunology Toda
y 12: 193 (1991)).

Itoh et al. (Cell 66: 233 (1991)) describe a cell surface antigen, Fas / CD23, that mediates apoptosis and is involved in clonal deletion of T cells. F
as is activated T cells in adult mice, B in addition to activated T cells, B cells and neutrophils.
Expressed in cells, neutrophils, and in thymus, liver, heart, and lung and ovary (Watanabe-Fukunaga et al., J. Immunol. 148:
1274 (1992)). In experiments where monoclonal Ab crosslinks to Fas:
Apoptosis is induced (Yonehara et al., J. Exp. Med. 169:
1747 (1989); Traut et al., Science 245: 301 (1989).
). In addition, there are examples in which binding of monoclonal Ab to Fas is stimulatory to T cells under certain conditions (Alderson et al., J. Exp. Med. 178: 2231).
(1993)).

The Fas antigen is a cell surface protein with a relative molecular weight of 45 Kd. Both the human and mouse genes for Fas have been cloned by Watanabe-Fukunaga et al. (J. Immunol. 148: 1274 (1992) and Itoh et al. (
Cell 66: 233 (1991)). The proteins encoded by these genes are structurally homologous to the nerve growth factor / tumor necrosis factor receptor superfamily, including two TNF receptors, the low affinity nerve growth factor receptor, and CD40, CD27, CD30, and OX40. Both transmembrane proteins have sex.

Recently, a Fas ligand has been described (Suda et al., Cell 75: 1169 (1
993)). This amino acid sequence indicates that the Fas ligand is a type II transmembrane protein belonging to the TNF family. Thus, the Fas ligand polypeptide contains three major domains: a short intracellular domain at the amino terminus and a long extracellular domain at the carboxy terminus joined by a hydrophobic transmembrane domain. Fas ligand is expressed in spleen cells and thymocytes, consistent with T cell-mediated cytotoxicity. Purified Fas ligand has a molecular weight of 40 kD.

Recently, it has been shown that Fas / Fas ligand interaction is required for apoptosis following T cell activation (Ju et al., Nature 373: 444 (1995); B
runner et al., Nature 373: 441 (1995)). Activation of T cells induces both proteins on the cell surface. Subsequent interactions between the ligand and receptor result in cellular apoptosis. This supports a possible regulatory role on apoptosis induced by Fas / Fas ligand interactions during normal immune responses.

Therefore, there is a need to provide cytokines similar to TNF that are involved in pathological conditions. Such novel cytokines can be used to create new antibodies or other antagonists that bind these TNF-like cytokines to the treatment of disorders associated with TNF-like cytokines.

(Summary of the Invention)
The present invention provides an isolated nucleic acid molecule comprising a polynucleotide encoding a cytokine that is structurally similar to TNF and related cytokines and is believed to have similar biological effects and activities. This cytokine is named Neutrokine alpha, and the present invention provides at least the amino acid sequence (SEQ ID NO: 2) in FIG.
It includes a Neutrokine alpha polypeptide having a portion of the amino acid sequence encoded by the cDNA clone deposited on bacterial host as ATCC deposit on 0-22. The nucleotide sequence determined by sequencing the deposited Neutrokine α clone (shown in FIG. 1 (SEQ ID NO: 1)) is N-terminal methionine, a putative intracellular domain of about 46 amino acid residues, about 26 It contains an open reading frame encoding a complete polypeptide of 285 amino acid residues, including a predicted transmembrane domain of amino acids, a predicted extracellular domain of approximately 213 amino acids, and a predicted molecular weight for the complete protein of approximately 31 kDa. Other II
For type I transmembrane proteins, a soluble form of Neutrokine alpha is a polypeptide that includes all or part of the extracellular domain cleaved from the transmembrane domain and a complete Neutrokine alpha polypeptide that lacks the transmembrane domain (ie, the cell Extracellular domain bound to the inner domain).

Accordingly, one aspect of the invention provides an isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence selected from the group consisting of: (a) FIG. 1 (SEQ ID NO: 2)
Or a nucleotide sequence encoding a Neutrokine alpha full-length polypeptide having the complete amino acid sequence as encoded by a cDNA clone included in the ATCC deposit on October 22, 1996; (b) FIG. 1 (SEQ ID NO: 2 ) Or 19
A nucleotide sequence encoding a putative extracellular domain of a Neutrokine alpha polypeptide having amino acid sequence 73 to 285 as encoded by a cDNA clone contained in the ATCC deposit on October 22, 1996; (c) Neutrokine About the amino acid residue in the nucleotide sequence encoding a polypeptide comprising the α intracellular domain (FIG. 1 (SEQ ID NO: 2)) or as encoded by the cDNA clone included in the ATCC deposit on October 22, 1996 (D) from position 46 to position 46); (d) a nucleotide sequence encoding a polypeptide comprising the transmembrane domain of Neutrokine alpha (in FIG. 1 (SEQ ID NO: 2) or included in the ATCC deposit on October 22, 1996) Amino acid residues as encoded by the cDNA clone 47 to about 72); (e) a nucleotide sequence encoding a soluble Neutrokine alpha polypeptide having an extracellular domain and an intracellular domain but lacking a transmembrane domain; and (f) (a), (b), (c) above ), (D), or (e)
A nucleotide sequence complementary to any of the nucleotide sequences in

A further embodiment of the invention is at least 90% identical to any of the nucleotide sequences in (a), (b), (c), (d), (e) or (f) above, and More preferably, a polynucleotide having the same nucleotide sequence of 95%, 96%, 97%, 98%, or 99%, or the above (a), (b), (c), (d), (e)
Or an isolated nucleic acid molecule comprising a polynucleotide that hybridizes under stringent hybridization conditions to the polynucleotide in (f). This polynucleotide that hybridizes does not hybridize under stringent hybridization conditions to a polynucleotide having a nucleotide sequence consisting of only A or T residues. Further nucleic acid embodiments of the present invention are the above (a),
The present invention relates to an isolated nucleic acid molecule comprising a polynucleotide encoding an amino acid sequence of an epitope-bearing portion of a Neutrokine alpha polypeptide having the amino acid sequence in (b), (c), (d), or (e).

The invention also provides a recombinant vector comprising an isolated nucleic acid molecule of the invention, a host cell comprising the recombinant vector, and methods and recombinant techniques for producing such vectors and host cells. It relates to methods of using these for the production of Caine alpha polypeptides or peptides.

The present invention further provides an isolated Neutrokine alpha polypeptide comprising an amino acid sequence selected from the group consisting of: (a) shown in FIG. 1 (SEQ ID NO: 2) or October 1996 The amino acid sequence of Neutrokine alpha full-length polypeptide having the complete amino acid sequence as encoded by the cDNA clone contained in the 22 day ATCC deposit; (b) in FIG. 1 (SEQ ID NO: 2) or The amino acid sequence of the putative extracellular domain of Neutrokine alpha polypeptide having amino acid sequence 73-285 as encoded by the cDNA clone contained in the ATCC deposit of Japan; (c)
In the amino acid sequence of the intracellular domain of Neutrokine α (FIG. 1 (SEQ ID NO: 2))
Or amino acid residues about 1 to about 46 as encoded by the cDNA clone contained in the ATCC deposit on October 22, 1996); (d) the amino acid sequence of the putative transmembrane domain of Neutrokine α (FIG. 1 (SEQ ID NO: 2) or October 2, 1996
Amino acid residues from about position 47 to about position 72 as encoded by the cDNA clone included in the two day ATCC deposit); and (e) an extracellular domain, each of which is defined as above, and Amino acid sequence of a soluble Neutrokine alpha polypeptide having an intracellular domain but lacking a transmembrane domain.

The polypeptide of the present invention also has the above (a), (b), (c), (d), or (e)
At least 90% similarity to the amino acid sequence described in
A polypeptide having an amino acid sequence with at least 95% similarity, and at least 80% identical, more preferably at least 90% identical, and even more preferably 95%, 96%, 97%, 98% to the above amino acid sequence Or a polypeptide having an amino acid sequence that is 99% identical.

A further embodiment of this aspect of the invention is an epitope-bearing portion of a Neutrokine alpha polypeptide having the amino acid sequence set forth in (a), (b), (c), (d), or (e) above It relates to a peptide or polypeptide having the amino acid sequence of A peptide or polypeptide having an amino acid sequence of an epitope-bearing portion of a Neutrokine alpha polypeptide of the invention comprises such an amino acid comprising at least 6 or 7, preferably at least 9, and more preferably at least about 30 amino acids to about 50 amino acids. Also encompassed by the present invention are epitope-bearing polypeptides of any length that comprise a portion of a polypeptide, but up to and including the entire amino acid sequence of a polypeptide of the invention described above. In another embodiment, the present invention provides an isolation that specifically binds to a polypeptide having the amino acid sequence described in (a), (b), (c), (d), or (e) above. Provided antibodies.

The invention further provides a method of isolating an antibody that specifically binds to a Neutrokine alpha polypeptide having an amino acid sequence as described herein. Such antibodies are
Useful diagnostically or therapeutically as described below.

The present invention also provides soluble Neutrokine alpha polypeptides, particularly human Neutrokine alpha
Pharmaceutical compositions comprising the polypeptides are provided. Soluble Neutrokine alpha polypeptides treat, for example, tumors and tumor metastases, infection by bacteria, viruses, or other parasites, immunodeficiencies, inflammatory diseases, lymphadenomas, autoimmune diseases, graft-versus-host diseases And can be used to stimulate peripheral tolerance, destroy several transformed cell lines, mediate cell activation and proliferation, and functionally as the first mediator of immune regulation and inflammatory responses It is connected.

The invention further provides a composition comprising a Neutrokine alpha polynucleotide or Neutrokine alpha polypeptide for administration to a cell in vitro, to a cell ex vivo, and to a cell in vivo or to a multicellular organism. In certain particularly preferred embodiments of this aspect of the invention, the composition comprises Neutrokine alpha polynucleotide for expression of Neutrokine alpha polypeptide in a host organism for treatment of disease. Particularly preferred in this regard is expression in human patients for the treatment of dysfunction associated with abnormal endogenous activity of the Neutrokine alpha gene.

The present invention also includes contacting a candidate compound with a cell expressing Neutrokine, assaying a cellular response, and a standard cellular response (where the standard is made in the absence of the candidate compound). Provides a screening method for identifying compounds that can enhance or inhibit the cellular response induced by Neutrokine alpha, including comparing the cellular response to Assayed when contacted in the absence of compound. Here, an enhanced cellular response over the standard indicates that the compound is an agonist, and a reduced cellular response over the standard indicates that the compound is an antagonist.

In another aspect, methods are provided for identifying Neutrokine alpha receptors, and screening assays for agonists and antagonists that use such receptors. This assay involves determining the influence of a candidate compound on Neutrokine alpha binding to Neutrokine alpha receptor. In particular, the method comprises contacting a Neutrokine alpha receptor with a Neutrokine alpha polypeptide and a candidate compound, and increasing the Neutrokine alpha polypeptide binding to the Neutrokine alpha receptor due to the presence of the candidate compound or Determining whether to decrease. Antagonists can be used to prevent septic shock, inflammation, cerebral malaria, HIV virus activation, graft host rejection, bone resorption, rheumatoid arthritis, and cachexia (waste or oligotrophic).

The present inventors have stated that Neutrokine α is not only neutrophils, but also kidneys, lungs, peripheral live leukocytes,
It was also found to be expressed in bone marrow, T cell lymphoma, B cell lymphoma, activated T cells, gastric cancer, smooth muscle, macrophages, umbilical cord blood tissue. Many of these tissue and cell disorders (eg, tumors and tumor metastases, bacterial, viral, and other parasite infections, immunodeficiency, septic shock, inflammation, cerebral malaria, HIV virus activation, graft pairs For host rejection, bone resorption, rheumatoid arthritis, and cachexia (waste or oligotrophic)
Significantly higher or lower levels of Neutrokine α compared to the standard “Neutrokine α gene expression level (ie, the expression level of Neutrokine α in tissues or fluids from non-injured individuals) It is believed that gene expression can be detected in specific tissues (eg, bone marrow) or body fluids (eg, serum, plasma, urine, joint fluid, or spinal fluid) taken from a solid with such a disorder. Thus, the present invention provides diagnostic methods that are useful during diagnosis of a disorder. This includes: (a) assaying the level of Neutrokine alpha gene expression in an individual's cells or fluid; (b) comparing the level of Neutrokine alpha gene expression to a standard level of Neutrokine alpha gene expression. An increase or decrease in the assayed Neutrokine alpha gene expression level compared to the standard expression level, thereby indicating the disorder.

A further aspect of the present invention is a method for treating an individual in need of elevated levels of Neutrokine α activity in the body, comprising a therapeutically effective amount of an isolated Neutrokine α polypeptide of the present invention or its It relates to a method comprising administering a composition comprising an agonist to such an individual.

A still further aspect of the present invention is a method for treating an individual in need of reduced levels of Neutrokine alpha activity in the body, wherein a composition comprising a therapeutically effective amount of a Neutrokine alpha antagonist is included in such an individual. To a method comprising the step of: Preferred antagonists for use in the present invention are Neutrokine alpha specific antibodies.

  The present invention provides the following.

(1) An isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence that is at least 95% identical to a sequence selected from the group consisting of:
(A) a nucleotide sequence encoding a Neutrokine α polypeptide having the complete amino acid sequence (SEQ ID NO: 2) in FIG. 1;
(B) a nucleotide sequence encoding Neutrokine alpha having the complete amino acid sequence encoded by the cDNA clone included in the ATCC deposit on October 22, 1996;
(C) a nucleotide sequence encoding a Neutrokine alpha polypeptide extracellular domain;
(D) a nucleotide sequence encoding a Neutrokine alpha polypeptide transmembrane domain;
(E) a nucleotide sequence encoding a Neutrokine alpha polypeptide intracellular domain;
(F) a nucleotide encoding a soluble Neutrokine alpha polypeptide comprising an extracellular domain and an intracellular domain but lacking a transmembrane domain;
(G) A nucleotide sequence complementary to any nucleotide sequence in (a), (b), (c), (d), (e), or (f) above.

(2) The nucleic acid molecule according to item (1), wherein the polynucleotide has the complete nucleotide sequence (SEQ ID NO: 1) in FIG.

(3) The item according to item (1), wherein the polynucleotide has the nucleotide sequence (SEQ ID NO: 1) in FIG. 1 encoding the Neutrokine α polypeptide having the complete amino acid sequence (SEQ ID NO: 2) in FIG. Nucleic acid molecule.

(4) The nucleic acid molecule according to item (1), wherein the polynucleotide has a nucleotide sequence (SEQ ID NO: 2) encoding soluble Neutrokine α containing the extracellular domain shown in FIG.

(5) An isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence at least 95% identical to a sequence selected from the group consisting of:
(A) a nucleotide sequence encoding a polypeptide having an amino acid sequence consisting of residues n to 285 of SEQ ID NO: 2, wherein n is an integer ranging from 2 to 190;
(B) a nucleotide sequence encoding a polypeptide having an amino acid sequence consisting of residues 1 to m of SEQ ID NO: 2, wherein m is an integer in the range of 274 to 284;
(C) a nucleotide sequence encoding a polypeptide having an amino acid sequence consisting of residues n to m of SEQ ID NO: 2, wherein n and m are the above (a) and (b), respectively
An array that is an integer as defined in
(D) a nucleotide sequence encoding a polypeptide consisting of a portion of the complete Neutrokine alpha amino acid sequence encoded by the cDNA clone contained in the ATCC deposit on October 22, 1996, wherein the portion is A nucleotide sequence that does not include 1-190 amino acids from the amino terminus and 1-11 amino acids from the C-terminus of the complete amino acid sequence.

(6) The polynucleotide is included in the ATCC deposit on October 22, 1996 c
The nucleic acid molecule according to item (1), which has the complete nucleotide sequence of a DNA clone.

(7) The polynucleotide is included in the ATCC deposit on October 22, 1996 c
The nucleic acid molecule of item (1), having a nucleotide sequence encoding a Neutrokine alpha polypeptide having the complete amino acid sequence encoded by a DNA clone.

(8) The polynucleotide is included in the ATCC deposit on October 22, 1996 c
The nucleic acid molecule according to item (1), having a nucleotide sequence encoding a soluble Neutrokine alpha polypeptide comprising an extracellular domain encoded by a DNA clone.

(9) A stringent high level of a polynucleotide having a nucleotide sequence identical to the nucleotide sequence in (a), (b), (c), (d), (e), or (f) of item (1) An isolated nucleic acid molecule comprising a polynucleotide that hybridizes under hybridization conditions, wherein the hybridizing polynucleotide has a nucleotide sequence consisting of only A or T residues An isolated nucleic acid molecule that does not hybridize under stringent conditions.

(10) The amino acid sequence of the epitope-bearing portion of the Neutrokine α polypeptide having the amino acid sequence of (a), (b), (c), (d), (e), or (f) of item (1) An isolated nucleic acid molecule comprising an encoding polynucleotide.

(11) The isolated nucleic acid molecule of item (10), which encodes an epitope-bearing portion of a Neutrokine alpha polypeptide selected from the group consisting of: about Phe 115-
A polypeptide comprising about Leu 147 amino acid residues (SEQ ID NO: 2); about Ile 150
A polypeptide comprising about .about.Tyr 163 amino acid residues (SEQ ID NO: 2);
A polypeptide comprising about Ser 171 to about Phe 194 amino acid residues (SEQ ID NO: 2); a polypeptide comprising about Glu 223 to about Tyr 247 amino acid residues (SEQ ID NO: 2); and about Ser 271 to about Phe 278 A polypeptide comprising the amino acid residue (SEQ ID NO: 2).

(12) A method for producing a recombinant vector, comprising a step of inserting the isolated nucleic acid molecule according to item (1) into a vector.

  (13) A recombinant vector produced by the method according to item (12).

(14) A method for producing a recombinant host cell, comprising the step of introducing the recombinant vector according to item (13) into the host cell.

  (15) A recombinant host cell produced by the method according to item (14).

(16) A recombinant method for producing a Neutrokine alpha polypeptide, under conditions such that the polypeptide is expressed and the polypeptide is recovered
A method comprising culturing the recombinant host cell according to 1.

(17) An isolated Neutrokine α polypeptide comprising an amino acid sequence at least 95% identical to a sequence selected from the group consisting of:
(A) Neutrokine α having the complete amino acid sequence in FIG. 1 (SEQ ID NO: 2)
Amino acid sequence of
(B) the amino acid sequence of Neutrokine alpha having the complete amino acid sequence encoded by the cDNA clone contained in the ATCC deposit on October 22, 1996;
(C) the amino acid sequence of the Neutrokine alpha polypeptide extracellular domain;
(D) the amino acid sequence of the Neutrokine α polypeptide transmembrane domain;
(E) the amino acid sequence of the Neutrokine α polypeptide intracellular domain;
(F) the amino acid sequence of a soluble Neutrokine α polypeptide comprising a domain; and (g) any of the polypeptides of (a), (b), (c), (d), (e), or (f) Or the amino acid sequence of one epitope-bearing part.

(18) The isolated polypeptide according to item (17), comprising an epitope-bearing portion of Neutrokine α, wherein the portion is selected from the group consisting of: about Ph
a polypeptide comprising the amino acid residues of e 115 to about Leu 147 (SEQ ID NO: 2);
a polypeptide comprising amino acid residues from 150 to about Tyr 163 (SEQ ID NO: 2); a polypeptide comprising amino acid residues from about Ser 171 to about Phe 194 (SEQ ID NO: 2); about Glu 223 to about A polypeptide comprising the amino acid residue of Tyr 247 (SEQ ID NO: 2); and a polypeptide comprising the amino acid residue of about Ser 271 to about Phe 278 (SEQ ID NO: 2).

(19) specifically binds to the Neutrokine α polypeptide according to item (17),
Isolated antibody.

(20) A pharmaceutical composition comprising the polypeptide of item (17) and a pharmaceutically acceptable carrier.

(21) An isolated nucleic acid molecule comprising a polynucleotide having a sequence at least 95% identical to a sequence selected from the group consisting of:
(A) the nucleotide sequence of clone HSOAD55R (SEQ ID NO: 7);
(B) the nucleotide sequence of clone HSLAH84R (SEQ ID NO: 8);
(C) nucleotide sequence of clone HLTBM08R (SEQ ID NO: 9);
(D) the nucleotide sequence of the portion of the sequence shown in FIG. 1 (SEQ ID NO: 1), wherein said portion comprises at least 30 consecutive nucleotides from nucleotide 1 to nucleotide 809; and (e ) A nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), (c) or (d) above.

(Detailed explanation)
The present invention includes an isolation comprising a polynucleotide encoding a Neutrokine α polypeptide having the amino acid sequence shown in FIG. 1 (SEQ ID NO: 2), determined by sequencing cloned cDNA Neutrokine α. Provided nucleic acid molecules. Figure 1
The nucleotide sequence shown in SEQ ID NO: 1) was found on October 22, 1996, American Type Culture Collection, 12301 Park Lawn Drive, Rock.
Obtained by sequencing of the HNEDU15 clone deposited with Ville, Maryland. The deposited clone is contained in the pBluescript SK (−) plasmid (Stratagene, La Jolla, Calif.).

The Neutrokine α protein of the present invention shares sequence homology with the translation products of TNF-α, TNF-β, and Fas ligand human mRNA (FIG. 2). as mentioned above,
TNFα is an important cytokine that plays a role in the regulation of cytotoxicity, necrosis, apoptosis, costimulation, proliferation, lymph node formation, immunoglobulin class switch, differentiation, antiviral activity, adhesion molecules and other cytokines and growth factors It is believed that there is.

(Nucleic acid molecule)
Unless otherwise indicated, all nucleotide sequences determined by sequencing DNA molecules herein are expressed in an automated DNA sequencer (eg, Applied Bi
ossystems, Inc. All amino acid sequences of the polypeptides encoded by the DNA molecules determined using Model 373) and determined herein were predicted by translation of the DNA sequence determined as described above. . Thus, as is known in the art for any DNA sequence determined by this automated approach, any nucleotide sequence determined herein can contain some errors. The nucleotide sequence determined by automation is typically at least about 90% identical to the actual nucleotide sequence of the DNA molecule being sequenced, more typically at least about 95% to at least about 99.9. % Identical. The actual sequence can be more accurately determined by other approaches including manual DNA sequencing methods well known in the art. As is also known in the art, a single insertion or deletion in the determined nucleotide sequence compared to the actual sequence causes a frameshift in the translation of the nucleotide sequence, resulting in a determined nucleotide sequence. The predicted amino acid sequence encoded is completely different from the amino acid sequence actually encoded by the DNA molecule being sequenced starting at a point such as an insertion or deletion.

Depending on the “nucleotide sequence” of a nucleic acid molecule or polynucleotide, the sequence of deoxyribonucleotides for a DNA molecule or polynucleotide and the corresponding sequence of ribonucleotides (A, G, C, and U) for an RNA molecule or polynucleotide ( Each thymidine deoxyribonucleotide (T) in the deoxyribonucleotide sequence identified herein is intended to be replaced by the ribonucleotide uridine (U)).

Using the information provided herein (eg, the nucleotide sequence of FIG. 1), nucleic acid molecules of the invention encoding Neutrokine alpha polypeptides can be prepared using standard cloning and screening procedures (eg, as starting materials). a procedure for cloning cDNA using mRNA). As an example of the present invention, the nucleic acid molecule described in FIG. 1 (SEQ ID NO: 1) was discovered in a neutrophil derived cDNA library. An expressed sequence tag corresponding to a portion of the Neutrokine α cDNA was also found in neutrophils.

The Neutrokine α gene has about 285 amino acid residues (an intracellular domain of about 46 amino acids (approximately 1 to about 46 amino acid residues of FIG. 1 (SEQ ID NO: 2)), a transmembrane domain of about 26 amino acids (FIG. 1 ( Open reading encoding a protein of approximately 47 to approximately 72 amino acid residues of SEQ ID NO: 2), an extracellular domain of approximately 213 amino acids (approximately 73 to approximately 285 amino acid residues of FIG. 1 (SEQ ID NO: 2))) Including the frame; and an estimated molecular weight of about 31 kDa. The Neutrokine α protein shown in FIG. 1 (SEQ ID NO: 2) is Ge
About 20% similar and about 10% identical to human TNF-α, which can be accessed as nBank accession number 339774.

As those skilled in the art will appreciate, due to the possibility of sequencing errors described above, the deposited cD
The actual complete Neutrokine alpha polypeptide (containing about 285 amino acids) encoded by NA may be somewhat smaller. In particular, the determined Neutrokine alpha coding sequence includes a second methionine codon that can serve as a selective initiation codon for translation of the open reading frame at nucleotide positions 210-213 in FIG. 1 (SEQ ID NO: 1). . More generally, the actual open reading frame is in the range of ± 20 amino acids, predicted from either the first or second methionine codon from the N-terminus shown in FIG. 1 (SEQ ID NO: 1), It is likely that somewhere in the range of ± 10 amino acids. Depending on the analytical criteria used to identify the various functional domains,
It is further understood that the exact “address” of the extracellular, intracellular, and transmembrane domains of the Neutrokine alpha polypeptide can be slightly different. For example, FIG.
The exact location of the Neutrokine alpha extracellular domain of (SEQ ID NO: 2) can vary slightly depending on the criteria used to define the domain (eg, the address is about 1 to about 20 residues). Groups, more likely about 1 to about 5 residues can be "shifted"). In this case, the end of the transmembrane domain and the start of the extracellular domain are predicted based on the identification of the hydrophobic amino acid sequence at the above position, as shown in FIG. In any event, as will be discussed further below, the present invention further relates to polypeptides in which various residues have been deleted from the N-terminus of the complete polypeptide (the soluble extracellular form of Neutrokine alpha protein). Comprising a polypeptide that deletes one or more amino acids from the N-terminus of the extracellular domain described herein that constructs the domain).

As indicated, the nucleic acid molecules of the invention may be in the form of RNA (eg, mRNA) or D
NA forms (eg, cD obtained by cloning or synthetically produced)
NA and genomic DNA). DNA can be double-stranded or single-stranded. The single stranded DNA or RNA can be the coding strand (also known as the sense strand),
Or it can be the non-coding strand (also known as the antisense strand).

By “isolated” nucleic acid molecule (s) is intended a nucleic acid molecule (DNA or RNA) that has been removed from its natural environment. For example, recombinant DN contained in a vector
The A molecule is intended to be isolated for the purposes of the present invention. Further examples of isolated DNA molecules are recombinant DNA molecules maintained in heterologous host cells, or in solution (
Including partially or substantially purified DNA molecules. Isolated RNA molecules include in vivo or in vitro RNA transcripts of the DNA molecules of the present invention. Nucleic acid molecules isolated according to the present invention further include such molecules as are produced synthetically.

The isolated nucleic acid molecule of the present invention comprises one of the nucleotide sequences shown in FIG. 1 (SEQ ID NO: 1).
D containing an open reading frame (ORF) with an initiation codon at positions 47-149
Contains NA molecules. In addition, isolated nucleic acid molecules of the present invention include DNA molecules that are substantially different from the sequences described above but still contain sequences encoding Neutrokine alpha protein due to the degeneracy of the genetic code. Of course, the genetic code is well known in the art. Therefore, it is routine for those skilled in the art to generate the above degenerate variants. In another aspect, the present invention provides an isolated nucleic acid molecule encoding a Neutrokine alpha polypeptide having an amino acid sequence encoded by a cDNA contained in a plasmid deposited on October 22, 1996. Preferably, the nucleic acid molecule comprises a sequence encoding the extracellular domain of the polypeptide encoded by the deposited cDNA clone.

The present invention further provides the nucleotide sequence shown in FIG. 1 (SEQ ID NO: 1), or the Neutrokine α cDNA contained in the deposited clone above, or one of the above sequences.
Nucleic acid molecules having a sequence complementary to each other are provided. Such isolated molecules, in particular DNA
The molecules are useful as probes for gene mapping by in situ hybridization with chromosomes and for detecting the expression of Neutrokine alpha gene in human tissues, for example by Northern blot analysis.

The invention further provides nucleic acid molecules that encode portions of the nucleotide sequences described herein,
As well as fragments of the isolated nucleic acid molecules described herein. Specifically, the present invention provides a polynucleotide having a nucleotide sequence (consisting of positions 1 to 1001 of SEQ ID NO: 1) representing a portion of SEQ ID NO: 1.

Furthermore, the present invention provides a sequence that is at least 95% identical to any portion of at least about 30 contiguous nucleotides, preferably at least about 50 nucleotides, of the sequence from nucleotide 1 to nucleotide 809 of FIG. 1 (SEQ ID NO: 1). A polynucleotide comprising

More generally, a diagnostic probe as discussed herein by the nucleotide sequence of the deposited cDNA or a fragment of an isolated nucleic acid molecule having the nucleotide sequence shown in FIG. 1 (SEQ ID NO: 1) And at least about 1 useful as a primer.
Fragments that are 5 nt, and more preferably at least about 20 nt, even more preferably at least about 30 nt, and even more preferably at least about 40 nt in length are contemplated. Of course, larger fragments of 50-300 nt length according to the present invention are also useful. This is because these fragments are most, if not all, of the deposited cDNA or nucleotide sequence as shown in FIG. 1 (SEQ ID NO: 1). For example, by a fragment of at least 20 nt in length, a fragment comprising 20 or more contiguous bases of the deposited cDNA or from the nucleotide sequence as shown in FIG. 1 (SEQ ID NO: 1) is contemplated. Preferred nucleic acid fragments of the invention include nucleic acid molecules that encode the epitope-bearing portion of a Neutrokine alpha polypeptide as identified in FIG. 1 and described in more detail below.

In another aspect, the present invention provides stringent hybridization conditions,
Provided is an isolated nucleic acid molecule comprising a polynucleotide that hybridizes to a portion of the polynucleotide in the nucleic acid molecule of the invention described above (eg, a cDNA clone contained in the ATCC deposit on October 22, 1996). . According to “stringent hybridization conditions”, a solution containing parentheses (50% formamide, 5 × SSC (150 mM Na
Cl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6)
5 × Denhart solution, 10% dextran sulfate, and 20 g / ml denatured sheared salmon sperm DNA) overnight incubation at 42 ° C. followed by washing the filter in 0.1 × SSC at about 65 ° C. Intended.

Depending on the polynucleotide that hybridizes to a “portion” of the polynucleotide, at least about 15 nucleotides (nt) of the reference polynucleotide, and more preferably at least about 20 nt, even more preferably at least about 30 nt, and even more preferably about Polynucleotide (DN) hybridizing to 30-70 (eg 50) nt
Either A or RNA) is contemplated. These are useful as diagnostic probes and primers as discussed in more detail above and below.

For example, a portion of a polynucleotide “at least 20 nt long” may be used by the nucleotide sequence of the reference polynucleotide (eg, deposited cDNA or FIG. 1 (SEQ ID NO: 1
More than 20 contiguous nucleotides of the sequence from) are contemplated. Of course, only the poly A sequence (eg, the 3 ′ end poly (A) region of the Neutrokine α cDNA shown in FIG. 1 (SEQ ID NO: 1)), or the complementary region of the T (or U) residue only. Hybridizing polynucleotides are not included in the polynucleotides of the invention used to hybridize to portions of the nucleic acids of the invention. Because
This is because such a polynucleotide hybridizes to any nucleic acid molecule comprising a poly (A) region or its complement (eg, particularly any double-stranded cDNA clone).

As indicated, the nucleic acid molecules of the invention encoding Neutrokine alpha polypeptides are:
Nucleic acid molecules encoding may include, but are not limited to: amino acid sequences of the extracellular domain of the polypeptide; and coding sequences and additional sequences of the extracellular domain of the polypeptide (eg, intracellular and membranes) A transcoding domain sequence, or a preprotein sequence or a proprotein sequence or a sequence encoding a preproprotein sequence); a coding sequence of the extracellular domain of a polypeptide with or without said additional coding sequence.

Also encoded by the nucleic acids of the invention are the protein sequences described above with additional non-coding sequences, such as introns and non-coding 5 ′ and 3 ′ sequences (eg, roles in transcription, mRNA processing (eg, ribosomes) Transcribed untranslated sequences responsible for binding and mRNA stability (including splicing and polyadenylation signals)); including but not limited to additional coding sequences encoding additional amino acids such as sequences that provide additional functionality Not.

Thus, a sequence encoding a polypeptide can be fused to a marker sequence (eg, a sequence encoding a peptide that facilitates purification of the fused polypeptide). In certain preferred embodiments of this aspect of the invention, the marker amino acid sequence is inter alia a hexa-histidine peptide (eg pQE vector (QIAGEN, Inc., 9259).
Eton Avenue, Chatsworth, CA, 91311), many of which are commercially available. For example, Gentz et al., Pro
c. Natl. Acad. Sci. USA 86: 821-824 (198
As described in 9), hexahistidine provides convenient purification of the fusion protein. The “HA” tag is another peptide useful for purification corresponding to an epitope derived from influenza hemagglutinin protein, which is described in Wilson et al., Cell 3
7: 767 (1984). As discussed below, other such fusion proteins include Neutrokine alpha fused to Fc at the N or C terminus.

(Modified and mutant polynucleotides)
The present invention further relates to variants of the nucleic acid molecules of the present invention that encode portions, analogs, or derivatives of Neutrokine alpha protein. Variants can occur naturally, such as natural allelic variants. By “allelic variant” is intended one of several alternative forms of a gene occupying a given locus on an organism's chromosome. Genes II,
Lewin, B.B. Hen, John Wiley & Sons, New York (
1985). Non-naturally occurring variants can be generated using mutagenesis techniques known in the art.

Such variants include those produced by nucleotide substitutions, deletions or additions. Substitutions, deletions, or additions can include one or more nucleotides. Variants can be altered in coding regions, non-coding regions, or both. Changes in the coding region can result in conservative or non-conservative amino acid substitutions, deletions, or additions. Particularly preferred among these are silent substitutions, additions and deletions that do not alter the properties and activities of the Neutrokine alpha protein, or portions thereof. Also particularly preferred in this regard is conservative substitution.

Most preferably, the amino acid sequence shown in FIG. 1 (SEQ ID NO: 2), or the deposited cD
A nucleic acid molecule encoding the extracellular domain of a protein having the extracellular domain of Neutrokine alpha amino acid sequence encoded by the NA clone. Further embodiments are:
An isolated comprising a polynucleotide having a nucleotide sequence that is at least 90% identical, and more preferably at least 95%, 96%, 97%, 98%, or 99% identical to a polynucleotide selected from the group consisting of: (A) a nucleotide sequence encoding a Neutrokine alpha polypeptide having the complete amino acid sequence in FIG. 1 (SEQ ID NO: 2); (b) positions 73-285 in FIG. 1 (SEQ ID NO: 2) A nucleotide sequence encoding the deduced extracellular domain of a Neutrokine alpha polypeptide having an amino acid sequence in; (c) a Neutrokine having a complete amino acid sequence encoded by a cDNA clone contained in the ATCC of 22 October 1996 a nucleotide sequence encoding an α polypeptide; (d) 1996 A nucleotide sequence encoding the extracellular domain of a Neutrokine alpha polypeptide having an amino acid sequence encoded by a cDNA clone contained in the ATCC deposit of 0-22; and (e) (a), (b) above, (C),
Or a nucleotide sequence complementary to any of the nucleotide sequences of (d).

A polynucleotide having a nucleotide sequence that is at least, for example, 95% “identical” to a reference nucleotide sequence encoding a Neutrokine α polypeptide, such that the polynucleotide sequence is each 100 nucleotides of the reference nucleotide sequence encoding a Neutrokine α polypeptide. It is contemplated that the nucleotide sequence of the polynucleotide is identical to the reference sequence, except that it may contain up to 5 point mutations per. In other words, to obtain a polynucleotide having a nucleotide sequence that is at least 95% identical to the reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence can be deleted or replaced with another nucleotide, or the reference A number of nucleotides up to 5% of the total nucleotides in the sequence can be inserted into the reference sequence. These variations of the reference sequence are either at the 5 ′ or 3 ′ terminal position of the reference nucleotide sequence, either individually in the nucleotides in the reference sequence, or in one or more consecutive groups in the reference sequence Can occur anywhere between these end positions.

In practice, any particular nucleic acid molecule is present, for example, at least 90%, 95%, 96% in the nucleotide sequence shown in FIG. 1 or the nucleotide sequence of the deposited cDNA clone,
Whether it is 97%, 98%, or 99% identical is determined by the Bestfit program (Wi
sconsin Sequence Analysis Package, Versi
on 8 for Unix (R), Genetics Computer G
group, University Research Park, 575 Scie
nce Drive, Madison, WI 53711) can be determined conventionally using known computer programs. Bestfit is Smith and Waterman, Advances in Applied Mathematics.
cs. 2: 482-489 (1981) to find the optimal segment of homology between two sequences. When using Bstfit or any other sequence alignment program to determine whether a particular sequence is, for example, 95% identical to a reference sequence according to the present invention, the parameters are of course the percent identity. Set to be calculated over the entire length of the reference nucleotide sequence and to allow gaps in homology up to 5% of the total number of nucleotides in the reference sequence.

The present application, regardless of whether it encodes a polypeptide having Neutrokine alpha activity, is at least 90%, 95% of the nucleic acid sequence shown in FIG. 1 (SEQ ID NO: 1) or the deposited cDNA. Pertains to nucleic acid molecules that are 96%, 97%, 98%, or 99% identical. This is because, even if a particular nucleic acid molecule does not encode a polypeptide having Neutrokine alpha activity, one skilled in the art will know how to make a nucleic acid molecule, for example, a hybridization probe or a polymerase chain reaction (PCR) primer. This is because it still knows what to use as. Uses of the nucleic acid molecules of the present invention that do not encode a polypeptide having Neutrokine alpha activity include, among others, (1) isolating the Neutrokine alpha gene or allelic variant thereof in a cDNA library; (2) Verma et al. , Human Chromosomes: A Manual of Basic T
technologies, Pergamon Press, New York (198
8) in situ hybridization (eg, FISH) to metaphase chromosomal expansions to provide the precise chromosomal location of the Neutrokine α gene as described in 8); and (3) Neutrokine α mRNA expression in specific tissues. Northern blot analysis for detection.

However, in practice, at least 90%, 95%, 96%, 97%, or more of the nucleic acid sequence shown in FIG. Nucleic acid molecules having sequences that are 98% or 99% identical are preferred. Similar to the activity of the extracellular domain or full-length Neutrokine alpha protein of the invention, as measured by a "polypeptide having Neutrokine alpha activity" in a particular biological assay (but not necessarily Polypeptides exhibiting (not identical) activity are contemplated. For example, the Neutrokine alpha protein of the present invention regulates cell proliferation, cytotoxicity, and cell death. In vitro cell proliferation assays, cytotoxicity assays, and cell death assays for measuring protein effects on specific cells are well known and commonly used in the art to detect cell replication and / or cell death This can be done by using possible reagents. For example, T
A number of such assays for NF-related protein activity are described in various references in the background section of this disclosure above. Briefly, such an assay involves collecting human or animal (eg, mouse) cells and (1) a transfected host cell supernatant containing a Neutrokine alpha protein (or candidate polypeptide),
Or (2) mixing with an untransfected host cell supernatant control;
As well as measuring the effect on cell number or viability after a certain period of incubation. Such cell growth regulatory activity, as can be measured in this type of assay, is useful for the treatment of tumors, tumor metastases, infections, autoimmune disease inflammation, and other immune related diseases.

Neutrokine alpha regulates cell proliferation and differentiation in a dose dependent manner in the above assay. Thus, a “polypeptide having Neutrokine alpha protein activity” also includes polypeptides that exhibit any of the same cellular regulatory (particularly immunomodulatory) activities in a dose-dependent manner in the above assay. The degree of dose-dependent activity need not be the same as that of Neutrokine α protein, but preferably a “polypeptide having Neutrokine α protein activity” is substantially in a given activity compared to Neutrokine α protein. (Ie, the candidate polypeptide is a reference Neutrokine α
Show about 25 times more or less activity compared to proteins, and preferably about 10 times less activity).

Like other members of the TNF family, Neutrokine alpha exhibits activity against leukocytes including, for example, monocytes, lymphocytes, and neutrophils. This is why Neutrokine alpha is active in directing the growth, differentiation and mobilization of these cell types. Such activity is useful for immune enhancement or suppression, bone marrow protection, stem cell mobilization, control of acute and chronic inflammation, and treatment of leukemia. Assays for measuring such activity are known in the art. See, for example, Peters et al., Immun. Today
17: 273 (1996); Young et al. , J. et al. Exp. Med. 182: 111
1 (1995); Caux et al., Nature 390: 258 (1992); and S
antiago-Shwarz et al., Adv. Exp. Med. Biol. 378: 7
(1995).

Of course, due to the degeneracy of the genetic code, one of ordinary skill in the art will have at least 90%, 95%, 96%, 97%,
Numerous nucleic acid molecules with sequences that are 98% or 99% identical are identified as “Neutrokine α
It is immediately recognized that it encodes a polypeptide having “protein activity”. In fact, since all degenerate variants of these nucleotide sequences encode the same polypeptide, this will be apparent to those skilled in the art even without performing the above-described comparative assay. It is further recognized in the art that for such nucleic acid molecules that are not degenerate variants, a reasonable number also encodes a polypeptide having Neutrokine alpha protein activity. This is, as described further below, for those skilled in the art that either amino acid substitutions that are less likely or less likely to significantly affect protein function (e.g., This is because they completely know the substitution of one aliphatic amino acid with a second aliphatic amino acid.

(Vector and host cell)
The invention also relates to vectors containing the isolated DNA molecules of the invention, host cells genetically engineered with recombinant vectors, and production of Neutrokine alpha polypeptides or fragments thereof by recombinant techniques. The vector can be, for example, a phage vector, a plasmid, a viral vector, or a retroviral vector. Retroviral vectors can be replicable or replication defective. In the latter case, viral propagation generally occurs only in complementary host cells. The polynucleotide can be linked to a vector containing a selectable marker for growth in a host cell. In general, plasmid vectors are introduced in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid. If the vector is a virus, the vector can be packaged in vitro using an appropriate packaging cell line and then transduced into host cells.

DNA inserts are suitable promoters (eg, phage λP
L promoter, E.I. E. coli lac promoter, trp promoter, phoA promoter, and tac promoter, SV40 early and late promoters, and retroviral LTR promoter). Other suitable promoters are known to those skilled in the art. The expression construct further includes a site for transcription initiation, transcription termination, and a ribosome binding site for translation in the transcription region. The coding portion of the extracellular domain of the transcript expressed by the construct preferably includes a transcription start at the beginning of the polypeptide to be translated and a suitably placed stop codon (UAA, UGA, or UAG at the end). )including.

As indicated, the expression vector preferably includes at least one selectable marker.
Such markers include dihydrofolate reductase for eukaryotic cell culture,
G418, or neomycin resistance, and E. coli. Examples of culture in E. coli and other bacteria include a tetracycline resistance gene, a kanamycin resistance gene, or an ampicillin resistance gene. Representative examples of suitable hosts include bacterial cells (eg, E.c.
oli cells, Streptomyces cells, and Salmonella typhi
mulium cells); fungal cells (eg yeast cells); insect cells (eg Drosoph)
ila S2 cells and Spodoptera Sf9 cells); animal cells (eg CH
O cells, COS cells, 293 cells, and Bowes melanoma cells); and plant cells. Appropriate culture media and conditions for the above-described host cells are known in the art.

Among the preferred vectors for use in bacteria are pQE70, pQE60, and pQ.
E-9 (available from QIAGEN, Inc., supra); pBS vector, Page
script vector, Bluescript vector, pNH8A, pNH16a, p
NH18A, pNH46A (available from Stratagene); and ptrc9
9a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmac
available from cia). Among the preferred eukaryotic vectors are pWLNEO,
pSV2CAT, pOG44, pXT1, and pSG (available from Stratagene); and pSVK3, pBPV, pMSG, and pSVL (Pharmaci
a). Other suitable vectors will be readily apparent to those skilled in the art.

Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE dextran mediated transfection, cationic lipid mediated transfection, electroporation, transduction, infection or other methods. Such a method is described in Davis et al., Basic Methods In Molecular B.
It is described in many standard laboratory manuals such as iology (1986).

The polypeptide can be expressed in a modified form, such as a fusion protein, and can include additional heterologous functional regions as well as secretion signals. For example, additional amino acids,
In particular, a region of charged amino acids can be added to the N-terminus of the polypeptide to improve stability and persistence in the host cell, during purification, or during subsequent manipulation and storage. Peptide moieties can also be added to the polypeptide to facilitate purification. Such regions can be removed prior to final preparation of the polypeptide. In particular, the addition of peptide moieties to polypeptides to produce secretion or excretion, to improve stability, and to facilitate purification is well known in the art and is a routine technique . Preferred fusion proteins comprise a heterologous region derived from immunoglobulin useful for protein stabilization and purification. For example, EP-A-0 464 533 (Canadian counterpart application 2045869) is:
Disclosed are fusion proteins comprising various portions of the constant region of an immunoglobulin molecule along with another human protein or portion thereof. In many cases, the Fc moiety in the fusion protein is quite advantageous for use in therapy and diagnosis, thus for example resulting in improved pharmacokinetic properties (EP-A 0232 262). On the other hand, for some uses it is desirable that the Fc portion can be deleted after the fusion protein has been expressed, detected and purified in the advantageous manner described. This is the case when the Fc portion proves to be a hindrance to use in therapy and diagnosis (eg when the fusion protein is used as an antigen for immunization). In drug discovery, human proteins such as hIL-5 are
Fused with the Fc portion for the purpose of high throughput screening assays to identify 5 antagonists. D. Bennett et al., J. MoI. Molecular Recogn
position 8: 52-58 (1995), and K.I. Johanson et al. B
iol. Chem. 270: 9459-9471 (1995).

Neutrokine alpha protein can be subjected to ammonium sulfate precipitation or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography, and lectin chromatography. It can be recovered from recombinant cell culture and purified by well-known methods including. Most preferably, high performance liquid chromatography (“HPLC”) is used for purification. The polypeptides of the present invention can be produced by natural purification products, products of chemical synthesis procedures, and prokaryotic or eukaryotic hosts (eg,
Including products produced by recombinant techniques from bacterial cells, yeast cells, higher plant cells, insect cells, and mammalian cells). Depending on the host used in the recombinant production procedure, the polypeptides of the invention may be glycosylated or non-glycosylated.
Furthermore, the polypeptides of the present invention may also include an initiating modified methionine residue in some cases as a result of host-mediated processes.

(Neutrokine α polypeptide and fragment)
The present invention further provides an isolated Neutrokine α polypeptide having the amino acid sequence encoded by the deposited cDNA, or the amino acid sequence of FIG. 1 (SEQ ID NO: 2),
Alternatively, a peptide or polypeptide comprising a part of the polypeptide is provided.

(Modified and mutant polypeptides)
Protein manipulation can be used to improve or modify the characteristics of a Neutrokine alpha polypeptide. Recombinant DNA technology known to those skilled in the art can be used to create novel mutant proteins or “muteins or fusion proteins containing single or multiple amino acid substitutions, deletions, additions”. Such modified polypeptides can exhibit, for example, enhanced activity or increased stability. In addition, they can be purified in high yield and exhibit better solubility than the corresponding natural polypeptides at least under certain purification and storage conditions.

(N-terminal deletion mutant and C-terminal deletion mutant)
For example, for many proteins containing the extracellular domain or mature form of a secreted protein, one or more amino acids can be deleted from the N-terminus or C-terminus without substantial loss of biological function. Known in the art. For example, Ron et al. Biol
. Chem. 268: 2984-2988 (1993) is a modified KG having heparin binding activity even if 3, 8 or 27 amino terminal amino acid residues are lost.
F protein was reported.

In this case, since the protein of the present invention is a member of the TNF polypeptide family, deletion of the N-terminal amino acid up to the Gly (G) residue at position 191 in FIG. It may retain activity (eg, cytotoxicity against appropriate target cells).

Polypeptides with additional N-terminal deletions containing Gly (G) residues are not expected to retain such biological activity. This is because this residue is the beginning of a conserved domain required for biological activity in TNF-related polypeptides.
However, even if deletion of one or more amino acids from the N-terminus of the protein resulted in alteration of loss of one or more biological functions of the protein, other biological activities can still be retained. Thus, a truncated protein's ability to induce and / or bind an antibody that recognizes the complete or extracellular domain of a protein generally has N residues less than the majority of the complete or extracellular domain of the protein. If removed from the end, it is retained.
Whether a particular polypeptide lacking the N-terminal residue of the complete protein retains such immunological activity is known in the routine methods described herein and elsewhere in the art. It can be easily determined by routine methods.

Accordingly, the present invention further comprises a polypeptide having one or more residues from the amino terminus to Gly191 residues from the amino terminus of the amino acid sequence of Neutrokine α shown in FIG. 1 (SEQ ID NO: 2), and Polynucleotides encoding such polypeptides are provided. In particular, the present invention provides a polypeptide having the amino acid sequence of residues n to 190 of SEQ ID NO: 2, wherein n is an integer ranging from 2 to 190, and 191 is a Neutrokine alpha protein Is the position of the first residue from the N-terminus of the complete Neutrokine alpha polypeptide (shown in SEQ ID NO: 2) that is thought to be required for the activity of More particularly, the present invention provides a polynucleotide encoding a polypeptide having the amino acid sequence of the following residues of SEQ ID NO: 2.

Polynucleotides encoding these polypeptides are also provided.

Similarly, many examples of biologically functional C-terminal deletion muteins are known. For example, interferon γ exhibits up to 10-fold higher activity by deleting 8-10 amino acid residues from the carboxy terminus of the protein (Doebeli et al., J. Bio).
technology 7: 199-216 (1988)). Since the protein is a member of the TNF polypeptide family, deletion of the C-terminal amino acid up to Leu at position 284 results in most if not all biological activities (eg, modulation of receptor binding and cell replication). ). Polypeptides with deletions of up to about 10 additional C-terminal residues can also retain some activity (eg, receptor binding), but such polypeptides are conserved TNF beginning approximately at Leu284. It lacks the domain part. However, even if the deletion of one or more amino acids at the C-terminus of the protein modifies the loss of one or more biological functions of the protein, other biological activities can still be retained. Thus, the ability of a truncated protein to induce and / or bind an antibody that recognizes a complete or mature protein generally retains when fewer than most residues of the complete or mature protein are removed from the C-terminus. Is done. Whether a particular polypeptide lacking the C-terminal residue of the complete protein retains such immunological activity is known in the routine methods described herein and other art-recognized. It can be easily determined by routine methods.

Accordingly, the present invention further relates to Gly274 from the carboxy terminus from one or more residues from the carboxy terminus of the amino acid sequence of Neutrokine α shown in FIG. 1 (SEQ ID NO: 2).
Polypeptides having up to residues and polynucleotides encoding such polypeptides are provided. In particular, the invention provides a polypeptide having residues 1-m of the amino acid sequence of SEQ ID NO: 2, wherein m is any integer in the range of 274-284. More particularly, the present invention provides residues 1-274, 1-275, 1-276, 1-277 of SEQ ID NO: 2.
, 1-278, 1-279, 1-280, 1-281, 1-282, 1-283, and polynucleotides encoding polypeptides having the amino acid sequence of 1-284. Polynucleotides encoding these polypeptides are also provided.

Also provided is a polypeptide in which one or more amino acids have been deleted from both the amino terminus and the carboxy terminus, which generally has residues nm of the amino acid sequence of SEQ ID NO: 2, wherein n And m can be described as being an integer as described above. Also, 1996 1
A polypeptide consisting of a portion of the complete Neutrokine alpha amino acid sequence encoded by the cDNA clone contained in the ATCC deposit of 22nd 22 wherein this portion is encoded by the cDNA in the deposited clone. Which encodes a polypeptide that is excluded from the amino acid terminus from 1 to 190 amino acids or from the C terminus from 1 to 11 amino acids (or any combination of these N and C terminal deletions) Nucleotide sequences are also included. Polynucleotides encoding the above deletion polypeptides are also provided.

(Other mutants)
In addition to the terminally deleted forms of the proteins described above, one of skill in the art will recognize that some amino acid sequences of Neutrokine alpha polypeptides can be altered without having a significant effect on the structure or function of the protein. . If such sequence differences are intended, it should be recalled that there are important regions of the protein that determine activity.

Accordingly, the present invention further includes variants of Neutrokine α polypeptide that exhibit substantial Neutrokine α polypeptide activity or that include regions of Neutrokine α protein (eg, the protein portion discussed below). Such variants include deletions, insertions, inversions, repeats, and type substitutions selected according to general rules known in the art to have little effect on activity. For example, further guidance on creating phenotypically silent amino acid substitutions can be found in Bowie, J. et al. U. Et al “Decip
herring the Message in Protein Sequences:
Tolerance to Amino Acid Substitutions ",
Science 247: 1306-1310 (1990). Here, the authors show that there are two main approaches to study amino acid sequence tolerance to changes. The first method is by an evolutionary process, where mutations are either accepted or rejected by natural selection. The second approach uses genetic engineering to introduce amino acid changes at specific positions in the cloned gene, and sequences that retain functionality are identified by selection or screening.

According to the author, these studies revealed that proteins are surprisingly tolerant of amino acid substitutions. The authors further indicate which amino acid substitutions appear to be tolerated at specific positions in the protein. For example, most buried amino acid residues
Nonpolar side chains are required, while the characteristics of surface side chains are generally hardly conserved. Other such phenotypically silent substitutions are described in Bowie, J. et al. U. Et al., Cited above and in the references cited therein. A typical conservative substitution is the aliphatic amino acid A
substitution of one amino acid for another in la, Val, Leu, and Ile;
Exchange of hydroxyl residues Ser and Thr, exchange of acidic residues Asp and Glu, substitution between amide residues Asn and Gln, exchange of basic residues Lys and Arg, and between aromatic residues Phe, Tyr Is a substitution.

Thus, a fragment, derivative, or analog of the polypeptide of FIG. 1 (SEQ ID NO: 2) or the polypeptide encoded by the deposited cDNA is: (i) one or more amino acid residues are conservative or non-conservative amino acids Are substituted with residues, preferably conservative amino acid residues, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) One or more amino acid residues containing a substituent, or (iii) the extracellular domain of a polypeptide is fused with another compound, such as a compound that increases the half-life of the polypeptide (eg, polyethylene glycol). Or (iv) an additional amino acid is an IgG Fc fusion region peptide or leader or secretory sequence or polypeptide One fused to the extracellular domain of a polypeptide, such as a sequence used to purify the extracellular domain of a tide or proprotein sequence. Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.

Accordingly, the Neutrokine alpha of the present invention may include one or more amino acid substitutions, deletions, or additions derived from either natural mutations or artificial manipulations. As indicated, non-critical changes in properties are preferred, such as conservative amino acid substitutions that do not significantly affect protein folding or activity (see Table 1).

Amino acids in the Neutrokine alpha protein of the invention that are essential for function can be identified by methods known in the art, such as site-directed mutagenesis or alanine scanning mutagenesis (Cunningham and Wells, Science 244).
: 1081-1085 (1989)). The latter procedure induces a single alanine mutation at every residue in the molecule. The resulting mutant molecules are then tested for biological activity such as receptor binding or in vitro or in vivo proliferative activity.

Of particular concern is the substitution of a charged amino acid with another charged or neutral amino acid. This can result in proteins with improved properties that are highly desirable (eg, less aggregation). Aggregation is problematic not only because it can result in decreased activity, but also because aggregates can be immunogenic in preparing pharmaceutical formulations (Pinkcard et al., Clin. Ex.
p. Immunol. 2: 331-340 (1967); Robbins et al., Dia.
betes 36: 838-845 (1987); Cleland et al., Crit.
Rev. Therapeutic Drug Carrier Systems 1
0: 307-377 (1993)).

Amino acid substitutions can also change the selectivity of ligand binding to cell surface receptors. For example, Ostade et al., Nature 361: 266-268 (1993) describe specific mutations that result in selective binding of TNFα to only one of the two known types of TNF receptors. Since neurokine alpha is a member of the TNF polypeptide family, a mutation similar to that of TNF-alpha appears to have a similar effect on neurocaine alpha.

Sites important for ligand-receptor binding can also be determined by structural analysis such as crystallization, nuclear magnetic resonance, or photoaffinity labeling (Smith et al., J. Mol. Biol. 2).
24: 899-904 (1992) and de Vos et al., Science 255: 3
06-312 (1992)). Since neurokine alpha is a member of the TNF-related protein family, preferably the mutation encodes an amino acid of the TNF conserved domain in order to modulate rather than completely eliminate the biological activity of neurokine alpha. Created within the sequence (ie, positions 191 to 284 of FIG. 1 (SEQ ID NO: 2)), more preferably residues in this region that are not conserved by all members of the TGF family. By making specific mutations in Neutrokine alpha at positions where such conserved amino acids are typically found in the associated TNF, Neutrokine alpha acts as an antagonist and thereby possesses angiogenic activity. To do. Accordingly, the polypeptides of the present invention include neurokine alpha mutants. Such a Neutrokine α variant consists of the full length or preferably the extracellular domain of the Neutrokine α amino acid sequence shown in FIG. 1 (SEQ ID NO: 2).
Furthermore, the forming part of the present invention is also an isolated polynucleotide comprising a nucleic acid sequence encoding the Neutrokine alpha variant described above.

The polypeptides of the present invention are preferably provided in an isolated form and are preferably substantially purified. Recombinant production forms of Neutrokine alpha polypeptide include Smith and J
It can be substantially purified by a one-step method as described in onson, Gene 67: 31-40 (1988).

The polypeptide of the present invention comprises the complete polypeptide encoded by the deposited cDNA, including the intracellular domain, the transmembrane domain, and the extracellular domain of the polypeptide encoded by the deposited cDNA. Extracellular domain minus domain and transmembrane domain, complete polypeptide of FIG. 1 (SEQ ID NO: 2), extracellular domain of FIG. 1 (SEQ ID NO: 2) minus intracellular domain and transmembrane domain, and Polypeptides having at least 90% similarity to polypeptides, more preferably at least 95% similarity, and even more preferably at least 96%, 97%, 98%, or 99% similarity.

Further polypeptides of the invention are at least 80% identical, more preferably at least 90% or 95% identical, even more preferably to the polypeptide encoded by the deposited cDNA or the polypeptide of FIG. 1 (SEQ ID NO: 2). At least 96%, 97%,
It includes polypeptides that are 98%, or 99% identical, and also includes portions of such polypeptides having at least 30 amino acids, and more preferably at least 50 amino acids.

By “% similarity” for two polypeptides, the Bestfit program (W
isconsin Sequence Analysis Package, Vers
ion 8 for Unix (registered trademark), Genetics Computer
Group, University Research Park, 575 Sci.
ance Drive, Madison, WI 53711) and the default value for determining similarity, and the similarity values resulting from comparing the amino acid sequences of two polypeptides are contemplated. Bestfit is
Smith and Waterman (Advanceds in Applied Mat
hematics 2: 482-489 (1981)) is used to find the optimal segment of similarity between two sequences.

The reference amino acid sequence of the Neutrokine alpha polypeptide has at least, for example, 95% “
With a polypeptide having an “identical” amino acid sequence, the amino acid sequence of the polypeptide is such that the polypeptide sequence can contain up to 5 amino acid changes for every 100 amino acids of the reference amino acid sequence of the Neutrokine alpha polypeptide. It is intended to be identical to the reference sequence. In other words, in order to obtain a polypeptide having an amino acid sequence that is at least 95% identical to the reference amino acid sequence, up to 5% amino acid residues in the reference sequence can be deleted or replaced with another amino acid, Alternatively, multiple amino acids of up to 5% total amino acid residues in the reference sequence can be inserted into the reference sequence. These reference sequence modifications are distributed either at the amino-terminal position or the carboxy-terminal position of the reference amino acid sequence, or individually between residues of the reference sequence, or within one or more adjacent groups within the reference sequence Can occur somewhere between the end positions to be made.

In fact, any particular polypeptide may be at least 90%, 95%, for example, relative to the amino acid sequence shown in FIG. 1 (SEQ ID NO: 2), or the amino acid sequence encoded by the deposited cDNA clone, Whether 96%, 97%, 98%, or 99% are identical is determined by the Bestfit program (Wisconsin Sequence Analyze).
version 8 for sis Package, Unix (registered trademark), Genetics
Computer Group, University Research Park
, 575 Science Drive, Madison, Wis. 53711). To determine whether a particular sequence is, for example, 95% identical to a reference sequence of the present invention, Bestf
When using it or any other sequence alignment program, of course, the percent identity is calculated over the entire length of the reference amino acid sequence, and gaps in homology up to 5% of the total number of amino acid residues in the reference sequence Allowable parameters are set.

The polypeptides of the present invention can be used as molecular weight markers in SDS-PAGE gels or molecular sieve gel filtration columns using methods well known to those skilled in the art.

As described in detail below, the polypeptides of the present invention are also useful in assays for detecting Neutrokine alpha protein expression, as described below, or agonists that can enhance or inhibit Neutrokine alpha protein function. And as an antagonist, it can be used to raise polyclonal and monoclonal antibodies. In addition, such polypeptides can be used in a yeast two-hybrid system to “capture” Neutrokine alpha protein binding proteins that are also candidate agonists and antagonists of the present invention. The yeast two-hybrid system is described in Fields and Song, Nature 340: 245-246 (1989).

(Epitope holding part)
In another aspect, the present invention provides a peptide or polypeptide comprising an epitope-bearing portion of the polypeptide of the present invention. The epitope portion of this polypeptide is the immunogenic or antigenic epilope of the polypeptide of the invention. An “immunogenic epitope” is defined as the part of a protein that elicits an antibody response when the entire protein is an immunogen. On the other hand, the region of a protein molecule to which an antibody can bind can be defined as an “antigenic epitope”. The number of immunogenic epitopes in a protein is generally less than the number of antigenic epitopes. See, for example, Geysen et al., Proc. Natl. Acad. Sci.
USA 81: 3998-4002 (1983).

For the selection of peptides or polypeptides carrying antigenic epitopes (ie including regions of the protein molecule to which the antibody can bind), relatively short synthetic peptides that mimic part of the protein sequence were partially mimicked It is well known in the art that antisera that react with proteins can be routinely induced. For example, Sutcliffe, J. et al. G. , Shin
nick, T .; M.M. Green, N .; And Learner, R .; A. (1983)
Antibodies that react with predetermined
sites on proteins. Science 219: 660-666 "
checking ... Peptides capable of inducing protein-reactive sera are frequently present in the primary sequence of proteins and can be characterized by a simple set of chemical rules and immunity of intact proteins (ie, immunogenic epitopes) Neither the dominant region nor the amino terminus or carboxyl terminus is restricted. The antigenic epitope-bearing peptides and polypeptides of the invention are therefore useful for raising antibodies, including monoclonal antibodies that specifically bind to the polypeptides of the invention. For example, Wilson et al., Cell
37: 767-778 (1984).

The antigenic epitope-bearing peptides and polypeptides of the present invention are preferably at least 7, more preferably at least 9, and most preferably from about 15 to about 30 amino acids included within the amino acid sequence of the polypeptides of the present invention. Contains an array. Non-limiting examples of antigenic polypeptides or peptides that can be used to produce Neutrokine-specific antibodies include the following: The amino acid residues from about Phe115 to about Leu147 of FIG. 1 (SEQ ID NO: 2) Polypeptide containing; about Ile150 to about Tyr16 of FIG. 1 (SEQ ID NO: 2)
A polypeptide containing 3 amino acid residues; about Ser171 to about P in FIG. 1 (SEQ ID NO: 2)
a polypeptide containing the amino acid residue of he194; about Glu22 of FIG. 1 (SEQ ID NO: 2)
A polypeptide containing 3 to about Tyr247 amino acid residues; about S of FIG. 1 (SEQ ID NO: 2)
A polypeptide containing amino acid residues from er271 to about Leu278. These polypeptide fragments were determined to possess the antigenic epitope of Neutrokine alpha protein by analysis of the Jameson-Wol antigenicity index as shown in FIG. 3 above.

The epitope-bearing peptides and polypeptides of the present invention can be produced by any convenient means. For example, Houghten, R .; A. (1985) General
method for the rapid solid-phase syntheses
is of large numbers of peptides: specifi
city of antigen-antibody interaction at
the level of individual amino acids. Pr
oc. Natl. Acad. Sci. USA 82: 5131-5135; this “multiple peptide synthesis (SMPS)” process is further described in US Pat. No. 4,631,211 of Houghten et al. (1986).

The epitope-bearing peptides and polypeptides of the present invention are used to induce antibodies by methods well known in the art. For example, Sutcliffe et al., Supra; Wilso
n et al., supra; Et al., Proc. Natl. Acad. Sci. U
SA 82: 910-914; and Bittle, F .; J. et al. Et al. Gen.
Virol. 66: 2347-2354 (1985). The immunogenic epitope-bearing peptide of the invention (ie, the portion of the protein that elicits an antibody response) is identified according to methods known in the art when the entire protein is the immunogen. For example, Ge
ysen et al., supra. Still further, Geysen (1990), U.S. Pat. No. 5,194,3.
No. 92 detects the sequence of a monomer (amino acid or other compound) that is a topological equivalent of an epitope that is complementary to a particular paratope (antigen binding site) of the antibody of interest (ie, a “mimotope”) A general method of determination is described. More generally, Geys
US Pat. No. 4,433,092 to en (1989) describes a method for detecting or determining the sequence of monomers that are topological equivalents of a ligand that is complementary to the ligand binding site of a particular receptor of interest. Describe. Similarly, Perkylated Oligopepe
Houghten, R. in Tide Mixtures. A. (1996) U.S. Pat. No. 5,480,971 describes linear C1-C7-alkyl peralkylation (pera).
lkylated) oligopeptides and sets and libraries of such peptides, and using such oligopeptide sets and libraries to determine the sequence of hyperalkylated oligopeptides that preferentially bind to the acceptor molecule of interest A method is disclosed. Thus, non-peptide analogs of the epitope-bearing peptides of the invention can also be made routinely by these methods.

(Fusion protein)
As those skilled in the art will appreciate, the Neutrokine alpha polypeptides of the present invention, as well as those epitope-bearing fragments described above, can bind to a portion of the constant domain of an immunoglobulin (IgG), resulting in a chimeric peptide. These fusion proteins facilitate purification and show an increased half-life in vivo. This has been shown, for example, for chimeric proteins consisting of the first two domains of a human CD4-polypeptide and various domains of the constant region of a mammalian immunoglobulin heavy or light chain (EP A 394,827; T
raunecker et al., Nature 331: 84-86 (1988)). Fusion proteins having a disulfide-linked dimer structure with an IgG moiety may also be more effective than monomeric Neutrokine alpha protein or protein fragment alone in binding and neutralizing other molecules (Funtoulakis et al., J. Biochem.
270: 3958-3964 (1995)).

(Diagnosis of immune system related disorders)
The present inventors have discovered that Neutrokine alpha is expressed in various tissues and particularly neutrophils. For a number of immune system related disorders, substantial compared to “standard” neurokine alpha gene expression levels (ie, Neutrokine alpha expression levels in immune system tissues or fluids from individuals without immune system disorders) Altered (increased or decreased) levels of Neutrokine alpha gene expression may result in immune system tissues or other cells or body fluids (eg, serum, plasma, urine, synovial fluid, or Cerebrospinal fluid). Thus, the present invention provides a useful diagnostic method during the diagnosis of system disorders,
Measuring the level of expression of a gene encoding Neutrokine alpha protein in immune system tissue or other cells or body fluids derived from an individual, and comparing the measured gene expression level with a standard Neutrokine alpha gene expression level Whereby an increase or decrease in gene expression level compared to a standard is indicative of immune system disorders.

In particular, Neutrokine alpha protein and significantly increased or decreased levels of Neutrokine alpha protein-encoding mRNA when a particular tissue in a mammal with immune cancer is compared to the corresponding "standard" level Is considered to be expressed. In addition, enhanced or suppressed levels of Neutrokine alpha protein, when compared to sera from mammals of the same species that do not have cancer, certain body fluids (eg, serum, Plasma, urine, and cerebrospinal fluid).

Thus, the present invention provides a useful diagnostic method during the diagnosis of immune system disorders (including cancers of this system). The method comprises measuring the expression level of a gene encoding Neutrokine alpha protein in an immune system tissue or other cell or body fluid from an individual, and determining the measured gene expression level and a standard Neutrokine alpha gene expression level. An increase or decrease in gene expression level compared to a standard is indicative of an immune system disorder.

If a diagnosis of a disorder in the immune system (including tumor diagnosis) has already been made according to conventional methods, the present invention is useful as a prognostic indicator, thereby enhancing Neutrokine alpha gene expression enhanced or suppressed. The patients shown will experience worse clinical results compared to patients expressing this gene at levels closer to the standard level.

By “assaying the expression level of a gene encoding a Neutrokine alpha protein” directly (eg, by determining or assessing absolute protein or mRNA levels) or relative in a first biological sample (E.g. Neutrokine alpha protein protein level or mRN in the second biological sample)
Qualitative or quantitative measurement or assessment of the level of Neutrokine alpha protein or the level of mRNA encoding Neutrokine alpha protein is contemplated, either by comparison with the A level. Preferably, Neutrokine alpha protein level or mRNA level in the first biological sample is measured or evaluated and compared to standard Neutrokine alpha protein level or mRNA level. The standard can be obtained from a second biological sample obtained from an individual without a disorder or determined by an average level from a population of individuals without an immune system disorder. As assessed in the art, once a standard Neutrokine alpha protein level or mRNA level is known, it can be used repeatedly as a standard for comparison.

By “biological sample” is intended any biological sample obtained from an individual, body fluid, cell line, tissue culture, or other source including Neutrokine alpha protein or mRNA. As shown, the biological sample is a bodily fluid (eg, serum, plasma, urine, synovial fluid, and cerebrospinal fluid) that contains the free extracellular domain of Neutrokine alpha protein.
, Immune system tissues, and the extracellular domain of complete or free Neutrokine alpha protein or other tissue sources found to express Neutrokine alpha receptor. Methods for obtaining tissue biopsies and body fluids from mammals are well known in the art. If the biological sample contains mRNA, tissue biopsy is the preferred source.

The present invention is useful for the diagnosis or treatment of various immune system related disorders in mammals (preferably humans). Such disorders include tumors and tumor metastases, infection by bacteria, viruses and other parasites, immunodeficiencies, inflammatory diseases, lymphadenopathy, autoimmune diseases, and graft versus host disease. However, it is not limited to these.

Total cellular RNA can be obtained using any suitable technique (eg, Chomczynski and Sacc
hi, Anal. Biochem. 162: 156-159 (1987) can be isolated from biological samples using the one-step guanidine-thiocyanate-phenol-chloroform method). The level of mRNA encoding Neutrokine alpha protein is then assayed using any suitable method. These include Northern blot analysis, S1 nuclease mapping, polymerase chain reaction (PCR), reverse transcription combined with polymerase chain reaction (RT-PCR), and reverse transcription combined with ligase chain reaction (RT-LCR).

An assay for Neutrokine alpha protein levels in a biological sample can occur using antibody-based techniques. For example, Neutrokine alpha protein expression in tissues can be studied by classical immunohistological methods (Jalkanen, M. et al., J. Cel).
l. biol. 101: 976-985 (1985); Jalkanen, M .;
Et al. Cell. Biol. 105: 3087-3096 (1987)). Other antibody-based methods useful for detecting Neutrokine alpha protein gene expression include immunoassays, such as enzyme-linked immunosorbent assay (ELISA) and radioimmunoassay (RIA). Suitable antibody assay labels are known in the art,
And glucose oxidase and radioisotopes (eg, iodine ( ¹²⁵ I, ^1
21 I), carbon ( ¹⁴ C), sulfur ( ³⁵ S), tritium ( ³ H), indium ( ^11
1 In), and technetium ( ^99m Tc)), as well as fluorescent labels (eg, fluorescein and rhodamine) and enzymes, labels such as biotin.

In addition to assaying Neutrokine alpha protein levels in a biological sample obtained from an individual, Neutrokine alpha protein can also be detected in vivo by image analysis. Antibody labels or markers for in vivo image analysis of Neutrokine alpha protein include those detectable by radiography, NMR, or ESR. For radiography, suitable labels include radioactive isotopes such as barium or cesium that emit detectable radiation but are not clearly harmful to the subject. Suitable markers for NMR and ESR include those with a detectable characteristic rotation, such as deuterium, that can be incorporated into the antibody by labeling the relevant hybridoma nutrients.

Radioisotopes (eg, ¹³¹ I, ¹¹¹ In, ^99m Tc), radioactive opaque bodies (r
a Neutrokine alpha protein-specific antibody or antibody fragment labeled with an appropriate detectable image analysis moiety, such as an adio-opaque) substrate or a substance detectable by nuclear magnetic resonance, is tested for immune system disorders Introduced into a mammal (eg, parenterally, subcutaneously, or intravenously). It will be understood in the art that the size of the subject and the image analysis system used will determine the amount of image analysis portion required to produce a diagnostic image. For the radioisotope portion, for human subjects:
The amount of radioactivity injected is usually ^99m Tc in the range of about 5-20 millicuries. The labeled antibody or antibody fragment then accumulates preferentially at the location of the cell containing Neutrokine alpha protein, respectively. In vivo tumor image analysis is W. Burch
iel et al., "Immunopharmacologicals of Radiolab.
elled Antibodies and The Fragments "(Tu
Mer Imaging Chapter 13: The Radiochemical Decec
tion of Cancer, S.M. W. Burchiel, and A. Rho
des, Masson Publishing Inc. (1982)).

(antibody)
Neutrokine alpha protein specific antibodies for use in the present invention can be raised against intact Neutrokine alpha protein or an antigenic polypeptide fragment thereof. This can be presented to animal systems (eg, rabbits or mice) with a carrier protein such as albumin or without a carrier if it is long enough (at least about 25 amino acids).

As used herein, the term “antibody” (Ab) or “monoclonal antibody” (
Mab) is meant to include complete molecules and antibody fragments (such as Fab and F (ab ′) ₂ fragments) that can specifically bind to Neutrokine alpha protein. Fab and F (ab ′) ₂ fragments lack the Fc fragment of the complete antibody, are removed more rapidly by circulation, and have little to no nonspecific tissue binding of the complete antibody (Wahl et al., J Nucl.Med.24: 316-3.
25 (1983)). These fragments are therefore preferred.

The antibodies of the present invention can be prepared by any of a variety of methods. For example, cells expressing Neutrokine alpha protein or antigenic fragment thereof can be administered to animals to induce the production of serum containing polyclonal antibodies. In a preferred method, a Neutrokine alpha protein preparation is prepared and purified as described above, so that it is substantially free of natural contaminants. Such preparations are then introduced into animals to produce a more specific activity polyclonal antisera.

In the most preferred method, the antibody of the invention is a monoclonal antibody (or a Neutrokine alpha protein binding fragment thereof). Such monoclonal antibodies are
Hybridoma technology (Kohler et al., Nature 256: 495 (1975);
Kohler et al., Eur. J. et al. Immunol. 6: 511 (1976); Ko
hler et al., Eur. J. et al. Immunol. 6: 292 (1976); Hamm
erling et al .: Monoclonal Antibodies and T-Cell
Hybridomas, Elsevier, N .; Y. , (1981) pp56
3-681). In general, such a procedure involves immunizing an animal (preferably a mouse) with a Neutrokine alpha protein antigen, or more preferably with a Neutrokine alpha protein expressing cell. Suitable cells can be recognized by their ability to bind anti-Neutrokine alpha protein antibodies. Such cells can be cultured in any suitable tissue culture medium; however, supplemented with 10% fetal calf serum (inactivated at about 56 ° C.) and about 10 g / l non-essential amino acid, about 1 1,000 U / ml penicillin,
Preferably, the cells are cultured in Earle's modified Eagle medium supplemented with about 100 μg / ml streptomycin. Such mouse splenocytes are extracted and fused with an appropriate myeloma cell line. Any suitable myeloma cell line can be used in accordance with the present invention; however, American Type Culture Collection, Rockville, Mar
It is preferred to use the parent myeloma cell line (SP2O) available from yland. After fusion, the resulting hybridoma cells are selectively maintained in HAT medium and then Wands
(Gastroenterology 80: 225-232 (1981)). The hybridoma cells obtained by such selection are then assayed to identify clones that secrete antibodies that can bind to Neutrokine alpha protein antigen.

Alternatively, additional antibodies that can bind to Neutrokine alpha protein antigen can be produced in a two-step procedure through the use of anti-idiotype antibodies. Such a method uses the fact that an antibody is itself an antigen, and thus it is possible to obtain an antibody that binds to a secondary antibody. In accordance with this method, Neutrokine alpha protein specific antibodies are used to immunize animals (preferably mice). The splenocytes of such animals are then used to produce hybridoma cells, and the hybridoma cells are antibodies whose ability to bind to Neutrokine alpha protein-specific antibodies can be blocked by Neutrokine alpha protein antigens, respectively. Are screened to identify clones producing. Such antibodies include anti-idiotype antibodies to Neutrokine alpha protein-specific antibodies and can be used to immunize animals to induce the formation of additional Neutrokine alpha protein-specific antibodies.

It will be appreciated that Fab fragments and F (ab ′) ₂ fragments and other fragments of the antibodies of the present invention may be used in accordance with the methods disclosed herein. Such fragments are typically produced by proteolytic cleavage using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F (ab ′) ₂ fragments). Alternatively, Neutrokine alpha protein binding fragments can be generated through the application of recombinant DNA technology or through synthetic chemistry.

For diagnosis in humans, it may be preferable to use “humanized” chimeric monoclonal antibodies when in vivo imaging is used to detect enhanced levels of Neutrokine alpha protein. Such antibodies can be generated using genetic constructs derived from hybridoma cells that produce the monoclonal antibodies described above. Methods for producing chimeric antibodies are known in the art. For a review, see Morrison, Scie
nce 229: 1202 (1985); Oi et al., BioTechniques
4: 214 (1986); Cabilly et al., US Pat. No. 4,816,567;
Taniguchi et al., EP 17196; Morrison et al., EP 17
3494; Neuberger et al., WO 8601533; Robinson et al.,
WO 8702671; Boulianne et al., Nature 312: 643.
(1984); Neuberger et al., Nature 314: 268 (1985).
)checking.

(Treatment of immune system related disorders)
As noted above, Neutrokine alpha polynucleotides and polypeptides are useful for diagnosing conditions involving abnormally high or low expression of Neutrokine alpha activity. Given the cells and tissues in which Neutrokine alpha is expressed, and the activity modulated by Neutrokine alpha, a substantially altered (increased or decreased) level of Neutro in an individual compared to a standard or “normal” level The expression of Cain α results in a pathological condition associated with the body system in which Neutrokine α is expressed and / or active.

Since the Neutrokine alpha protein of the present invention is a member of the TNF family, the extracellular domain of the protein can be released in soluble form from cells expressing Neutrokine alpha by proteolytic cleavage, and thus Neutrokine alpha protein ( It is also noted that when a soluble form of the extracellular domain) is added from an exogenous source to a cell, tissue or body of an individual, the protein also exerts its modulating activity in any target cell of the individual. It is understood by the contractor. In addition, cells expressing this type II transmembrane protein can be added to a cell, tissue or body of an individual, whereby the added cells bind to cells expressing the receptor for Neutrokine alpha, thereby Cells expressing cain alpha can cause an action (eg, cytotoxicity) in receptor-bearing target cells.

Therefore, a condition caused by a decrease in normal or normal levels of Neutrokine alpha activity in an individual (especially an immune system disorder) is caused by Neutrokine alpha protein (a form of soluble extracellular domain or a cell that expresses the complete protein). It is understood that can be treated by administration of Thus, the present invention also provides a method of treating an individual in need of increased levels of Neutrokine alpha. This method involves administering to such an individual a pharmaceutical composition containing an amount of an isolated Neutrokine alpha polypeptide of the present invention effective to increase the level of Neutrokine alpha activity in such an individual. Process.

Since Neutrokine alpha belongs to the TNF superfamily, it should also regulate angiogenesis. In addition, Neutrokine alpha inhibits immune cell function and thus has a wide range of anti-inflammatory activity. Neutrokine alpha is an anti-angiogenic factor for treating solid tumors by stimulating invasion and activation of host defense cells (eg, cytotoxic T cells and macrophages) and inhibiting tumor angiogenesis Can be used as Those of ordinary skill in the art are aware of other non-cancerous signs where vascular growth is not desired. They can also be used to increase host defense against resistant chronic and acute infections, such as mycobacterial infection through the attraction and activation of bactericidal leukocytes. Neutrokine alpha can also be used to inhibit T cell proliferation by inhibiting IL-2 biosynthesis for the treatment of T cell mediated autoimmune diseases and lymphocytic leukemia. Neutrokine alpha can also be used to stimulate wound healing through both debris removal and the recruitment of connective tissue promoting inflammatory cells. In this same manner, Neutrokine alpha can also be used to treat other fibrotic disorders, including cirrhosis, osteoarthritis, and pulmonary fibrosis. Neutrokine alpha also increases the presence of eosinophils with the unique function of killing parasite larvae that invade tissues in cases such as schistosomiasis, trichinosis, and roundworms. For example, it can be used to regulate hematopoiesis by regulating the activation and differentiation of various hematopoietic progenitors to release mature leukocytes from the bone marrow after chemotherapy (ie, in stem cell mobilization). Neutrokine alpha can also be used to treat sepsis.

(Prescription)
Neutrokine alpha polypeptide compositions (particularly including polypeptides that are soluble forms of the extracellular domain) can affect the clinical status of individual patients (particularly the side effects of treatment with Neutrokine alpha polypeptide alone), Neutrokine alpha poly Delivery site of peptide composition, method of administration,
Taking into account the dosing schedule and other factors known to the practitioner, it is formulated and administered in a manner consistent with good medical practice. Thus, Neutrokine α for purposes herein
An “effective amount” of a polypeptide is determined by such considerations.

As a general suggestion, the total pharmaceutically effective amount of Neutrokine alpha polypeptide administered parenterally per dose ranges from about 1 μg / kg / day to 10 mg / kg / day per patient body weight, As noted above, this is subject to therapeutic discretion. More preferably, this dose is at least 0.01 mg / kg / day, and most preferably about 0.01-1 mg / kg / day in hormones for humans. When given sequentially, Neutrokine alpha polypeptide is typically injected at 1 to 4 injections per day at a dose rate of about 1 μg / kg / hour to about 50 μg / kg / hour, or, for example, It is administered by either continuous subcutaneous infusion using a minipump. An intravenous bag solution may also be used. The length of treatment required to observe the change, and the interval until response occurs after the treatment appears to vary according to the desired effect.

A pharmaceutical composition comprising the Neutrokine alpha polypeptide of the present invention may be administered by oral, rectal, parenteral, intracisternally, intravaginally, intraperitoneally, topically (powder, ointment, eye drops, or transdermal patch). A) or buccal or as an oral or intranasal spray. “Pharmaceutically acceptable carrier” refers to any type of non-toxic solid, semi-solid,
Or a liquid excipient, diluent, encapsulating material, or formulation aid. The term “parenteral” as used herein refers to modes of administration including intravenous and intramuscular, intraperitoneal, substernal, subcutaneous, and intraarticular injections and infusions.

Neutrokine alpha polypeptides are also suitably administered by a sustained release system. Suitable examples of sustained release compositions include a semipermeable polymer matrix in the form of a shaped article (eg, a film or microcapsule). Sustained release matrices include polylactide (US Pat. No. 3,773,919, EP 58,481), L-glutamic acid and γ-ethyl-L-
Copolymers with glutamate (Sidman, U., et al., Biopolymers 2
2: 547-556 (1983)), poly (2-hydroxyethyl methacrylate) (
R. Langer et al. Biomed Mater. Res. 15: 167
-277 (1981) and R.A. Langer, Chem. Tech. 12:
98-105 (1982)), ethylene vinyl acetate (R. Langer et al.,
Ibid), or poly-D-(-)-3-hydroxybutyric acid (EP 133,988). The sustained release Neutrokine alpha polypeptide composition also includes Neutrokine alpha polypeptide encapsulated in liposomes. Liposomes containing Neutrokine alpha polypeptide are prepared by methods known per se (DE 3,218,121; Epste).
in et al., Proc. Natl. Acad. Sci. (USA) 82: 368
8-3692 (1985); Hwang et al., Proc. Natl. Acad.
Sci. (USA) 77: 4030-4034 (1980); EP 52,3
EP 36,676; EP 88,046; EP 143,949; EP
142, 641; Japanese Patent Application No. 83-118008; US Pat. No. 4,48
5,045 and 4,544,545; and EP 102,324). Usually, liposomes are of a small (about 200-800 angstrom) monolayer type,
Here, the fat content is about 30 mol. Above% cholesterol, the selected ratio is adjusted for optimal Neutrokine alpha polypeptide therapy.

For parenteral administration, in one embodiment, the Neutrokine alpha polypeptide is generally in a unit dosage injectable form (solution, suspension, or emulsion) with the desired degree of purity.
Of this polypeptide with a pharmaceutically acceptable carrier (ie, a carrier that is non-toxic to the recipient and compatible with the other ingredients of the formulation) at the dosages and concentrations employed. It is prescribed by. For example, the formulation preferably does not include oxidizing agents and other compounds that are known to be deleterious to polypeptides.

In general, formulations are prepared by contacting Neutrokine alpha polypeptide uniformly and directly with a liquid carrier or a finely divided solid carrier or both. Then, if necessary, the product is shaped into the desired formulation. Preferably, the carrier is a parenteral carrier, more preferably a solution that is isotonic with the blood of the recipient. Examples of such carrier vehicles include water, saline, Ringer's solution, and dextrose solution. Non-aqueous vehicles such as fixed oils and ethyl oleate, as well as liposomes are useful herein.

The carrier suitably contains minor amounts of additives such as substances that enhance isotonicity and chemical stability. Such substances are non-toxic to recipients at the dosages and concentrations used, and buffers such as phosphoric acid, citric acid, succinic acid, acetic acid, and other organic acids or their salts; Antioxidants such as ascorbic acid; low molecular weight (less than about 10 residues) polypeptides (eg, polyarginine or tripeptides); proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic properties such as polyvinylpyrrolidone Polymers; amino acids such as glycine, glutamic acid, aspartic acid, or arginine; monosaccharides, disaccharides, and other carbohydrates including cellulose or derivatives thereof, glucose, mannose, or dextrin; chelating agents such as EDTA; mannitol Or a sugar alcohol such as sorbitol; Counterions such as sodium; and / or polysorbate, including non-ionic surfactants such as Porookisama (poloxamer) or PEG.

Neutrokine alpha polypeptide is typically about 0.1 mg in such a vehicle.
/ Ml to 100 mg / ml, preferably 1-10 mg / ml, at a pH of about 3-8. It will be appreciated that the use of certain of the excipients, carriers, or stabilizers described above will result in a formulation of Neutrokine alpha polypeptide salt.

Neutrokine alpha polypeptides used for therapeutic administration must be sterile. Sterilization is readily achieved by filtration through a sterile filtration membrane (eg, a 0.2 micron membrane). The therapeutic Neutrokine alpha polypeptide composition is generally placed in a container with a sterile doorway (eg, a vial with a stopper through which an intravenous solution bag or hypodermic needle can penetrate).

Neutrokine alpha polypeptides are usually stored in unit dose or multi-dose containers (eg, sealed ampoules or vials) as aqueous solutions or lyophilized formulations for reconstitution. As an example of a lyophilized formulation, a 10 ml vial is filled with 5 ml of sterile filtered 1% (w / v) aqueous Neutrokine α polypeptide solution and the resulting mixture is lyophilized. The injection solution was lyophilized Neutrokine α
The polypeptide is prepared by reconstitution with bacteriostatic distilled water for injection.

The present invention also provides pharmaceutical packs and kits comprising one or more containers filled with one or more components of the pharmaceutical composition of the present invention. In such containers, precautionary statements in a form prescribed by a government agency that regulates the manufacture, use, or sale of drugs or biological products, the manufacture, use of products for human administration, Or it may be accompanied by a note reflecting the approval by the sales agency. Furthermore, the polypeptides of the present invention can be used in combination with other therapeutic compounds.

Agonists and antagonists-assays and molecules
The invention also provides a method of screening compounds to identify compounds that enhance or block the action of Neutrokine alpha in cells (eg, interaction with Neutrokine alpha binding molecules such as receptor molecules). An agonist is a compound that increases the natural biological function of Neutrokine alpha, or functions in a manner similar to Neutrokine, while an antagonist reduces or eliminates such function.

In another aspect of this embodiment, the present invention provides a method for identifying a receptor protein or ligand binding protein that specifically binds to a Neutrokine alpha polypeptide. For example, cell compartments (eg, membranes or preparations thereof) can be prepared from cells that express molecules that bind Neutrokine alpha. The preparation is incubated with labeled Neutrokine alpha, and the Neutrokine alpha complex bound to the receptor or other binding protein is isolated and characterized according to routine methods known in the art. Attached. Alternatively, the Neutrokine alpha polypeptide can be bound to a solid support, as binding molecules solubilized from cells bind to the column and are then eluted and characterized according to routine methods.

In the assays of the invention for agonists or antagonists, a cellular compartment (eg, a membrane or preparation thereof) expresses a molecule that binds to Neutrokine alpha (eg, a signal transduction or regulatory pathway molecule regulated by Neutrokine alpha). Can be prepared from cells. This preparation is incubated with labeled Neutrokine alpha in the absence or presence of candidate molecules that may be Neutrokine alpha agonists or antagonists. The ability of the candidate molecule to bind to the binding molecule is reflected in decreased binding of the labeled ligand. Molecules that bind without reason (ie, without inducing the effects of Neutrokine alpha on binding Neutrokine alpha binding molecules) are almost good antagonists. Molecules that bind well and elicit effects that are identical or closely related to Neutrokine alpha are agonists.

Neutrokine alpha-like effects of potential agonists and antagonists can be determined, for example, by determining the activity of a second messenger system after interaction of a candidate molecule with a cell or appropriate cell preparation, and Neutrokine alpha or can be measured by comparing to the effect of molecules that induce the same effect as Neutrokine alpha. Second messenger systems that may be useful in this regard include, but are not limited to, AMP guanylate cyclase, ion channels, or phosphoinositide hydrolyzed second messenger systems.

Another example of an assay for a Neutrokine alpha antagonist is competition that combines Neutrokine alpha with a potential antagonist having a membrane-bound receptor receptor or a recombinant Neutrokine alpha receptor molecule under conditions appropriate for a competitive inhibition assay. Assay. Neutrokine alpha can be labeled, for example, by radioactivity, so that the number of Neutrokine alpha molecules that bind to the receptor molecule can be accurately determined to assess the effects of potential antagonists.

Potential antagonists include small organic molecules, peptides, polypeptides, and antibodies that bind to a polypeptide of the invention and thereby inhibit or deactivate its activity.
Potential antagonists also bind to the same site on a binding molecule (eg, a receptor molecule) without inducing Neutrokine alpha-inducing activity, thereby causing Neutrokine alpha
It can be a small organic molecule, peptide, polypeptide, such as a closely related protein or antibody that prevents the action of Neutrokine alpha by preventing it from binding.

Other potential antagonists include antisense molecules. Antisense technology can be used to control gene expression through antisense DNA or RNA, or through triple helix formation. Antisense technology is described, for example, in Okano, J. et al. Neuroche
m. 56: 560 (1991); Oligodeoxynucleotides
as Antisense Inhibitors of Gene Express
on, CRC Press, Boca Raton, FL (1988). Triple helix formation is described, for example, by Lee et al., Nucleic. Acid
s Research 6: 3073 (1979); Cooney et al., Science
ce 241: 456 (1988); and Dervan et al., Science 25
1: 1360 (1991). The method comprises the step of:
Based on binding to complementary DNA or RNA. For example, the 5 ′ coding portion of a polynucleotide encoding the extracellular domain of a polypeptide of the invention can be used to design an antisense RNA oligonucleotide of about 10-40 base pairs in length. DNA oligonucleotides are designed to be complementary to gene regions involved in transcription, thereby preventing transcription and production of Neutrokine alpha. Antisense RNA oligonucleotides hybridize to mRNA in vivo and the mRNA molecule, Neutrokine α
Block translation to polypeptide. The oligonucleotides described above can also be delivered to cells so that antisense RNA or DNA can be expressed in vivo and inhibit Neutrokine alpha production.

Agonists and antagonists can be used in compositions having a pharmaceutically acceptable carrier, eg, as described above.

Antagonists are, for example, macrophages and their precursors, and neutrophils,
Neutrokine alpha in basophils, B lymphocytes, and some T cell subsets (eg, activated CD8 cytotoxic T cells and natural killer cells in certain autoimmune and chronic inflammatory and infectious diseases) Can be used to inhibit chemotaxis and activity. Examples of autoimmune diseases include multiple sclerosis and insulin dependent diabetes. Antagonists can also prevent infectious diseases (by preventing recruitment and activation of monocyte phagocytes).
Can be used to treat silicosis, including sarcoidosis, idiopathic pulmonary fibrosis). They can also be used to treat hypereosinophilic syndrome by preventing eosinophil production and migration. Endotoxin shock can also be treated with antagonists by preventing macrophage migration and production of the human chemokine polypeptides of the invention. Antagonists can also be used to treat atherosclerosis by preventing monocyte infiltration in the arterial wall. Antagonists also include histamine-mediated allergic reactions and immunological disorders (late allergic reactions, chronic urticaria, and atopic dermatitis by inhibiting the release of chemokine-induced mast cells and eosinophil degranulation and histamine ) Can be used. IgE-mediated allergic reactions such as allergic asthma, rhinitis, and eczema can also be treated. Antagonists can also be used to treat chronic and acute inflammation by preventing the attraction of monocytes to the wound area. They can also be used to control normal pulmonary macrophage populations. This is because chronic and acute inflammatory pulmonary diseases are associated with mononuclear phagocyte necrotic separation in the lung. Antagonists can also be used to treat rheumatoid arthritis by preventing the attraction of monocytes into the joint fluid in the patient's joint. Monocyte influx and activation plays a significant role in the pathogenesis of both degenerative and inflammatory arthropathy. Antagonists can be used to prevent deleterious cascades primarily due to IL-1 and TNF, which prevent the biosynthesis of other inflammatory cytokines. In this way, antagonists can be used to prevent inflammation. Antagonists can also be used to inhibit prostaglandin-dependent heat induced by chemokines. Antagonists can also be used to treat cases of bone marrow failure (eg, aplastic anemia and myelodysplastic syndromes). Antagonists can also be used to treat asthma and allergies by preventing eosinophil accumulation in the lung. Antagonists can also be used to treat subepithelial basement membrane fibrosis, a hallmark of asthmatic lung.

Antibodies against Neutrokine alpha can be used to bind Neutrokine alpha and inhibit Neutrokine alpha activity and treat ARDS by preventing neutrophil infiltration into the lung after injury. Antagonists can be used, for example, in compositions having a pharmaceutically acceptable carrier as described herein below.

(Chromosome assay)
The nucleic acid molecules of the present invention are also useful for chromosome identification. A sequence can be specifically targeted to and hybridized to a particular location on an individual human chromosome. Furthermore, there is currently a need to identify specific sites on the chromosome. Currently, most chromosome labeling reagents based on actual sequence data (repetitive polymorphisms) are not available for labeling chromosome positions. Mapping of DNA to chromosomes according to the present invention is an important first step in correlating these sequences with genes associated with disease.

In certain preferred embodiments in this regard, the cDNA disclosed herein is used to clone genomic DNA of a Neutrokine alpha protein gene. This can be accomplished using a variety of well-known techniques and commonly available libraries. The genomic DNA is then used for in situ chromosome mapping using well known techniques for this purpose.

Further, in some cases, sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from cDNA. Computer analysis of the 3 ′ untranslated region of the gene is used to rapidly select primers that do not span more than one exon in the genomic DNA and thus complicate the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Fluorescence in situ hybridization (“FISH”) of cDNA clones to metaphase chromosome spreads can be used to provide accurate chromosomal location in one step. This technique can be used with probes derived from cDNAs as short as 50 or 60 bp. For a review of this technology, see Verma et al., Human Chr.
omosomes: A Manual Of Basic Techniques,
See Pergamon Press, New York (1988).

Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data is, for example, V.I. McKusick
, Mendelian Inheritance In Man (Johns Hop
(available online at Kins University, Welch Medical Library). The relationship between the gene mapped to the same chromosomal region and the disease is then identified by linkage analysis (co-inheritance of physically adjacent genes).

Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals. If the mutation is observed in some or all affected individuals but not in any normal individual, the mutation appears to be a causative agent of the disease.

Although the present invention has been generally described, the present invention is more readily understood by reference to the following examples, which are provided by way of illustration and are not intended to be limiting.

Example 1a: Expression and purification of “His-tagged” Neutrokine α in E. coli
The bacterial expression vector pQE9 (pD10) is used for bacterial expression in this example. (QUIAGEN, Inc. supra). pQE9 encodes ampicillin antibiotic resistance (“Ampr”), bacterial origin of replication (“ori”), IPTG-inducible promoter, ribosome binding site (“RBS”), QIAGEN, Inc. , Six codons encoding histidine residues that allow affinity purification using the nickel-nitrilo-triacetic acid ("Ni-NTA") affinity resin sold by the above, and an appropriate single restriction enzyme cleavage Including sites. These elements consist of six Hi fragments in which an inserted DNA fragment encoding a polypeptide is covalently attached to the amino terminus of the polypeptide.
Aligned to express a polypeptide having s residues (ie, “6 × His tag”).

D encoding the desired portion of the Neutrokine alpha protein containing the extracellular domain sequence
The NA sequence is in the amino terminal sequence of the desired portion of the Neutrokine alpha protein and c
Amplified from the deposited cDNA clone using PCR oligonucleotide primers that anneal to the sequence in the deposited construct 3 'to the DNA coding sequence. pQE
Additional nucleotides containing restriction sites that facilitate cloning in the 9 vector
Added to the 5 'and 3' primer sequences, respectively.

In order to clone the extracellular domain of the protein, the 5 'primer is the sequence 5'
It has GTG GGATCCA GCCTCCGGGGCAGAGCTG 3 ′ (SEQ ID NO: 10), which contains the underlined BamHI restriction site followed by 18 nucleotides of the amino terminal coding sequence of the extracellular domain of the Neutrokine alpha sequence in FIG. Of course, one skilled in the art will recognize that the DNA segment encoding any desired portion of the complete Neutrokine alpha protein is shorter or longer than the form of the extracellular domain at the point where the 5 'primer in the protein coding sequence begins. Understand that it can be modified to amplify. 3 '
The primer is the sequence 5 ′ GTG AAGCTT TTATTACAGCAGTTTCAAT
GCACC 3 ′ (SEQ ID NO: 11), which is complementary to the underlined Hind III restriction site, followed by two stop codons, and the 3 ′ end of the coding sequence of the Neutrokine α DNA sequence in FIG. Contains 18 nucleotides.

The amplified Neutrokine α DNA fragment and the vector pQE90 were transformed into Bam
Digest with HI and HindIII, and then digest the digested DNA together. The insertion of Neutrokine alpha DNA into the restricted pQE90 vector results in Neutrokine alpha
The coding region of the protein is placed downstream of the IPTG inducible promoter and in-frame at the start AUG and six histidine codons.

The ligation mixture was purified using competent E. coli using standard procedures. E. coli cells are transformed. Such a procedure is described by Sambrook et al., Molecular Cloning:
A Laboratory Manual, 2nd edition, Cold Spring Harb
or Laboratory Press, Cold Spring Harbor,
N. Y. (1989). E. coli containing multiple copies of plasmid pREP4, which expresses the lac repressor and also confers kanamycin resistance (“Kan ^r ”). The E. coli strain M15 / rep4 is used in carrying out the exemplary embodiments described herein. This strain, which is the only of many strains that are suitable for expressing Neutrokine alpha protein, is QIAGEN, Inc. Commercially available from above. Transformants are identified by their ability to grow on LB plates in the presence of ampicillin and kanamycin. Plasmid DNA is isolated from resistant colonies and the identity of the cloned DNA is confirmed by restriction analysis, PCR, and DNA sequencing. Clones containing the desired construct were grown overnight in liquid culture in LB medium supplemented with both ampicillin (100 μg / ml) and kanamycin (25 μg / ml) (“O /
N ") grow. O / N cultures are used to inoculate large scale cultures at a dilution of about 1:25 to 1: 250. Cells are grown to an absorbance at 600 nm (“OD600”) of between 0.4 and 0.6. Then, isopropyl-BD-thiogalactopyranoside ("IPTG
)) To give a final concentration of 1 mM and inactivate the lacI repressor,
Induces transcription from a lac repressor sensitive promoter. Cells are subsequently incubated for an additional 3-4 hours. Cells are then harvested by centrifugation according to standard methods.

The cells are then agitated in 6M guanidine HCl, pH 8 for 3-4 hours at 4 ° C. Cell debris was removed by centrifugation, and the supernatant containing Neutrokine alpha was removed from a nickel nitrilotriacetic acid (“Ni-NTA”) affinity resin column (QIAGEN,
Inc. , Available from above). Protein with 6 × His tag
Binding to Ni-NTA resin with high affinity and a single one-step procedure (for details see T
he QIA expressionist, 1995, QIAGEN, Inc. ,
The above can be purified. Briefly, the supernatant is washed with 10 volumes of 6M guanidine-HCl, pH 8, the column is first loaded in 6M guanidine HCl, pH 8, and then 10 volumes of 6
Wash with M guanidine HCl, pH 6, and finally elute with Neutrokine alpha with 6M guanidine HCl, pH 5.

The purified protein is then added to phosphate buffered saline (PBS) or 50 mM.
Regenerate by dialyzing against Na-acetate, pH 6 buffer plus 200 mM NaCl. Alternatively, the protein can be successfully refolded while immobilized on a Ni-NTA column. Recommended conditions are as follows: 500 mM NaCl, 20% glycerol, 20 mM Tris / HCl using a linear 6M-1M urea gradient.
Regeneration in pH 7.4 (containing protease inhibitors). Regeneration should be done for a period of at least 1.5 hours. After regeneration, the protein can be eluted by the addition of 250 mM imidazole. Imidazole is added to PBS or 50 mM sodium acetate (pH
6) Remove by a final dialysis step against buffer plus 200 mM NaCl. The purified protein is stored at 4 ° C or frozen at -80 ° C.

Example 1b: Expression and purification of Neutrokine alpha in E. coli
The bacterial expression vector pQE60 is used for bacterial expression in this example. (QI
AGEN, Inc. , 9259 Eton Avenue, Chatsworth
, CA, 91111). pQE60 is ampicillin antibiotic resistance ("Ampr")
And the bacterial origin of replication (“ori”), IPTG-inducible promoter, ribosome binding site (“RBS”), QIAGEN, Inc. 6 codons encoding histidine residues that allow affinity purification using a nickel nitrilotriacetic acid ("Ni-NTA") affinity resin commercially available from (supra), and an appropriate single restriction enzyme cleavage site. Such an element consists of six His residues (ie, "" and a polypeptide-encoding DNA fragment covalently linked to the carboxy terminus of the peptide.
It is arranged so that it can be inserted in such a way as to produce its polypeptide with a 6 X His tag "). However, in this example, the polypeptide coding sequence is inserted such that translation of the six His codons is prevented, and thus the polypeptide is produced without the 6 X His tag.

D encoding the desired portion of the Neutrokine alpha protein containing the extracellular domain sequence
Use PCR oligonucleotide primers to anneal the NA sequence from the deposited cDNA clone to the amino terminal sequence of the desired portion of the Neutrokine alpha protein and the sequence in the deposited construct 3 'to the cDNA coding sequence Then amplify. pQ
Additional nucleotides containing restriction sites to facilitate cloning into the E60 vector are added to each of the 5 ′ and 3 ′ sequences.

To clone the extracellular domain of the protein, the 5 ′ primer contains an underlined BspH restriction site followed by 17 nucleotides of the amino terminal coding sequence of the extracellular domain of the Neutrokine alpha sequence of FIG. 'GTG TCATGA GCCTCC
It has GGGCAGAGCTG 3 '(SEQ ID NO: 12). The skilled artisan will understand that the point in the protein coding sequence where the 5 ′ primer begins can naturally be altered to amplify the desired portion of the complete protein that is shorter or longer than the form of the extracellular domain. To do. 3
'The primer is a sequence containing the underlined HindIII restriction site, followed by two stop codons, and 18 nucleotides complementary to the 3' end of the coding sequence in the Neutrokine alpha DNA sequence of Figure 1 5'GTG AAGCTT TTATTACAGCAGTTTCAAT
It has GCACC 3 ′ (SEQ ID NO: 13).

The amplified Neutrokine alpha DNA fragment and the vector pQE60 are Bs
The DNA digested with pHI and HindIII is then ligated together. Insertion of Neutrokine alpha DNA into the restricted pQE60 vector places the Neutrokine alpha protein coding region, including its associated stop codon, downstream from the IPTG inducible promoter and in frame with the initiating AUG. The accompanying stop codon prevents translation of the six histidine codons downstream of the insertion point.

The ligation mixture was obtained from Sambrook et al., Molecular Cloning: a L.
laboratory Manual, 2nd edition; Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY
(1989) using standard procedures such as competent E. coli. col
Transform into i cells. expresses the lac repressor and is resistant to kanamycin ("K
anr ") containing multiple copies of plasmid pREP4. coli
Strain M15 / rep4 is used to perform the exemplary examples described herein.
This strain, which is the only one of many suitable for expressing Neutrokine alpha protein, is QIAGEN, Inc. (Supra). Transformants are identified by their ability to grow on LB plates in the presence of ampicillin and kanamycin. Isolate plasmid DNA from resistant colonies and clone DNA
Is confirmed by restriction analysis, PCR, and DNA sequencing.

Clones containing the desired construct were overnight (“O / N” in liquid culture in LB medium supplemented with both ampicillin (100 μg / ml) and kanamycin (25 μg / ml).
]) Grow. O / N cultures are used to inoculate large cultures at a dilution of about 1:25 to 1: 250. Cells are grown to an optical density at 600 nm (“OD600”) of between 0.4 and 0.6. Isopropyl-bD-thiogalactopyranoside ("IPTG"
) To a final concentration of 1 mM and inactivate the lacI repressor,
Induces transcription from a lac repressor sensitive promoter. Then, add 3 more cells
Incubate for ~ 4 hours. Cells are then harvested by centrifugation.

The cells are then stirred in 6M guanidine HCl (pH 8) at 4 ° C. for 3-4 hours. Cell debris is removed by centrifugation and the supernatant containing Neutrokine alpha
Dialyze against 50 mM sodium acetate buffer (pH 6) supplemented with 0 mM NaCl. Alternatively, the protein is 500 mM NaCl, 20% glycerol, 25 mM
It can be successfully refolded by dialyzing against Tris / HCl, pH 7.4 (containing protease inhibitors). After regeneration, the protein can be purified by ion exchange chromatography, hydrophobic interaction chromatography, and size exclusion chromatography. Alternatively, affinity chromatography steps such as antibody columns can be used to obtain pure Neutrokine alpha protein. Purified protein is stored at 4 ° C or frozen at -80 ° C.

(Example 2: Cloning and expression of Neutrokine α protein in baculovirus expression system)
In this illustrative example, using the plasmid shuttle vector pA2 GP,
A cloned DNA encoding the extracellular domain of a protein lacking its naturally associated intracellular and transmembrane sequences is inserted into a baculovirus and the baculovirus leader and Summers et al., A Manual of Methods for.
Baculovirus Vectors and Insect Cell Cult
ure Procedures, Texas Agricultural Expert
elementary Station Bulletin No. 1555 (1987)
Is used to express the extracellular domain of Neutrokine alpha protein. This expression vector contains the powerful polyhedrin promoter of Autographa californica nuclear polyhedrosis virus (AcMNPV), followed by the secretion signal peptide (leader) of baculovirus gp67 protein, and BamHI, X
It contains convenient restriction sites such as baI and Asp718. The polyadenylation site of simian virus 40 (“SV40”) is used for efficient polyadenylation. For easy selection of recombinant viruses, the plasmid is a weak Drosoph in the same orientation.
E. coli under the control of the ila promoter. contains the β-galactosidase gene from E. coli followed by the polyadenylation signal of the polyhedrin gene. The inserted gene is used to generate a viable virus that expresses the cloned polynucleotide.
The viral sequences are flanked on both sides for cell-mediated homologous recombination with NA.

Many other baculovirus vectors have constructs, as will be readily appreciated by those skilled in the art.
As long as it provides an appropriately positioned signal for transcription, translation, secretion, etc. (including signal peptide and in-frame AUG if necessary)
Ac373, pVL941, and pAcIM1) can be used. Such vectors are described, for example, by Luckow et al., Virology 170: 31-39 (19
89).

Encodes the extracellular domain of the deposited clone Neutrokine alpha protein, A
The UG initiation codon and the cDNA sequence lacking the naturally associated intracellular and transmembrane domain sequences shown in FIG. 1 (SEQ ID NO: 2) are designated as PCR oligonucleotide primers corresponding to the 5 ′ and 3 ′ sequences of the gene. Use to amplify. The 5 ′ primer contains an underlined BamHI restriction enzyme site followed by 18 nucleotides of the sequence of the extracellular domain of Neutrokine alpha protein shown in FIG. 1 (starting at the indicated end of the extracellular domain of the protein) Sequence 5 'GTG GGATCC CCGGGCAGAGCTGCAG
It has GGC 3 '(SEQ ID NO: 14). The 3 ′ primer is a sequence containing the underlined BamHI restriction site followed by two stop codons and 18 nucleotides complementary to the 3 ′ coding sequence of FIG. 1 5 ′ GTG GGATCC
It has TGCACC 3 ′ (SEQ ID NO: 15).

The amplified fragment is obtained from a commercially available kit (“Geneclean”, BIO 10
1 Inc. La Jolla, Ca. ) To isolate from a 1% agarose gel. The fragment is then digested with BamHI and purified again on a 1% agarose gel. This fragment is designated F1 herein.

The plasmid can be digested with the restriction enzyme BamHI and optionally dephosphorylated using bovine intestinal phosphatase using routine procedures known in the art. Then
DNA was prepared using a commercially available kit (“Geneclean” BIO 101 Inc., La
Jolla, Ca. ) To isolate from a 1% agarose gel. This vector DN
A is designated herein as “V1”.

Fragment F1 and dephosphorylated plasmid V1 are ligated together with T4 DNA ligase. E. coli HB101 or other suitable E. coli. E. coli host (eg, XL
-1 Blue (Stratagene Cloning Systems, La J
olla, CA) cells) were transformed with the ligation mixture and expanded on culture plates. Bacteria containing plasmids with the human Neutrokine alpha gene are identified by digesting DNA from individual colonies using BamHI and then analyzing the digestion products by gel electrophoresis. The sequence of the cloned fragment is confirmed by DNA sequencing. This plasmid is designated herein as pA2GP Neutrokine alpha.

5 μg of plasmid pA2GP Neutrokine α was obtained from Felgner et al., Proc.
Natl. Acad. Sci. USA, 84: 7413-7417 (198
7) 1.0 μg of commercially available linearized baculovirus DNA (“BaculoGold ^™ baculovirus DNA”,
Pharmingen, San Diego, CA. ) At the same time. 1 μg of BaculoGold ^™ viral DNA and 5 μg of plasmid pA2GP Neutrokine α were added to 50 μl of serum-free Grace's medium (Life Tech).
nologies Inc. , Gaithersburg, MD) in a sterile well of a microtiter plate. Then 10 μl Lipofectin and 9
Add 0 μl of Grace's medium, mix and incubate for 15 minutes at room temperature.
The transfection mixture was then transferred to 35m with 1ml serum-free Grace medium.
Add dropwise to Sf9 insect cells (ATCC CRL 1711) seeded in m tissue culture plates. The plate is then incubated for 5 hours at 27 ° C. The transfection solution is then removed from the plate and 1 ml of Grace insect medium supplemented with 10% fetal calf serum is added. Subsequently, the culture is continued at 27 ° C. for 4 days.

After 4 days, the supernatant is collected and a plaque assay is performed as described in Summers and Smith (supra). To allow easy identification and isolation of gal expression clones producing blue-stained plaques, “Blue Gal” (Life Tec)
hnologies Inc. , Gaithersburg). (A detailed description of this type of “plaque assay” can also be found in Life Tec.
hnologies Inc. Also found in the insect cell culture and baculovirology user's guide (pages 9-10) distributed in Gaithersburg).
After appropriate incubation, the blue-stained plaque is picked up with a micropipette (Eppendorf) tip. The agar containing the recombinant virus was then resuspended in a microcentrifuge tube containing 200 μl Grace's medium and the suspension containing the recombinant baculovirus was used to seed Sf9 cells seeded in 35 mm dishes. Infect. After 4 days, the supernatants of these culture dishes are collected and then stored at 4 ° C. This recombinant virus is referred to as V-neutrokine α.

To assess Neutrokine alpha gene expression, Sf9 cells supplemented with 10% heat-inactivated FBS are grown in Grace's medium. Cells are infected with recombinant baculovirus V-neutrokine alpha at a multiplicity of infection ("MOI") of about 2. If radiolabeled protein is desired, the medium is removed after 6 hours and SF900II medium without methionine and cysteine (Life Technologies Inc.,
(Available from Rockville, MD). 42 hours later, 5 μCi ³
Add ⁵ S methionine and 5 μCi of ³⁵ S cysteine (available from Amersham). Cells are further incubated for 16 hours and then harvested by centrifugation.
Proteins in the supernatant and intracellular proteins are analyzed by SDS-PAGE followed by autoradiography (if radiolabeled).

Microsequencing of the amino-terminal amino acid sequence of the purified protein can be used to determine the amino-terminal sequence of the extracellular domain of the protein and thus the cleavage point and length of the secretory signal peptide.

(Example 3: Cloning and expression of Neutrokine α in mammalian cells)
A typical mammalian expression vector contains a promoter element (which mediates initiation of transcription of mRNA), a protein coding sequence, and signals necessary for transcription termination and transcript polyadenylation. Additional elements include enhancers, Kozak sequences, and intervening sequences flanked by donor and acceptor sites for RNA splicing. Very effective transcription can be achieved by early and late promoters from SV40, long terminal repeats (LTR) from retroviruses (eg RSV, HTLVI, HIVI),
As well as the cytomegalovirus (CMV) early promoter. However, cellular elements can also be used (eg, the human actin promoter). Expression vectors suitable for use in the practice of the present invention include, for example, pSVL and pMSG (Ph
armacia, Uppsala, Sweden), pRSVcat (ATCC 3)
7152), pSV2dhfr (ATCC 37146), and pBC12MI (A
A vector such as TCC 67109). Mammalian host cells that can be used include human Hela, 293, H9 and Jurkat cells, mouse NIH3T3 and C127 cells, Cos1, Cos7 and CV1, quail QC1-3 cells, mouse L cells, and Chinese hamster ovary (CHO) cells. Is mentioned.

Alternatively, the gene can be expressed in stable cell lines that contain the gene integrated into the chromosome. Co-transfection with a selectable marker (eg dhfr, gpt, neomycin, hygromycin) allows the identification and isolation of the transfected cells.

The transfected gene can also be amplified to express large amounts of the encoded protein. The DHFR (dihydrofolate reductase) marker is a useful marker for developing cell lines with hundreds or thousands of copies of the gene of interest. Another useful selectable marker is the enzyme glutamine synthase (GS) (Murphy et al., Bioche).
m J.M. 227: 277-279 (1991); Bebbington et al., Bio / T
technology 10: 169-175 (1992)). Using these markers, mammalian cells are grown in selective media and the cells with the highest resistance are selected. These cell lines contain the amplified gene (s) that are incorporated into the chromosome. Chinese hamster ovary (CHO) cells and NSO cells are often used for protein production.

Expression vectors pC1 and pC4 contain the Rous sarcoma virus strong promoter (LT
R) (Cullen et al., Molecular and Cellular Biolog
y, 438-447 (March 1985)) and a fragment of the CMV-enhancer (Boshart et al., Cell 41: 521-530 (1985)). Multiple cloning sites (eg, restriction enzyme cleavage sites BamHI, XbaI, and Asp718)
) Facilitates cloning of the gene of interest. The vector further includes the 3 ′ intron, polyadenylation, and termination signal of the rat preproinsulin gene.

(Example 3 (a): Cloning and expression in COS cells)
The expression plasmid p Neutrokine α HA is used to express the portion of the deposited cDNA encoding the extracellular domain of Neutrokine α protein, the expression vector pcDNA I / Am.
It is made by cloning into p or pcDNAIII (available from Invitrogen, Inc.). To produce a soluble, secreted form of the polypeptide, the extracellular domain is fused to the secretory leader sequence of the human IL-6 gene.

The expression vector pcDNAI / amp is as follows: E. coli effective for growth in E. coli and other prokaryotic cells. E. coli replication origin; (2) Ampicillin resistance gene for selection of plasmid-containing prokaryotic cells; (3) SV4 for propagation in eukaryotic cells.
0 origin of replication; (4) CMV promoter, polylinker, SV40 intron; (5) several codons encoding a hemagglutinin fragment (ie, an “HA” tag that facilitates purification) followed by a termination codon and It contains a sequenced polyadenylation signal so that the cDNA is conveniently under the control of the expression of the CMV promoter and can be operably linked to the SV40 intron and the polyadenylation signal by a restriction site in the polylinker. The HA tag is described in Wilson et al., Cell 37: 767 (1984).
Corresponds to the epitope derived from the influenza hemagglutinin protein described by. The fusion of the HA tag to the target protein allows easy detection and recovery of the recombinant protein using an antibody that recognizes the HA epitope. pcDNAIII further contains a selectable neomycin marker.

A DNA fragment encoding the extracellular domain of Neutrokine alpha polypeptide is cloned into the polylinker region of the vector so that recombinant protein expression is driven by the CMV promoter. The plasmid construction strategy is as follows. The deposited clone Neutrokine α cDNA was obtained from the E. coli strain described above. As with the construction of the vector for expression of Neutrokine alpha in E. coli, amplification is performed using primers containing convenient restriction sites. Suitable primers used in this example include: The 5 ′ primer comprising the underlined BamHI site, the Kozak sequence, the AUG initiation codon, the sequence encoding the secretory leader peptide from the human IL-6 gene, and 18 nucleotides of the 5 ′ coding region of the extracellular domain of Neutrokine alpha protein And having the following sequence: 5 ′ GCGGGATCC GCCACC ATGAACTCCCTTCTC
CACAAGCGCCCTTCGGTCCCAGTTGCCTTCTCCCCTGGGCTG
CTCCTGGTGTTGCCCTGCTGCCTCCTCGCCCCAGTTGGA
GACAAGGGGACTGGCCAGC 3 ′ (SEQ ID NO: 16). Underlined BamH
I restriction site, containing 18 of nucleotides complementary to the 3 'coding sequence immediately before the stop codon 3
'Primer has the following sequence: 5' GTG GGATCC TTACAGCAGTT
TCAATGCACC 3 '(SEQ ID NO: 17).

The PCR amplified DNA fragment and the vector pcDNAI / Amp are digested with BamHI and then ligated. The ligation mixture is treated with E. coli. E. coli strain SURE (Str
atagene Cloning Systems, 11099 North Tor
rey Pines Road, available from La Jolla, CA 92037), and the transformed culture is then plated onto ampicillin media plates that are incubated to allow the growth of ampicillin resistant colonies. Plasmid DNA is isolated from resistant colonies and tested by restriction analysis or other means for the presence of fragments encoding Neutrokine alpha extracellular domain.

For the expression of recombinant Neutrokine α, COS cells can be used, for example, Sambrook.
Et al., Molecular Cloning: a Laboratory Manua
l, Cold Spring Laboratory Press, Cold Sp
DEAE-DEXT described in ring Harbor, New York (1989)
RAN is used to transform with an expression vector as described above. Cells are incubated under conditions for expression of Neutrokine alpha by the vector.

Expression of a Neutrokine α-HA fusion protein can be performed, for example, by Harlow et al., An
tibodies: A Laboratory Manual, 2nd Edition; Cold
Spring Harbor Laboratory Press, Cold Spr
Detection is by radiolabeling and immunoprecipitation using the method described in ing Harbor, New York (1988). To achieve this goal, two days after transfection, cells are labeled by incubating for 8 hours in media containing ³⁵ S-cysteine. Cells and media are collected and cells are washed and detergent-containing RIPA buffer as described in Wilson et al. (Cited above): 150 mM
NaCl, 1% NP-40, 0.1% SDS, 0.5% DOC, 50 mM TRI
Dissolve in S, pH 7.5. Proteins are precipitated from cell lysates and culture media using HA specific monoclonal antibodies. The precipitated protein was then washed with SDS-PA.
Analyze by GE and autoradiography. The expected size of the expression product is observed in the cell lysate, which is not observed in the negative control.

(Example 3 (b): Cloning and expression in CHO cells)
Vector pC4 is used for the expression of Neutrokine alpha protein. Plasmid pC4 is a derivative of plasmid pSV2-dhfr (ATCC accession number 37146). To produce a soluble, secreted form of Neutrokine alpha polypeptide,
The portion of the deposited cDNA encoding the extracellular domain is fused to the secretory leader sequence of the human IL-6 gene. This vector plasmid contains the mouse DHFR gene under the control of the SV40 early promoter. Chinese hamster ovary cells transformed with these plasmids or other cells lacking dihydrofolate activity are selected media supplemented with the chemotherapeutic agent methotrexate (α minus MEM, Life Technologies).
It can be selected by growing the cells in it. Amplification of the DHFR gene in cells resistant to methotrexate (MTX) is well documented (eg, Alt, F
. W. , Kellems, R .; M.M. Bertino, J .; R. And Schi
mke, R.M. T.A. , 1978, J Biol. Chem. 253: 1357-
1370, Hamlin, J. et al. L. And Ma, C.I. , Biochem. et
Biophys. Acta, 1097: 107-143 (1990), Page,
M.M. J. et al. And Sydenham, M .; A. , Biotechnology 9: 6
4-68 (1991)). Cells grown in increasing concentrations of MTX are DH
As a result of the amplification of the FR gene, resistance to the drug is produced by overproducing the target enzyme DHFR. When the second gene is linked to the DHFR gene, it is usually co-amplified,
And it is overexpressed. This approach involves 1,000 of the amplified gene (s)
It is known in the art that it can be used to develop cell lines with more than one copy. Subsequently, if methotrexate is removed, the cell line is obtained as a cell line containing the amplified gene that is incorporated into the host cell chromosome (s).

Plasmid pC4 is the Rous sarcoma virus (Cullen et al., Molecular a
nd Cellular Biology, March 1985: 438-447), a gene for a strong promoter of interest for the long terminal repeat (LTR), and human cytomegalovirus (CMV) (Boshart et al., Cell 41: 521-530 (1985). Expression of fragments of genes isolated from enhancers of early genes). Downstream of the promoter is the following single restriction enzyme cleavage site that allows gene uptake: B
amHI, XbaI and Asp718. Behind these cloning sites, the plasmid contains the 3 ′ intron and polyadenylation site of the rat preproinsulin gene. Other highly efficient promoters are also expressed (eg, human β-actin promoter, S
It can be used for long terminal repeats from V40 early or late promoters, or other retroviruses such as HIV and HTLVI. Clontech Tet-Of
The f and Tet-On gene expression systems and similar systems can be used to express Neutrokine alpha in a regulated manner in mammalian cells (Gossen, M. and Bujar).
d, H. 1992, Proc Natl. Acad. Sci. USA 89:
5547-5551). Other signals (eg, from human growth hormone or globin genes) can be used as well for mRNA polyadenylation. Stable cell lines with the gene of interest inserted into the chromosome can also be selected based on co-transfection with a selectable marker (eg, gpt, G418, or hygromycin). It is useful to use more than one selectable marker at the start (eg G418 and methotrexate).

Plasmid pC4 is digested with the restriction enzyme BamHI and then dephosphorylated using bovine intestinal phosphatase by procedures known in the art. The vector is then isolated from a 1% agarose gel.

The DNA sequence encoding the extracellular domain of Neutrokine alpha protein (including the leader sequence) is amplified using PCR oligonucleotide primers corresponding to the 5 'and 3' sequences of the gene. Contains the underlined BamHI site, followed by the Kozak sequence, the AUG initiation codon, the sequence encoding the secretory leader peptide from the human IL-6 gene, and 18 nucleotides of the 5 'coding region of the extracellular domain of Neutrokine alpha protein The 5 ′ primer comprises the following sequence: 5 ′ GCGGGATCC GCCACC AT
GAACTCTCTCTCCACAAGCGCCCTTCGGTCCAGTTGCCTTC
TCCCTGGGGCTGCTCCTGGTGTGGCCCTGCTGCTCTCCCTG
CCCCAGTTGTGAGACAAGGGGACCTGGCCAGC 3 ′ (SEQ ID NO: 16). The underlined BamHI and the 3 ′ primer containing 18 of nucleotides complementary to the 3 ′ coding sequence immediately before the termination codon include the following sequence: 5 ′ GTG G
GATCC TTACAGCAGTTTCAATGCACC 3 ′ (SEQ ID NO: 17).

The amplified fragment is digested with the endonuclease BamHI and then purified again on a 1% agarose gel. The isolated fragment and dephosphorylated vector are then
4 Ligate with DNA ligase. Then E. E. coli HB101 cells or XL-1
Blue cells are transformed and plasmid pC4, for example using restriction enzyme analysis
Bacteria containing fragments inserted into are identified.

Chinese hamster ovary cells lacking an active DHFR gene are used for transfection. 5 μg of expression plasmid pC4 was added to lipofectin (Felg
ner et al., supra) is co-transfected with 0.5 μg of plasmid pSV-neo. Plasmid pSV2-neo contains a dominant selectable marker (neo gene from Tn5 encoding an enzyme that confers resistance to a group of antibiotics including G418). Cells are seeded in alpha minus MEM supplemented with 1 mg / ml G418. Two days later, the cells were trypsinized and 10, 25, or 50 ng / ml methotrexate and 1 mg
Seed on hybridoma cloning plates (Greiner, Germany) in α minus MEM supplemented with / ml G418. After about 10-14 days, a single clone was trypsinized and then different concentrations of methotrexate (50 nM, 100 nM,
200nM, 400nM, 800nM) is used to seed 6 well petri dishes or 10ml flasks. The clones growing at the highest concentration of methotrexate are then renewed with new 6 containing higher concentrations of methotrexate (1 μM, 2 μM, 5 μM, 10 μM, 20 μM).
Transfer to well plate. The same procedure is repeated until clones are obtained that grow at a concentration of 100-200 μM. Expression of the desired gene product can be determined, for example, by SDS-PAGE.
And analyzed by Western blot analysis or by reverse phase HPLC analysis.

(Example 4: Tissue distribution of Neutrokine α mRNA expression)
Northern blot analysis was performed to test the expression of the Neutrokine alpha gene in human tissues, inter alia using the method described by Sambrook et al. (Cited above). A cDNA probe (SEQ ID NO: 1) containing the complete nucleotide sequence of Neutrokine alpha protein was prepared using a rediprime ^™ DNA labeling system (Amersham Life).
Science) and labeled with ³² P according to the manufacturer's instructions. After the sign
The probe was attached to a CHROMA SPIN-100 ^TM column (Clontech Labo
ratores, Inc. ), The manufacturer's protocol number PT1200-1
Purified according to The purified labeled probe is then used to
Various human tissues were tested for mRNA.

Multi-tissue northern (MTN) including various human tissues (H) or human immune system tissues (IM)
Blots were obtained from Clontech and using manufacturer's protocol number PT119 using ExpressHyb ^™ hybridization solution (Clontech).
Tested with labeled probe according to 0-1. Following hybridization and washing, blots were attached and exposed to film overnight at −70 ° C., and the film was developed according to standard procedures.

It will be clear that the invention may be practiced otherwise than as particularly described in the foregoing description and examples. Many modifications and variations of the present invention are possible in light of the above teachings and, therefore, are within the scope of the appended claims.

The disclosures of all publications (including patents, patent applications, journal literature, laboratory manuals, books, or other documents) cited herein are hereby incorporated by reference.

  (Sequence Listing)

FIG. 1 shows the nucleotide sequence (SEQ ID NO: 1) and deduced amino acid sequence (SEQ ID NO: 2) of Neutrokine alpha protein. Amino acids 1-46 represent the intracellular domain, amino acids 47-72 represent the transmembrane domain (underlined sequence), and amino acids 73-285 represent the extracellular domain (remaining sequence). FIG. 2 shows Neutrokine α protein and TNF-α (SEQ ID NO: 3), TNF-β (Lymphotoxin) (SEQ ID NO: 4) as determined by the “Megalign” routine (which is part of a computer program called “DNAStar”). ), And the region of identity between the amino acid sequences of the FAS ligand (SEQ ID NO: 5). FIG. 3 shows the analysis of Neutrokine alpha amino acid sequence. α, β, turn and coil regions; hydrophilic and hydrophobic; amphiphilic regions; flexible regions; antigen index and surface probability. The “Antigen Index—Jameson-Wolf” graph shows the location of the highly antigenic region of the Neutrokine alpha protein, ie the region where the epitope-bearing peptide of the invention can be obtained. FIG. 4A shows the related human cDNA clones of the present invention of the Neutrokine alpha nucleotide sequence determined from the human cDNA deposited at the ATCC deposit on October 22, 1996 (these are HSOAD55R (SEQ ID NO: 7), HSLAH84R ( Alignment with SEQ ID NO: 8) and HLTBM08R (designated SEQ ID NO: 9). FIG. 4B shows the related human cDNA clones of the present invention of the Neutrokine alpha nucleotide sequence determined from the human cDNA deposited at the October 22, 1996 ATCC deposit (these are HSOAD55R (SEQ ID NO: 7), HSLAH84R ( Alignment with SEQ ID NO: 8) and HLTBM08R (designated SEQ ID NO: 9). FIG. 4C shows the related human cDNA clones of the present invention of the Neutrokine alpha nucleotide sequence determined from the human cDNA deposited at the ATCC deposit on October 22, 1996 (these are HSOAD55R (SEQ ID NO: 7), HSLAH84R ( Alignment with SEQ ID NO: 8) and HLTBM08R (designated SEQ ID NO: 9).

Claims (1)

An isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence that is at least 95% identical to a sequence selected from the group consisting of:
(A) A nucleotide sequence encoding a Neutrokine alpha polypeptide having the complete amino acid sequence in FIGS.

Images