JP2007222106A - Expression cassette used for producing recombinant protein in silkworm - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a means for efficiently producing a recombinant protein in a mass and in a shape maintaining the fhysiological activities in a silkworm. <P>SOLUTION: The expression cassette having a fused gene of a gene encoding a foreign protein and a fibroin H chain gene, linked to the downstream of a promotor for specifically expressing the sericterium of the silkworm has a sequence for recognizing a proteolytic enzyme between the gene encoding the foreign protein and the fibroin H chain gene. The genetically recombinant silkworm is obtained by incorporating the expression cassette into a chromosome. The method for producing the protein comprises using the genetically recombinant silkworm. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

  The present invention relates to an expression cassette used for production of a recombinant protein using a silkworm as a host, a genetically modified silkworm incorporating the expression cassette into a chromosome, and a method for producing a protein using the genetically modified silkworm.

  In recent years, useful proteins have been vigorously produced by gene recombination techniques, and the obtained recombinant proteins are used in a wide range of fields such as pharmaceuticals, diagnostics, foods, and chemical products. Conventionally, in many cases, a recombinant protein is a protein synthesized after introducing a gene encoding a foreign protein (foreign gene) into a bacterial, yeast, or animal cell and growing the cell in a medium. Is produced by recovering. However, in bacteria or yeast, there are problems with post-translational modification, and it may not be possible to synthesize recombinant proteins in a fully functional manner. In addition, in animal cells, it is often possible to synthesize recombinant proteins in a functional manner, but in general, it is difficult to grow cells and the production amount is low, which is not economical.

  On the other hand, insects or insect cells are also used as hosts for recombinant protein production. In systems using insects or insect cells as a host, a method of infecting insects or insect cells with a baculovirus incorporating a foreign gene is used, and recombinant proteins can be mass-produced at a relatively low cost. It is known that post-translational modifications can be obtained. Until now, various physiologically active proteins useful as pharmaceuticals such as cytokines have been produced in insect or insect cell host systems. For example, production of feline interferon-ω and canine interferon-γ in silkworms (Patent Documents) 1, Patent Document 2), production of human collagen in insect cells (Patent Document 3) and the like have been reported.

  However, in the production of recombinant proteins using conventional insects or insect cells, viruses are used for introduction of foreign genes, so that inactivation and containment are necessary, and virus inoculation is complicated. There's a problem. In addition, the silkworm body fluid contains a large amount of contaminating proteins, and it is difficult to purify the recombinant protein produced there with high purity.

  On the other hand, a technique for producing a recombinant protein that introduces a foreign gene into the silkworm chromosome has been studied. For example, using the DNA of Autographa californica nucleopolyhedrovirus (AcNPV), a kind of nuclear polynuclear disease virus, a fusion gene obtained by adding a jellyfish green fluorescent protein gene to the silkworm fibroin L chain gene is introduced into the silkworm chromosome by homologous recombination. In addition, a technique for expression has been reported (Non-patent Document 1), and a silkworm into which a human collagen gene has been introduced using the technique has been produced, and human collagen has been produced using the silkworm (Patent Document 4). . Recently, a method for stably introducing a foreign gene into a silkworm chromosome using piggyBac, a transposon derived from a lepidopteran insect, and expressing a protein encoded by the foreign gene was studied using a jellyfish green fluorescent protein as a model, It was also confirmed that the gene was stably transmitted to offspring by crossing (Non-patent Document 2). However, in the above method using AcNPV, since the recombinant protein is fused with the fibroin light chain polypeptide, there is a problem that only the recombinant protein cannot be recovered and its physiological activity is reduced. In addition, in the method using transposon piggyBac, the amount of recombinant protein produced is low and it is produced throughout the silkworm. Therefore, in order to recover the expressed recombinant protein in a highly purified form, advanced purification technology is required. There was an economic problem.

  Until now, various attempts to improve the expression level have been studied in the production of recombinant proteins in silkworms. For example, addition of a silkworm gland specific promoter and transposon-derived DNA sequence to a foreign gene (Patent Document 5), addition of a fibroin H chain gene-derived polynucleotide that promotes transcriptional activity to a foreign gene (Patent Document 5) 6) Construction of an expression cassette containing a fusion gene of a foreign gene and a fibroin H chain gene has been reported (Patent Document 7). However, there is a problem that the expression level of the recombinant protein is not sufficient in any expression system, or that the protein cannot be recovered while maintaining the physiological activity of the recombinant protein.

Japanese Patent Laid-Open No. 3-139276 Japanese Patent Laid-Open No. 9-234085 JP-A-8-23979 JP 2001-161214 A JP2003-325188 JP 2004-344123 A Japanese Patent Laid-Open No. 2004-254681 Genes Dev., 13,511-516,1999 Nature Biotechnology 18,81-84,2000

  Accordingly, an object of the present invention is to provide means for efficiently producing a large amount of a recombinant protein in a silkworm while retaining its physiological activity.

  In order to solve the above problems, the present inventors have introduced a gene in which a proteolytic enzyme recognition sequence is inserted into a fusion gene of a gene encoding a foreign protein and a fibron heavy chain gene into a promoter that causes specific expression in the silkworm silk gland. An expression cassette linked to the downstream of the protein was constructed, and the expression cassette was introduced into a silkworm chromosome using a DNA sequence derived from a transposon to produce a transgenic silkworm. It was found that a large amount of fusion protein having a proteolytic enzyme recognition site was produced. Then, when the silk gland or silk thread was solubilized and subjected to proteolytic enzyme treatment, the protein that maintained the activity was successfully recovered. The present invention has been completed based on such findings.

That is, the present invention includes the following inventions.
(1) An expression cassette in which a fusion gene of a gene encoding a foreign protein and a fibron heavy chain gene is linked downstream of a promoter specifically expressed in silkworm silk gland, the gene encoding the foreign protein and fibroin H The said expression cassette characterized by having a proteolytic enzyme recognition sequence between the chain genes.
(2) The expression cassette according to (1), wherein the gene encoding the foreign protein is fused between the 5 ′ end region of the fibroin H chain gene and the 3 ′ end region of the fibroin H chain gene.
(3) The expression cassette according to (2), wherein the 5 ′ end region of the fibroin heavy chain gene comprises the first exon region, the first intron region, and the second exon region of the fibroin heavy chain gene. .
(4) The expression cassette according to (2), wherein the 3 ′ end region of the fibron H chain gene includes a region encoding a fibroin H chain C terminal portion and a poly A region of the fibron H chain gene.
(5) The expression cassette according to (1), wherein the promoter specifically expressed in silkworm silk gland is a fibroin heavy chain gene promoter.
(6) The expression cassette according to (1), wherein the foreign protein is a cytokine.
(7) The expression cassette according to (6), wherein the cytokine is interferon.
(8) The expression cassette according to (7), wherein the interferon is cat interferon-ω.
(9) A vector for introducing a foreign gene comprising the expression cassette according to any one of (1) to (8).
(10) The vector for introducing a foreign gene according to (9), comprising a DNA sequence derived from transposon.
(11) A genetically modified silkworm in which the expression cassette according to (1) to (8) is incorporated into a chromosome and produces a foreign protein in a silk gland or silk thread.
(12) Producing a recombinant silkworm in which the expression cassette according to (1) to (8) is incorporated into a chromosome, solubilizing the silk gland or silk thread of the obtained recombinant silkworm, and then treating with a proteolytic enzyme And collecting a foreign protein.

  According to the present invention, a recombinant protein produced using a silkworm as a host can be efficiently recovered from a silk gland or silk thread that does not contain a large amount of contaminants while maintaining its activity, and a complicated purification operation Is not required. Further, since no virus such as baculovirus is used, inactivation of the virus is unnecessary, and a recombinant protein can be produced simply and safely.

1. Expression cassette The expression cassette of the present invention refers to a set of DNAs necessary for allowing expression of a foreign protein when introduced into a silkworm chromosome. The expression cassette of the present invention comprises a promoter that is specifically expressed in the silkworm silk gland and a fusion gene of a gene encoding a foreign protein and a fibron H chain gene downstream thereof, and a gene encoding the foreign protein and fibron H It has a proteolytic enzyme recognition sequence between the chain genes.

  The “foreign protein” is not particularly limited as long as it is a protein that is expressed in a silkworm and subsequently retains physiological activity by proteolytic enzyme treatment, and examples thereof include cytokines, hormones, antigens, antibodies, and the like. Of these, cytokines known as physiologically active proteins having various functions such as immunoregulatory action, antiviral action, blood cell proliferation action, and intercellular signal transduction action are preferred. Cytokines include interferon (interferon-α, β, γ, ω, τ, etc.), colony stimulating factor [granulocyte colony stimulating factor (G-CSF), monocyte colony stimulating factor (M-CSF), granulocyte-macrophage Colony stimulating factor (GM-CSF), etc.], erythropoietin (EPO), thrombopoietin (TPO), interleukin (interleukin-1, 2, 6, 10, 12, etc.), etc. Cat interferon-ω (Biosci. Biotech. Biochem., 56, 211-214, 1992, GenBank database accession number E04599), feline granulocyte colony-stimulating factor (Gene , 274, 263-269, 2001), human interferon-β and the like.

  Examples of the “promoter specifically expressed in silkworm silk gland” include a fibroin H chain gene promoter (base numbers 255 to 574 in GenBank accession number V00094, base numbers 62118 to 62437 in GenBank accession number AF226688), fibroin L Examples include a promoter of a chain gene (Gene, 100: 151-158: GenBank accession number M76430), a promoter of a sericin gene (base numbers 599 to 1656 of GenBank accession number AB007831), and the promoter of a fibroin H chain gene is preferable. .

  In the expression cassette of the present invention, the gene encoding the foreign protein is fused between the 5 'end region of the fibron H chain gene and the 3' end region of the fibron H chain gene. Here, the 5 ′ end region of the fibroin H chain gene is not particularly limited as long as it has an action of promoting the transcription activity of the gene encoding the foreign protein. For example, the first exon region, the first 1 The intron region and the second exon region (base numbers 62118 to 63513 of GenBank accession number AF226688) are preferred. Further, the 3 ′ end region of the fibron H chain gene is not particularly limited as long as it has an effect of secreting the produced foreign protein into the silkworm silk gland. For example, the region encoding fibroin H chain C terminal portion and fibron The polyA region of the H chain gene (base numbers 79099 to 79995 of GenBank accession number AF226688) is preferred.

  In the expression cassette of the present invention, the expression control region, the signal sequence, and the poly A sequence are included in the specific region of the fibroin heavy chain gene described above, but are not limited thereto, and those depending on the type of foreign protein to be expressed. You may select and use suitably.

  There is no particular limitation on the method for obtaining the gene contained in the expression cassette. Based on the known gene information, a method to amplify and acquire the necessary gene region using PCR (polymerase chain reaction) method, a method to screen using homology as an index from a genomic library or cDNA library based on the known gene information, etc. Is mentioned.

For example, the feline interferon-ω gene can be obtained by excision from a plasmid extracted from E. coli (pFeIFN1) (Microtechnical Research Institute No. 1633). Alternatively, a recombinant plasmid prepared by ligating the excised feline interferon-ω gene to a silkworm cloning vector (T. Horiuchi et al., Agric. Biol. Chem., 51, 1573-1580, 1987) and silkworm polynuclear disease Viral DNA can also be obtained from rBNV100 prepared by cotransfecting silkworm-established cells.

  Each gene included in the expression cassette of the present invention includes a mutant gene as long as it has a function equivalent thereto. The mutated gene may be any of a mutated gene obtained by artificial mutation treatment using a genetic polymorphism or a mutation agent. A genetic polymorphism is one in which the base sequence of a gene is partially changed due to a natural mutation on the gene.

  A “proteolytic enzyme recognition sequence” is inserted between a gene encoding a foreign protein and a fibroin heavy chain gene, as long as the activity of the foreign protein is not inhibited by degradation (cleavage) of the recognition sequence by a proteolytic enzyme. There is no particular limitation.

For example, as a proteolytic enzyme recognition sequence, the recognition sequence L (leucine) E (glutamic acid) V (valine) L (leucine) F (phenylalanine) Q (glutamine) G (glycine) of PreScission Protease ^™ (Amersham Biosciences) ) P (proline), thrombin recognition sequence L (leucine) V (valine) P (proline) R (arginine) G (glycine) S (serine), Factor Xa recognition sequence I (isoleucine) E (glutamic acid) G ( Glycine) R (arginine), enterokinase recognition sequence D (aspartic acid) D (aspartic acid) D (aspartic acid) D (aspartic acid) K (lysine) S (serine), and the like.

2. Foreign gene introduction vector The “foreign gene introduction vector” of the present invention is not particularly limited as long as it contains the above-described expression cassette and can introduce the expression cassette into the silkworm chromosome. Viral vector, DNA derived from transposon A vector containing the sequence or a plasmid vector that does not integrate into the chromosome can be used.

  Examples of the transposon include piggyBac (Nature Biotechnology 18, 81-84, 2000), a transposon derived from lepidopterous insects, and mariner (Third International workshop on transgenesis of invertebrate organisms, p37-38, 1999) derived from Drosophila. , Minos (Insect Mol. Biol. 9, 277-281, 2000) and the like, but piggyBac is preferable. The transposon-derived DNA sequence refers to, for example, a pair of inverted terminal repeats containing a TTAA sequence, which is a piggyBac-derived DNA sequence, and is inserted into both sides of the expression cassette in the vector.

  In addition, a marker gene such as a fluorescent protein gene may be inserted into the exogenous gene introduction vector, if necessary, in order to facilitate screening of transgenic silkworms. For example, a green fluorescent protein (GFP) gene bound downstream of an appropriate promoter may be introduced at an appropriate site between the pair of transposon-derived DNA sequences. The promoter used here is not particularly limited as long as it is an effective promoter in silkworm cells. For example, a Drosophila heat shock protein gene promoter, a silkworm actin promoter (Nature Biotechnology 18, 81-84, 2000) Examples include the 3xP3 promoter known to be expressed in the Drosophila optic nerve, and the promoter of the silkworm actin gene (Nature Biotechnology 18,81-84,2000) or the 3xP3 promoter is preferable.

3. Recombinant silkworms The method for introducing the above expression cassette into the silkworm chromosome is not particularly limited as long as it is a gene introduction method in which the gene is stably integrated into the chromosome and expressed, and the gene is stably transmitted to offspring by mating. For example, a method of microinjecting a vector containing the above expression cassette into an egg of Bombyx mori or a method using a gene gun can be used.

  When the vector containing the above expression cassette is a vector containing a transposon-derived DNA sequence, a helper plasmid (Nature Biotechnology 18, 81-84, 2000) containing a transposase gene is simultaneously microinjected into a silkworm egg. Examples of such vectors include vectors containing piggyBac derived from Trichoplusia ni cell line TN-368, Autographa californica NPV (AcNPV), Galleria mellonea NPV (GmMNPV), preferably a part of PiggyBac derived from Trichoplusia ni cell line TN-368. The plasmid pHA3PIG having pPIGA3GFP (Nature biotechnology 18, 81-84, 2000) and the like can be used.

  Silkworms introduced with the gene into the chromosome as described above are blanched under normal conditions, and hatched larvae are reared up to 5 years old to obtain adults (G0 generation). The resulting G0 adult male and female are mated to obtain eggs, and these eggs are bluened and hatched. Next, the target transgenic silkworm is selected from the obtained larvae, preferably 1-2 years old silkworm (G1 generation). Selection of transgenic silkworms can be performed, for example, by extracting DNA from a part of the above-mentioned G1 generation silkworm larvae tissue and amplifying it by PCR using primers designed based on the foreign gene. Alternatively, when a marker gene such as GFP is inserted into a foreign gene introduction vector, it can be carried out more easily by selecting an individual emitting green fluorescence from the G1 generation silkworm larvae.

  The foreign gene is hatched from the microinjected silkworm egg and introduced into the germline of the grown transgenic silkworm. The progeny of the transgenic silkworm thus obtained can stably hold a foreign gene on its chromosome. The transgenic silkworm obtained in the present invention can be maintained for passage in the same manner as a normal silkworm. That is, eggs are blanched under normal conditions, hatched ant moths are swept into artificial feed, etc., and reared under the same conditions as normal silkworms, it is possible to rear up to 5th instar silkworms.

  The genetically modified silkworm obtained by the present invention can be hatched to make a silkworm in the same manner as a normal silkworm. Males and females are discriminated at the stage of pupae, and after they have been bred, males and females are mated and eggs collected the next day. Eggs can be stored in the same way as normal silkworm eggs. The transgenic silkworm of the present invention can be passaged by repeating such breeding and can be increased in large quantities.

  The genetically modified silkworm of the present invention is a silkworm in which a gene encoding a foreign protein (foreign gene) has been introduced into the chromosome, and the silkworm chromosomal DNA is treated with a restriction enzyme according to a conventional method and then labeled according to a conventional method. This is a silkworm that gives a positive signal when Southern blotting is performed using the introduced foreign gene as a probe. The gene locus on the chromosome into which the foreign gene is introduced is not particularly limited as long as it does not inhibit the development, differentiation, and growth of silkworm.

4). Protein Production Method The genetically modified silkworm of the present invention obtained above produces a foreign protein in its silk gland or silk thread. In order to recover the foreign protein produced in the silk gland or silkworm of this transgenic silkworm while retaining its activity, the silk gland or silkworm is first solubilized and then specific to the above-mentioned proteolytic enzyme recognition sequence. Treat with typical proteolytic enzymes.

  There is no particular limitation on the solvent used for extraction of the foreign protein from the silk gland or silk thread, but an aqueous solvent is preferable in order to recover it while maintaining its activity. The aqueous solvent used for extraction may contain an appropriate solute to facilitate protein extraction. Examples of such solutes include inorganic acids such as phosphoric acid, organic acids such as acetic acid, citric acid and malic acid, salts such as sodium chloride, urea, guanidine hydrochloride and calcium chloride, ethanol, methanol, acetonitrile and acetone. And polar organic solvents. The pH of the solvent is not particularly limited as long as it does not deactivate the target foreign protein.

  The method for isolating and purifying the extracted protein is not particularly limited, and a normal protein purification method can be used. For example, chromatography using a silica gel carrier, an ion exchange carrier, a gel filtration carrier, a chelating carrier, a dye carrier, etc. while using the function inherent in the target foreign protein as an index, ultrafiltration, gel filtration, It can be purified and isolated by a combination of dialysis, salting-out, desalting, and concentration.

  For example, in the transgenic silkworm introduced with the expression cassette of the present invention, when the foreign protein is cat interferon-ω, the silk gland of the transgenic silkworm is homogenized with 20 mM phosphate buffer (pH 7.0). The soluble fraction obtained in this manner can be recovered by treating with a proteolytic enzyme. Furthermore, the purity of cat interferon-ω can be increased by adsorbing the obtained soluble fraction to, for example, a blue sepharose carrier, and washing and eluting with a buffer containing salts.

  The recombinant protein produced as described above can be used for pharmaceutical use and various measurement / diagnostic uses in the same manner as proteins produced by other conventional methods. In this case, you may use as a mixture which added various additives. The silkworm tissue and silk thread expressing the recombinant protein can be used as a medical or clothing fiber as it is or after being processed.

  Hereinafter, the present invention will be described more specifically with reference to examples. However, the present invention is not limited to these.

(Reference Example) Antiviral Activity Measurement Method The physiological activity of interferon (cat interferon-ω) produced in the transgenic silkworm of the present invention was evaluated by measuring antiviral activity. Antiviral activity is determined by the following CPE method using Vesicular Stomatitis Virus (VSV) as a virus and feline Fc9 cells (JKYamamoto et al .; Vet. Immunol. And Immunopathol., 11 , 1-19, 1986) as sensitive cells. The measurement was performed as described above.

  To the sensitive cells cultured at 37 ° C until confluent on a 96-well microplate, add a diluted solution of the sample (recombinant feline interferon-ω produced in the example) to the top row, and double it toward the bottom. Serial dilutions were made. After culturing at 37 ° C. for 20 to 24 hours, VSV was added and further cultured at 37 ° C. for 16 to 20 hours. Sensitive cells that survived and adhered to the microplate were stained with a crystal violet staining solution containing 20% formalin, and the amount of crystal violet was determined by measuring the absorbance at 570 nm. Similarly, for the standard, the same operation as described above was performed, the absorbance at 570 nm was measured, and the antiviral activity was determined by comparing with the absorbance of the above sample. As a standard, Intercat (manufactured by Toray Industries, Inc.) adjusted to 400 U / ml with a cell culture medium was used.

(Example 1) Gene preparation Fibroin H chain gene promoter, first exon region, first intron region, second exon region (base numbers 62118 to 63513 of GenBank accession number AF226688: hereinafter "HP region") Using silkworm genomic DNA as a template, the following primer 1 [adds HindIII site and AscI site (underlined part) at positions 62118 to 62157 of GenBank accession number AF226688] and primer 2 [BamHI site at positions 63474 to 63513 of GenBank accession number AF226688 ( The underlined portion was added by PCR.
Primer 1 (SEQ ID NO: 1): taa aagcttGGCGCGCC gggagaaagcatgaagtaagttctttaaatattacaaaaa
Primer 2 (SEQ ID NO: 2):
ata ggatcc gacatcactcccaaaatagtcctcatcaaaatcattgatg

Fibroin H chain C-terminal partial coding region / Poly A region of fibroin H chain gene (GenBank accession number AF226688, nucleotide numbers 79999 to 79993: “CA region”) is silkworm genomic DNA as a template and the following primer 3 [GenBank Acquired by PCR using BamHI site (underlined) added to 79999-79149 of registration number AF226688] and primer 4 [KpnI site and AscI site (underlined) added to 79955-79995 of GenBank registration number AF226688] did.
Primer 3 (SEQ ID NO: 3):
taa ggatcc cgcagttacgactattctcgtcgtaacgtccgcaaaaactgtggaattcct
Primer 4 (SEQ ID NO: 4):
atta ggtaccGGCGCGCC acgacgtagacgtatagccatcggggatcaaagcatacagg

  The region where the recognition sequence of PreScission Protease (hereinafter “pIFNp region”) is added to both ends of the feline interferon-ω gene (base numbers 9 to 590 of GenBank accession number S62636: hereinafter “IFN region”) is the cat interferon-ω Using the baculovirus rBNV100 encoding the gene as a template, the following primer 5 [BamHI site (underlined) and PreScission Protease recognition sequence (square box) added to GenBank accession number S62636 at positions 9 to 54] and primer 6 [GenBank registration] It was obtained by PCR using a BamHI site (underlined) and a PreScission Protease recognition sequence (square box) at positions 545 to 590 of number S62636. The PreScission Protease recognition sequence (ctggaagttctgttccaggggcccc) added to Primer 5 and Primer 6 is an amino acid sequence (Leu-Gln-Val-Leu-Phe-Gln-Gly) that serves as a recognition site for PreScission Protease manufactured by Amersham Biosciences. -Pro).

  The baculovirus rBNV100 described above is E. coli. The gene for FeIFN was excised from the plasmid extracted from Escherichia coli (pFeIFN) (Maiko Kenjo No. 1633) and cloned into a silkworm cloning vector (T. Horiuchi et al., Agric. Biol. Chem., 51, 1573-1580, 1987). ) And a silkworm polynuclear disease virus DNA were prepared by cotransfecting silkworm established cells.

PCR was performed using KODplus (Toyobo Co., Ltd.) according to the attached protocol.
The PCR reaction solution composition is shown in Table 1 below, and the PCR reaction conditions are shown in Table 2 below. PCR reaction was performed using a DNA thermal cycler manufactured by Biorad.

[Table 1]
(PCR reaction solution composition)
Template: 100ng for silkworm genomic DNA, 10ng for rBNV100 viral genome
Each primer: 50pmol
Attached 10 × PCR buffer: 10 μl
1 mM MgCl ₂
0.2mM dNTPs
2 units KODplus DNA polymerase
100 μl total volume

[Table 2]
(PCR reaction conditions)
DNA denaturation conditions: 94 ° C, 15 seconds Primer annealing conditions: 55 ° C, 30 seconds
Elongation conditions: 68 ° C, 30 seconds to 300 seconds
30 cycles with the above reaction as one cycle

  Each PCR reaction product was electrophoresed on a 1% agarose gel, and DNA fragments of 1.4 kbp in the HP region, 0.9 kbp in the CA region, and 0.9 kbp in the IFN region were extracted and purified according to a conventional method. These DNA fragments were phosphorylated with polynucleotide kinase (manufactured by Takara Bio Inc.), then cleaved with HincII, and dephosphorylated using the pUC19 vector using Takara Bio Inc. DNA Ligation Kit Ver.2. The reaction was performed overnight at 16 ° C. and ligated. Escherichia coli was transformed according to a conventional method using each of the obtained pUC vectors. The fact that the PCR fragment was inserted into the transformant was confirmed by PCR of the obtained colony under the same conditions as described above. Moreover, by sequencing the plasmid, it was confirmed that the PCR fragment contained in it was the respective gene.

(Example 2) Preparation of vector for introduction of cat interferon-ω gene (1) Construction of expression cassette Plasmid (pUC-pIFNp) prepared in Example 1 having a cat interferon-ω gene with a PreScission Protease cleavage site added at both ends. 1.4) excised from the plasmid (pUC-HP) having the fibroin heavy chain gene promoter, first exon region, first intron region, and second exon region at the cleavage site with SalI and HindIII. A kbp fragment (HP region) was inserted. Further, this was cleaved with BamHI, and a 0.9 kbp fragment (CA region) excised with BamHI from a plasmid (pUC-CA) having a fibroin H chain C-terminal partial coding region and a fibroin H chain gene polyA region at the cleavage site. Inserted. Regarding the direction of the inserted gene, it was confirmed by sequence analysis whether the CA region was inserted in the correct direction. The plasmid (pUC-HP-pIFNp-CA) containing the HP, pIFNp, and CA genes obtained by these operations was cleaved with AscI, and an about 3.2 kbp fragment (HP-pIFNp-CA) was excised. Takara Bio Inc. Both ends were blunted with T4 DNA Polymerase. The obtained expression cassette: HP-pIFNp-CA is a fibroin heavy chain gene promoter, first exon region, first intron region, second exon region / PreScission Protease recognition sequence / feline interferon-ω / PreScission Protease recognition Sequence / Fibroin H chain C-terminal region / Fibroin H chain polyA region

(2) Construction of vector for gene introduction On the other hand, the plasmid for gene introduction contains pigA3GFP (Nature Biotechnology 18, 81-84, 2000) containing a terminal inverted repeat of a transposon derived from Trichoplusia ni. used. pigA3GFP removes the transposase-encoding region from plasmid p3E1.2 disclosed in US Pat. No. 218185, and in that portion, an A3 promoter (base numbers 1764 to 2595 of GenBank accession number U49854) and pEGFP-N1 A vector (manufactured by Clontech) with a green fluorescent protein (GFP) and SV40-derived poly A addition sequence (base numbers 659 to 2578 of GenBank accession number U55762) inserted. It can be distributed from the laboratory.

  The blunt-ended approximately 3.2 kbp fragment (HP-pIFNp-CA) was ligated to the pigA3GFP previously blunted in the XhoI site upstream of the A3 promoter and dephosphorylated, and pBAC-HP-pIFNp-CA Got. The obtained plasmid was purified using QIAGEN Plasmid Maxi Kit according to the attached protocol.

  FIG. 1 shows the structure of the feline interferon-ω expression cassette (HP-pIFNp-CA) obtained above and the construction procedure of the feline interferon-ω gene introduction vector (pBAC-HP-pIFNp-CA).

(Example 3) Production of transgenic silkworm 0.5 mM phosphoric acid containing 200 μg / ml each of the vector (pBAC-HP-pIFNp-CA) constructed in Example 2 and DNA (pHA3PIG) producing piggyback transposase protein A buffer (pH 7.0) / 5 mM KCl solution was prepared, and 3 to 20 nl was microinjected into 500 silkworm eggs within 4 hours after laying eggs. The above pHA3PIG (Nature biotechnology 18,81-84,2000 available from the National Institute of Agrobiological Resources) lacks one inverted repeat of piggyback transposon, the 5 'flanking region, and the transposase gene leader sequence. Instead, the 5 'flanking region and leader sequence of the silkworm actin gene are incorporated. pHA3PIG has the function of making a piggyback transposase protein by the action of the actin promoter, but its own DNA does not transfer because one inverted repeat of the piggyback transposon is missing.

  After microinjection, larvae hatched from silkworm eggs are reared, and the next generation (G1) obtained by multiplying the resulting adults (G0) within the group is used to introduce the target gene into the chromosome using GFP fluorescence as an indicator. The genetically modified silkworms were screened.

(Example 4) Expression analysis of feline interferon-ω in silk gland tissue by Western analysis The posterior silk gland tissue of the transgenic silkworm obtained in Example 3 was recovered, and feline interferon-ω in silk gland tissue was Expression was examined by Western analysis as follows.

  After homogenizing the posterior silk gland of silkworms whose introduction of the target gene was confirmed by GFP in 100 mM sodium phosphate buffer (pH 7.0), the supernatant was collected by centrifugation, and PreScission Protease ( Amersham Biosciences Inc.) was added, and the mixture was reacted at 4 ° C. overnight. About the obtained sample, the cat interferon-omega was detected as follows using ECL PlusTM Western blotting Kit (made by Amersham Pharmacia) according to the attached protocol.

  First, the blotted membrane was blocked in a blocking solution (5% skim milk / 0.1% Tween20 / PBS) at 4 ° C. overnight. The membrane was washed twice with TPBS (0.1% Tween20 / PBS) and treated with an anti-cat interferon antibody diluted 1000 times with TPBS for 1 hour at room temperature. The membrane was washed twice with TPBS, and further washed 3 times with TPBS for 5 minutes. Thereafter, the resultant was diluted 10,000 times with TPBS, and then treated with an HRP-labeled anti-rabbit IgG antibody at room temperature for 1 hour. The membrane was washed twice with TPBS, and further washed 3 times with TPBS for 5 minutes, and then a detection reagent (solution A + solution B) of ECL Plus ™ Western blotting Detection System (Amersham Pharmacia) was added. Luminescence was exposed and developed on HyperfilmTM ECLTM. For comparison of signals, a molecular imager FXPro manufactured by BIORAD was used. The results are shown in FIG. 2 (lane 1: control (Intercat (manufactured by Toray Industries, Inc.)), lane 2: feline interferon-ω of the transgenic silkworm silk gland, lane 3: protease recognition site of the recombinant silkworm silk gland. Cat interferon-ω, lane 4: 3 catase-treated cat interferon-ω).

  As shown in FIG. 2, in lane 4, the band indicating feline interferon-ω (lane 3) having a protease recognition site of the recombinant silkworm silk gland by protease treatment corresponds to the molecular weight of the original feline interferon-ω. It was changed to a band, and it was confirmed that it was recovered as an active form. This was also confirmed from the difference in antiviral activity shown in Example 5 described later. From the above results, it is possible to obtain a protein having the same molecular weight as the original protein by recovering the foreign protein from the recombinant silkworm silk gland introduced with the expression cassette of the present invention and treating with a protease. Moreover, it has been found that when the foreign protein is a protein having enzyme activity or the like, an activity close to that of the original protein can be obtained. The difference in molecular weight between the cat interferon preparation, which is the lane 1 control, and the cat interferon-ω in the transgenic silkworm silk gland was thought to be due to the difference in sugar chain modification.

(Example 5) Antiviral activity of feline interferon-ω produced in transgenic silkworm silk gland tissue Since feline interferon-ω has antiviral activity, the presence of feline interferon-ω is known from its titer. Can do. Of the generation (G2) obtained by crossing the transgenic silkworm (G1) obtained in Example 3 with a wild silkworm, the silkworm silk posterior silk thread in which the introduction of the cat interferon-ω gene was confirmed. The glands were removed and homogenized with 20 mM sodium phosphate buffer (pH 7.0) (protein concentration: 2.69 mg / ml). PreScission Protease (Amersham Biosciences) was added to the silk gland lysate and allowed to react overnight at 4 ° C. For the silk gland lysate after the protease treatment, antiviral activity was measured according to the method of the above Reference Example and compared with that of the silk gland lysate untreated with protease. The results are shown in Table 3 below. The silk gland lysate treated with protease showed higher antiviral activity than the silk gland lysate untreated with protease.

[Table 3]

(Example 6) Expression analysis of feline interferon-ω in silkworm silkworm silk by Western analysis The secretion of feline interferon-ω into silkworm silkworm silkworm obtained in Example 3 was examined by Western analysis as follows. It was.
10 mg each of silkworm silkworm silk whose introduction of the target gene was confirmed by GFP was weighed, 4 ml of 60% LiSCN was added, stirred, and allowed to stand overnight at room temperature to dissolve the silkworm silk. PreScission Protease (manufactured by Amersham Biosciences) was added to a 10-fold diluted solution of this silk thread solution with 8M urea / 2% SDS / 5% 2-mercaptoethanol, and reacted at 4 ° C. overnight. About the obtained sample, the cat interferon-omega was detected like Example 4 using ECL PlusTM Western blotting Kit (made by Amersham Pharmacia) according to the attached protocol. The results are shown in FIG. 3 (lane 1: control (Intercat (manufactured by Toray Industries, Inc.)), lane 2: cat interferon-ω having a protease recognition site of transgenic silkworm silk thread, and lane 3: 2 cat treated with protease. Interferon-ω).

  As shown in FIG. 3, it was confirmed that most of the fusion protein in Lane 3 was cleaved by protease treatment. Here, the slight difference in molecular weight from the standard cat interferon-ω was thought to be due to the difference in glycosylation. From the above, it is possible to obtain a protein having a molecular weight almost the same as that of the original protein by extracting the foreign protein from the silkworm of the transgenic silkworm introduced with the expression cassette of the present invention to which the proteolytic enzyme recognition sequence is added. It was confirmed that it was possible.

Example 7 Antiviral Activity of Feline Interferon-ω Produced in Genetically Modified Silkworm Silk Measure the antiviral activity of the silkworm lysate after protease treatment obtained in Example 6 according to the method of the above reference example. And compared with that of the untreated protease solution. The results are shown in Table 4 below. The silkworm lysate treated with protease showed higher antiviral activity than the silkworm lysate untreated with protease.

[Table 4]

FIG. 1 is a diagram showing the structure of a cat interferon-ω expression cassette and the procedure for constructing a cat interferon-ω gene introduction vector. FIG. 2 is a view obtained by subjecting recombinant feline interferon-ω expressed in the silk gland to protease treatment and Western analysis using a feline interferon antibody (lane 1: control (Intercat (manufactured by Toray))), lane 2: transgenic silkworm Cat interferon-ω of silk gland, lane 3: cat interferon-ω having a protease recognition site of transgenic silkworm silk gland, cat interferon-ω obtained by treating lane 4: 3 with protease. FIG. 3 is a view of recombinant feline interferon-ω expressed in silkworms treated with protease and subjected to Western analysis with a feline interferon antibody (lane 1: control (Intercat (manufactured by Toray Industries))), lane 2: genetically modified silkworm silk thread Cat interferon-ω having the protease recognition site of, and cat interferon-ω obtained by treating lane 3: 2 with protease)

Claims (12)

  An expression cassette in which a fusion gene of a gene encoding a foreign protein and a fibron heavy chain gene is linked downstream of a silkworm silk gland specific expression promoter, wherein the gene encoding the foreign protein and the fibroin heavy chain gene The said expression cassette characterized by having a proteolytic enzyme recognition sequence in between.   The expression cassette according to claim 1, wherein the gene encoding the foreign protein is fused between the 5 'terminal region of the fibroin heavy chain gene and the 3' terminal region of the fibroin heavy chain gene.   The expression cassette according to claim 2, wherein the 5 'terminal region of the fibroin heavy chain gene comprises a first exon region, a first intron region, and a second exon region of the fibroin heavy chain gene.   The expression cassette according to claim 2, wherein the 3 'terminal region of the fibron heavy chain gene includes a region encoding a fibroin heavy chain C terminal portion and a poly A region of the fibron heavy chain gene.   The expression cassette according to claim 1, wherein the promoter specifically expressed in silkworm silk gland is a fibroin H chain gene promoter.   The expression cassette according to claim 1, wherein the foreign protein is a cytokine.   The expression cassette according to claim 6, wherein the cytokine is interferon.   The expression cassette according to claim 7, wherein the interferon is cat interferon-ω.   A vector for introducing a foreign gene comprising the expression cassette according to claim 1.   The vector for introducing a foreign gene according to claim 9, comprising a DNA sequence derived from transposon.   A genetically modified silkworm in which the expression cassette according to claim 1 is incorporated into a chromosome and produces a foreign protein in a silk gland or silk thread.   A recombinant silkworm in which the expression cassette according to claim 1 is incorporated into a chromosome is prepared, and the silk gland or silk thread of the obtained recombinant silkworm is solubilized, followed by proteolytic enzyme treatment, A method for producing a protein, comprising collecting the protein.

Images