JP2007218824A - Base material for bioassay - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a base material for bioassay having greater signal intensity than a conventional base material. <P>SOLUTION: This base material for bioassay for immobilizing a physiologically active substance on the solid phase surface of the base material has characteristics wherein a polymer compound is provided on the solid phase surface of the base material and particles are held thereon. In the base material for bioassay, preferably the particles are coated with the polymer compound, and the particles are held on the base material surface through the polymer compound, and the polymer compound has a physiologically active substance bonding component, a bridging component and a matrix component as each constitution unit. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

  The present invention relates to a bioassay substrate used for parallel detection and analysis of a large number of proteins, nucleic acids and the like in a biological sample. More specifically, the present invention relates to bioassay substrates used for proteomics as well as measurement of gene activity at the intracellular protein level.

Techniques for obtaining sample specimen information using microarrays are becoming indispensable techniques in biology and medicine. For example, DNA microarrays enable the study of the expression pattern of the entire genome even in complex biological systems, resulting in an explosive increase in the amount of gene information.
In the signal detection of the microarray, the S / N ratio is the signal amount (signal) obtained from the labeled sample specimen and the signal amount generated from a site other than the signal substance obtained from the labeled sample specimen ( This is a value divided by (noise), and it is generally said that the detection sensitivity increases when the S / N ratio is high.

The material used as the substrate for microarrays is often made of glass or plastic, but since the surface of these materials is usually chemically inert, surface modification is applied to immobilize physiologically active substances. There is a need. Since it is difficult to introduce various functional groups directly onto an inert surface such as glass or plastic, it is common to first introduce an amino group and then introduce the functional group via the amino group. is there.
Examples of methods for introducing amino groups onto the substrate surface include treatment with aminoalkylsilane, plasma treatment under nitrogen atmosphere, coating with amino group-containing polymer materials, etc., but the simplicity, uniformity and reproducibility of the treatment. From the viewpoint, treatment with aminoalkylsilane is frequently used. Examples of aminoalkylsilanes generally used include aminoalkylsilanes having a primary amino group such as aminopropyltrimethoxysilane, aminopropyltriethoxysilane, and aminopropylmethyldimethoxysilane.
As a method for introducing a functional group via an amino group, for example, it is known to introduce an aldehyde group into a substrate by treating with glutaraldehyde having a bifunctional aldehyde (Patent Documents 1 and 2). Patent Document 3). When a maleimide group is introduced, it can be treated with N- (6-maleimidocaproyloxy) succinimide, which is a crosslinking agent having a maleimide group at one end and an active ester at one end (Patent Document 4). Similarly, when N-hydroxysuccinimide active ester is introduced, Ethyleneglycol-O, O-bis (succinimidylsuccinate) having active ester groups at both ends is used.
However, in the surface treatment as described above on the solid phase substrate, since the base material surface is smooth, the functional group density for immobilizing the physiologically active substance is low, so the signal intensity is low and the cause of the decrease in the S / N ratio. It was. There was also a problem that caused a decrease in the S / N ratio. For this reason, a bioassay substrate having a high signal amount has been demanded.

"DNA Microarray Practice Manual", Hayashizaki Yoshihide, Okazaki Koji edited, Yodosha, 2000, p.57 JP 2002-176991 A JP 2002-181817 A JP 2002-532699 A JP 11-187900 A

    An object of this invention is to provide the base material for bioassays from which a signal intensity becomes high compared with a conventional base material.

The present invention
(1) A bioassay substrate for immobilizing a physiologically active substance on the solid phase surface of the substrate, having a polymer compound on the solid phase surface of the substrate, and holding particles A bioassay substrate characterized by
(2) The bioassay substrate according to (1), wherein the particles are coated with the polymer compound,
(3) The bioassay substrate according to (1) or (2), wherein the particles are held on the surface of the substrate via the polymer compound,
(4) The bioassay substrate according to any one of (1) to (3), wherein the particles and the substrate surface are bonded by a chemical covalent bond,
(5) The bioassay substrate according to (4), wherein the chemical covalent bond is formed through the polymer compound,
(6) The bioassay substrate according to any one of (1) to (5), wherein the polymer compound has a physiologically active substance binding component, a crosslinking component, and a matrix component as constituent units;
(7) The bioassay substrate according to any one of (1) to (6), wherein the particles are composed of an inorganic compound, an organic compound, or an organic-inorganic composite compound,
(8) The bioassay substrate according to any one of (1) to (6), wherein the particles are titanium oxide particles or silica particles,
(9) The bioassay substrate according to any one of (1) to (6), wherein the particles are polystyrene resin particles, polyimide resin particles, or poly (meth) acrylic resin particles,
(10) The bioassay substrate according to any one of (1) to (9), wherein the average particle diameter is 1-1000 nm,
(11) The bioassay substrate according to any one of (1) to (10), wherein the substrate is a slide-shaped substrate, a 96-well plate, a container, or a microfluidic substrate.
(12) A microarray in which a physiologically active substance is immobilized on the bioassay substrate according to any one of (1) to (11),
(13) A method for producing a bioassay substrate according to any one of (1) to (11), wherein the bioassay includes a step of immersing or applying a solution containing the polymer compound, the particles and a solvent to the substrate. A method for producing an assay substrate;
It is.

    According to the bioassay substrate of the present invention, the signal intensity of the detection target substance is improved, and a microarray with high detection accuracy can be obtained.

    The bioassay substrate of the present invention is characterized by having a polymer compound on the solid phase surface of the substrate and retaining particles. By holding the particles on the surface of the substrate, the surface area of the substrate can be increased, and accordingly, the density of the physiologically active substance-binding group can be increased, and the signal intensity can be increased.

    Although the particle | grains used for this invention are not specifically limited, The particle | grains which consist of an inorganic compound, an organic compound, or an organic inorganic composite compound can be used conveniently. The average particle diameter is 100 μm or less, preferably 1 to 5000 nm, more preferably 1 to 1000 nm.

    There are various kinds of particles composed of inorganic compounds, but they can be used arbitrarily. For example, carbon, glass, silica, metal, metal oxide, metal hydroxide, metal salt (carbonate, sulfite, sulfate, metal halide, etc.), Examples thereof include metal sulfides, metal nitrides, and metal carbides. Specific examples of these include, for example, gold, gold hydroxide, magnesium oxide, calcium oxide, aluminum oxide, zirconium oxide, iron oxide (ferrite, etc.), titanium oxide, tin oxide, zinc oxide, copper oxide, nickel oxide, Cobalt oxide, vanadium oxide, tungsten oxide, magnesium hydroxide, calcium hydroxide, aluminum hydroxide, magnesium carbonate, calcium carbonate, calcium sulfite, aluminum sulfate, cuprous chloride, silicon carbide, silicon nitride, sodium silicate, aluminum nitride Etc. are exemplified.

As the carbon beads, carbon particles obtained by carbonizing and firing a raw material containing a large amount of carbon such as coal, pitch, graphite, coke, carbon black, wood (carbohydrate), and resin can be used.
As for silica particles, sicastar (registered trademark) (micromod) is known as a commercial product.

    The particles made of an organic compound are preferably particles made of a resin. As resins, phenol resin, urea resin, melamine resin, benzoguanamine resin, alkyd resin, unsaturated polyester resin, vinyl ester resin, diallyl phthalate resin, epoxy resin, urethane resin, furan resin, ketone resin, xylene resin, polyimide resin, poly Known are carbodiimide resins, styrylpyridine resins, triazine resins, styrene resins, acrylic resins, methacrylic resins, carbonate resins, vinyl alcohol resins, polypropylene resins, cyclopolyolefin resins, and the like. Commercially available products include Sumilite Resin ACS series (Sumitomo Bakelite Co., Ltd.), Bell Pearl (Kanebo Co., Ltd.) and Univex (Unitika Co., Ltd.), micromer (registered trademark) (micromod Co., Ltd.), which are phenol resin fine particles. Yes.

    The particles in the present invention are preferably chemically bonded to the surface of the substrate via a polymer compound. Therefore, the polymer compound and the particles can be easily bonded by activating the particles with sulfuric acid, hydrochloric acid, plasma treatment, or the like as necessary.

    As the polymer compound used in the present invention, those having a physiologically active substance binding component, a crosslinking component, and a matrix component as constituent units are preferable. This polymer compound is obtained, for example, by copolymerizing a monomer having a physiologically active substance binding component, a monomer having a crosslinking component, and a monomer having a matrix component.

The monomer having a physiologically active substance-binding component used in the present invention is not particularly limited in structure, but has the general formula [1] (wherein R ₂ represents a hydrogen atom or a methyl group, and Y represents 1 to 10 carbon atoms). An alkyleneoxy group or an alkyl group, wherein W represents a physiologically active substance binding group) and W is a chain of an alkyleneoxy group having 1 to 10 carbon atoms or a chain of an alkyl group. It is preferable that the compound is bonded together. The repeating number q of the alkyleneoxy group Y is an integer of 1 to 20, and when the repeating number is 2 or more and 20 or less, the carbon number of the repeating alkyleneoxy group may be the same or different.

    As the physiologically active substance binding group W, p-nitrophenyl ester group, N-hydroxysuccinimide ester group, succinimide ester group, phthalimide ester group, 5-norbornene-2,3-dicarboximide ester group, aldehyde Group, amino group, epoxy group, and the like. A p-nitrophenyl ester group or an N-hydroxysuccinimide ester group is preferable because a physiologically active substance can be immobilized at a lower pH.

The monomer having a crosslinking component used in the present invention is not particularly limited as long as it has a crosslinkable functional group and the reaction of the crosslinkable functional group does not proceed during the synthesis of the polymer compound. Absent.
As the crosslinkable functional group, for example, a functional group that generates a silanol group by hydrolysis, a glycidyl group, or the like is used, but a functional group that generates a silanol group by hydrolysis is preferable because it can be crosslinked at a lower temperature.

The monomer having a crosslinking component used in the present invention is a monomer represented by the general formula [2] (wherein R ₃ represents a hydrogen atom or a methyl group, and Z represents an alkyl group having 1 to 20 carbon atoms). However, Z may be omitted, and at least one of A ₁ , A ₂ , and A ₃ is a hydrolyzable group, and the other is preferably an alkyl group.

    A monomer having a functional group that generates a silanol group by hydrolysis represented by the general formula [2] is an alkyl having 1 to 20 carbon atoms that has a (meth) acryl group and a functional group that generates a silanol group by hydrolysis. A compound bonded via a chain or directly. The functional group that generates a silanol group by hydrolysis is a group that readily undergoes hydrolysis and forms a silanol group when contacted with water. For example, a halogenated silyl group, an alkoxysilyl group, a phenoxysilyl group, an acetoxysilyl group Etc. Among these, an alkoxysilyl group is preferable because it easily generates a silanol group.

    Examples of the monomer containing an alkoxysilyl group include 3- (meth) acryloxypropenyltrimethoxysilane, 3- (meth) acryloxypropylbis (trimethylsiloxy) methylsilane, and 3- (meth) acryloxypropyldimethyl. Methoxysilane, 3- (meth) acryloxypropyldimethylethoxysilane, 3- (meth) acryloxypropylmethyldimethoxysilane, 3- (meth) acryloxypropylmethyldiethoxysilane, 3- (meth) acryloxypropyltrimethoxy Silane, 3- (meth) acryloxypropyltriethoxysilane, 3- (meth) acryloxypropyltris (methoxyethoxy) silane, 8- (meth) acryloxyoctanyltrimethoxysilane, 11- (meth) acryloxyundenyl bird It can be exemplified Tokishishiran like of (meth) acryloxy alkyl silane compound. Among these, 3-methacryloxypropyltrimethoxysilane, 3-methacryloxypropyltriethoxysilane, 3-methacryloxypropyldimethylmethoxysilane, and 3-methacryloxypropyldimethylethoxysilane are copolymerizable with a monomer having a phosphorylcholine group. Is preferable from the viewpoints of being excellent and easy to obtain. These monomers having an alkoxysilyl group are used alone or in combination of two or more.

The monomer having a matrix component used in the present invention is not particularly limited in structure, but is preferably a (meth) acrylic group-bonded compound represented by the general formula [3]. (Wherein R ₁ represents a hydrogen atom or a methyl group, and X represents a group having a phosphorylcholine group or a group having an alkylene glycol residue).

    Examples of the monomer having a phosphorylcholine group include 2- (meth) acryloyloxyethyl phosphorylcholine, 2- (meth) acryloyloxyethoxyethyl phosphorylcholine, 6- (meth) acryloyloxyhexyl phosphorylcholine, 10- (meth) acryloyloxyethoxy. Nonyl phosphorylcholine, 2- (meth) acryloyloxypropyl phosphorylcholine and the like can be mentioned, and 2-methacryloyloxyethyl phosphorylcholine is preferable from the viewpoint of availability.

The alkylene glycol residue is, for example, a group composed of repeating alkylene glycol residues T, and the number of repetitions is an integer of 1 to 100, more preferably an integer of 2 to 100, still more preferably 2 to 95. It is an integer, most preferably an integer of 20 to 90. When the number of repetitions is 2 or more and 100 or less, the carbon number of the alkylene glycol residue T to be repeated may be the same or different.
Carbon number of the alkylene glycol residue T is 1-10, More preferably, it is 1-6, More preferably, it is 2-4, More preferably, it is 2-3, Most preferably, it is 2.

    Examples of the monomer having an alkylene glycol residue include hydroxyl groups such as methoxypolyethylene glycol (meth) acrylate, 2-hydroxyethyl (meth) acrylate, 2-hydroxypropyl (meth) acrylate, and 2-hydroxybutyl (meth) acrylate. (Meth) acrylates of mono-substituted esters, glycerol mono (meth) acrylate, (meth) acrylate having polypropylene glycol as a side chain, 2-methoxyethyl (meth) acrylate, 2-ethoxyethyl (meth) acrylate, methoxydiethylene glycol (Meth) acrylate, ethoxydiethylene glycol (Meth) acrylate, ethoxypolyethylene glycol (Meth) acrylate, etc. Methacrylate is preferred.

    The method for synthesizing the polymer compound used in the present invention is not particularly limited, but from the viewpoint of ease of synthesis, at least a monomer having a physiologically active substance binding component, a monomer having a crosslinking component, and a matrix component It is preferable to radically polymerize a mixture containing a monomer having a solvent in a solvent in the presence of a polymerization initiator.

    Any solvent may be used as long as each monomer can be dissolved, and examples thereof include methanol, ethanol, t-butyl alcohol, benzene, toluene, tetrahydrofuran, dioxane, dichloromethane, and chloroform. These solvents are used alone or in combination of two or more. When the polymer compound is applied to a plastic substrate, ethanol and methanol are preferable because they do not denature the substrate.

The polymerization initiator may be any ordinary radical initiator, for example, 2,
Azo compounds such as 2′-azobisisobutylnitrile (hereinafter referred to as “AIBN”), 1,1′-azobis (cyclohexane-1-carbonitrile), organic peroxides such as benzoyl peroxide and lauryl peroxide be able to.

    The chemical structure of the polymer compound used in the present invention may be in any form such as random, block or graft as long as each monomer is copolymerized.

  The molecular weight of the polymer compound used in the present invention is preferably 5,000 or more, more preferably 10,000 or more, because separation and purification of the polymer compound and unreacted monomer are facilitated.

    An example of a method of coating the polymer compound on the substrate surface or particles is shown below. For example, a polymer solution in which a polymer compound is dissolved in an organic solvent in a concentration of 0.05 to 10% by weight is prepared, and then mixed with particles dispersed in the second solvent. At this time, it is preferable that the particles and the polymer compound are chemically covalently bonded by reaction. The substrate is coated on the surface of the substrate by a known method such as dipping or spraying in the mixed solution thus obtained, and then dried at room temperature or under heating.

    The first solvent and the second solvent may be the same or different, but are preferably organic solvents. For example, a single solvent such as ethanol, methanol, t-butyl alcohol, benzene, toluene, tetrahydrofuran, dioxane, dichloromethane, chloroform, or a mixed solvent thereof is used. Of these, ethanol or methanol is preferable because it does not denature the plastic substrate and is easy to dry.

    As the substrate used in the present invention, a slide-shaped substrate, a 96-well plate, a container, and a microfluidic substrate are preferable. Examples thereof include a plastic substrate, a glass substrate, and a substrate having a metal vapor deposition film. Specific examples of the plastic substrate include a substrate made of cycloolefin polymer, polypropylene, polyethylene poly, polysalphone, polyimide, polycarbonate, polymethyl petaacrylate.

    By immobilizing a physiologically active substance using the bioassay substrate of the present invention, a bioassay with high signal intensity is possible.

    Examples of the synthesis of polymer compounds used in the present invention and examples of bioassay substrates are shown below.

(Synthesis of p-nitrophenyloxycarbonyl-polyethylene glycol methacrylate (MEONP))
0.01 mol of polyethylene glycol monomethacrylate (Blenmer PE-200 (n = 4) manufactured by NOF Corporation) was dissolved in 20 mL of chloroform, and then cooled to -30 ° C. While maintaining at −30 ° C., 0.01 mol of p-nitrophenyl chloroformate (manufactured by Aldrich), 0.01 mol of triethylamine (manufactured by Wako Pure Chemical Industries, Ltd.) and 20 mL of chloroform were added to this solution. The homogeneous solution was slowly added dropwise. After reacting at −30 ° C. for 1 hour, the solution was further stirred at room temperature for 2 hours. Thereafter, salts were removed from the reaction solution by filtration, and the solvent was distilled off to obtain p-nitrophenyloxycarbonyl-polyethylene glycol methacrylate (MEONP). The obtained monomer was measured by 1H-NMR in deuterated chloroform solvent, and it was confirmed that 4.5 units of ethylene glycol residue was contained.

(Synthesis Example 1 of polymer compound)
2-Methacryloyloxyethyl phosphorylcholine (MPC), 3-methacryloxypropyltriethoxysilane (MPTES), and MEONP were added to dehydrated ethanol in the order of 0.9 mol / L, 0.05 mol / L, and 0.05 mol / L, respectively. It was dissolved to prepare a monomer mixed solution. Thereto was further added 0.002 mol / L AIBN and stirred until uniform. Then, after making it react at 60 degreeC by argon gas atmosphere for 3 hours, the reaction solution was dripped in the mixed solvent of diethyl ether and chloroform, and precipitation was collected. The obtained high molecular compound was measured by 1H-NMR. The peaks attributed to methylene of BMA appearing near 1.46 and 1.65 ppm, the peaks attributed to trimethyl of MPC appearing near 3.34 ppm, The composition ratio of the polymer compound was calculated from the integrated value. Table 1 shows the results.

(Substrate 1)
A saturated cyclic polyolefin resin was processed into a slide glass shape (dimensions: 76 mm × 26 mm × 1 mm) to prepare a solid phase substrate, and oxygen plasma treatment was performed.

(Particle 1)
As silica nanobeads, micromod sicastar (registered trademark): average particle diameter of 70 nm (product number 43-00-701) was used.

Solution 1 (Preparation of polymer compound solution with particles)
The polymer compound obtained in Synthesis Example 1 and the particles 1 were dissolved in ethanol to prepare a solution containing 0.3% by weight of the polymer compound and 0.2% by weight of the particles.

Solution 2 (Polymer compound solution adjustment)
The polymer compound obtained in Synthesis Example 1 was dissolved in ethanol to prepare a solution containing 0.3% by weight of the polymer compound.

Example 1
Substrate 1 was dipped in solution 1 and pulled up, and heated at 100 ° C. for 2 hours to obtain a bioassay substrate.

(Comparative Example 1)
A bioassay substrate was obtained in the same manner as in Example 1 except that the solution 2 was used.

(Evaluation)
(Preparation of DNA solution)
DNA solution 1: 24 bp oligo DNA having an amino group at the 5 ′ end (TAGAAGCATTTGCGGTGGAGATG (SEQ ID NO: 1) (manufactured by Sigma Genosys)) with a predetermined buffer so as to have a concentration of 0.1 μg / μl. Dissolved.
DNA solution 2; 3 × SSC, 24 bp oligo DNA having a Cy3 label at the 5 ′ end (CATCGTCCCACCCACAAATGCTTCTA (SEQ ID NO: 2) (manufactured by Sigma Genosys)) at a concentration of 0.002 μg / μl, 0 × Dissolved in 2% SDS solution.

(Spot and hybridization)
In Example 1, DNA solution 1 was dispensed into a 96-well plate and spotted on a substrate using a micropin type microarray spotter. After the spotting, it was stationary in an oven at 80 ° C.
Then, the blocking treatment was performed by inactivating the active ester group by immersing in a 0.1N sodium hydroxide solution for 5 minutes. Next, the DNA solution 2 is spread on this substrate, covered with a cover glass, and left in a humid container at 65 ° C. for 3 hours to allow hybridization between the immobilized oligo DNA and Cy3 labeled oligo DNA. went. Then, the substrate after DNA hybridization was prepared by washing in 2 × SSC, 0.5% SDS and then washing with pure water.

Table 2 shows the results obtained by measuring the fluorescence count value and background value after DNA hybridization and digitizing the spot fluorescence.
A microarray scanner “ScanArray” manufactured by Packard BioChip Technologies was used for the measurement of the amount of fluorescence. The measurement conditions were laser output 90%, PMT sensitivity 60%, excitation wavelength 649 nm, measurement wavelength 670 nm, and resolution 50 μm.
The Example was found to be a bioassay substrate having a higher amount of hybrid signal than the Comparative Example.

Claims (13)

A bioassay substrate for immobilizing a physiologically active substance on a solid phase surface of a substrate, characterized in that it has a polymer compound on the solid phase surface of the substrate and particles are retained. A base material for bioassay. The bioassay substrate according to claim 1, wherein the particles are coated with the polymer compound. The bioassay substrate according to claim 1 or 2, wherein the particles are held on the surface of the substrate via the polymer compound. The bioassay substrate according to any one of claims 1 to 3, wherein the particles and the substrate surface are bound by a chemical covalent bond. The bioassay substrate according to claim 4, wherein the chemical covalent bond is formed via the polymer compound. The bioassay substrate according to any one of claims 1 to 5, wherein the polymer compound has a physiologically active substance-binding component, a crosslinking component, and a matrix component as constituent units. The bioassay substrate according to any one of claims 1 to 6, wherein the particles are composed of an inorganic compound, an organic compound, or an organic-inorganic composite compound. The bioassay substrate according to any one of 1 to 6, wherein the particles are titanium oxide particles or silica particles. The bioassay substrate according to any one of 1 to 6, wherein the particles are polystyrene resin particles, polyimide resin particles, or poly (meth) acrylic resin particles. The bioassay substrate according to any one of claims 1 to 9, wherein an average diameter of the particles is 1-1000 nm. The bioassay substrate according to any one of claims 1 to 10, wherein the substrate is a slide-shaped substrate, a 96-well plate, a container, or a microfluidic substrate. A microarray in which a physiologically active substance is immobilized on the bioassay substrate according to claim 1. It is a manufacturing method of the base material for bioassays in any one of Claims 1-11, Comprising: The base material for bioassays including the process of immersing or apply | coating the solution containing the said high molecular compound, the said particle | grain, and a solvent to a base material. Production method.