JP2001183378A - Method for immobilizing dna fragment to solid phase carrier surface and dna chip - Google Patents

Abstract

PROBLEM TO BE SOLVED: To develop a fixation method whereby a preliminarily separately prepared DNA fragment can be bound to a solid phase carrier surface by a quick reaction and a reaction product can stably maintain the binding. SOLUTION: According to the method for immobilizing the DNA fragment to the solid phase carrier surface, the DNA fragment is brought in contact in a liquid phase to the surface of a fixed bed of the solid phase carrier which has the fixed bed of inorganic fine particles dispersed in a hardening film of a water soluble resin bridged by a crosslinking agent, whereby the DNA fragment is immobilized at one terminal part to the surface of the fixed bed. A DNA chip is obtained by the method, and a complementary nucleic acid fragment to the DNA fragment on the DNA chip is detected in a method using the DNA chip.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a large number of DNs which are very useful for simultaneous analysis of gene expression, mutation, polymorphism, etc.
The present invention relates to a method for immobilizing DNA fragments on a solid-phase carrier surface, which is necessary for producing a high-density array (DNA chip) in which A fragments and oligonucleotides are arranged on a solid-phase surface. The present invention also provides a DNA chip produced by a method for immobilizing the DNA fragment on the surface of a solid support, and DN on the DNA chip.
The present invention also relates to a method for detecting a nucleic acid fragment having complementarity to the A fragment.

[0002]

2. Description of the Related Art Technology development for efficiently analyzing the functions of all genes of various organisms has been progressing, and a DNA chip has been used as an analysis means. A DNA chip is usually in the form of a microarray in which a large number of DNA fragments are aligned and fixed on a solid support such as a slide glass, and has a DNA complementary to the DNA fragments fixed to the DNA chip.
The fragment sample is immobilized on a DNA chip by hybridization and used for detection. As a means for detecting the formed hybrid, there are a method using a fluorescent label or a radioactive label previously bound to the DNA fragment sample, and a method using an intercalator having a fluorescent group or a conductive group incorporated into the hybrid. Are known.

[0003] DNA chip technology using a DNA chip can be applied to biomolecules other than DNA, and provides new means for research and development of drug discovery research, diagnosis and prevention of diseases, and measures against energy and environmental problems. It is expected to provide.

[0004] The use of a DNA chip as a DNA analysis means has been embodied in a method of determining the base sequence of DNA by hybridization with an oligonucleotide (SBH, sequencing by hyb).
(D. Ridation) is devised (D
rmanac, R .; et al. , Genomics,
4, page 114 (1989)). Although SBH was a method capable of overcoming the limitations of base sequencing using gel electrophoresis, it did not reach practical use.

[0005] Subsequently, a DNA chip fabrication technique was developed, and so-called HTS (high throughppu), which efficiently and efficiently examines gene expression, mutation, polymorphism and the like in a short time.
t screening) (Fodo
r, S. P. A. , Science, 251, page
767 (1991) and Schena, M .; , Sc
issue, 270, page 467 (199
5)).

However, in order to put the DNA chip utilization technology into practical use, a DNA chip production technology for aligning and immobilizing a large number of DNA fragments and oligonucleotides on the surface of a solid support is required.

As a method for preparing a DNA chip, a method of directly synthesizing a DNA fragment on the surface of a solid support (referred to as an “on-chip method”) and a method of fixing a separately prepared DNA fragment on the surface of a solid support are used. And is known. The on-chip method combines the use of protecting groups that are selectively removed by light irradiation with the photolithography and solid-phase synthesis techniques used in semiconductor manufacturing to define a specific area of a tiny matrix. A method of performing selective synthesis (referred to as “masking technique”) is typical.

As a method for immobilizing a DNA fragment prepared in advance on the surface of a solid support, there are the following methods depending on the type of the DNA fragment and the type of the solid support. (1) The DNA fragment to be fixed is cDNA (complementary DNA synthesized using mRNA as a template) or PCR product (cDNA
In the case of a DNA fragment obtained by amplifying the DNA fragment by a PCR method, these are applied to the surface of a solid support that has been surface-treated with a polycation (polylysine, polyethyleneimine, etc.) using a spotter device provided in a DNA chip preparation device. In general, a method of spotting and electrostatically bonding to a solid support using the charge of DNA is used. As a method for treating the surface of the solid support, a method using a silane coupling agent having an amino group, an aldehyde group, an epoxy group, or the like is also used (Geo, Z. et al., Nucleic A).
cid Research, 22, 5456-5465
(1994)). In this case, since amino groups, aldehyde groups, and the like are introduced into the surface of the solid support by covalent bonds, they are more stably present on the surface of the solid support than in the case of polycations.

As a modification of the method utilizing the charge of DNA, a PCR product modified with an amino group is suspended in SSC (standard saline citrate buffer) and spotted on a silylated slide glass surface. A method of sequentially performing a treatment with sodium borohydride and a heat treatment after incubation (Schena, M. et a) has been reported.
l. Proc. Natl. Acad. Sci. USA
93, 10614-10619 (1996)). However, this fixing method has a problem that sufficient stability is not always obtained. In DNA chip technology, the detection limit is important. Therefore, the development of a technique for stably immobilizing a DNA fragment in a sufficient amount on the surface of a solid support greatly contributes to improving the detection limit of hybridization between the immobilized DNA fragment and the labeled sample nucleic acid fragment.

(2) When the DNA fragment to be fixed is a synthetic oligonucleotide, an oligonucleotide having a reactive group introduced therein is synthesized, the oligonucleotide is spotted on the surface of the surface-treated solid support, and covalently bonded. ("Protein / Nucleic acid / Enzyme", Vol. 43, (1998), 2004-2)
011, Lamture, J.M. B. et al. , Nu
cl. Acids Res. , 22,2121-212
5, 1994, and Guo. Z. , Et al. ,
Nucl. Acids Res. , 22,5456-5
465, 1994). For example, a method of reacting an amino group-introduced oligonucleotide with a slide glass having an amino group introduced thereto in the presence of PDC (p-phenylenediisothiocyanate) and a method of reacting an aldehyde group-introduced oligonucleotide with the slide glass are known. Have been. In these two methods, the oligonucleotide is stably immobilized on the surface of the solid-phase carrier as compared with the method (1) using the charge of DNA. However, in the method in which PDC is present, the reaction between PDC and an amino group-introduced oligonucleotide is slow, and in the method using an aldehyde group-introduced oligonucleotide, the stability of the reaction product, the Schiff base, is low (usually, hydrolysis). Easily occur).

[0011]

DISCLOSURE OF THE INVENTION The present invention relates to a method for binding a separately prepared DNA fragment to the surface of a solid support by a rapid reaction, and to stably maintain the binding of the reaction product. It is an object of the present invention to provide an immobilization method and a method for detecting a nucleic acid fragment.

[0012]

The above objects have been attained by the present invention described below.

(1) A solid phase carrier having a fixed layer in which inorganic fine particles are dispersed in a cured film of a water-soluble resin cross-linked by a cross-linking agent. A method for immobilizing a DNA fragment on a surface of a solid phase carrier, wherein the DNA fragment is immobilized on the surface of the immobilization layer by contacting the DNA fragment. In this fixing method, it is preferable that the inorganic fine particles are silica fine particles having an average primary particle diameter of 20 nm or less, the water-soluble resin is polyvinyl alcohol, and the crosslinking agent is a boric acid compound. (2) A DNA chip obtained by the above method. (3) A method for blocking a DNA chip, comprising treating the DNA chip with an acid having a pKa of 7 or less.

(4) A step of applying an aqueous liquid containing a nucleic acid fragment sample labeled with a fluorescent substance or a radioactive substance to the surface of the DNA chip, wherein the nucleic acid fragment has complementarity with the DNA fragment fixed on the DNA chip. Immobilizing the sample on a DNA chip by hybridization,
And detecting a fluorescent label or a radioactive label of the labeled nucleic acid fragment sample immobilized on the DNA chip.
A method for detecting a nucleic acid fragment having complementarity to a DNA fragment on a DNA chip. (5) a step of applying an aqueous liquid containing an intercalator having a fluorescent group or a conductive group and a nucleic acid fragment sample to the surface of the DNA chip, which has complementarity with the DNA fragment fixed to the DNA chip; Immobilizing a nucleic acid fragment sample on a DNA chip by hybridization, and fluorescence or conduction generated from a fluorescence generating group of an intercalator incorporated in a hybrid structure formed from the DNA fragment and the nucleic acid fragment sample of the DNA chip Detecting a current flowing through the functional group,
A method for detecting a nucleic acid fragment having complementarity to a DNA fragment on a DNA chip.

The present invention will be described in more detail. The present inventors have studied the interaction of various inorganic fine particles with DNA fragments. As a result, they have found that a DNA fragment can be strongly immobilized when inorganic fine particles coexist with a water-soluble resin. The present invention has been completed based on this finding.

The present researchers conducted research based on the above research results, and formed a thin film of inorganic fine particles and a water-soluble resin on a solid support, and cross-linked with a cross-linking agent. By spraying an aqueous solution of the DNA fragment
It has been found that immobilization can be carried out strongly without introducing a special functional group into the NA fragment, and strong immobilization that sufficiently functions as a DNA chip becomes possible.

Furthermore, since the metal oxide of the present invention is exposed at the portion where the DNA fragment is not spotted, the sample nucleic acid fragment as the test sample is easily adsorbed, and the portion where hybridization has occurred is detected. In some cases, the background of the measurement may increase, and the sensitivity may decrease.
For this reason, it is preferable to cover the portions where the DNA fragments are not spotted by surface treatment. Hereinafter, this surface coating is called blocking. The present inventors have conducted intensive studies on the above points. As a result, in the method for fixing a DNA fragment using the oxidized fine particles and the water-soluble resin of the present invention, an acid having a pKa of 7 or less is used as a coating agent as a blocking method. To give very favorable results.

In the present invention, sulfonic acids, sulfinic acids, phosphoric acid monoesters, phosphoric diesters, phosphonic acids, phosphonic acid monoesters, carboxylic acids, and squaric acids have been found to be particularly effective. .

[0019]

BEST MODE FOR CARRYING OUT THE INVENTION The preferred embodiment of the method for immobilizing a DNA fragment on the surface of a solid support of the present invention is as follows. (1) The inorganic fine particles and the water-soluble resin of the present invention are applied on a substrate and fixed as a thin film using a crosslinking agent. (2) Use a DNA fragment whose base sequence is known. (3) An aqueous liquid containing the DNA fragment prepared in (2) is spotted on the surface of the solid support prepared in (1). (4) The solid phase carrier on which the DNA fragment prepared in (3) is immobilized is treated with a coating agent to cover a portion where the DNA fragment is not spotted. (5) The crosslinking agent is a boron compound (especially, borax). (6) The inorganic fine particles are silica fine particles having an average primary particle diameter of 20 nm or less (preferably 10 nm or less, particularly in the range of 3 to 10 nm). (7) The water-soluble resin is polyvinyl alcohol. (8) The weight ratio of the inorganic fine particles to the water-soluble resin is 1.5: 1.
To 10: 1 (inorganic fine particles: water-soluble resin).

The inorganic fine particles used in the present invention include:
For example, fine silica particles, colloidal silica, calcium silicate, zeolite, kaolinite, halloysite, muscovite, talc, calcium carbonate, calcium sulfate, boehmite, pseudo boehmite and the like can be mentioned. Among these, silica fine particles are preferred. The average primary particle diameter of the inorganic fine particles is preferably 20 nm or less (preferably 10 nm or less, particularly in the range of 3 to 10 nm).

Since silica particles are liable to adhere to each other due to hydrogen bonding due to silanol groups on the surface, a structure having a particularly large porosity can be formed when the average primary particles are particularly 10 nm or less as described above. Thus, the DNA fragments can be combined in a dispersed state, and the discrimination of hybridization can be improved.

The silica particles are roughly classified into wet process particles and dry process particles according to the production method. In the wet method, a method is generally used in which active silica is generated by acid decomposition of a silicate, which is appropriately polymerized and coagulated and settled to obtain hydrated silica.
On the other hand, the dry method is a method based on high-temperature gas phase hydrolysis of silicon halide (flame hydrolysis), a method in which silica sand and coke are heated and reduced by an arc in an electric furnace and oxidized with air (arc method). The method of obtaining anhydrous silica by the method (1) is mainly used. The hydrated silica and anhydrous silica obtained by these methods have different properties, such as the density of silanol groups on the surface and the presence or absence of vacancies, and show different properties, respectively. In the case of silicic anhydride (anhydrous silica), Particularly, a three-dimensional structure having a high porosity is easily formed, which is preferable.

Examples of the water-soluble resin include polyvinyl alcohol (PVA) which is a resin having a hydroxyl group as a hydrophilic structural unit, a cellulose resin [methylcellulose (M), ethylcellulose (EC), hydroxyethylcellulose (HEC), and carboxy. Methylcellulose (CMC) etc.], chitins and starches; polyethylene oxide (PEO), polypropylene oxide (PPO), polyethylene glycol (PEG) and polyvinyl ether (PE) which are resins having an ether bond; and an amide group or amide Examples thereof include polyacrylamide (PAAM) and polyvinylpyrrolidone (PVP), which are resins having a bond. Further, polyacrylates having a carboxyl group as a dissociable group, maleic acid resins, alginates, and gelatin can be mentioned. As the water-soluble resin, polyvinyl alcohol is preferable.

The ratio of the inorganic fine particles (preferably silica fine particles) to the water-soluble resin (PB ratio: the weight of the inorganic fine particles with respect to the weight of the water-soluble resin of 1) is preferably in the range of 0.5 to 10, preferably 2 to 10. It is particularly preferred that it is in the range of 5.

In the solid support of the present invention, a crosslinking agent is applied to a layer mainly composed of inorganic fine particles and a water-soluble resin,
Crosslinked. Borax, boric acid,
Borates (eg, orthoborate, indium borate, scandium borate, yttrium borate, lanthanum borate, magnesium borate, cobalt borate), diborates (eg, magnesium diborate, diborate) cobalt),
Metaborate (eg, lithium metaborate, calcium metaborate, sodium metaborate, potassium metaborate), tetraborate (eg, sodium tetraborate decahydrate), pentaborate (eg, pentaborate) Potassium tetrahydrate, calcium pentaborate heptahydrate, cesium pentaborate), glyoxal, melamine / formaldehyde (eg, methylol melamine, alkylated methylol melamine), methylol urea, resole resin, polyisocyanate, etc. Can be. Of these, borax, boric acid or borate is preferred. Borax, boric acid, and borates are preferably used in combination with polyvinyl alcohol as a water-soluble resin because they cause rapid crosslinking.

The solution of the crosslinking agent is prepared by dissolving the crosslinking agent in water and / or an organic solvent. The concentration of the crosslinking agent in the crosslinking agent solution is preferably in the range of 0.05 to 10% by mass, particularly preferably in the range of 0.1 to 7% by mass. In general, it is preferable to use water as a solvent for the crosslinking agent. As the organic solvent, any one can be used as long as the crosslinking agent dissolves, for example, methanol, ethanol, alcohols such as isopropyl alcohol, acetone, ketones such as methyl ethyl ketone,
Examples thereof include esters such as methyl acetate and ethyl acetate, aromatic solvents such as toluene, ethers such as tetrahydrofuran, and halogenated carbon solvents such as dichloromethane.

Next, a method for forming a thin film on a solid support by using a coating solution containing inorganic fine particles and a water-soluble resin as main components will be described. The coating liquid for forming a porous layer is prepared, for example, by adding silica fine particles having an average primary particle diameter of 10 nm or less to water (eg, in the range of 10 to 20% by mass), and using a high-speed rotating wet colloid mill, for example, at 10,000 rpm (preferably). Is dispersed for 20 minutes (preferably in the range of 10 to 30 minutes) under the condition of high-speed rotation of 500 to 20,000 rpm, and then becomes a polyvinyl alcohol aqueous solution (for example, PVA having a weight of about 1/3 of silica). )
Further, it can be obtained by performing dispersion under the same conditions as described above. The coating solution thus obtained is a uniform sol, and a porous layer having a three-dimensional network structure can be obtained by forming this on a support by the following coating method.

After the application of the coating solution for forming a porous layer, a solution containing the crosslinking agent of the present invention is applied onto the coating layer in the same manner as the coating solution for forming a porous layer, and dried. Can be obtained. The solution containing the crosslinking agent may be applied by a method such as spraying, or may be applied by dipping in the solution. The timing of applying the solution containing the crosslinking agent is preferably several minutes from immediately after the application of the coating solution for forming a porous layer. The drying after the application of the coating liquid for forming a porous layer is preferably performed at a temperature of 50 to 180 ° C. for 0.5 to 10 minutes (particularly preferably for 0.5 to 5 minutes). The drying time varies depending on the coating amount, but the above range is appropriate. For application of the solution containing the crosslinking agent, known coating methods such as a curtain flow coater, an extrusion die coater, an air doctor coater, a rod coater, a knife coater, a squeeze coater, a reverse roll coater, and a bar coater can be used. It is preferable to use a method in which the coater does not directly contact the coating layer by using a lug die coater, a curtain flow coater, a bar coater, or the like. The coating amount of the coating solution containing the crosslinking agent is 0.01 to 10 g / m ^2.
In the range of 0.05 to 5 g / m ²
It is particularly preferable that the ratio is within the range. After the application of the coating solution containing the crosslinking agent, the coating layer is dried at a temperature of 40 to 180 ° C. for 0.5 to 30 minutes, and drying and curing are performed. It is particularly preferable to carry out the above conditions at a temperature of 40 to 150 ° C. for 1 to 20 minutes.

Next, a cross-linking agent is contained simultaneously with the application of a coating liquid (coating liquid for forming a porous layer) containing inorganic fine particles and a water-soluble resin as main components, which is another method for preparing the solid phase carrier of the present invention. A method for applying the solution will be described. This method is obtained by simultaneously applying a coating solution for forming a porous layer and a solution containing a crosslinking agent on a support so that the coating solution for forming a porous layer comes into contact with the support and curing the solution. be able to. Simultaneous application of the coating solution for forming a porous layer and a solution containing a crosslinking agent can be performed by an application method using, for example, an extrusion die coater or a curtain flow coater. Drying after simultaneous coating (multilayer coating) is performed by heating the coating layer at a temperature of 40 to 150 ° C. for a period of 0.5 to 10 minutes, and the coating layer is cured.
It is preferable to further heat the cured layer at a temperature of 40 to 100 ° C. for 0.5 to 5 minutes. For example,
When borax or boric acid is used as the crosslinking agent, it is preferable to heat at a temperature of 60 to 100 ° C. for 5 to 20 minutes. After coating and drying, the obtained solid phase carrier can be improved in surface smoothness and coating strength by passing it between roll nips under heat and pressure using, for example, a super calender or a gross calender.

As the solid phase carrier, a carrier having low hydrophobicity or low hydrophilicity is preferable. In addition, even if the surface has unevenness and low flatness, it can be preferably used. Materials for the solid support include ceramics or new ceramics such as glass, cement, and porcelain, polymers such as polyethylene terephthalate, cellulose acetate, bisphenol A polycarbonate, polystyrene, and polymethyl methacrylate, silicon, activated carbon, porous glass, and porous materials. Ceramics, porous silicon, porous activated carbon, woven fabric, knitted fabric, nonwoven fabric, filter paper, short fibers, porous materials such as membrane filters, conductive materials such as gold, etc. can be used. The size of the pores of the porous material is preferably in the range of 2 to 1000 nm, particularly preferably in the range of 2 to 500 nm. The material of the solid support is particularly preferably glass or silicon. This is due to the ease of surface treatment and the ease of analysis by electrochemical methods. The thickness of the solid support is preferably in the range of 100 to 2000 μm.

The thickness of the porous layer containing the inorganic fine particles and the water-soluble resin as the main components on the solid support of the present invention is 0.005.
To 100 μm, preferably 0.01 to 100 μm.
To 10 μm, more preferably 0.0 to 10 μm.
It is particularly preferred that it is in the range of 5 to 1 μm.

In the method for immobilizing a DNA fragment of the present invention, a blocking step is preferably performed, and the use of an acid having a pKa of 7 or less as a coating agent lowers the background upon detection, and gives favorable results.

Among them, particularly effective acids in the present invention include sulfonic acids, sulfinic acids, phosphoric acid monoesters, phosphoric diesters, phosphonic acids, phosphonic acid monoesters, carboxylic acids, and squaric acids. be able to. Hereinafter, preferred specific examples will be described. Examples of the sulfonic acids include octanesulfonic acid, p-toluenesulfonic acid, 4-dodecyloxybenzenesulfonic acid, hexadecanesulfonic acid, and salts thereof. Examples of the sulfinic acid include sodium hexadecanesulfinate, 4-hexanoylaminobenzenesulfinic acid and the like. Examples of the phosphoric acid monoesters include monooctyl phosphate disodium salt, monododecyl phosphate monosodium salt, monooctadecyl phosphate, and the like. Examples of the phosphate diesters include dibenzyl phosphate, dibutyl phosphate, didecyl phosphate, di- (2-ethylhexyl) phosphate, and dihexadecyl phosphate.
Examples of the phosphonic acids include 4-butoxyphenylphosphonic acid, hexylphosphonic acid, dodecylphosphonic acid and the like. Examples of the phosphonic acid monoesters include benzylphosphonic acid monoethyl ester and ethoxycarbonylmethylphosphonic acid monoethyl ester.
Examples of the carboxylic acids include propionic acid, butyric acid, hexanoic acid, dodecanoic acid, 2-ethylhexanoic acid, hexadecanoic acid, benzoic acid, 3-chlorobenzoic acid, 4-dodecyloxybenzoic acid, dodecylsuccinic acid, and 4-butoxyphthalic acid. Is mentioned. Examples of the squaric acids include squaric acid, disodium squarate, and monocyclohexyl squarate.

When applying these coating agents on a solid support, a method of dissolving in water or an organic solvent miscible with water, or a mixed solvent thereof, and applying the solution onto the solid support, or by spraying. A method or a method of immersing a solid support in this solution is preferably used.

The amount of the coating agent applied to the solid support varies depending on the type and amount of the metal oxide of the present invention and the roughness of the surface of the solid support, but is usually 0.01 μg to 1 μm per 1 m ^2.
g, preferably from 0.1 μg to 100 g.
Particularly preferred is in the range of mg.

In the fixing method of the present invention, the base may promote the immobilization at the time of spotting the DNA fragment or coating with the coating agent, and the base can be preferably used in the present invention. The base that can be used in the present invention may be an inorganic or organic base, and it is also preferable to use them in combination. Examples of the inorganic base include potassium carbonate, sodium carbonate, cesium carbonate, lithium hydroxide, sodium hydroxide, potassium hydroxide, cesium hydroxide, calcium hydroxide, magnesium hydroxide and the like. Examples of organic bases include trimethylamine, triethylamine, tetramethylammonium hydroxide, dimethylbenzylamine, diethylaniline, pyridine,
4-dimethylaminopyridine, 1,4-diazabicyclo [2.2.2] octane, 1,8-diazabicyclo [5.4.0] -7-undecene, sodium methoxide, sodium ethoxide, potassium-t-butoxide , N-butyllithium, lithium diisopropylamide, tetrabutylammonium fluoride, sodium acetate, potassium acetate and the like.

In the fixing method of the present invention, various organic solvents can be used as a solvent at the time of spotting DNA fragments or coating with a coating agent. As the organic solvent, a hydrophobic solvent such as toluene, xylene, or n-hexane can be used, but a highly polar solvent miscible with water is preferable. Examples include ethyl acetate, methyl acetate, methanol, ethanol, isopropyl alcohol, n-butanol, t-butanol, sulfolane,
1,2-dimethoxyethane, dimethylformamide, dimethylsulfoxide, dimethylacetamide, N-methylpyrrolidone, acetonitrile, propionitrile, diethyl ether, tetrahydrofuran, ethylene glycol, 1,3-propanediol, 1,4-butanediol , Glycerin, 2-methoxyethanol, diethylene glycol, diethylene glycol dimethyl ether,
Acetic acid, pyridine, formic acid, propionic acid, butyric acid and the like can be mentioned.

In the fixing method of the present invention, it is also preferable to heat at the time of spotting DNA fragments or coating with a coating agent. The heating temperature is preferably in the range of 4 to 150 ° C, more preferably in the range of 50 to 130 ° C, and particularly preferably in the range of 50 to 100 ° C. In addition, the reaction is preferably performed by covering the periphery with a partition wall for the purpose of preventing volatilization and volatilization of the reaction solvent, or for controlling the humidity or supplying a gaseous reagent. The reaction requiring application of pressure can be carried out in a pressure-resistant container such as an autoclave.

On the surface of the solid support having been subjected to the surface treatment, a layer made of a hydrophilic polymer having a charge or a layer made of a crosslinking agent may be further provided. By providing such a layer, unevenness of the surface-treated solid support can be reduced. Depending on the type of the solid phase carrier, a hydrophilic polymer or the like can be contained in the carrier, and a solid phase carrier that has been subjected to such treatment can be preferably used.

The DNA fragment can be divided into two types depending on the purpose. To examine gene expression, the cD
It is preferable to use a polynucleotide such as NA, a part of cDNA, or EST. These polynucleotides may be of unknown function, but are generally amplified by PCR using a cDNA library, genomic library or whole genome as a template based on sequences registered in a database. (Hereinafter, referred to as “PCR product”). Those not amplified by the PCR method can also be preferably used. In addition, in order to examine gene mutations and polymorphisms, it is preferable to synthesize various oligonucleotides corresponding to the mutations and polymorphisms based on a known sequence as a standard, and use them. Furthermore, in the case of nucleotide sequence analysis, it is preferable to use 4 ⁿ (n is the length of a base) synthesized oligonucleotides. The base sequence of the DNA fragment is preferably determined in advance by a general base sequence determination method. The DNA fragment is preferably a 2- to 50-mer, and particularly preferably a 10- to 25-mer.

The DNA fragments are spotted by dissolving or dispersing the DNA fragments in an aqueous medium in 96 wells or 3 wells.
The dispensing is preferably performed by dispensing into an 84-well plastic plate and dropping the dispensed aqueous liquid onto the surface of the solid support using a spotter or the like.

In order to prevent drying of the DNA fragment after spotting,
A substance having a high boiling point may be added to the aqueous liquid in which the DNA fragment is dissolved or dispersed. As a substance with a high boiling point,
It is preferably a substance which can be dissolved in an aqueous liquid in which a DNA fragment is dissolved or dispersed, and which does not hinder hybridization with a sample nucleic acid fragment and has low viscosity. Such materials can include glycerin, ethylene glycol, dimethyl sulfoxide and low molecular weight hydrophilic polymers. Examples of the hydrophilic polymer include polyacrylamide, polyethylene glycol, and sodium polyacrylate. The molecular weight of the polymer is preferably in the range of 10 ³ to 10 ^6. As the substance having a high boiling point, glycerin or ethylene glycol is more preferably used, and glycerin is particularly preferably used.
The concentration of the high-boiling substance is 0.1% in the aqueous solution of the DNA fragment.
Preferably, it is in the range of 0.5 to 2% by volume, particularly preferably in the range of 0.5 to 1% by volume.

For the same purpose, it is also preferable to place the solid phase carrier after spotting the DNA fragment in an environment having a humidity of 90% or more and a temperature range of 25 to 50 ° C.

After spotting the DNA fragment, post-treatment with ultraviolet light, sodium borohydride or Schiff's reagent may be performed. These post-treatments may be performed in combination of a plurality of types, and particularly preferably performed in combination of the heat treatment and the ultraviolet treatment. After spotting, it is also preferable to carry out incubation. After incubation, undotted D
Preferably, the NA fragments are removed by washing.

The amount of DNA fragments immobilized is preferably in the range of 10 ^{2 to} 10 ⁵ types / cm ^{2 on} the surface of the solid support. The amount of the DNA fragment is in the range of 1 to 10 ¹⁵ mol, and the weight is preferably several ng or less. By spotting, the aqueous liquid of the DNA fragment is fixed in the form of dots on the surface of the solid support. The shape of the dot is almost circular. The absence of variation in shape is important for quantitative analysis of gene expression and analysis of single nucleotide mutation. The distance between the dots is preferably in the range of 0 to 1.5 mm, particularly preferably in the range of 100 to 300 μm. The size of one dot is 5
It is preferably in the range of 0 to 300 μm. The amount of spotting is preferably in the range of 100 pL to 1 μL, and particularly preferably in the range of 1 to 100 nL.

The life of the DNA chip produced by the above-described process is as follows.
Longer for chips. These DNA chips are used for gene expression monitoring, nucleotide sequence determination, mutation analysis, polymorphism analysis, and the like. The principle of detection is hybridization with a labeled sample nucleic acid fragment described below.

The labeling method can be roughly classified into the RI method and the non-R method.
Although the I method (fluorescence method, biotin method, electrochemical method, chemiluminescence method, etc.) is known, the DNA chip of the present invention
It is particularly advantageous when using a fluorescence method. As the fluorescent substance, any substance can be used as long as it can bind to the base portion of the nucleic acid. Examples of the fluorescent substance include a cyanine dye (for example, Cy3 and Cy5 of the CyDye ^™ series), rhodamine 6G reagent, N-acetoxy-N ² -Acetylaminofluorene (AAF) or AAIF (iodine derivative of AAF) can be used.

It is to be noted that, besides utilizing the above-mentioned label, a method utilizing an electrochemical detection method using an intercalator having a conductive group and having a property of being incorporated into the formed hybrid structure is also known. And D of the present invention
NA chips can also be used for electrochemical detection methods. Alternatively, there is also known a method of using a method for detecting the formation of a hybrid by a fluorescence method using an intercalator having a fluorescence-generating group and having a property of being incorporated into the formed hybrid structure. Can also be used for this detection method.

Examples of the nucleic acid fragment used as a sample include a DNA fragment sample and an RNA fragment whose sequence and function are unknown.
It is preferable to use a fragment sample. The sample nucleic acid fragment is preferably isolated from eukaryotic cell or tissue samples for the purpose of examining gene expression. If the sample is a genome, it is preferably isolated from any tissue sample except red blood cells. Any tissue other than red blood cells is preferably peripheral blood lymphocytes, skin, hair, semen and the like. If the sample is mRNA, it is preferably extracted from a tissue sample in which mRNA is expressed. The mRNA is labeled by incorporating a labeled dNTP (“dNTP” means a deoxyribonucleotide whose base is adenine (A), cytosine (C), guanine (G) or thymine (T)) by a reverse transcription reaction. Preferably, it is cDNA. dNTP is dCT because of its chemical stability.
P is preferably used. The amount of mRNA required for one hybridization depends on the amount of liquid and the labeling method, but is preferably several μg or less. In addition, DNA
When the DNA fragment on the chip is an oligo DNA,
It is desirable that the sample nucleic acid fragment be reduced in molecular weight. In prokaryotic cells, since it is difficult to selectively extract mRNA, it is preferable to label total RNA.

For the purpose of examining gene mutation or polymorphism, the sample nucleic acid fragment is preferably prepared by PCR of the target region in a reaction system containing a labeled primer or a labeled dNTP.

In the hybridization operation, an aqueous liquid in which a labeled sample nucleic acid fragment is dissolved or dispersed, which is dispensed on a 96-well or 384-well plastic plate, is spotted on the DNA chip prepared above. It is preferable to carry out the above. The amount of spotting is preferably in the range of 1 to 100 nL. The hybridization operation is preferably performed in a temperature range from room temperature to 70 ° C., and for a time in the range from 6 to 20 hours.
After the completion of the hybridization, it is preferable to wash with a mixed solution of a surfactant and a buffer to remove unreacted sample nucleic acid fragments. It is preferable to use sodium dodecyl sulfate (SDS) as the surfactant. Buffers include citrate buffer, phosphate buffer,
A borate buffer, a Tris buffer, a Good buffer, and the like can be used, but a citrate buffer is particularly preferable.

A feature of hybridization using a DNA chip is that the amount of labeled sample nucleic acid fragments used is very small. Therefore, DN immobilized on a solid support
It is necessary to set optimal hybridization conditions depending on the length of the A fragment and the type of the labeled sample nucleic acid fragment. For gene expression analysis, it is preferable to perform hybridization for a long time so that low-expressed genes can be sufficiently detected. For detection of a single nucleotide mutation, it is preferable to perform hybridization for a short time. Another feature is that by preparing two types of sample nucleic acid fragments labeled with different fluorescent substances and simultaneously using them for hybridization, the expression level can be compared and quantified on the same DNA chip.

[0053]

EXAMPLES Example 1 Preparation of DNA Fragment-Immobilized Slide and Measurement of DNA Fragment Amount (1) Preparation of Solid Carrier Slide (C) of the Present Invention (A) Composition of Coating Solution for Forming Porous Layer (Hereinafter, all values of parts by weight indicating the blending amounts of all coating solutions represent solid content or nonvolatile content.) Anhydrous silica fine particles (average primary particle size: 7 nm, surface silanol groups: 23 / nm ² , Refractive index: 1.45, trade name: Aerosil 300 (manufactured by Nippon Aerosil Co., Ltd.)) 10 parts by weight polyvinyl alcohol (saponification degree: 81.8%, polymerization degree: 4000, trade name: PVA440 (Kuraray Co., Ltd.) 3.3) parts by weight Deionized water 136.0 parts by weight

The silica fine particles were added to ion-exchanged water (73.3 parts by weight), and a high-speed rotating wet colloid mill (CLEARMIX (manufactured by M Technique Co., Ltd.)) was added.
After dispersing at 10,000 rpm for 20 minutes using an aqueous solution of polyvinyl alcohol, an aqueous solution of polyvinyl alcohol (dissolved in the remaining 62.7 parts by weight of ion-exchanged water) was added, and the mixture was further dispersed under the same conditions as described above. Thus, a coating solution for forming a porous layer was obtained. A slide glass (25 mm × 75 mm) was immersed in the coating solution for forming a porous layer obtained above for 10 minutes, taken out, and dried at 80 ° C. (wind speed 3 m / sec) for 3 minutes by a hot air drier. After drying for 3 minutes, the slide glass was immersed for 1 second in a borax-containing solution of the following (B),
For 10 minutes. Thus, a slide (C) having a cured film containing silica fine particles and polyvinyl alcohol on the surface of the solid support and crosslinked with borax was prepared.

(B) Borax-containing solution Borax 1 part by weight Surfactant 0.2 part by weight (trade name: F144D, manufactured by Dainippon Ink and Chemicals, Inc.) Ion-exchanged water 98.8 parts by weight

(2) Spotting of DNA Fragments and Measurement of Fluorescence Intensity The 5 ′ end was a fluorescent labeling reagent (FluoroLink Cy).
DNA fragment (3'CTAGTCTGTGAAGTGTC) modified with 5dCTP, manufactured by Amersham Pharmacia Biotech
TGATC 5 ') was dispersed in 0.1 M carbonate buffer (pH 9.3) to prepare an aqueous liquid (1 × 10 ^-6 M, 1 μL), which was applied to the slide (C) obtained in the above (1). I wore it. Immediately, apply each spotted slide at 60 ° C and 90% humidity
After leaving for 1 hour at 0.1%
DS (sodium dodecyl sulfate) and 2 × SSC (2 × S
SC: a solution obtained by diluting the stock solution of SSC two-fold, and a mixed solution with SSC: standard saline citrate buffer) twice, 0.2 ×
It was sequentially washed once with an aqueous SSC solution. Next, the washed slide is immersed in a 0.1 M glycine aqueous solution (pH 10) for 1 hour and 30 minutes, washed with distilled water, and dried at room temperature to obtain a slide (D) on which a DNA fragment is fixed. Was. The fluorescence intensity of the surface of the slide (D) was measured with a fluorescence scanning apparatus, and was found to be 1480. It can be seen that the DNA fragment was efficiently immobilized on the slide glass by the immobilization method of the present invention.

Example 2 Detection of Sample DNA Fragment (1) Preparation of DNA Chip A DNA chip was immobilized in the same manner as in Example 1 except that a DNA fragment whose end was not modified with a fluorescent labeling reagent was used. Make a slide and add 3% by weight of this slide
Immersed in an aqueous solution of disodium hexadecylsuccinate for 1 minute, and then 0.1% by mass SDS (sodium dodecyl sulfate) and 2 × SSC (2 × SSC: a solution obtained by diluting the stock solution of SSC by 2 times, SSC: standard salt) (Citrate buffer) and once with a 0.2 × SSC aqueous solution. Then, the slide after washing was immersed in a 0.1 M glycine aqueous solution (pH 10) for 1 hour and 30 minutes.
After washing with distilled water and drying at room temperature, a slide (D) on which a DNA fragment was fixed was obtained.

(2) Detection of Sample DNA Fragment A 22-mer sample oligonucleotide (GATCAGACACTTCACAGACTAG5 ′) with Cy5 bound to the 5 ′ end was used as a hybridization solution (a mixed solution of 4 × SSC and 10% by mass SDS) (20 μL). What was dispersed in
After applying to the slide (D) obtained in the above (1) and protecting the surface with a cover glass for a microscope, the slide was incubated at 60 ° C. for 20 hours in a Moisture chamber. Then, this was mixed with 0.1% by mass of SDS and 2 × SSC,
After sequentially washing with a mixed solution of 0.1% by mass SDS and 0.2 × SSC and a 0.2 × SSC aqueous solution, 600 r
Centrifuged at pm for 20 seconds and dried at room temperature. The fluorescence intensity on the surface of the slide glass was 490 when measured with a fluorescence scanning device.

The D prepared by the immobilization method of the present invention
It can be seen that the use of the NA chip allows detection of a sample DNA fragment having complementarity with the DNA fragment immobilized on the DNA chip.

[0060]

According to the present invention, DNA can be deposited on the surface of a solid support.
The fragments can be fixed stably and quickly. In particular, when silica fine particles and polyvinyl alcohol are applied to the surface of the solid support and crosslinked with borax, the DNA fragments can be firmly fixed. The stable immobilization of DNA fragments enables the production of a DNA chip having a high detection limit that can be effectively used for gene analysis and the like. As one example, by performing hybridization with a sample nucleic acid fragment using a DNA chip prepared according to the present invention, a sample nucleic acid fragment having complementarity to a DNA fragment immobilized on a DNA chip can be detected with high sensitivity. Can be detected.

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) G01N 33/53 C12N 15/00 A (72) Inventor Hiroshi Shinoki 3-11-46 Fuji, Izumi, Asaka-shi, Saitama F-term in Photo Film Co., Ltd. (reference) 2G042 AA01 BD12 BD20 CB03 DA08 FA11 FB05 HA07 4B024 AA11 AA20 BA80 CA01 HA14 HA19 4B029 AA07 AA23 BB20 CC03 CC08 CC10 FA15 4B063 QA01 QA12 QA17 QA18 QA19 QQQ3 QS34 QS36 QS39 QX02 QX05 QX07

Claims (6)

[Claims] 1. A DNA fragment is brought into contact with the surface of a solid phase carrier having a fixed layer in which inorganic fine particles are dispersed in a cured film of a water-soluble resin cross-linked by a cross-linking agent in a liquid phase. And fixing the DNA fragment to the surface of the fixing layer. 2. An inorganic fine particle having an average primary particle diameter of 20 nm.
The method for immobilizing a DNA fragment on a solid phase carrier according to claim 1, wherein the following fine silica particles are used, the water-soluble resin is polyvinyl alcohol, and the crosslinking agent is a boric acid compound. 3. A DNA chip obtained by the method according to claim 1. 4. The DNA chip according to claim 3, wherein the DNA chip is pKa.
A method for blocking a DNA chip, wherein the method is treated with an acid of 7 or less. 5. A step of applying an aqueous liquid containing a nucleic acid fragment sample labeled with a fluorescent substance or a radioactive substance to the surface of the DNA chip according to claim 3, wherein complementarity with the DNA fragment immobilized on the DNA chip is determined. Immobilizing a nucleic acid fragment sample having on a DNA chip by hybridization, and detecting a fluorescent label or a radioactive label of the labeled nucleic acid fragment sample immobilized on the DNA chip. A method for detecting a nucleic acid fragment having complementarity. 6. A step of applying an aqueous liquid containing an intercalator having a fluorescent group or a conductive group and a nucleic acid fragment sample to the surface of the DNA chip according to claim 3,
A nucleic acid fragment sample complementary to the DNA fragment immobilized on the NA chip is DNized by hybridization.
Step of fixing on A chip, and DN of DNA chip
A DNA fragment on a DNA chip, comprising a step of detecting a current flowing through a fluorescent or conductive group generated from a fluorescent group of the intercalator taken into a hybrid structure formed from the A fragment and the nucleic acid fragment sample. A method for detecting a nucleic acid fragment having complementarity to