JP2006204267A - Thermostable and thermoactive dna polymerase and dna encoding the same - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To obtain a new thermostable or thermoactive DNA polymerase, a DNA encoding the DNA polymerase, a recombinant vector containing the DNA and a transformant containing the recombinant vector. <P>SOLUTION: The thermostable or thermoactive DNA polymerase as a new thermostable or thermoactive DNA polymerase comprises (a) an amino acid sequence described in the sequence number 2 or (b) an amino acid sequence described in the sequence number 2 in which one or a plurality of amino acids are deleted, substituted or added in an amino acid sequence part composed of 1-573 amino acids and/or an amino acid sequence part composed of 792-837 amino acids. <P>COPYRIGHT: (C)2006,JPO&NCIPI

Description

  The present invention relates to a thermostable or thermoactive DNA polymerase and the DNA encoding it.

  A DNA polymerase capable of synthesizing a DNA strand consisting of a complementary base sequence according to the base sequence of the template DNA includes PCR (polymerase chain reaction), DNA base sequence determination, site-specific mutagenesis, etc. It is routinely used as an indispensable reagent for genetic manipulation experiments such as the first. The contribution of this enzyme that has been made for the development of molecular medicine, molecular biology and biochemistry is immeasurable.

To date, many types of DNA polymerases are on the market, but the physicochemical properties of each enzyme, such as thermal stability, ability to extend synthetic strands, ability to calibrate missynthesis, and preference for template DNA are different. , Depending on the purpose of the experiment.
For example, the use of thermostable or thermoactive DNA polymerase is essential for PCR. Since the thermostable or thermoactive DNA polymerase is not inactivated when the double-stranded DNA is denatured, it is possible to save the trouble of adding an enzyme. In addition, by performing a DNA strand elongation reaction at high temperature using thermostable or thermoactive DNA polymerase, non-specific annealing of primers, intramolecular higher-order structure of single-stranded DNA (eg hairpin loop, etc.) And the like, and the intended extension reaction can be efficiently advanced.

Examples of the thermostable or thermoactive DNA polymerase include DNA polymerase (Taq DNA polymerase) derived from Thermus aquaticus (see Patent Documents 1, 2, and 3), Thermotoga maritima (Thermotoga maritima). A DNA polymerase (Tma DNA polymerase) (see Patent Documents 4 and 5) is known.
U.S. Pat. No. 4,889,818 US Pat. No. 5,352,600 US Pat. No. 5,079,352 US Pat. No. 5,374,553 US Pat. No. 5,420,029

An object of the present invention is to provide a novel thermostable or thermoactive DNA polymerase, DNA encoding the DNA polymerase, a recombinant vector containing the DNA, and a transformant containing the recombinant vector.
Another object of the present invention is to provide a PCR kit containing a novel thermostable or thermoactive DNA polymerase.

In order to achieve the above object, the present invention provides the following inventions.
(1) A thermostable or thermoactive DNA polymerase comprising the amino acid sequence shown in the following (a) or (b).
(A) in the amino acid sequence described in SEQ ID NO: 2 (b) in the amino acid sequence described in SEQ ID NO: 2, in the amino acid sequence portion consisting of amino acids 1 to 573 and / or in the amino acid sequence portion consisting of amino acids 792 to 837, Amino acid sequence in which one or more amino acids have been deleted, substituted or added (2) DNA encoding the thermostable or thermoactive DNA polymerase described in (1) above.
(3) The DNA according to (2) above, which contains the DNA shown in (c) or (d) below.
(C) DNA comprising the nucleotide sequence set forth in SEQ ID NO: 1
(D) DNA that hybridizes under stringent conditions to DNA complementary to the DNA shown in (c) above and encodes a thermostable or thermoactive DNA polymerase
(4) A recombinant vector comprising the DNA according to (2) or (3).
(5) A transformant comprising the recombinant vector according to (4).
(6) A PCR kit comprising the thermostable or thermoactive DNA polymerase according to (1).

According to the present invention, there are provided a novel thermostable or thermoactive DNA polymerase, DNA encoding the DNA polymerase, a recombinant vector containing the DNA, and a transformant containing the recombinant vector. The present invention also provides a PCR kit containing a novel thermostable or thermoactive DNA polymerase.
Since the thermostable or thermoactive DNA polymerase of the present invention has superior DNA polymerase activity (primer extension activity) compared to Taq DNA polymerase, it is useful when performing PCR.

Hereinafter, the present invention will be described in detail.
The thermostable or thermoactive DNA polymerase of the present invention consists of an amino acid sequence shown in the following (a) or (b).
(A) in the amino acid sequence described in SEQ ID NO: 2 (b) in the amino acid sequence described in SEQ ID NO: 2, in the amino acid sequence portion consisting of amino acids 1 to 573 and / or in the amino acid sequence portion consisting of amino acids 792 to 837, Amino acid sequence in which one or more amino acids are deleted, substituted or added

  Hereinafter, the thermostable or thermoactive DNA polymerase comprising the amino acid sequence (a) is referred to as “DNA polymerase (a)”, and the thermostable or thermoactive DNA polymerase comprising the amino acid sequence (b) is referred to as “DNA polymerase (b)”. "

  In the present invention, the term “thermostable DNA polymerase” refers to heat-stable, heat-resistant, and after being placed under a temperature necessary for denaturation of double-stranded DNA (for example, 80 to 105 ° C.) The term “thermoactive DNA polymerase” refers to an enzyme that retains DNA polymerase activity. Specific annealing (specific priming) of primers to single-stranded DNA caused by denaturation of double-stranded DNA and primer extension Means an enzyme capable of exhibiting DNA polymerase activity at a temperature necessary for ensuring the above (for example, 55 to 80 ° C.). In addition, “specific annealing of primer to single-stranded DNA” means that the primer anneals to a target region in single-stranded DNA, and “DNA polymerase activity” means an appropriate deoxyribonucleoside. It means catalytic action to synthesize DNA complementary to template DNA (primer extension product) using triphosphate as a substrate.

  The DNA polymerase activity can be expressed by, for example, the primer extension activity (kb / min / U) per unit of enzyme, and the primer extension activity at 74 ° C. of DNA polymerase (a) is the primer at 74 ° C. of Taq DNA polymerase. About 11 times the elongation activity (see Examples). The primer extension activity at 74 ° C. of DNA polymerase (b) is considered to change depending on the total number and position of amino acids to be deleted, substituted or added, but 2 of the primer extension activity at 74 ° C. of Taq DNA polymerase. It is preferably at least twice, more preferably at least 5 times. Taq DNA polymerase is a DNA polymerase derived from Thermus aquaticus, the amino acid sequence thereof is shown in SEQ ID NO: 4, and the base sequence of the DNA encoding it is shown in SEQ ID NO: 3.

  DNA polymerase (b) consists of an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 2. In the amino acid sequence described in SEQ ID NO: 2, one or more amino acids are deleted, substituted or added, the amino acid sequence consisting of the 1st to 573rd amino acids in the amino acid sequence described in SEQ ID NO: 2 and / or This is an amino acid sequence portion consisting of amino acids 792 to 837. Of the amino acid sequence set forth in SEQ ID NO: 2, the total number of amino acids deleted, substituted or added to the amino acid sequence portion consisting of amino acids 1 to 573 and / or the amino acid sequence portion consisting of amino acids 792 to 837 and The position is not particularly limited. The total number of amino acids to be deleted, substituted or added is 1 or more, preferably 1 or several, and the specific range thereof is usually 1 to 10, preferably 1 to 5 for deletion, More preferably, the number is 1 to 2, the substitution is usually 1 to 10, preferably 1 to 5, more preferably 1 to 2, and the addition is usually 1 to 10, preferably 1 to 5. The number is more preferably 1-2. Mutations such as deletion, substitution, addition and the like may be added to only one of the amino acid sequence portion consisting of amino acids 1 to 573 and the amino acid sequence portion consisting of amino acids 792 to 837. , May be added for both.

  DNA polymerases (a) and (b) may be either proteins with added sugar chains or proteins without added sugar chains. The type, position, etc. of the sugar chain added to the protein vary depending on the type of host cell used in the production of the protein, but any host cell can be used for the protein with the added sugar chain. Protein is also included. Further, the DNA polymerases (a) and (b) may be their salts.

  A portion consisting of amino acids 574 to 791 in the amino acid sequence of DNA polymerase (a) (SEQ ID NO: 2) and a portion corresponding to the above portion of the amino acid sequence of Taq DNA polymerase (SEQ ID NO: 4) (SEQ ID NO: 4) FIG. 11 shows the alignment results with the portion consisting of the 574th to 786th amino acids.

  The difference between the amino acid sequence of DNA polymerase (a) and the amino acid sequence of Taq DNA polymerase is that the amino acid sequence consisting of amino acids 574 to 786 in the amino acid sequence of Taq DNA polymerase (SEQ ID NO: 4) is The amino acid sequence derived from the microorganism contained in the amino acid sequence (amino acid sequence consisting of amino acids 574 to 791 of the amino acid sequence described in SEQ ID NO: 2). The difference between the 792nd amino acid (isoleucine) in the amino acid sequence of DNA polymerase (a) (SEQ ID NO: 2) and the 787th amino acid (leucine) in the amino acid sequence of Taq DNA polymerase (SEQ ID NO: 4), and The difference between the 793rd amino acid (leucine) in the amino acid sequence of DNA polymerase (a) (SEQ ID NO: 2) and the 788th amino acid (valine) in the amino acid sequence of SEQ ID NO: 4 (SEQ ID NO: 4) is Taq DNA This occurred when the restriction enzyme site BglII was introduced to replace the amino acid sequence of the polymerase (see Examples).

  DNA encoding DNA polymerase (a) or (b) can be obtained by chemical synthesis according to its base sequence. For the chemical synthesis of DNA, a commercially available DNA synthesizer, for example, a DNA synthesizer using a thiophosphite method (manufactured by Shimadzu Corporation) or a DNA synthesizer using a phosphoramidite method (manufactured by Perkin Elmer) is used. Can be done.

  In addition, DNA encoding DNA polymerase (a) or (b) is artificially mutated to DNA (SEQ ID NO: 3) encoding Taq DNA polymerase using a known method such as site-directed mutagenesis. It can be obtained by introduction. Mutation can be introduced, for example, using a mutation introduction kit such as Mutant-K (TAKARA), Mutant-G (TAKARA), or TAKARA LA PCR in vitro Mutagenesis series kit.

  DNA encoding Taq DNA polymerase is prepared using a probe synthesized based on the nucleotide sequence described in SEQ ID NO: 3, for example, by preparing a cDNA library using mRNA extracted from Thermus aquaticus, It can be obtained by screening a clone containing the DNA of interest from a cDNA library.

  The DNA encoding DNA polymerase (a) or (b) contains an open reading frame and a stop codon located at its 3 ′ end. Further, the DNA encoding DNA polymerase (a) or (b) can contain an untranslated region (UTR) at the 5 ′ end and / or the 3 ′ end of the open reading frame.

  Examples of the DNA encoding the DNA polymerase (a) include DNA containing DNA consisting of the base sequence described in SEQ ID NO: 1. Here, among the base sequence described in SEQ ID NO: 1, the open reading frame is located at the base sequence consisting of the 1st to 2511th bases, the translation start codon is the 1st to 3rd bases, and the stop codon is the base sequence consisting of the 2512st to 2514th bases. The base sequence of DNA encoding DNA polymerase (a) is not particularly limited as long as it encodes DNA polymerase (a), and the base sequence of the open reading frame is 1 in the base sequence described in SEQ ID NO: 1. It is not limited to the base sequence consisting of the ˜2511th base.

  Examples of the DNA encoding the DNA polymerase (b) include DNA containing DNA that hybridizes under stringent conditions to DNA complementary to the DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 1.

  Examples of “stringent conditions” include conditions of 42 ° C., 2 × SSC and 0.1% SDS, preferably 65 ° C., 0.1 × SSC and 0.1% SDS.

  The DNA that hybridizes under stringent conditions to DNA complementary to the DNA consisting of the base sequence described in SEQ ID NO: 1 is at least 88% or more, preferably 90% or higher, with the DNA consisting of the base sequence described in SEQ ID NO: 1. More preferred is DNA having a homology of 95% or more.

The DNA polymerases (a) and (b) can be produced, for example, by expressing DNA encoding each in a host cell according to the following steps.
[Production of recombinant vector and transformant]
When preparing a recombinant vector, first, a DNA fragment of an appropriate length containing the coding region of the target protein is prepared. In the base sequence of the coding region of the target protein, the base may be substituted so as to be an optimal codon for expression in the host cell.

  Next, the above DNA fragment is inserted downstream of the promoter of an appropriate expression vector to prepare a recombinant vector. The DNA fragment needs to be incorporated into a vector so that its function is exhibited. The vector is not only a promoter but also a cis element such as an enhancer, a splicing signal, a poly A addition signal, a selection marker (for example, dihydro A folate reductase gene, an ampicillin resistance gene, a neomycin resistance gene), a ribosome binding sequence (SD sequence), and the like.

A transformant capable of producing the target protein can be obtained by introducing a recombinant vector into an appropriate host cell.
The expression vector is not particularly limited as long as it can replicate autonomously in a host cell, and for example, a plasmid vector, a phage vector, a virus vector and the like can be used. Examples of plasmid vectors include plasmids derived from E. coli (eg, pRSET, pBR322, pBR325, pUC118, pUC119, pUC18, pUC19), plasmids derived from Bacillus subtilis (eg, pUB110, pTP5), and plasmids derived from yeast (eg, YEp13 YEp24, YCp50) can be used, and as phage vectors, for example, λ phages (for example, Charon4A, Charon21A, EMBL3, EMBL4, λgt10, λgt11, λZAP) and the like can be used. For example, animal viruses such as retroviruses and vaccinia viruses, and insect viruses such as baculoviruses can be used.

  As a host cell, any of prokaryotic cells, yeast, animal cells, insect cells, plant cells and the like may be used as long as the DNA encoding the target protein can be expressed. Moreover, you may use an animal individual, a plant individual, a silkworm body, etc.

When a bacterium is used as a host cell, for example, Escherichia such as Escherichia coli, Bacillus subtilis such as Bacillus subtilis, Pseudomonas putida such as Pseudomonas putida, Rhizobium meriroti ( Rhizobium meliloti) and other bacteria belonging to the genus Rhizobium can be used as host cells. Specifically, Escherichia coli BL21, Escherichia coli XL1-Blue, Escherichia coli XL2-Blue, Escherichia coli DH1, Escherichia coli K12, Escherichia coli JM109, Escherichia coli HB101, etc., Bacillus subtilis MI 114, Bacillus subtilis 207-21 Bacillus subtilis such as can be used as a host cell. The promoter of the case is not particularly limited as long as it can be expressed in bacteria such as Escherichia coli, for example, using a promoter derived from the trp promoter, lac promoter, P _L promoter, P _R promoter of Escherichia coli or phage, etc. can do. In addition, artificially designed and modified promoters such as tac promoter, lacT7 promoter, and let I promoter can also be used.

  The method for introducing a recombinant vector into bacteria is not particularly limited as long as it is a method capable of introducing DNA into bacteria. For example, a method using calcium ions, an electroporation method, or the like can be used.

  When yeast is used as a host cell, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris, and the like can be used as host cells. The promoter in this case is not particularly limited as long as it can be expressed in yeast. For example, gal1 promoter, gal10 promoter, heat shock protein promoter, MFα1 promoter, PHO5 promoter, PGK promoter, GAP promoter, ADH promoter, AOX1 promoter Etc. can be used.

  The method for introducing a recombinant vector into yeast is not particularly limited as long as it is a method capable of introducing DNA into yeast. For example, an electroporation method, a spheroplast method, a lithium acetate method, or the like can be used.

  When animal cells are used as host cells, monkey cells COS-7, Vero, Chinese hamster ovary cells (CHO cells), mouse L cells, rat GH3, human FL cells, and the like can be used as host cells. The promoter in this case is not particularly limited as long as it can be expressed in animal cells. For example, SRα promoter, SV40 promoter, LTR (Long Terminal Repeat) promoter, CMV promoter, human cytomegalovirus early gene promoter, etc. Can be used.

  The method for introducing the recombinant vector into the animal cell is not particularly limited as long as it can introduce DNA into the animal cell. For example, an electroporation method, a calcium phosphate method, a lipofection method, or the like can be used.

When insect cells are used as hosts, Spodoptera frugiperda ovary cells, Trichoplusia ni ovary cells, cultured cells derived from silkworm ovary, etc. can be used as host cells. Spodoptera frugiperda ovarian cells such as Sf9 and Sf21, Trichoplusia ni ovarian cells such as High 5, BTI-TN-5B1-4 (manufactured by Invitrogen), and silkworm ovary-derived cultured cells such as Bombyx mori N4 can do.
The method for introducing a recombinant vector into insect cells is not particularly limited as long as DNA can be introduced into insect cells, and for example, calcium phosphate method, lipofection method, electroporation method and the like can be used.

[Culture of transformants]
A transformant into which a recombinant vector incorporating a DNA encoding the target protein has been introduced is cultured. The transformant can be cultured according to a usual method used for culturing host cells.

  As a medium for cultivating transformants obtained by using microorganisms such as E. coli and yeast as host cells, the medium contains a carbon source, nitrogen source, inorganic salts, etc. that can be assimilated by the microorganisms, so that transformants can be cultured efficiently. As long as it is a medium that can be used, any of natural and synthetic media may be used.

  As the carbon source, carbohydrates such as glucose, fructose, sucrose, and starch, organic acids such as acetic acid and propionic acid, and alcohols such as ethanol and propanol can be used. As the nitrogen source, use ammonium salt of inorganic acid or organic acid such as ammonia, ammonium chloride, ammonium sulfate, ammonium acetate, ammonium phosphate, peptone, meat extract, yeast extract, corn steep liquor, casein hydrolyzate, etc. Can do. As the inorganic salt, monopotassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, copper sulfate, calcium carbonate and the like can be used.

  Culture of transformants obtained using microorganisms such as Escherichia coli and yeast as host cells can be performed under aerobic conditions such as shaking culture or aeration and agitation culture. The culture temperature is usually 25 to 37 ° C., the culture time is usually 12 to 48 hours, and the pH is usually maintained at 6 to 8 during the culture period. The pH can be adjusted using an inorganic acid, an organic acid, an alkaline solution, urea, calcium carbonate, ammonia or the like. When culturing, an antibiotic such as ampicillin or tetracycline may be added to the medium as necessary.

  When culturing a microorganism transformed with an expression vector using an inducible promoter as a promoter, an inducer may be added to the medium as necessary. For example, isopropyl-β-D-thiogalactopyranoside is used when cultivating a microorganism transformed with an expression vector using the lac promoter, and indole acrylic is used when a microorganism transformed with an expression vector using the trp promoter is cultured. An acid or the like may be added to the medium.

As a medium for culturing a transformant obtained by using animal cells as host cells, generally used RPMI1640 medium, Eagle's MEM medium, DMEM medium, Ham F12 medium, Ham F12K medium, fetal bovine serum, etc. Can be used. The transformant is usually cultured at 37 ° C. for 3 to 10 days in the presence of 5% CO ₂ . When culturing, antibiotics such as kanamycin, penicillin, streptomycin and the like may be added to the medium as necessary.

  As a medium for culturing a transformant obtained by using insect cells as host cells, commonly used TNM-FH medium (Pharmingen), Sf-900 II SFM medium (Gibco BRL), ExCell400 ExCell405 (manufactured by JRH Biosciences) or the like can be used. The transformant is usually cultured at 27 ° C. for 3 to 10 days. When culturing, an antibiotic such as gentamicin may be added to the medium as necessary.

  The protein of interest may be expressed as a secreted protein or a fusion protein. Examples of proteins to be fused include β-galactosidase, protein A, IgG binding region of protein A, chloramphenicol acetyltransferase, poly (Arg), poly (Glu), protein G, maltose binding protein, glutathione S- A transferase, a polyhistidine chain (His-tag), an S peptide, a DNA-binding protein domain, a Tac antigen, thioredoxin, green fluorescent protein, and the like can be used.

[Isolation and purification of protein]
The target protein is obtained by collecting the target protein from the culture of the transformant. Here, the “culture” includes any of culture supernatant, cultured cells, cultured cells, cells or disrupted cells.

  If the target protein accumulates in the cells of the transformant, the culture is centrifuged to collect the cells in the culture, wash the cells, disrupt the cells, Extract the protein to be used. When the target protein is secreted outside the transformant, the culture supernatant is used as it is, or cells or cells are removed from the culture supernatant by centrifugation or the like.

  The obtained protein was extracted using a solvent extraction method, a salting-out method using ammonium sulfate, a desalting method, a precipitation method using an organic solvent, diethylaminoethyl (DEAE) -sepharose, an ion exchange chromatography method, a hydrophobic chromatography method, a gel filtration method, It can be purified by affinity chromatography or the like.

  DNA polymerases (a) and (b) can be produced by chemical synthesis methods such as Fmoc method (fluorenylmethyloxycarbonyl method) and tBoc method (t-butyloxycarbonyl method) based on the amino acid sequence. it can. At this time, a commercially available peptide synthesizer can be used.

  DNA polymerases (a) and (b) are useful when performing PCR and can be used as components of PCR kits. In addition to DNA polymerase (a) or (b), the PCR kit can contain reagents, containers, devices and the like necessary for performing PCR.

[Example 1] Acquisition of genomic DNA derived from microorganisms contained in high-temperature environmental soil (1) Collection of high-temperature environmental soil In order to effectively use DNA polymerase, it must have heat resistance that can be used for PCR and the like. Is considered important. In order to obtain a thermostable enzyme, it is most efficient to obtain a sample from a high temperature environment. Therefore, hot spring zones with different properties (pH) were selected as the high temperature environment. One is the Kyushu Kagoshima Kirishima hot spring area which shows strong acidity, and the other is the Miyagi prefecture Onikobe hot spring area and Akita prefecture Daifoyu hot spring area which show a pH close to neutrality.

  There are a number of mud pots (holes in which mud is simmered) in a natural state (a state where human hands cannot enter) in a specific area within the hot spring area. From these points, the color, moisture content, and other conditions of the sample collected along with data such as temperature and pH were recorded for each sampling point by video. About 100 g of soil, mud or sediment was collected from each point so that a sufficient amount of DNA could be recovered.

(2) Extraction of genomic DNA from high-temperature environmental soil After 1 g of collected soil was dispensed into a sterilized Eppendorf tube, genomic DNA derived from microorganisms contained in the soil was extracted. Extraction of genomic DNA from soil was performed using an Ultra Clean ^™ Soil DNA Purification kit (manufactured by MO Bio, catalog No. 12800-50, Funakoshi catalog No. LM128000), which is a DNA extraction kit from soil. The operation followed the operation procedure attached to this kit.
2 μL, which is 1/50 of the actually extracted DNA solution, is collected, 18 μL of TAE buffer (0.04 M Tris, 0.02 M acetic acid, 0.001 M EDTA (pH 8.0)) and 2 μL of electrophoresis Concentrated staining solution (0.25% bromophenol blue, 0.25% xylene cyanol, 30% glycerol) was added and confirmed by 0.8% agarose gel electrophoresis.

  As a result, as shown in FIG. 1, it was confirmed that genomic DNA having a length of 10 kilobase pairs or more was recovered from several points although the amount was somewhat. In FIG. 1, “M” represents a molecular weight marker, and lanes 1 to 38 represent results regarding different points. From this result, it was confirmed that there was a sufficient amount of microorganisms capable of extracting a sufficient amount of genomic DNA in the high-temperature environment soil.

[Example 2] PCR using primers specific to family A DNA polymerase
(1) Design of family A type DNA polymerase-specific primers The results are shown in accordance with the alignment of amino acid sequences of family A type DNA polymerases derived from multiple microorganisms (Bacillus subtilis, Bacillus caldotenax, Thermus aquaticus, Themus thermophilus, Escherichia coli). 2 and FIG. 3 is a continuation of FIG.

  In FIG. 2 and FIG. 3, the two regions surrounded by a square (DPNLQNIP and QVHDELX (X represents I, V or L)) are amino acid sequences having high homology among a plurality of microorganisms. This amino acid sequence is presumed to be conserved in the family A type DNA polymerase possessed by other microorganisms.

  Therefore, based on the amino acid sequence, two types of degenerate primers (Takashi Uemori, Yoshizumi Ishino, Kayo Fujita) shown in Table 1 (5 ′ primer (SEQ ID NO: 5) and 3 ′ primer (SEQ ID NO: 6)) were designed. , Kiyozo Asada and Ikunoshin Kato “Cloning of the DNA Polymerase Gene of Bacillus caldotenax and Characterization of the Gene Product” (1993) J. Biocem., 113, 401-410.).

  "Y" is t or c, "s" is c or g, "k" is g or t, "r" is a or g, "h" is a or t or c, “n” represents a or g or c or t.

(2) PCR using family A type DNA polymerase specific primers
Genomic DNA extracted from 10 kinds of microorganisms (Bacillus caldotenax, Bacillus caldolyticus, Escherichia coli, Bacillus subtilis, Lactobacillus bulgaricus, Lactobacillus homohiochii, Lactobacillus heterohiochii, Thermus aquaticus, Themus thermophilus, Sulfolobus solfataricus) PCR was performed in a solution containing 50 μL of 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 15 mM MgCl ₂ , 200 μM dNTP and 5 units TAKARA Ex Taq polymerase (manufactured by Takara Bio Inc.) using 100 pmol of the primer. In PCR, 30 temperature cycles comprising 94 ° C. for 30 seconds, 55 ° C. for 1 minute, and 72 ° C. for 2 minutes were performed.

  As a result, as shown in FIG. 4, PCR amplified fragments presumed to be derived from family A type DNA polymerase were obtained in all 10 types of microorganisms. In FIG. 4, “M” represents a molecular weight marker, lane 2 is Bacillus caldotenax, lane 3 is Bacillus caldolyticus, lane 4 is Escherichia coli, lane 5 is Bacillus subtilis, lane 6 is Lactobacillus bulgaricus, lane 7 is Lactobacillus homohiochii. Lane 8 is a result of Lactobacillus heterohiochii, Lane 9 is a Thermus aquaticus, Lane 10 is a Themus thermophilus, and Lane 11 is a result of Sulfolobus solfataricus.

  From this result, it was revealed that the degenerate primer can be used as a primer for a family A DNA polymerase gene derived from any microorganism.

Next, in the presence of 1/50 (1 μL) of the total recovery amount of genomic DNA recovered from high-temperature environmental soil such as the Kirishima hot spring area and Onikobe hot spring area, 50 μL of 10 mM Tris- PCR was performed in a solution containing HCl (pH 8.3), 50 mM KCl, 15 mM MgCl ₂ , 200 μM dNTP and 5 units TAKARA EX Taq polymerase (manufactured by Takara Bio Inc.). In PCR, 30 cycles of a temperature cycle of 94 ° C. for 30 seconds, 55 ° C. for 1 minute, and 72 ° C. for 2 minutes were performed.

  As a result, as shown in FIG. 5, when genomic DNA collected from several points was used as a template, a DNA fragment presumed to be derived from the family A type DNA polymerase was amplified. When the length of the DNA fragment almost coincided with the prediction, the DNA fragment was presumed to be a DNA fragment derived from a family A type DNA polymerase. In FIG. 5, “M” represents a molecular weight marker, and lanes 1 to 29 represent results regarding different points.

(3) Cloning of amplified fragments After adding equal amounts of 10 mM Tris-HCl (pH 7.5) and 1 mM EDTA solution to the reaction solution after completion of PCR, an equal amount of water-saturated phenol / chloroform solution may be added to the aqueous solution. The mixture was stirred and heated at 70 ° C. for 10 minutes, then centrifuged at 10,000 rpm for 5 minutes, and the upper aqueous solution fraction was carefully collected. The collected aqueous solution fraction was added to Microcon 100 (Millipore) and centrifuged at 2500 rpm for 15 minutes. Again, 200 μL of 10 mM Tris-HCl (pH 7.5) and 1 mM EDTA solution was added and centrifuged at 2500 rpm for 15 minutes. By the above operation, unreacted primers, nucleotides, salts and the like were removed.

  About 0.05 μg of PCR amplified fragment, 0.1 μg of pGEM T-vector (Promega) dissolved in 10 mM Tris-HCl (pH 7.5) and 1 mM EDTA solution, and 10 mM Tris-HCl (pH 7.5) / 1 mM After mixing with 8 μL of EDTA solution, 10 μL of Ligation Kit Version 2 (Takara Bio Inc.) was added and incubated at 16 ° C. for 30 minutes to ligate the PCR amplified fragment to plasmid DNA. 1 μL of plasmid DNA ligated with the PCR amplified fragment was added to 50 μL of calcium-treated E. coli DH10B dissolved in ice, allowed to stand on ice for 20 minutes, heated at 42 ° C. for 2 minutes, and then 950 μL of liquid LB medium ( 10 g tryptone per liter, 5 g yeast extract, 5 g sodium chloride and 1 g glucose) was added, followed by shaking culture at 37 ° C. for 60 minutes. 150 μL of the culture after shaking culture was inoculated on an LB agar medium containing 100 μg / mL ampicillin and cultured overnight at 37 ° C.

(4) Decoding the base sequence of PCR amplified fragment The colonies of E. coli amplified on an agar medium were inoculated into an LB medium containing about 2 mL of 100 μg / mL ampicillin and cultured overnight at 37 ° C. with shaking. The grown cells were collected by centrifugation at 10,000 rpm for 10 minutes, and the plasmid DNA was recovered using QIAprep Spin Miniprep Kit (manufactured by QIAGEN, catalog No. 27104). PCR was performed using the collected plasmid DNA as a template and primers for base sequence decoding (M13 primer M4 and T promoter primer). For PCR, a dye terminator cycle sequencing kit (manufactured by ABI) was used, and for decoding of the base sequence, an ABI 3700 automatic base sequence detector was used.

(5) Determination of the amino acid sequence encoded by the PCR amplified fragment Since the determined base sequence of the PCR amplified fragment may contain a mechanical error, the base sequence was manually corrected to eliminate the mechanical error. Thereafter, the amino acid sequence encoded by the base sequence was determined. Homology search using public protein database, comparing amino acid sequence encoded by PCR amplified fragment with amino acid sequence of known family A type DNA polymerase (Thermus aquaticus-derived DNA polymerase (Taq DNA polymerase)) Went.

  As a result, as shown in FIG. 6, it was confirmed that the amino acid sequence encoded by the PCR amplified fragment includes the amino acid sequence of the functional domain of the family A type DNA polymerase.

  In FIG. 6, “Taq” represents the amino acid sequence of Taq DNA polymerase, and “No. 1”, “No. 2” and “No. 3” were obtained using genomic DNA recovered from different points as templates. The amino acid sequences encoded by the PCR amplified fragments represent 90%, 57% and 52% homology with the amino acid sequence of Taq DNA polymerase, respectively. In addition, the amino acid sequences relating to “No. 1”, “No. 2”, and “No. 3” show only amino acid sequences that differ from Taq DNA polymerase.

  In addition, as shown in Table 2, the amino acid sequences encoded by PCR amplified fragments obtained using genomic DNA recovered from different points (a to g) as templates are family A type DNA polymerases derived from different microorganisms, respectively. It was confirmed that a number of unknown family A-type DNA polymerases exist in a high-temperature environment.

[Example 3] Construction of plasmid having DNA encoding modified DNA polymerase (1) Design of primer for introducing restriction enzyme site PCR amplified fragment obtained in Example 2 bears the center of DNA polymerase activity Since the region covers the region, among the amino acid sequence of Taq DNA polymerase (SEQ ID NO: 4), the region showing homology with the amino acid sequence encoded by the PCR amplified fragment is the amino acid sequence encoded by the PCR amplified fragment. The substituted modified DNA polymerase is believed to exhibit DNA polymerase activity that is different from Taq DNA polymerase and may exhibit improved DNA polymerase activity. In addition, the function of the modified DNA polymerase is considered to reflect the function of an unknown family A type DNA polymerase present in high-temperature soil.

  Therefore, in order to introduce restriction enzyme sites (BlpI site and BglII site) outside the region to be replaced with the PCR amplified fragment of DNA encoding Taq DNA polymerase (SEQ ID NO: 3), two types shown in Table 3 are used. Primer A (SEQ ID NO: 7) and Primer B (SEQ ID NO: 8) were designed. Primer A is designed so that a BlpI recognition sequence can be introduced as a new restriction enzyme site without affecting the amino acid sequence of Taq DNA polymerase. Primer B is designed so that a BglII recognition sequence can be introduced as a new restriction enzyme site. When BglII recognition sequence is introduced by primer B, the amino acid residue Leu at the 787th position of Taq DNA polymerase is similar to that. The 788th amino acid residue Val is substituted with the amino acid residue Leu having similar properties to the amino acid residue Ile having the same properties.

  On the other hand, in order to introduce restriction enzyme sites (BlpI site and BglII site) outside the PCR amplified fragment, two types of primer C (SEQ ID NO: 9) and primer D (SEQ ID NO: 10) shown in Table 3 were designed. Primer C is designed so that a BlpI recognition sequence can be introduced as a new restriction enzyme site without affecting the amino acid sequence of Taq DNA polymerase. Although it is designed so that a BglII recognition sequence can be introduced as a new restriction enzyme site, when the BglII recognition sequence is introduced by the primer D, the amino acid residue Leu at the 787th position of Taq DNA polymerase is an amino acid having similar properties. In residue Ile, the 788th amino acid residue Val is replaced with an amino acid residue Leu having similar properties.

  In Table 3, the single underlined portion represents a newly introduced BlpI site, and the double underlined portion represents a newly introduced BglII site.

(2) PCR using restriction site introduction primer
A DNA encoding Taq DNA polymerase (SEQ ID NO: 3) was cloned into the plasmid vector pTV1N (Takara Bio Inc.). (Ishino Y, Ueno T, Miyagi M, Uemori T, Imamura M, Tsunasawa S, Kato I. “Overproduction of Thermus aquaticus DNA polymerase and its structural analysis by ion-spray mass spectrometry” (1994) J Biochem (Tokyo), 116 (Refered to (5), 1019-24). The presence of 10 ng, using primers A and B 2pmol, 10mM Tris-HCl ( pH8.3) of 50 [mu] L, containing _{50mM KCl, 15mM MgCl 2, 200μM} dNTP and 2.5 units PfuUltra DNA polymerase (Stratagene, Inc.) PCR was performed in solution. PCR was carried out 20 cycles of 95 ° C for 1 minute, 55 ° C for 1 minute, 72 ° C for 15 minutes.

Next, in the presence of 10 ng of the plasmid clone obtained in Example 2, 50 μL of 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 15 mM MgCl ₂ , 200 μM dNTP and 2. PCR was performed in a solution containing 5 units PfuUltra DNA polymerase (Stratagene). In PCR, 30 cycles of a temperature cycle of 95 ° C. for 1 minute, 55 ° C. for 1 minute, and 72 ° C. for 2 minutes were performed.

(3) Restriction enzyme treatment of PCR amplified fragment The PCR amplified fragment was cleaved with restriction enzymes BlpI and BglII. That is, 50 μL of each PCR amplification reaction solution was mixed with a buffer solution for 10-fold concentrated restriction enzyme (200 mM Tris-HCl (pH 8.2), 100 mM MgCl ₂ , 600 mM NaCl, 10 mM DTT) 5 μL, sterile distilled water 42 μL and restriction enzyme BlpI 3 μL. In addition, after mixing well, the mixture was kept at 37 ° C. for 3 hours. Next, 4 μL of 5 M NaCl solution and 3 μL of restriction enzyme BglII were added and mixed well, and then incubated at 60 ° C. for 3 hours. After the incubation, 10 μL of 10 mM EDTA and 2% SDS solution were added to stop the reaction.

Each DNA fragment cleaved by 0.8% agarose gel electrophoresis was separated, and then each DNA fragment was collected and purified using QuiaQuickTip manufactured by QUIAGEN.
(4) Ligation of DNA fragments treated with restriction enzymes 0.5 μg (1 μL) of each recovered and purified DNA fragment was mixed on ice, added with 3 μL of 10 mM Tris-HCl (pH 7.5) and 1 mM EDTA solution, and Takara After adding 5 μL of Takara Ligation Kit version 2 manufactured by Bio Inc. and mixing well, the mixture was incubated at 16 ° C. for 1 hour.

(5) Introduction into E. coli 1 μL of the ligation reaction solution was mixed with 20 μL of calcium-treated E. coli JM109 cell solution on ice, allowed to stand for 30 minutes, and after heat treatment at 42 ° C. for 30 seconds, 980 μL of LB liquid medium was added, The shaking culture was performed at 37 ° C. for 60 minutes. Subsequently, 100 μL was collected and uniformly inoculated on an agar LB medium containing 100 μg / mL ampicillin, and then kept at 37 ° C. overnight.

(6) Confirmation of recombination Among the E. coli inoculated on the agar medium, only those having plasmid DNA grew on the agar medium to form colonies. Of the colonies formed, 10 were selected at random, inoculated into 2 mL of LB liquid medium, shaken overnight at 37 ° C., and then subjected to QIAGEN QIAprep Spin Miniprep Kit (Catalog No. 27104). Used to recover plasmid DNA. The recovered plasmid DNA was treated with BlpI and BglII, and the BlpI / BglII fragment was excised. As a result, as shown in FIG. 7, an expression plasmid expected to have a PCR-amplified fragment incorporated into a plasmid containing DNA encoding Taq DNA polymerase, that is, having DNA encoding modified DNA polymerase. It was confirmed that it was constructed. In FIG. 7, “M” represents a marker, and lanes 1 and 2 show the results relating to the recombinant plasmid into which PCR amplified fragments obtained using genomic DNAs collected from different points as templates were incorporated.

(7) Determination of the base sequence of the PCR amplified fragment Of the DNA encoding the modified DNA polymerase shown in lane 1 of FIG. 7, the base sequence of the PCR amplified fragment was determined as follows.
Using the recombinant plasmid as a template, a cycle dideoxy reaction was performed using CQE Dye terminator cycle sequencing with quick start kit manufactured by Beckman Coulter. At this time, 5′-tccaccccaggacgggccgcctccac-3 ′ was used as the 5′-side primer, and 5′-cccctccatgacctccttggccagcc-3 ′ was used as the 3′-side primer. Using 300 ng of template DNA and 5 pmol of primer, 30 cycles of reaction were performed with 96 ° C. for 20 seconds, 50 ° C. for 20 seconds, and 60 ° C. for 4 minutes. Unreacted substrate was removed by passing the reaction solution through a Sephadex G-50 column. After the reaction solution was dried and dissolved in 40 μL of electrophoresis solution, the base sequence was determined by CEQ 2000XL DNA Analysis System of Beckman Coulter.

  The base sequence of the DNA encoding the modified DNA polymerase shown in lane 1 of FIG. 7 is shown in SEQ ID NO: 1, and the amino acid sequence of the modified DNA polymerase deduced from this base sequence (SEQ ID NO: 1) is shown in SEQ ID NO: 2. From this amino acid sequence, the recombined part was predicted to be part of the DNA polymerase gene. Of the nucleotide sequence set forth in SEQ ID NO: 2, the amino acid sequence portion consisting of amino acid residues 1 to 573 and the amino acid sequence portion consisting of amino acid residues 792 to 837 are derived from Taq DNA polymerase and 574 to 791. The amino acid sequence portion consisting of the second amino acid residue is derived from a PCR amplified fragment incorporated in Taq DNA polymerase.

[Example 4] Production and functional analysis of modified DNA polymerase (1) Introduction of recombinant plasmid into E. coli for expression Expression plasmid for expression (pTV-Taq26-) having DNA encoding the modified DNA polymerase shown in lane 1 of FIG. 35) was transformed into E. coli strain JM109.
E. coli JM109 competent cells were thawed and transferred to a falcon tube by 0.1 mL each. A solution corresponding to 10 ng of the plasmid for expression was added thereto, and the solution was left on ice for 30 minutes, followed by heat shock at 42 ° C. for 30 seconds, 0.9 mL of SOC medium was added thereto, and shaken at 37 ° C. for 1 hour. Cultured at last. Thereafter, a suitable amount was sprinkled on an LB agar plate containing ampicillin and cultured overnight at 37 ° C. to obtain transformant E. coli JM109 / pTV-Taq26-35.

(2) Production of modified DNA polymerase The transformant that appeared on the agar medium was cultured in 5 mL of LB medium containing ampicillin at 37 ° C. until the absorbance (A ₆₀₀ ) at ₆₀₀ nm reached 0.4 to 0.6. After that, IPTG (Isopropyl-bD-thiogalactopyranoside) was added to 1 mM, and further cultured at 30 ° C. for 10 hours. After culture, the cells were collected by centrifugation (6,000 rpm for 20 minutes).

  The collected cells were heat-treated at 75 ° C. for 60 minutes, and then added with 2 volumes of 50 mM Tris-HCl buffer (pH 7.5), 1 tablet protease inhibitor (Complete EDTA-free, manufactured by Roche), Suspended. The obtained suspension was sonicated and kept at 75 ° C. for 60 minutes, followed by centrifugation (11,000 rpm for 20 minutes) to obtain a supernatant. To this was added a 5% polyethyleneimine solution to a final concentration of 0.15% and left in ice for 60 minutes. After centrifugation, ammonium sulfate was added to the supernatant to 100% saturation. After centrifugation, the precipitate was dialyzed against 50 mM Tris-HCl buffer (pH 8.0), 1 mM PMSF (phenylmethylsulfonyl fluoride) and 1 mM EDTA. Insoluble matter was removed by centrifugation, and then ammonium sulfate was added to the supernatant to 0.5 M, followed by centrifugation at 1,8000 × g for 10 minutes to obtain a supernatant. This supernatant was treated with a HiTrap phenyl HP column and then with a HiTrap heparin HP column to obtain a crude DNA polymerase fraction.

  The result of subjecting the crude DNA polymerase fraction to SDS-PAGE and then staining with CBB (Coomassie Brilliant Blue) is shown in FIG. In FIG. 8, “M” represents a molecular weight marker, and lane 7 relates to a crude DNA polymerase fraction obtained by expressing an expression plasmid having a DNA encoding the modified DNA polymerase shown in lane 1 of FIG. The results are shown, and lane 8 shows the results for the crude DNA polymerase fraction obtained from E. coli having an expression plasmid containing DNA encoding wild type Taq DNA polymerase. As shown in FIG. 8, the crude DNA polymerase fraction was a nearly uniform protein grade.

(3) Functional analysis of modified DNA polymerase Using the DNA polymerase purified in (2), the deoxynucleotide uptake activity was measured, and the specific activity of the modified DNA polymerase shown in lane 7 of FIG. 8 was determined. As reaction solutions, 20 mM Tris-HCl (pH 8.0), 2 mM MgCl ₂ , 2 mM 2-mercaptoethanol, 0.2 mg / mL calf thymus DNA (activated by DNAase), 40 μM dATP, dGTP, dCTP, 60 nM each A solution containing [methyl ³ H] dTTP is prepared, 5 mL of a fraction solution is added to 45 mL of the reaction solution, and the mixture is reacted at 70 ° C. Then, a part thereof is spotted on DE81 paper, and then 5% Washed 5 times with Na ₂ HPO ₄ solution. The radioactivity remaining on the DE81 paper filter was measured with a liquid scintillation counter. Thus, when the activity concentration of each enzyme preparation was displayed in units, the specific activity of Taq DNA polymerase was 5.10 × 10 ⁵ units / mg, and the specific activity of the modified DNA polymerase was 0.67 × 10 ⁵ units / mg. Met.

The modified DNA polymerase shown in lane 7 of FIG. 8 was evaluated by measuring the primer extension activity, and compared with the activity of Taq DNA polymerase.
The primer extension activity was measured as follows. First, 0.1 pmol of ³² P-labeled primer was added to 0.2 μg of M13mp18 single-stranded DNA dissolved in 20 mM Tris-HCl buffer (pH 8.8), 5 mM magnesium chloride, 14 mM 2-mercaptoethanol. After heat treatment at 100 ° C. for 5 minutes, annealing was performed by slowly cooling. The dNTP solution was added to this DNA solution so that it might become 0.2 mM. Add 0.0012-0.05 units (0.0012, 0.0031, 0.0062, 0.012, 0.025, 0.05 units) of modified DNA polymerase, 0.0052 units of Taq DNA polymerase, 74 The reaction was carried out at 0 ° C. (reaction system 12 μL). After 5 minutes of reaction, 8 μL was taken and 2 μL of reaction stop solution (98% deionized formamide, 1 mM EDTA, 0.1% xylene cyanol, 0.1% bromophenol blue) was added and subjected to electrophoresis. For electrophoresis, 1% agarose gel containing 50 mM NaOH and 1 mM EDTA was used, and electrophoresis was performed at 30 mA for 16 hours.

The measurement results are shown in FIG. In FIG. 9, “M” represents a molecular weight marker, “Taq” represents Taq DNA polymerase, and “Taq 26-35” represents a modified DNA polymerase.
As shown in FIG. 9, the primer extension activity of the modified DNA polymerase is 96.0 kb / min / unit, the primer extension activity of Taq DNA polymerase is 8.4 kb / min / unit, and the modified DNA polymerase is the Taq DNA polymerase. The primer extension activity was about 11 times.

Next, the binding activity of the modified DNA polymerase to the primer annealed to the template DNA was measured by the gel shift method and compared with the binding activity of Taq DNA polymerase.
The measurement of the binding activity by the gel shift method was performed as follows. First, 0.02 pmol of template DNA (N49mer DNA) (5′-agctaccatgcctgcacgaattaagcaattcgtaatcatggtcatagct -3 ′) and 0.02 pmol of ³² P-labeled primer (d27mer DNA) (5′- ³² P-agctatgaccatgattacgaattgctt -3 ′) buffered with 20 mM The solution (pH 8.8) was contacted in a solution containing 10 mM sodium chloride, 14 mM 2-mercaptoethanol, 100 μg / ml BSA and 5% glycerol. After heat treatment at 100 ° C. for 5 minutes, the primer was annealed to the template DNA by slowly cooling. Next, 0.004 to 4 pmol (0.004, 0.016, 0.063, 0.25, 1.0, 4.0 pmol) of modified DNA polymerase or Taq DNA polymerase was added and reacted at 40 ° C. for 5 minutes. (Reaction system 10 μl). After the reaction, 3 μl of a reaction stop solution (20 mM Tris acetate buffer (pH 8.0), 10% glycerol, 0.1% bromophenol blue, 0.1% xylene cyanol) was added and subjected to electrophoresis. For electrophoresis, 1% agarose containing 4 mM Tris acetate buffer (pH 8.4) was used, and electrophoresis was performed at 30 V for 2.5 hours.

  The results are shown in FIG. As shown in FIG. 10, Taq DNA polymerase hardly bound to the primer annealed to the template DNA at 0.25 pmol, but the modified DNA polymerase bound to the primer annealed to the template DNA even at 0.016 pmol. did. This reveals that the binding ability of the modified DNA polymerase to the primer annealed to the template DNA is significantly higher than that of Taq DNA polymerase.

It is a figure which shows the electrophoresis result of the genomic DNA extracted from the high temperature environmental soil. It is a figure which shows the alignment result of the amino acid sequence of the family A type DNA polymerase derived from several microorganisms (Bacillus subtilis, Bacillus caldotenax, Thermus aquaticus, Themus thermophilus, Escherichia coli). It is a figure (continuation of FIG. 2) which shows the alignment result of the amino acid sequence of the family A type DNA polymerase derived from several microorganisms (Bacillus subtilis, Bacillus caldotenax, Thermus aquaticus, Themus thermophilus, Escherichia coli). Condensed DNA primers extracted from multiple microorganisms (Bacillus caldotenax, Bacillus caldolyticus, Escherichia coli, Bacillus subtilis, Lactobacillus bulgaricus, Lactobacillus homohiochii, Lactobacillus heterohiochii, Thermus aquaticus, Themus thermophilus, Sulfolobus solfataricus) It is a figure which shows the electrophoresis result of the PCR amplification fragment obtained by performing. It is a figure which shows the electrophoresis result of the PCR amplification fragment | piece obtained by performing PCR using a degenerate primer in presence of the genomic DNA collect | recovered from the high temperature environmental soil. It is a figure which shows the amino acid sequence coded by the PCR amplification fragment obtained by performing PCR using a degenerate primer in presence of the genomic DNA collect | recovered from the high temperature environmental soil. It is a figure which shows the electrophoresis result of the BlpI / BglII fragment cut out from plasmid DNA. It is a figure which shows the result of having used CBB (Coomassie brilliant blue) dyeing | staining after using a crude DNA polymerase fraction for SDS-PAGE. It is a figure which shows the measurement result of primer extension activity of modified Taq polymerase and Taq DNA polymerase. It is a figure which shows the measurement result of the binding ability with respect to double stranded DNA of a modified DNA polymerase and Taq DNA polymerase. It is a figure which shows the alignment result of the amino acid sequence of modified Taq polymerase, and the amino acid sequence of Taq DNA polymerase.

Claims (6)

The thermostable or thermoactive DNA polymerase which consists of an amino acid sequence shown in the following (a) or (b).
(A) in the amino acid sequence described in SEQ ID NO: 2 (b) in the amino acid sequence described in SEQ ID NO: 2, in the amino acid sequence portion consisting of amino acids 1 to 573 and / or in the amino acid sequence portion consisting of amino acids 792 to 837, Amino acid sequence in which one or more amino acids are deleted, substituted or added   DNA encoding the thermostable or thermoactive DNA polymerase according to claim 1. The DNA according to claim 2, comprising the DNA shown in the following (c) or (d).
(C) DNA comprising the nucleotide sequence set forth in SEQ ID NO: 1
(D) DNA that hybridizes under stringent conditions to DNA complementary to the DNA shown in (c) above and encodes a thermostable or thermoactive DNA polymerase   A recombinant vector comprising the DNA according to claim 2 or 3.   A transformant comprising the recombinant vector according to claim 4. A PCR kit comprising the thermostable or thermoactive DNA polymerase according to claim 1.