WO2006080525A1

WO2006080525A1 - Thermally stable or thermally active dna polymerase and dna encoding the same

Info

Publication number: WO2006080525A1
Application number: PCT/JP2006/301550
Authority: WO
Inventors: Hideji Tajima; Masaaki Takahashi; Yukiko Miyashita
Original assignee: Universal Bio Research Co., Ltd.
Priority date: 2005-01-31
Filing date: 2006-01-31
Publication date: 2006-08-03
Also published as: JP2006204267A; JP4633488B2

Abstract

It is intended to provide a novel thermally stable or thermally active DNA polymerase. To achieve this object, a thermally stable or thermally active DNA polymerase which comprises: (a) the amino acid sequence represented by SEQ ID NO:2; or (b) an amino acid sequence derived from the amino acid sequence consisting of the amino acids at the 1- to 573-positions in the amino acid sequence represented by SEQ ID NO:2 and/or the amino acid sequence consisting of the amino acids at the 792- to 837-positions therein by deletion, substitution or addition of one or more amino acids is provided.

Description

Specification

Thermostable or thermoactive DNA polymerase and DNA technology encoding the same

[0001] The present invention relates to a thermostable or thermoactive DNA polymerase and DNA encoding the same.

Background art

[0002] A DNA polymerase that can synthesize a DNA strand consisting of a complementary base sequence according to the base sequence of a bowl-shaped DNA is PCR (polymerase 'chain' reaction), D

It is routinely used as an indispensable reagent for genetic manipulation experiments, including NA sequencing and site-directed mutagenesis. The contribution of this enzyme that has contributed to the development of molecular medicine, molecular biology and biochemistry is immeasurable.

[0003] The power of many types of DNA polymerases on the market to date. Physicochemical properties of each enzyme, such as thermal stability, synthetic chain extension, mis-synthesizing proof, preference for vertical DNA. Etc. are different and are used properly depending on the purpose of the experiment.

For example, the use of thermostable or thermoactive DNA polymerase is essential for PCR. Since thermostable or thermoactive DNA polymerase is not inactivated during denaturation of double-stranded DNA, it is possible to save the trouble of adding an enzyme. In addition, by performing a DNA strand elongation reaction at a high temperature using a thermostable or thermoactive DNA polymerase, non-specific annealing of the primer, intramolecular higher-order structure of single-stranded DNA (for example, hairpin loops) And the like, and the intended elongation reaction can be efficiently advanced.

[0004] Thermostable or thermoactive DNA polymerases include, for example, Thermus' Aquaticus

(Thermus aquaticus) -derived DNA polymerase (Taq DNA polymerase) (see Patent Documents 1, 2 and 3), Thermotoga maritima-derived DNA polymerase (Tma DNA polymerase) (see Patent Documents 4 and 5) Etc. are known.

Patent Document 1: U.S. Pat.No. 4,889,818

Patent Document 2: U.S. Pat.No. 5,352,600 Patent Document 3: U.S. Pat.No. 5,079,352

Patent Document 4: U.S. Pat.No. 5,374,553

Patent Document 5: U.S. Pat.No. 5,420,029

Disclosure of the invention

Problems to be solved by the invention

[0005] The present invention provides a novel thermostable or thermoactive DNA polymerase, a DNA encoding the DNA polymerase, a recombinant vector containing the DNA, and a transformant containing the recombinant vector. Objective.

Another object of the present invention is to provide a kit for PCR containing a novel thermostable or thermoactive DNA polymerase.

Means for solving the problem

In order to achieve the above object, the present invention provides the following inventions.

(1) A thermostable or thermoactive DNA polymerase having the amino acid sequence shown in (a) or (b) below.

(a) the amino acid sequence set forth in SEQ ID NO: 2

(b) In the amino acid sequence described in SEQ ID NO: 2, one or more amino acids are deleted in the amino acid sequence portion having the 1st to 573th amino acid strength and the amino acid sequence portion having the Z or 792 to 837th amino acid strength. , Substituted or added amino acid sequences

(2) DNA encoding the thermostable or thermoactive DNA polymerase according to (1) above.

(3) The DNA according to (2) above, which comprises the DNA shown in (c) or (d) below.

(c) DNA having the nucleotide sequence of SEQ ID NO: 1

(d) DNA that encodes a thermostable or thermoactive DNA polymerase that has been orbridized under stringent conditions with DNA complementary to the DNA shown in (c) above.

(4) A recombinant vector comprising the DNA according to (2) or (3).

(5) A transformant comprising the recombinant vector according to (4).

(6) A PCR kit comprising the thermostable or thermoactive DNA polymerase according to (1). The invention's effect [0007] According to the present invention, a novel thermostable or thermoactive DNA polymerase, DNA encoding the DNA polymerase, a recombinant vector containing the DNA, and a transformant containing the recombinant vector are provided. Provided. The present invention also provides a PCR kit containing a novel thermostable or thermoactive DNA polymerase.

Since the thermostable or thermoactive DNA polymerase of the present invention has superior DNA polymerase activity (primer extension activity) compared to Taq DNA polymerase, it is useful for PCR.

Brief Description of Drawings

[0008] FIG. 1 is a diagram showing the results of electrophoresis of genomic DNA from which high-temperature environmental soil force was also extracted.

FIG. 2 is a diagram showing the alignment results of amino acid sequences of family A type DNA polymerases derived from multiple microorganisms (Bacillus subtilis ゝ Bacillus caldotenax, Thermus aquaticus ゝ Themus thermophilus, Escherichia coli).

[Fig. 3] Diagram showing the alignment results of amino acid sequences of family A DNA polymerases derived from multiple microorganisms (Bacillus subtilis ^ Bacillus caldotenax ^ Thermus aquaticus ^ Themus thermophilus, Escherichia coli) (continuation of Fig. 2) is there.

[Fig. 4] Microorganisms (Bacillus caldotenax, Bacillus caldolyticus, Escherichia coli, Bacillus subtilis, Lactobacillus bulgaricus, Lactobacillus homohiochii, Lactobacillus hete rohiochn, Thermus aquaticus, Themus thermophilus, Sulfolobus solfataricus) FIG. 3 is a diagram showing an electrophoresis result of a PCR amplified fragment obtained by performing PCR using degenerate primers.

FIG. 5 is a diagram showing the results of electrophoresis of PCR amplified fragments obtained by PCR using degenerate primers in the presence of genomic DNA recovered from high-temperature environmental soil.

FIG. 6 is a view showing an amino acid sequence encoded by a PCR-amplified fragment obtained by PCR using degenerate primers in the presence of genomic DNA recovered from high-temperature environmental soil.

FIG. 7 is a diagram showing the results of electrophoresis of the excised BlplZBglll fragment of plasmid DNA.

[Fig. 8] After subjecting the crude DNA polymerase fraction to SDS-PAGE, CBB (Coomassie brilli FIG. 5 is a diagram showing the result of staining.

FIG. 9 is a graph showing the results of measuring the primer extension activity of modified Taq polymerase and Taq DNA polymerase.

FIG. 10 is a graph showing the results of measuring the binding ability of modified DNA polymerase and Taq DNA polymerase to double-stranded DNA.

FIG. 11 is a diagram showing alignment results between the amino acid sequence of modified Taq polymerase and the amino acid sequence of Taq DNA polymerase.

BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, the present invention will be described in detail.

The thermostable or thermoactive DNA polymerase of the present invention has the amino acid alignment ability shown in the following (a) or (b).

(a) the amino acid sequence set forth in SEQ ID NO: 2

[0010] In the following, amino acid sequence (a) a thermostable or thermoactive DNA polymerase that also has a force is referred to as “DNA polymerase (a)”, and amino acid sequence (b) is a thermostable or thermoactive DNA polymerase. May be referred to as “DNA polymerase (b)”.

[0011] In the present invention, "thermostable DNA polymerase" refers to heat-stable and heat-resistant, and is placed under a temperature necessary for denaturation of double-stranded DNA (for example, 80 to 105 ° C). Means an enzyme that retains DNA polymerase activity, and “thermoactive DNA polymerase” refers to the specific annealing of primers to single-stranded DNA caused by denaturation of double-stranded DNA (specific Priming) and an enzyme capable of exhibiting DNA polymerase activity at a temperature necessary for ensuring primer extension (for example, 55 to 80 ° C.). In addition, “specific annealing of primer to single-stranded DNA” means that the primer is annealed to the target region of single-stranded DNA, and “DNA polymerase activity” is an appropriate term. Deoxyribonucleoside triphosphate is used as a substrate to indicate the catalytic action of synthesizing DNA complementary to cage DNA (primer extension product). [0012] The DNA polymerase activity can be expressed, for example, by the primer extension activity (kb Z min ZU) per unit of enzyme. The primer extension activity of DNA polymerase (a) at 74 ° C is that of Taq DNA polymerase. About 11 times the primer extension activity at ° C (see Examples). The primer extension activity of DNA polymerase (b) at 74 ° C is considered to vary depending on the total number and position of amino acids to be deleted, substituted, or added. It is more than 2 times, more preferably 5 times or more. Taq DNA polymerase is a DNA polymerase derived from Thermus aquaticus, the amino acid sequence thereof is shown in SEQ ID NO: 4, and the base sequence of the DNA encoding it is shown in SEQ ID NO: 3.

[0013] The DNA polymerase (b) also has an amino acid sequence ability in which one or more amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 2. In the amino acid sequence described in SEQ ID NO: 2, the portion where one or more amino acids are deleted, substituted, or added is the amino acid sequence portion consisting of amino acids 1 to 573 in the amino acid sequence described in SEQ ID NO: 2 and Z Alternatively, it is an amino acid sequence portion which also has the amino acid power of 792 to 837. Of the amino acid sequence described in SEQ ID NO: 2, the total number of amino acids deleted, substituted, or attached to the amino acid sequence portion consisting of amino acids 1 to 573 and the amino acid sequence portion consisting of amino acids Z or 792 to 837 And the position is not particularly limited. The total number of amino acids to be deleted, substituted or appended is 1 or more, preferably 1 or several, and the specific range is usually 1 to 10, preferably 1 to 5 for deletion. More preferably, the number is 1 to 2, the substitution is usually 1 to 10, preferably 1 to 5, more preferably 1 to 2, and the addition is usually 1 to 10, preferably 1 to Five, more preferably 1-2. Mutations such as deletions, substitutions and additions can be detected only for one of the amino acid sequence part consisting of amino acids 1 to 573 and the amino acid sequence part consisting of amino acids 792 to 837. Okay, and you can be bothered by both.

[0014] The DNA polymerases (a) and (b) may be a protein with a sugar chain added thereto or a protein with a sugar chain added thereto. The type, position, etc. of the sugar chain added to the protein vary depending on the type of host cell used in the production of the protein. Proteins to which sugar chains have been added include proteins obtained using any host cell. Further, DNA polymerases (a) and (b) may be their salts.

[0015] A portion consisting of amino acids 574 to 791 in the amino acid sequence of DNA polymerase (a) (SEQ ID NO: 2) and a portion corresponding to the above portion in the amino acid sequence of Taq DNA polymerase (SEQ ID NO: 4) (sequence) FIG. 11 shows the alignment results with No. 4 (the portion consisting of amino acids 574 to 786).

[0016] The difference between the amino acid sequence of DNA polymerase (a) and the amino acid sequence of Taq DNA polymerase is the amino acid sequence of amino acids 574 to 786 in the amino acid sequence of Taq DNA polymerase (SEQ ID NO: 4). Is substituted with a microorganism-derived amino acid sequence (amino acid sequence consisting of amino acids 574 to 791 of the amino acid sequence described in SEQ ID NO: 2) contained in the high temperature soil. The difference between the amino acid sequence of DNA polymerase (a) (SEQ ID NO: 2) is the 792nd amino acid (isoleucine) and the amino acid sequence of Taq DNA polymerase (SEQ ID NO: 4) is the 787th amino acid (leucine), and The difference between the amino acid sequence of DNA polymerase (a) (SEQ ID NO: 2) at amino acid position 793 (leucine) and the amino acid sequence of Taq DNA polymerase (SEQ ID NO: 4) at amino acid position 788 (parin) is Taq This occurs when the restriction enzyme site Bglll is introduced to replace the amino acid sequence of DNA polymerase (see Examples).

[0017] DNA encoding DNA polymerase (a) or (b) can be obtained by chemical synthesis in accordance with its base sequence. For the chemical synthesis of DNA, a commercially available DNA synthesizer, for example, a DNA synthesizer using the thiophosphite method (manufactured by Shimadzu Corporation), or a DNA synthesizer using the phosphoramidite method (manufactured by Perkin 'Elma Ichi') Can be used.

[0018] In addition, DNA encoding DNA polymerase (a) or (b) is artificially converted to DNA encoding Taq DNA polymerase (SEQ ID NO: 3) using a known method such as site-directed mutagenesis. Can be obtained by introducing mutations. Mutation can be introduced, for example, using a mutation introduction kit such as Mutant-K (TAKARA), Mutant-G (TAKARA), or TAK ARA LA PCR in vitro Mutagenesis series kit. .

[0019] For DNA encoding Taq DNA polymerase, for example, a cDNA library is prepared using mRNA extracted from Thermus aquaticus, SEQ ID NO: Using a probe synthesized based on the nucleotide sequence described in No. 3, it can be obtained by screening a clone containing the target DNA from a cDNA library.

[0020] DNA encoding DNA polymerase (a) or (b) comprises an open reading frame and a stop codon located at its 3 'end. Further, the DNA encoding DNA polymerase (a) or (b) can contain an untranslated region (UTR) at the 5 ′ end and / or 3 ′ end of the open reading frame.

[0021] Examples of DNA encoding DNA polymerase (a) include DNA comprising DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 1. Here, in the nucleotide sequence described in SEQ ID NO: 1, the open reading frame is located at the 1-2511th position, the translation initiation codon is located at the 1-3th position, and the stop codon is located at the 2512-2514th nucleotide position. The base sequence of DNA encoding DNA polymerase (a) is not particularly limited as long as it encodes DNA polymerase (a). The base sequence of the open reading frame is the base sequence described in SEQ ID NO: 1. The base sequence is not limited to the 1st to 2511th bases.

[0022] As the DNA encoding DNA polymerase (b), for example, it is nobbridized under stringent conditions to DNA complementary to the DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 1.

Examples include DNA containing DNA.

[0023] "Stringent conditions" include, for example, conditions of 42 ° C, 2 X SSC and 0.1% SDS

Preferably, the conditions are 65 ° C, 0.1 IX SSC, and 0.1% SDS.

[0024] The DNA that hybridizes under stringent conditions to DNA complementary to the DNA having the base sequence ability described in SEQ ID NO: 1 is at least 88% or more preferably the DNA having the base sequence described in SEQ ID NO: 1. Examples thereof include DNA having 90% or more, more preferably 95% or more homology.

[0025] DNA polymerases (a) and (b) can be produced, for example, by expressing DNA encoding each in a host cell according to the following steps.

[Production of recombinant vector and transformant]

When preparing a recombinant vector, first, a DNA fragment of an appropriate length containing the coding region of the target protein is prepared. Base sequence of the coding region of the target protein Bases may be substituted in the sequence to be the optimal codon for expression in the host cell.

[0026] Next, the above-mentioned DNA fragment is inserted downstream of the promoter of an appropriate expression vector to prepare a recombinant vector. The DNA fragment needs to be incorporated into a vector so that its function is exhibited. The vector is not only a promoter but also a cis element such as an enhancer, a splicing signal, a poly A addition signal, a selection marker (for example, Dihydrofolate reductase gene, ampicillin resistance gene, neomycin resistance gene), ribosome binding sequence (SD sequence) and the like.

[0027] A transformant capable of producing a target protein can be obtained by introducing a recombinant vector into an appropriate host cell.

The expression vector is not particularly limited as long as it is capable of autonomous replication in a host cell, and for example, a plasmid vector, a phage vector, a virus vector and the like can be used. Examples of plasmid vectors include plasmids derived from E. coli (for example, pRSET, pBR322, pBR325, pUC118, pUC119, pUC18, pUC19), plasmids derived from Bacillus subtilis (for example, pUB110, pTP5), and plasmids derived from yeast (for example,ファージ ρ13, ΥΕρ24, YCp50) can be used, and for example, λ phage (for example, Charon4A, Charon21A ゝ EMBL3, EMBL4, gtl0, gtll, λZAP) can be used as the phage vector. Examples of virus vectors that can be used include animal viruses such as retroviruses and vaccinia viruses, and insect viruses such as baculoviruses.

[0028] As the host cell, any of prokaryotic cells, yeast, animal cells, insect cells, plant cells and the like may be used as long as the DNA encoding the target protein can be expressed. In addition, animals, plants, silkworms, etc. may be used.

[0029] When a bacterium is used as a host cell, for example, Escherichia coli or other Escherichia genus, Bacillus subtilis or other Bacillus genus or Pseudomonas putida or other Pseudomonas genus Bacteria belonging to the genus Rhizobium such as Rhizobium meliloti can be used as host cells. Specific [Koma, Escherichia coll BL21, Escherichia coll XL 1 -Blue ^ Escherichia coll XL2—Blue, Escherichia coli DH1, Escherichia coli K12, Escherichia coli JM109, Escheric Escherichia coli such as hia coli HB101, Bacillus subtilis such as Bacillus subtilis MI 114, Bacillus subtilis 207-21 can be used as host cells. The promoter in this case is not particularly limited as long as it can be expressed in bacteria such as Escherichia coli. For example, it is derived from Escherichia coli or phage such as trp promoter, lac promoter, p promoter, P promoter, etc.

L R

A promoter can be used. In addition, artificially designed and modified promoters such as tac promoter, lacT7 promoter, let I promoter can be used.

[0030] The method of introducing the recombinant vector into the bacterium is not particularly limited as long as it is a method capable of introducing DNA into the bacterium, and for example, a method using calcium ions, an electoporation method, or the like is used. Can do.

[0031] When yeast is used as a host cell, Saccharomycescerevisiae

Schizosaccharomyces pombe, Pichia pastoris, etc. can be used as host cells. The promoter in this case is not particularly limited as long as it can be expressed in the yeast. For example, gall promoter, gallO promoter motor, heat shock protein promoter, 1 promoter, PH05 promoter, PGK promoter, GAP promoter, ADH A promoter, AOX1 promoter, etc. can be used.

[0032] The method for introducing the recombinant vector into yeast is not particularly limited as long as it is a method capable of introducing DNA into yeast. For example, an electopore method, a spheroplast method, a lithium acetate method, or the like may be used. Can do.

[0033] When animal cells are used as host cells, monkey cells COS-7, Vero, Chinese nomstar ovary cells (CHO cells), mouse L cells, rat GH3, human FL cells, etc. may be used as host cells. it can. The promoter in this case is not particularly limited as long as it can be expressed in animal cells. For example, SRa promoter, SV40 promoter, LTR (Long Terminal Repeat) promoter, CMV promoter, human cytomegalovirus early residues. A gene promoter or the like can be used.

[0034] The method of introducing the recombinant vector into the animal cell is not particularly limited as long as it is a method capable of introducing DNA into the animal cell. For example, the electopore position method, the calcium phosphate method, The pouffexion method can be used.

When insect cells are used as hosts, Spodoptera frugiperda ovary cells, Trichoplusia ni ovary cells, silkworm ovary-derived cultured cells, and the like can be used as host cells. Spodoptera frugiperda ovarian cells such as S19, Sf21 etc., Trichoplusia ni ovarian cells such as High 5, ΒΤΙ-ΤΝ-5 インビトロ 1-4 (manufactured by Invitrogen) etc., Bombyx mori N4 etc. as silkworm ovary-derived culture cells Can be used.

The method for introducing a recombinant vector into an insect cell is not particularly limited as long as DNA can be introduced into an insect cell. For example, a calcium phosphate method, a lipofusion method, an electoral position method, or the like can be used.

[Culture of transformant]

Transform transformants into which a recombinant vector containing the DNA encoding the target protein has been introduced. The transformant can be cultured according to a conventional method used for culturing host cells.

[0037] As a medium for culturing a transformant obtained using a microorganism such as Escherichia coli or yeast as a host cell, the medium contains a carbon source, a nitrogen source, inorganic salts and the like that can be assimilated by the microorganism. If the medium is capable of efficiently cultivating, use a difference between natural and synthetic media.

[0038] As the carbon source, carbohydrates such as glucose, fructose, sucrose and starch, organic acids such as acetic acid and propionic acid, and alcohols such as ethanol and propanol can be used. Nitrogen sources include ammonia, ammonium chloride, ammonium sulfate, ammonium acetate, ammonium phosphates such as ammonium and phosphates, peptone, meat extract. Yeast extract, corn steep liquor, casein hydrolyzate, and the like can be used. As the inorganic salt, monopotassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride salt, ferrous sulfate, manganese sulfate, copper sulfate, calcium carbonate, etc. can be used. .

[0039] The transformant obtained by using microorganisms such as E. coli and yeast as host cells can be cultured under aerobic conditions such as shaking culture or aeration and agitation culture. The culture temperature is usually 25 to 37 ° C, the culture time is usually 12 to 48 hours, and the pH is usually 6 to 8 during the culture period. Hold on. The pH can be adjusted using an inorganic acid, organic acid, alkaline solution, urea, calcium carbonate, ammonia or the like. When culturing, antibiotics such as ampicillin and tetracycline may be added to the medium as necessary.

[0040] When cultivating a microorganism transformed with an expression vector using an inducible promoter as a promoter, an inducer may be added to the medium as necessary. For example, when cultivating a microorganism transformed with an expression vector using the lac promoter, cultivate a microorganism transformed with an expression vector using trp promoter, such as isopropyl β-D-thiogalatatopyranoside. When doing so, indoleacrylic acid or the like may be added to the medium.

[0041] As a medium for culturing a transformant obtained by using animal cells as host cells, RPMI1640 medium, Eagle's MEM medium, DMEM medium, Ham F12 medium, Ham F12K medium, or these mediums may be used. A medium supplemented with fetal calf serum or the like can be used. Transformants are usually cultured at 37 ° C for 3-10 days in the presence of 5% CO. Culture

2

At this time, if necessary, antibiotics such as kanamycin, penicillin, streptomycin and the like may be added to the culture medium.

[0042] As a medium for culturing a transformant obtained using insect cells as host cells, commonly used TNM-FH medium (Pharmingen), Sf-900 II SFM medium (G¾co BRL) ExCell400, ExCell405 (manufactured by JRH Biosciences), etc. can be used. Transformants are usually cultured at 27 ° C for 3 to 10 days. When culturing, an antibiotic such as gentamicin may be added to the medium as necessary.

[0043] The target protein may be expressed as a secreted protein or a fusion protein. Examples of the proteins to be fused include j8-galatatosidase, protein A, IgG binding region of protein A, chloramphee-col 'acetyltransferase, poly (Arg), poly (Glu), protein G, maltose binding protein, glutathione S-transferase, polyhistidine chain (His-tag), S peptide, DNA-binding protein domain, Tac antigen, thioredoxin, green 'fluorescent' protein, etc. can be used.

[0044] [Protein Isolation 'Purification] The target protein can be obtained by collecting the target protein from the transformant culture. Here, the term “culture” includes deviations of culture supernatant, cultured cells, cultured cells, cells or disrupted cells.

[0045] When the target protein is accumulated in the cells of the transformant, the culture is centrifuged to collect the cells in the culture, and after washing the cells, the cells are crushed. To extract the target protein. When the target protein is secreted outside the transformant, use the culture supernatant as it is, or remove cells or cells from the culture supernatant by centrifugation or the like.

[0046] The obtained protein is obtained by solvent extraction method, salting out method using ammonium sulfate, desalting method, precipitation method using organic solvent, jetylaminoethyl (DEAE) -sepharose, ion exchange chromatography method, hydrophobic chromatography method. It can be purified by gel filtration, affinity chromatography, and the like.

[0047] DNA polymerases (a) and (b) are based on their amino acid sequences! /, Fmoc method (fluoromethyloxycarbon method), tBoc method (tbutyloxycarbon method) It can also be produced by chemical synthesis methods. At this time, a commercially available peptide synthesizer can be used.

[0048] DNA polymerases (a) and (b) are useful in performing PCR, and can be used as components of a PCR kit. In addition to DNA polymerase (a) or (b), the PCR kit can contain reagents, containers, devices and the like necessary for PCR.

Example

[0049] [Example 1] Acquisition of genomic DNA derived from microorganisms contained in high-temperature environmental soil

(1) Collection of high temperature environmental soil

In order to effectively use DNA polymerase, it is considered important to have heat resistance that can be used for PCR and the like. In order to obtain a thermostable enzyme, it is most efficient to obtain a high-temperature environmental force sample. Therefore, hot springs with different properties ( _PH ) were selected as the high temperature environment. One is the Kyushu Kagoshima Kirishima Onsen area, which shows strong acidity, and the other is the Onikobe Onsen area in Miyagi Prefecture and the Daifoyu Onsen area, Akita Prefecture, which show pH close to neutrality. [0050] In a specific area within the hot spring area, there are a number of mud pots (holes where mud simmers and rusts) in their natural state (inaccessible to humans). From these points, the color, water content, and other conditions of the sample collected along with data such as temperature and pH were recorded for each sampling point. From each point, about lOOg of soil, mud or sediment was collected so that a sufficient amount of DNA could be recovered.

[0051] (2) Genomic DNA extraction from high temperature environmental soil

The collected soil lg was collected in a sterilized Eppendorf tube, and then genomic DNA derived from microorganisms contained in the soil was extracted. Extraction of genomic DNA with soil strength was performed using Ultra Clean ™ Soil DNA Purification kit (manufactured by MO Bio, catalog No. 12800-50, Funakoshi catalog No. M128000), a DNA extraction kit from soil. The operation was performed according to the operation procedure attached to this kit.

Dispense 2 μL of 1Z50 volume of the DNA solution actually extracted, and add 18 μL ΤΑΕ buffer (0.04Μ Tris, 0.02M acetic acid, 0.001M EDTA (pH 8.0)) and L Concentrated staining solution for electrophoresis (0.25% bromophenol blue, 0.25% xylene cyanol, 30% glycerol) was prepared and confirmed by 0.8% agarose gel electrophoresis.

As a result, as shown in FIG. 1, it was confirmed that genomic DNA having a length of 10 kilobase pairs or more was recovered from several points, although there were some amounts. In FIG. 1, “M” represents a molecular weight marker, and lanes 1 to 38 represent results relating to different points. From this result, it was confirmed that there were enough microorganisms in the high-temperature environment soil to extract a sufficient amount of genomic DNA.

[Example 2] PCR using primers specific to family A type DNA polymerase

(1) Family A type DNA polymerase specific primer design

The results are shown in FIG. 2 and FIG. 3 according to the alignment of the amino acid sequence of a family A type DNA polymerase derived from several microorganisms (Bacillus subtiiis, Bacillus caldotenax, Thermus aquaticus, Themus thermophilus, Escherichia coli). Figure 3 is a continuation of Figure 2.

[0054] In Fig. 2 and Fig. 3, the two regions enclosed by squares (DPNLQNIP and QVHDELX (X represents I, V or L)) are amino acid sequences having high homology among a plurality of microorganisms. This It is speculated that the non-acid sequence is also conserved in Family 1 type A DNA polymerase of other microorganisms.

[0055] Therefore, based on the above amino acid sequences, two types of degenerate primers (Takashi, 5 'primer (SEQ ID NO: 5) and 3' primer (SEQ ID NO: 6)) shown in Table 1 were designed (Takashi Uemori, Yo shizumi Ishino, Kayo Fujita, Kiyozo Asada and i unosnin Kato "Loning of the DNA Polymerase Gene of Bacillus caldotenax and Characterization of the Gene Product (1993) J. Biocem., 113, 401-410.).

[0056] [Table 1]

[0057] “y” is t or c, “s” is c or g, “k” is g or t, “r” is a or g, “h” is a or t or c, “n” represents a, g, c, or t.

[0058] (2) PCR using primers specific to family A type DNA polymerase

Ten organisms (Bacillus caldotenax, Bacillus caldolyticus, Escherichia coli, Baci llus subtilis, Lactobacillus bulgaricus, Lactobacillus homohiochn, Lactobacillus heter ohiochii, Thermus aquaticus, Themus thermophilus, Sulfolobus solfataricus) Using the above degenerate primer lOOpmol, 50 L of 10 mM Tris—HCl (pH 8.3), 50 mM KC1, 15 mM MgCl NTP

PCR was performed in a solution containing 2, 200 μM d and 5 units TAKARA Ex Taq polymerase (Takara Bio). PCR was performed at 30 ° C for 30 seconds at 94 ° C, 1 minute at 55 ° C, and 2 minutes at 72 ° C.

As a result, as shown in FIG. 4, PCR amplified fragments presumed to be derived from family A type DNA polymerases were obtained in all 10 types of microorganisms. In Fig. 4, "M" represents a molecular weight marker, lane 2 is Bacillus caldotenax ^ lane 3 is Bacillus caldolyticus , Les ~~ 4 ί Escherichia coli, les 5 ~ ί Bacillus subtilis, les 6 ~ ί Lactobacillus bul garicus, les 7 ~ ί Lactobacillus homohiochii, les 8 ~ ί Lactobacillus heteroniochn The results are related to ilfoi obus solfataricus.

[0060] From the results, it was revealed that the degenerate primer can be used as a primer for a family A type DNA polymerase gene derived from any microorganism.

[0061] Next, using the degenerate primer lOOpmol in the presence of 1, 50 μL of genomic DNA recovered from high-temperature environmental soil such as the Kirishima hot spring area and Onikobe hot spring area 10 mM Tris-HCl (pH 8.3), 50 mM KC1, 15 mM MgCl, 200 μM dNT

2

PCR was performed in a solution containing P and 5 units TAKARA EX Taq polymerase (manufactured by Takara Bio Inc.). PCR was performed for 30 cycles at 94 ° C for 30 seconds, 55 ° C for 1 minute, and 72 ° C for 2 minutes.

[0062] As a result, as shown in Fig. 5, when the genomic DNA collected from several points was used as a saddle type, a DNA fragment presumed to be derived from a family A type DNA polymerase was amplified. When the length of the DNA fragment was almost the same as predicted, it was estimated that the DNA fragment was derived from a family A DNA polymerase. In FIG. 5, “M” represents a molecular weight marker, and lanes 1 to 29 represent results for different points.

[0063] (3) Cloning of amplified fragments

After adding the same volume of 10 mM Tris-HCl (pH 7.5) and ImM EDTA solution to the reaction solution after the PCR, add the same amount of water-saturated phenol Z chloroform solution as the aqueous solution, stir well, and 70 ° C After 10 minutes of heating, the mixture was centrifuged at 10, OOOrpm for 5 minutes, and the upper aqueous solution fraction was carefully collected. The collected aqueous solution fraction was added to MicroconlOO (Millipore) and centrifuged at 2500 rpm for 15 minutes. Again, 200 L of 10 mM Tris-HCl (pH 7.5) and ImM EDTA solution was added and centrifuged at 2,500 rpm for 15 minutes. By the above operation, unreacted primers, nucleotides, salts and the like were removed.

[0064] About 0.05 μg of PCR-amplified fragment, pGEM T-vector (Promega) dissolved in 10 mM Tris-HCl (pH 7.5) and ImM EDTA solution, 0.1 ^ g, and 10 mM Tris— After mixing with 8 L of HC1 (pH 7.5) / ImM EDTA solution, Ligation Kit 'version 2 (manufactured by Takarabio) 10 L was added and incubated at 16 ° C. for 30 minutes to ligate the PCR amplified fragment to plasmid DNA. Transfer 1 μL of plasmid DNA ligated with PCR-amplified fragments to 50 L of calcium-treated E. coli DH10B dissolved in ice, leave it on ice for 20 minutes, and warm it at 42 ° C for 2 minutes. 950 1 ^ liquid 1 ^ medium (containing 11g 10g tryptone, 5g yeast extract, 5g sodium chloride and lg glucose) was incubated at 37 ° C for 60 minutes. After the shaking culture, 150 L of the culture was inoculated on an LB agar medium containing lOO ^ g / mL ampicillin and cultured at 37 ° C.

[0065] (4) Decoding the base sequence of PCR amplified fragments

Colonies of E. coli amplified on an agar medium were inoculated into LB medium containing about 2 mL of 100 μg / mL ampicillin and cultured at 37 ° C with shaking. The grown cells were collected by centrifugation at 10, OOOrpm for 10 minutes, and the plasmid DNA was recovered using QIAprep Spin Miniprep Kit (manufactured by QIAGEN, catalog No. 27104). The recovered plasmid DNA was used as a cage, and PCR was performed using primers for decoding the base sequence (Ml 3 primer M4 and T promoter primer). For PCR, a dye terminator one-cycle sequencing kit (ABI) was used, and for decoding the base sequence, an ABI 3700 automatic base sequence detector was used.

[0066] (5) Determination of the amino acid sequence encoded by the PCR amplified fragment

Since the base sequence of the determined PCR amplified fragment may contain mechanical errors, the base sequence was manually corrected to eliminate the mechanical error, and then the amino acid sequence encoded by the base sequence was determined. . A public protein database is used to perform homology searches. The amino acid sequence encoded by the PCR-amplified fragment and the amino acid sequence of a known family A DNA polymerase (Thermus aquaticus-derived DNA polymerase (Taq DNA polymerase)). Comparison was made with the acid sequence.

As a result, as shown in FIG. 6, it was confirmed that the amino acid sequence encoded by the PCR-amplified fragment includes the amino acid sequence of the functional domain of family A type DNA polymerase.

In FIG. 6, “Taq” represents the amino acid sequence of Taq DNA polymerase, and “No. 1”, “No.

“2” and “No. 3” are PCRs obtained by using genomic DNA recovered from different sites as a cage. Represents the amino acid sequence encoded by the amplified fragment and shows 90%, 57% and 52% homology with the amino acid sequence of TaqDNA polymerase, respectively. In addition, the amino acid sequences relating to “No. 1,” “No. 2,” and “No. 3” show only amino acid sequences different from Taq DNA polymerase.

[0069] In addition, as shown in Table 2, the amino acid sequences encoded by PCR amplified fragments obtained by using genomic DNA recovered from different points (a to g) as a saddle type are derived from different microorganisms. Since it showed homology with the amino acid sequence of family A type DNA polymerase, it was confirmed that many unknown family A type DNA polymerases exist in a high temperature environment.

[0070] [Table 2]

[Example 3] Construction of plasmid having DNA encoding modified DNA polymerase

(1) Design of primers for introducing restriction enzyme sites

Since the PCR amplification fragment obtained in Example 2 covers the region responsible for the center of DNA polymerase activity, it is encoded by the PCR amplification fragment of the amino acid sequence of Taq DNA polymerase (SEQ ID NO: 4). A modified DNA polymerase in which the region showing homology with the amino acid sequence is replaced with the amino acid sequence encoded by the PCR amplification fragment is considered to exhibit a DNA polymerase activity different from that of Taq DNA polymerase. May exhibit zeta activity. The function of the modified DNA polymerase is considered to reflect the function of an unknown family A-type DNA polymerase that exists in high-temperature soil. [0072] Therefore, in order to introduce restriction enzyme sites (Blpl site and Bglll site) outside the region to be replaced with the PCR amplification fragment in the DNA encoding Taq DNA polymerase (SEQ ID NO: 3), Two types of primer A (SEQ ID NO: 7) and primer B (SEQ ID NO: 8) shown in 3 were designed. Primer A is designed to introduce a Blpl recognition sequence as a new restriction enzyme site without affecting the amino acid sequence of Taq DNA polymerase. Primer B is designed so that a Bglll recognition sequence can be introduced as a new restriction enzyme site. However, when Bglll recognition sequence is introduced by primer B, amino acid residue Leu 787 of Taq DNA polymerase is introduced. Is replaced with amino acid residue lie with similar properties, and 788th amino acid residue Val is replaced with amino acid residue Leu with similar properties.

[0073] On the other hand, in order to introduce restriction enzyme sites (Blpl site and Bglll site) outside the PCR amplified fragment, two kinds of primers C (SEQ ID NO: 9) and primer D (SEQ ID NO: 10) shown in Table 3 were used. Designed. Primer C is designed to introduce a Blpl recognition sequence as a new restriction enzyme site that does not affect the amino acid sequence of Taq DNA polymerase. It is designed so that a Bglll recognition sequence can be introduced as a new restriction enzyme site. When Bglll recognition sequence is introduced by Polymer 1D, the amino acid residue Leu at position 787 of Taq DNA polymerase is similar to that. The 788th amino acid residue Val is replaced with the amino acid residue Leu having similar properties to the amino acid residue lie having the same properties.

[0074] [Table 3]

In Table 3, the single underlined portion represents the newly introduced Blpl site, and the double underlined portion represents the newly introduced Bglll site.

[0076] (2) PCR using restriction site introduction primer

DNA encoding Taq DNA polymerase (SEQ ID NO: 3) is transformed into plasmid vector pTVl Clawed to N (Takara Bio Inc.). (Ishino Y, Ueno T, Miyagi M, Uemori T, Im amura M, Tsunasawa S, Kato I. Overproduction of Thermus aquaticus DNA polymer ase and its structural analysis by ion-spray mass spectrometry "(1994) J Biochem (Tokyo) , 116 (5), 1019-24) 10 mM Tris—HCl (pH 8.3), 50 mM KC1, 15 mM MgCl using 2 pmol of primer A and B in the presence of 10 ng 200 M dNTP and 2.5 units PlUUltra DNA polymerase (Stratagen

2

PCR was performed in a solution containing e). PCR was carried out 20 cycles of 95 ° C for 1 minute, 55 ° C for 1 minute, and 72 ° C for 15 minutes.

[0077] Next, in the presence of 10 ng of the plasmid clone obtained in Example 2, using primers C and D 2 pmol, 10 mM Tris-HCl (pH 8.3), 50 mM KC1, 15 mM Mg CI, 200 M dNTP and 2.5 units PlUUltra DNA polymerase (Stratagene)

2

PCR was performed in a solution containing. PCR was performed with 30 temperature cycles of 95 ° C for 1 minute, 55 ° C for 1 minute, and 72 ° C for 2 minutes.

[0078] (3) Restriction enzyme treatment of PCR amplified fragment

The PCR amplified fragment was cleaved with restriction enzymes Blpl and Bglll. That is, each PCR amplification reaction solution 50 / z L, 10-fold concentrated restriction enzyme buffer (200 mM Tris—HCl (pH 8.2), 100 mM MgCl, 600 mM NaCl, lOmM DTT) 5 L, sterile distilled water 42 μL And restriction fermentation

2

After 3 μL of raw Blpl was mixed and mixed well, it was incubated at 37 ° C for 3 hours. Next, 5 M NaC 1 solution and restriction enzyme Bglll 3 L were added and mixed well, and then incubated at 60 ° C. for 3 hours. After the incubation, 10 _i u L of 10 mM EDTA and 2% SDS solution were added to stop the reaction.

[0079] After each DNA fragment cleaved by 0.8% agarose gel electrophoresis was separated, each DNA fragment was recovered and purified using QuiaQuickTip manufactured by QUI AGEN.

(4) Ligation of DNA fragments treated with restriction enzymes

Recovered 'purified DNA fragments (0.5 g (1 L)) were mixed on ice, 10 mM Tris—HCl (pH 7.5) and ImM EDTA solution (3 μL), and Takara Liga tion Kit (Takarabio). 5 μL of version 2 was added and mixed well, and then incubated at 16 ° C for 1 hour.

[0080] (5) Introduction into E. coli 1 L of the ligation reaction solution was mixed with 20 μL of calcium-treated E. coli JM109 cell solution on ice, allowed to stand for 30 minutes, heat-treated at 42 ° C for 30 seconds, 980 μL of LB liquid medium was added, and 37 The shaking culture was performed at ° C for 60 minutes. Subsequently, 100 / zL was fractionated and uniformly inoculated on agar LB medium containing 100 / z gZm L ampicillin, and then kept at 37 ° C.

[0081] (6) Confirmation of recombination

Of the E. coli inoculated on the agar medium, only those having plasmid DNA grew on the agar medium and formed colonies. Of the colonies that formed, 10 were randomly selected, inoculated into 2 mL of LB liquid medium, cultured at 37 ° C with shaking, and then QIAGEN QIA prep Spin Miniprep Kit (Catalog No. 27104). ) Was used to recover plasmid DNA. The recovered plasmid DNA was treated with Blpl and Bglll, and the BlplZBglll fragment was excised. As a result, as shown in FIG. 7, the PCR amplified fragment is incorporated into a plasmid containing DNA encoding Taq DNA polymerase, that is, for expression expected to have DNA encoding modified DNA polymerase. It was confirmed that the plasmid could be constructed. In FIG. 7, “M” represents a marker, and lanes 1 and 2 show results of recombinant plasmids incorporating PCR amplified fragments obtained by using genomic DNA collected from different points as a cage. Indicates.

[0082] (7) Determination of base sequence of PCR amplified fragment

Of the DNA encoding the modified DNA polymerase shown in lane 1 of FIG. 7, the nucleotide sequence of the PCR amplified fragment was determined as follows.

Cytanoresidoxy reaction was carried out using the recombinant plasmid as a saddle and using Beckman Coulter's CQE dye terminator cycle sequencing with quick start kit. At this time, 5'-tccaccccaggacgggccgcctccac-3 'was used as the 5th primer, and 5'-cccctccatgacctccttggccagcc-3' was used as the 3rd primer. Using 300 ng of the vertical DNA and 5 pmol of the primer, 30 cycles of the reaction were performed at 96 ° C for 20 seconds, 50 ° C for 20 seconds, and 60 ° C for 4 minutes. Unreacted substrate was removed by passing the reaction solution through a Sephadex G-50 column. The reaction solution was dried and dissolved in 40 L of electrophoresis solution, and the base sequence was determined by CEQ 2000XL DNA Analysis System of Beckman Coulter. [0083] The nucleotide sequence of the DNA encoding the modified DNA polymerase shown in lane 1 of Fig. 7 is shown in SEQ ID NO: 1, and the amino acid sequence of the modified DNA polymerase whose nucleotide sequence (SEQ ID NO: 1) is estimated is sequenced. It is shown in number 2. From this amino acid sequence, the recombined part was predicted to be part of the DNA polymerase gene. Of the nucleotide sequence set forth in SEQ ID NO: 2, the amino acid sequence portion consisting of amino acid residues 1 to 573 and the amino acid sequence portion consisting of amino acid residues 792 to 837 are derived from Taq DNA polymerase, The amino acid sequence portion consisting of the 574th to 791th amino acid residues is derived from a PCR amplified fragment incorporated into Taq DNA polymerase.

[Example 4] Production and functional analysis of modified DNA polymerase

(1) Introduction of recombinant plasmid into E. coli for expression

The expression plasmid (pTV-Taq26-35) having DNA encoding the modified DNA polymerase shown in lane 1 of FIG. 7 was transformed into E. coli strain JM109.

E. coli JM109 competent cells were thawed and transferred to a falcon tube in an amount of 0.1 mL. Add a solution corresponding to the expression plasmid lOng, and let it stand in ice for 30 minutes. Then, heat shock at 42 ° C for 30 seconds, add 0.9 mL of SOC medium to it at 37 ° C. Cultured with shaking for 1 hour. Thereafter, an appropriate amount was sprinkled on an LB agar plate containing ampicillin and cultured overnight at 37 ° C. to obtain transformant E. coli JM109ZPTV-Taq26-35.

[0085] (2) Production of modified DNA polymerase

The transformant that appeared on the agar medium was cultured in 5 mL of LB medium containing ampicillin at 37 ° C until the absorbance (A) at 600 nm reached 0.4 to 0.6, and then IPTG (Isopro

600

pyl-b-D-thiogalactopyranoside) was cultivated to ImM and further cultured at 30 ° C for 10 hours. After incubation, the cells were collected by centrifugation (6, OOOrpm for 20 minutes).

[0086] The collected cells were heat-treated at 75 ° C for 60 minutes, and then doubled in 50 mM Tris-HCl buffer.

(pH 7.5), 1 tablet of protease inhibitor (Complete EDTA-free, manufactured by Roche) was added and suspended. The obtained suspension was sonicated and kept at 75 ° C. for 60 minutes, followed by centrifugation (11, OOOrpm for 20 minutes) to obtain a supernatant. To this was added a 5% polyethyleneimine solution to a final concentration of 0.15% and left in ice for 60 minutes. After centrifugation, ammonium sulfate was added to the supernatant so as to be 100% saturated. After centrifugation, relax the precipitate with 50 mM Tris-HCl. It was dialyzed against an impulse (ρΗ8.0), ImM PMSF (phenol methylsulfur fluoride) and ImM EDTA. Insoluble matter was removed by centrifugation, and then ammonium sulfate was added to the supernatant to 0.5 M, followed by centrifugation at 1,8000 × g for 10 minutes to obtain a supernatant. This supernatant was treated with a HiTrap Phenyl HP column and then treated with HiTrap on a Parin HP column to obtain a crude DNA polymerase fraction.

[0087] Fig. 8 shows the results of subjecting the crude DNA polymerase fraction to SDS-PAGE and then staining with CBB (Kumasi-Brilliant Blue). In FIG. 8, “M” represents a molecular weight marker, and lane 7 relates to a crude DNA polymerase fraction obtained by expressing an expression plasmid having a DNA encoding the modified DNA polymerase shown in lane 1 of FIG. The results represent the results, and lane 8 represents the results for the crude DNA polymerase fraction obtained in E. coli with the expression plasmid containing DNA encoding wild-type Taq DNA polymerase. As shown in Figure 8, the crude DNA polymerase fraction was a nearly homogeneous protein grade.

[0088] (3) Functional analysis of modified DNA polymerase

Using the DNA polymerase purified in (2), the doxynucleotide uptake activity was measured, and the specific activity of the modified DNA polymerase shown in lane 7 of FIG. 8 was determined. As reaction solution, 20 mM Tris-HCl (pH 8.0), 2 mM MgCl

2, 2 mM 2-mercaptoethanol, 0.2 mg / mL calf thymus DNA (activated by DNAase), 40 M d ATP, dGTP, dCTP, 60 nM [^ Chill ³ H] dTTP After adding 5 mL of the fraction solution to 45 mL of the reaction solution and reacting at 70 ° C, a part of the solution was spotted on DE8 1 paper, and this was then washed 5 times with 5% Na HPO solution. Washed. And

twenty four

The radioactivity remaining on the DE81 paper filter was measured with a liquid scintillation counter. Thus, when displaying the activity concentration of each enzyme preparation in unit, the specific activity of Taq D NA polymerase 5. 10 X 10 ⁵ units / mg specific activity of the modified DNA polymerase 0. 67 X 10 ⁵ units / mg.

[0089] The modified DNA polymerase shown in lane 7 of Fig. 8 was evaluated by measuring the primer extension activity and compared with the activity of Taq DNA polymerase.

The primer extension activity was measured as follows. First, 0. lpmol of ³² P-labeled primer was added to 20 mM Tris-HCl buffer (pH 8.8), 5 mM magnesium chloride, 14 mM 2-medium. Added to 0.2 _i ug of M13mpl8-stranded DNA dissolved in lucaptoethanol. After heat treatment at 100 ° C for 5 minutes, annealing was performed by slowly cooling. A dNTP solution was added to the DNA solution to a concentration of 0.2 mM. Modified DNA polymerase from 0.00 00 to 0.05, HO. 0012, 0. 0031, 0. 0062, 0. 012, 0. 025, 0. 05, and Taq DNA polymerase to 0. The reaction was carried out at 74 ° C (reaction system 1 2 / z L). After 5 minutes of reaction, take 8 L, add 2 L of reaction stop solution (98% deionized formamide, ImM EDTA, 0.1% xylene cyanol, 0.1% bromophenol blue) and perform electrophoresis. Provided. For electrophoresis, 1% agarose gel containing 50 mM NaOH and ImM EDTA was used, and electrophoresis was performed at 30 mA for 16 hours.

[0090] Fig. 9 shows the measurement results. In FIG. 9, “M” represents a molecular weight marker, “Taq” represents Taq DNA polymerase, and “Taq 26-35” represents a modified DNA polymerase.

As shown in Figure 9, the primer extension activity of the modified DNA polymerase is 96. OkbZ min Z units, the primer extension activity of Taq DNA polymerase is 8.4 kb / min / unit, and the modified DNA polymerase is the same as that of Taq DNA polymerase. The primer extension activity was about 11 times.

[0091] Next, the binding activity of the modified DNA polymerase to the primer annealed to the truncated DNA was measured by the gel shift method and compared with the binding activity of Taq DNA polymerase.

The measurement of the binding activity by the gel shift method was performed as follows. First, recording-type DNA of 0. 02pmol (J 49merDNA Roh (5 - agctaccatgcctgcacgaattaagcaattcgtaatcatggtcata get - 3, ) and ³² [rho labeled primer 0. 02pmol (d27merDNA) (5 teeth ³² P- ^{agctatgacca tgattacgaattgctt} - a 3,), 20 mM Tris Contact was made in a solution containing hydrochloric acid buffer (pH 8.8), 10 mM sodium chloride, 14 mM 2-mercaptoethanol, 100 gZml BSA and 5% glycerol.After heat treatment at 100 ° C. for 5 minutes, slowly The primer was annealed to the vertical DNA by cooling, and then the modified DNA polymerase or Taq DNA polymerase was added at 0.004 to 4 pmol (0.004, 0.016, 0. 063, 0.25, 1 0, 4. Opmol), and allowed to react for 5 minutes at 40 ° C (reaction system 10 1) After the reaction, 3 1 reaction stop solution (20 mM Tris acetate buffer (pH 8.0), 10% glycerol, 0.1% Bromo Phenol blue, 0.1% xylene cyanol) was added and subjected to electrophoresis. For electrophoresis, 1% agarose containing 4 mM Tris acetate buffer (pH 8.4) was used, and electrophoresis was performed at 30 V for 2.5 hours.

The result is shown in FIG. As shown in Figure 10, Taq DNA polymerase did not bind to the primer annealed to 铸 -type DNA at 0.25 pmol. Modified DNA polymerase was primer annealed to 铸 -type DNA even at 0.016 pmol. Bound to This reveals that the ability of the modified DNA polymerase to bind to primers annealed to saddle DNA is significantly higher than that of Taq DNA polymerase.

Claims

The scope of the claims

[1] A thermostable or thermoactive DNA polymer having the amino acid sequence shown in (a) or (b) below.

(a) the amino acid sequence set forth in SEQ ID NO: 2

[2] DNA encoding the thermostable or thermoactive DNA polymerase according to claim 1.

[3] The DNA according to claim 2, comprising the DNA shown in the following (c) or (d):

(c) DNA having the nucleotide sequence of SEQ ID NO: 1

[4] A recombinant vector comprising the DNA according to claim 2 or 3.

[5] A transformant comprising the recombinant vector according to claim 4.

[6] A PCR kit comprising the thermostable or thermoactive DNA polymerase according to claim 1.