JP2006149276A - Method for examining inheritable predisposition of asthma - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for examining the inheritable predisposition of asthma, etc., by elucidating gene polymorphism and haplotype associated with the asthma. <P>SOLUTION: This method for examining the inheritable predisposition of the asthma is provided by detecting the base forms of the gene polymorphic sites corresponding to the following (i) and/or (ii) in nucleic acids collected from a subject. (i) The base at 1993th site contained in a promotor domain on a T-bet gene of a specific sequence. (ii) The base at 390th site contained in an exon 1 on the T-bet gene of the specific sequence. <P>COPYRIGHT: (C)2006,JPO&NCIPI

Description

  The present invention relates to gene polymorphisms of genes associated with human allergic diseases, particularly gene polymorphisms present in the T-bet gene and use thereof. More specifically, a method for testing a genetic predisposition for asthma including detection of a T-bet gene polymorphism, an oligonucleotide used therefor, a test kit for a genetic predisposition for allergic diseases using oligonucleotides, and use thereof About.

  Studies with twins and families have shown that genetic predisposition is strongly involved in allergic diseases. (For example, Non-Patent Document 1 etc.) Unlike single genetic diseases in which mutation of a single responsible gene causes disease, diabetes and hypertension including allergic diseases are “common diseases”. being called. Common diseases are thought to be manifested by the interaction between genetic predisposition and environmental factors, and many genes are involved in the disease as genetic predispositions. And qualitative (functional) changes are said to affect diversity in disease phenotypes.

  In the base sequence in the human genome, it has been clarified that there are differences in base sequences at many sites among individuals, and this base sequence difference is a gene polymorphism. This sequence difference is thought to contribute to the diversity of individual phenotypes, such as susceptibility to diseases (susceptibility), and is also associated with the risk of suffering from lifestyle-related diseases Has been reported (for example, Non-Patent Document 2).

  Single nucleotide polymorphisms (SNPs, SNPs) are genes that are defined as having a frequency of 1% or more in the population at a site where a single base difference in the DNA base sequence between individuals occurs. It is polymorphic and is said to have 3 to 10 million locations in the human genome. Single nucleotide polymorphisms can cause qualitative and quantitative changes in gene expression, and because they are present in the genome at high frequencies, they are important as markers for gene analysis such as disease-related gene identification, and are related to gene function. It is used for examination and search for disease-related genes.

  Studies have been conducted to clarify genes associated with diseases by genome analysis using gene polymorphisms including single nucleotide polymorphisms. By clarifying the causative substance by identifying the single nucleotide polymorphism site causing the disease and the disease-related gene, it is possible to determine the difference in the base sequence of the gene polymorphism and to determine the risk of disease, the mechanism of disease onset Research on the search and identification of disease-related genes by genetic polymorphism because there are many technical developments such as elucidation, application to presentation of prevention guidelines for diseases, drug development by clarifying the onset mechanism and target of diseases Has attracted attention and research is ongoing.

  Asthma is an allergic disease characterized by paroxysmal and reversible bronchial obstruction caused by excessive hyperresponsiveness of the bronchial system to various stimuli, including airway inflammation, epithelial damage, airway smooth muscle hypertrophy, and airway hypersensitivity Bring about symptoms. The existence of a genetic predisposition in asthma has been studied by twins and family studies before the establishment of molecular biology techniques, and identical twins are more consistent in phenotype than dizygotic twins. Many reports have shown the involvement of genetic predisposition. Asthma patients are on the rise worldwide, according to the National Institutes of Health (NIH), there are more than 150 million asthma patients worldwide. The number of asthma patients in Japan is more than 3 million, and the morbidity has increased remarkably, more than twice that of 30 years ago. Although the increase in the number of deaths has been suppressed by the development of treatment and management protocols such as guidelines for asthma treatment, approximately 4,000 people have died per year due to dyspnea due to seizures.

Aspirin asthma is an asthma caused by an anti-inflammatory analgesic typified by aspirin, and about 10% of adult asthma is said to be aspirin asthma. The causative agent of aspirin asthma, antipyretic analgesics (aspirin (Bufferin ^(R)), indomethacin (Inteban ^(R), Indashin ^(R), in free ^(R)), ibuprofen (Burufen ^(R)), naproxen (Naikisan ^(R) ), piroxicam (Felden ^(R) , Bakiso ^(R) ), diclofenac (Voltaren ^(R) ), loxoprofen (Loxonin ^(R) ), mefenamic acid (Pontar ^(R) ), etc., food and pharmaceutical additives (Edible Yellow No. 4 (Tartrazine ^R ), sodium benzoate, benzyl alcohol, parabens, Edible Yellow No. 5, etc. In addition, " ^(R) " in the parentheses indicates a registered trademark), salicylic acid Induced by foods containing strawberry (such as strawberries, grapes, tomatoes, cucumbers, citrus fruits). Symptoms include nasal congestion and nasal discharge within minutes to 2 hours after ingestion of the inducer, followed by coughing, wheezing and dyspnea, leading to severe asthma attacks. Leukotriene receptor antagonists are often used for treatment, but 30% of people will die if they are not treated. The onset mechanism is thought to result in excessive production of leukotrienes resulting in asthma attacks as a result of aspirin and the like inhibiting cyclooxygenase, an enzyme involved in arachidonic acid metabolism.

  T-bet (T-box expressed in T cell, TBX21) is a transcription factor localized in the nucleus identified as belonging to the T-box gene family that associates with the IL2 promoter. The T-bet gene is located at 17q21 on the human chromosome. T-bet is a transcription factor specifically expressed in Th1 cells that controls the expression of interferon γ, which is an indicator of Th1 cytokines. For example, without T-bet expression in mouse experiments, IFN-γ production by natural killer cells and CD4 T cells is greatly reduced, and cytokine production by CD4 + T cells is shifted to the Th2 side. (For example, Non-Patent Document 3). Moreover, it has been observed that T-bet-deficient mice cause spontaneous airway inflammation similar to human acute or chronic asthma (Non-patent Document 4, etc.). However, there are no examples of genetic polymorphisms on T-bet and genetic polymorphisms associated with asthma in the Japanese population.

Harris JR et al., Am J Respir Crit Care Med, 156, 43-, 1997, Manian P, Chest, 112, 1397-, 1997 Risch N, et al., Science, 273,1516-1517,1996, Collins F S, et al., Science, 274,536-539,1996 Science, 295,338-342,2002 Science, 295,336-338,2002

  In recent years, the number of people suffering from allergic diseases has increased rapidly, and the prevention / treatment and elucidation of the onset mechanism are desired. In particular, asthma exhibits severe symptoms as an allergic disease, and prevention, onset mechanism, and elucidation of the cause are strongly desired. If it becomes possible to predict the onset risk and severity of a patient, it will be possible to provide effective lifestyle guidance and preventive measures that take into account individual constitutions. In addition, the identification of genes related to asthma provides clues for elucidating the onset and exacerbation mechanisms, and is an important guideline for the development of more effective preventive / therapeutic methods and therapeutic drugs.

  The main object of the present invention is to clarify genetic polymorphisms and haplotypes related to asthma, and to provide a method for testing a genetic predisposition for asthma.

  In order to solve the above-mentioned problems, the present inventors searched for a gene associated with asthma disease and found a T-bet gene. Furthermore, we searched for SNPs strongly related to asthma in the T-bet gene, and identified strongly related polymorphisms and haplotypes. The present invention has been completed based on such knowledge. Therefore, the above problem is solved by the present invention described below. That is, the present invention provides a T-bet gene polymorphism as a genetic predisposition marker (risk risk factor) for asthma and a susceptibility test for asthma. Specifically, the following [1] to [ 15].

[1] A genetic predisposition test method for asthma comprising a step of detecting a base form of a gene polymorphism site corresponding to the following (i) and / or (ii) in a nucleic acid collected from a subject.
(I) the base of the -1993 site contained in the promoter region on the T-bet gene described in SEQ ID NO: 1 (ii) the 390 site contained in exon 1 on the T-bet gene described in SEQ ID NO: 1 Base [2] Further comprising the step of comparing the base form of the gene polymorphic site identified from the nucleic acid derived from the subject with the base form of the gene polymorphic site in the sequence described in SEQ ID NO: 1, The genetic predisposition test method described.
[3] The genetic predisposition test method for asthma according to the above [1] or [2], comprising a step of detecting a gene polymorphism site in linkage disequilibrium relationship with any of the following (i) and (ii).
(I) the base of the -1993 site contained in the promoter region on the T-bet gene described in SEQ ID NO: 1 (ii) the 390 site contained in exon 1 on the T-bet gene described in SEQ ID NO: 1 Base [4] An asthma susceptibility test method comprising the following steps (a) and (b):
(A) a step of detecting a base form of a gene polymorphic site corresponding to the following (i) and / or (ii) in a nucleic acid collected from a subject (i) on the T-bet gene described in SEQ ID NO: 1 Base at the -1993 site contained in the promoter region (ii) Base at the 390th site contained in exon 1 on the T-bet gene described in SEQ ID NO: 1 (b) Gene polymorphism identified from the nucleic acid derived from the subject Determining the genetic risk of suffering from asthma from the base form of the site [5] In the above (b), the base form of the gene polymorphic site identified from the nucleic acid derived from the subject and the gene in the sequence of SEQ ID NO: 1 The method for testing susceptibility to bronchial asthma according to [4] above, wherein the method compares the base form of the polymorphic site.
[6] In (b) above,
When the combination of base forms of alleles at the polymorphic site corresponding to (i) is a C homozygote or C and T heterozygote, and the allele at the polymorphic site corresponding to (ii) When the combination of base forms of genes is a homozygote of G or a heterozygote of G and A,
If it falls under at least one of the above, the susceptibility testing method according to the above [4], wherein it is determined that the genetic risk of suffering from asthma is relatively high.
[7] In (b) above,
When the combination of base forms of alleles at the polymorphic site corresponding to (i) is a homozygote of T, and the combination of base forms of alleles at the polymorphic site corresponding to (ii) is If it is a homozygote of A,
If it falls under at least one of the above, the susceptibility testing method according to the above [4], wherein it is determined that the genetic risk of suffering from asthma is relatively low.
[8] The susceptibility test according to any one of [4] to [7] above, which comprises a step of detecting a gene polymorphism site in linkage disequilibrium with any of (i) and (ii) below: Method.
(I) the base of the -1993 site contained in the promoter region on the T-bet gene described in SEQ ID NO: 1 (ii) the 390 site contained in exon 1 on the T-bet gene described in SEQ ID NO: 1 The morbidity test method according to any one of claims 4 to 8, wherein the morbidity of base [9] aspirin asthma is tested.
[10] The susceptibility testing method according to any one of [4] to [8], wherein the susceptibility of asthma accompanied by nasal polyps is tested.
[11] When the base form of the gene polymorphic site corresponding to (i) below is detected and the base of the gene polymorphic site corresponding to (i) is C, the expression level of the T-bet gene is relative T-bet gene expression state, which is estimated to be relatively high, and when the base of the polymorphic site corresponding to (i) is T, the T-bet gene expression level is estimated to be relatively low Analysis method.
(I) a nucleic acid selected from the group consisting of the base [12] of the -1993 site contained in the promoter region on the T-bet gene described in SEQ ID NO: 1 [12] (I), (II) and (III) below Genetic predisposition marker.
(I) Nucleic acid containing a gene polymorphic site at the -1993 site contained in the promoter region on the T-bet gene described in SEQ ID NO: 1 (II) Exon 1 on the T-bet gene described in SEQ ID NO: 1 Nucleic acid containing gene polymorphic site of the 390th site included (III) Nucleic acid having a sequence complementary to any one of the nucleic acids of (I) and (II) above [13] (I), (II) below And a nucleic acid having a base length of 10 or more that specifically hybridizes with at least one nucleic acid selected from the group consisting of (III).
(I) Nucleic acid containing a gene polymorphic site at the -1993 site contained in the promoter region on the T-bet gene described in SEQ ID NO: 1 (II) Exon 1 on the T-bet gene described in SEQ ID NO: 1 Nucleic acid containing gene polymorphic site at site 390 (III) Nucleic acid having a sequence complementary to any one of the above nucleic acids (I) and (II) [14] Detection of genetic predisposition marker for asthma The nucleic acid according to [13] above, which is a primer and / or a probe.
[15] A genetic predisposition detection kit for asthma comprising the primer and / or probe of [14] above.
[16] A method for screening a drug for preventing and / or treating asthma, comprising an expression regulatory region of a human T-bet gene, and a base sequence encoding a detectable expression product whose expression is controlled by the expression regulatory region A screening method comprising: administering a candidate drug to an expression cell line containing a recombinant nucleic acid comprising: and directly or indirectly detecting expression of the expression product.
[17] The screening according to [16] above, wherein the expression regulatory region includes a promoter region, and the base form of the gene polymorphic site in the promoter region is either (iv) or (v). Method.
(Iv) T
(V) C

  According to the present invention, it is possible to examine a genetic predisposition for asthma. Since the susceptibility (susceptibility) of a subject to asthma can be predicted by using the test method of the present invention, preventive medical guidance for asthma is possible. In addition, the onset of asthma can be delayed and detected early. The knowledge obtained in the present invention can also be applied to elucidation of the onset mechanism of asthma and development of therapeutic agents.

Hereinafter, the present invention will be described in detail.
As used herein, “polynucleotide” means a substance in which two or more nucleotides are linked by a phosphodiester bond. “Polynucleotide” includes “ribonucleotide (RNA)” and “deoxyribonucleotide (DNA)”. Here, DNA includes cDNA and genomic DNA. The “polynucleotide” is not limited to these, but also includes artificially synthesized nucleic acids such as peptide nucleic acids, morpholino nucleic acids, methyl phosphonate nucleic acids, S-oligonucleic acids. As used herein, the term “nucleic acid” is used synonymously or interchangeably with the “polynucleotide” and means DNA or RNA. Further, the terms “nucleic acid” and “polynucleotide” refer to isolated nucleic acids and polynucleotides, unless otherwise specified, which substantially exclude cellular material, culture media when prepared by recombinant DNA techniques, etc. Refers to a nucleic acid or polynucleotide that is not contained in and is substantially free of precursor chemicals or other chemicals when chemically synthesized.

  The abbreviations of amino acids, peptides, base forms, nucleic acids, etc. in this specification are defined by IUPAC (International Union of Pure and Applied Chemistry) or IUBMB (International Union of Biochemistry and Molecular Biology), “base sequence or amino acid sequence. "Guidelines for the creation of statements including specifications" (edited by the Japan Patent Office) and customary symbols in this field. As used herein, “base form” refers to the type or sequence of bases. In addition, thymine (t) when the polynucleotide is DNA is uracil (u) for RNA, and can be read interchangeably unless otherwise specified. Information such as base form and amino acid sequence can be digitized and handled on a computer.

  As used herein, “gene polymorphism” means that the nucleotide sequence on the human genome is different among individuals or the sequence type is different. A “single nucleotide polymorphism (SNP)” refers to a gene polymorphism that appears as a mutation of a single nucleotide nucleic acid. Further, the “nucleic acid fragment” refers to a nucleic acid having a partial sequence and / or a full-length sequence. The “gene region” includes a translation region encoding a protein and / or a transcription region other than the protein coding region, a promoter, an intron region, and a non-translation region such as a functional unidentified region near the gene.

  In the present specification, the “gene polymorphic site” refers to a site where there is a difference in the base form detected as the gene polymorphism. Polymorphisms can be identified as mutations such as base substitutions, deletions, and additions to a single base sequence. There may be a difference in the number of bases of the sequence due to deletion, addition, etc., but in this case, it can be specified by aligning the sequences as a site corresponding to the reference sequence. As one form of alignment, it is possible to align a sequence by processing a base sequence as electronic information on a computer. For example, by using various algorithms and software used in homology search such as FASTA and BLAST, two types of sequences can be aligned and the corresponding sites can be identified. It can also be identified by comparing the base sequences of individual individuals using the Sequencher program.

  As used herein, “specifically hybridizes” is synonymous with the term “hybridizes under stringent conditions,” recognized by those skilled in the art, and includes two nucleic acids (or fragments). ) By Sambrook, J., “Expression of cloned genes in E. coli”, Molecular Cloning: A laboratory manual, Hybridization to each other under hybridization conditions described in Cold Spring Harbor Laboratory Press, 1989, pp. 9.47-9.62, pp. 11.45-11.61 means.

  More specifically, the “stringent condition” refers to washing with 6.6 × SSC at about 45 ° C. and then washing with 2.0 × SSC at 50 ° C. For the selection of stringency, the salt concentration in the washing step can be selected, for example, from about 2.0 × SSC, 50 ° C. as low stringency to about 0.2 × SSC, 50 ° C. as high stringency. Furthermore, the temperature of the washing step can be increased from a low stringency condition of about 22 ° C. to a high stringency condition of about 65 ° C.

  The origin of the nucleic acid test sample (also referred to as specimen) used in the present invention includes any biological sample such as blood, bone marrow fluid, semen, peritoneal fluid, urine and other body fluids, tissue cells, body hair such as hair, and the like. It is done. The sample for detecting the gene polymorphism is preferably genomic DNA, but cDNA or mRNA can be used when the sequence of the polymorphic site and its adjacent region are the same or completely complementary to the genome. In addition to genomic DNA, the sample may include a partial base sequence of genomic DNA. That is, before analysis of a single nucleotide polymorphism site, a sample obtained by amplifying all or part of a base sequence (DNA fragment) that matches the purpose in a sample nucleic acid by any suitable method, such as PCR, is used as a nucleic acid test sample. May be used. DNA extraction can be performed using a known method, for example, a commercially available extraction kit such as “QIAamp mono kit” (manufactured by QIAGEN).

  The amplification method is performed by, for example, PCR, but may be performed by other known amplification methods such as NASBA, LCR, SDA, and LAMP. The selection of the primer is performed, for example, so as to amplify a sequence of at least 10 bases or more, preferably 10 to 100 bases, more preferably 10 to 50 bases including a single nucleotide polymorphism site, and its complementary sequence. As long as the primer can function as a primer that amplifies a predetermined nucleotide sequence including the single nucleotide polymorphism site, it may contain one or more substitutions, deletions, and additions in the sequence. The primer may also be selected so that one of the forward or reverse primers hybridizes to the single nucleotide polymorphism site so that it will be amplified only when the sample is of one allelic form.

  The primer used in the present invention can be prepared by any suitable production method such as a chemical synthesis method. The primer contains a gene polymorphism on the T-bet gene region, and does not contain a gene polymorphic site in the primer, but it contains a gene polymorphic site in the base sequence of the PCR product. Designed primers are preferred. The primer may have any suitable length that matches the detection method used, but is 10 nucleotides or longer, preferably 15 to 50 nucleotides, more preferably 15 to 30 nucleotides. Specifically, such a primer can be synthesized using, for example, an automatic synthesizer as a forward primer and a reverse primer based on single nucleotide polymorphism site and / or base sequence information in the vicinity thereof.

  A primer may carry one or more labels if desired. Preferred labels include enzymes, fluorescent materials, haptens, antigens, antibodies, dyes, radioactive materials and luminophores. The primer preferably has a sequence complementary to the template nucleic acid, but if necessary, one or more non-complementary sequences (mismatch, flap sequence, etc.) should be present in the primer unless undesirable effects occur. It may be introduced.

  The polynucleotide probe used in the present invention can be prepared by any suitable synthesis method. The polynucleotide probe may have any suitable length that matches the detection method and the like, but is 10 or more consecutive nucleotides, preferably 15 to 50 nucleotides, more preferably 15 to 30 nucleotides. The probe includes a base sequence complementary to an allele (allele) containing a gene polymorphic site in the T-bet gene region. The probe only needs to contain a base sequence complementary to either the coding strand or the antisense strand of the gene encoding the T-bet gene, and is complementary to any one of the pair of alleles. It only needs to contain a base sequence. Further, if necessary, one or more non-complementary base pairs may be introduced as long as an undesirable effect does not occur on the polynucleotide probe. Also, the probe may carry one or more labels, like the primer.

  The present invention also includes a nucleic acid fragment containing one or more gene polymorphic sites. For example, a nucleic acid amplified to include the gene polymorphic site by PCR or the like using a primer having a nearby sequence not including the gene polymorphic site. Nucleic acid containing one or more gene polymorphic sites, even if each gene polymorphism is on separate nucleic acid fragments, such as multi-primer PCR amplification products, or there are multiple gene polymorphisms on consecutive nucleic acid fragments May be. The length of the nucleic acid fragment is preferably 15b to 1 kb from the conditions such as the limit of the amplifiable length of the sample in PCR, the accuracy of base complementation in the extension reaction, and the ease of analysis. Such a nucleic acid fragment can be used as a sample for determination of a gene polymorphism site, a probe for a chip microarray, or the like as a sample such as base sequence analysis (sequence) or SSCP. The nucleic acid fragment may carry one or more labels if necessary.

  The method for detecting a genetic polymorphism is not particularly limited as long as the base difference of each genotype can be determined. For example, the amplification product may be directly sequenced (direct sequencing). The nucleotide sequence can be determined by a known method such as the dideoxy method or the Maxam-Gilbert method. Genetic polymorphism can also be detected by restriction fragment length polymorphisms (RFLP). RFLP uses a restriction enzyme that can be cleaved depending on the genotype taken by the single nucleotide polymorphism site. After digesting the sample with the restriction enzyme, the size of the digested fragment is measured to determine whether or not the sample nucleic acid is cleaved. It is a method of analyzing the mold. Other gene polymorphism detection methods include, for example, SSCP (Single Strand Conformation Polymorphism;), invader method, allele-specific PCR, hybridization using ASO (allele-specific oligonucleotide), Taqman assay, Chemical cleavage of mismatched sites, HET (hetero duplex method), base determination by MS (Mass Spectrometer), pyrosequencing, SnaPshot, allele-specific primer method, detection of gene polymorphism by DNA microarray, SPR (surface Plasmon resonance), WAVE system (detection of base difference by chromatography), molecular beacon (Sniper method, etc.) and the like can be used. In any of such known detection methods, a desired gene polymorphism site can be detected according to the test method of the present invention using the probe, the primer, and / or the polynucleotide of the present invention. it can.

In one embodiment, a genetic polymorphism associated with the development of asthma can be detected as follows, for example.
A genetic polymorphism is determined using a sample from an asthma patient (for example, allergic asthma patient) group, and a primary candidate polymorphism is selected from the genetic polymorphism (primary screening). Furthermore, the candidate polymorphism is narrowed down by increasing the number of specimens (secondary screening). On the other hand, the gene polymorphism of the candidate polymorphic site is similarly determined for the specimen from the control group of healthy subjects. Gene polymorphisms related to asthma are identified from the search results of disease-related gene polymorphisms by association analysis such as the creation of high-density genetic polymorphism maps of these gene polymorphisms and patient control studies. That is, the genetic polymorphism associated with the disease by these analyzes causes a significant difference in the allele appearance frequency between the asthma patient group and the control group.

Thus, genetic polymorphisms according to the present invention, that is, genetic polymorphisms were identified in the promoter region and exon of the T-bet gene shown in the following (i) and (ii) respectively.
(I) the base of the -1993 site contained in the promoter region on the T-bet gene described in SEQ ID NO: 1 (ii) the 390 site contained in exon 1 on the T-bet gene described in SEQ ID NO: 1 base

  The sequence of SEQ ID NO: 1 is the base sequence of the human genome containing the T-bet gene. The sequence of SEQ ID NO: 1 is accessible as an accession number: NT_010783, Version: NT_010783.14, GI: 37544107 (hereinafter also simply referred to as “NT_010783 sequence”) in a database such as NCBI (National Center for Biotechnology Information). . However, the array of SEQ ID NO: 1 represents the 43rd, 163, 609th to the 43, 178, 584th region in the NT_010783 array recorded in NCBI. The NT_010783 sequence is a genomic sequence and includes introns and exons. The first base “a” of the base number in SEQ ID NO: 1 is the 43,163,609th position in the NT_010783 sequence, and corresponds to the 5′-end of the first exon of the T-bet gene. The translation start codon of the T-bet gene is “atg” starting from nucleotide number 2212 in SEQ ID NO: 1, and is located from position 43,165,820 to position 43,165,822 in the NT — 010783 sequence. The stop codon of the T-bet gene is “tga” starting from nucleotide number 14121 in SEQ ID NO: 1, and is located from nucleotide numbers 43,177,729 to 43,177,731 in the NT — 010783 sequence.

  In the present specification, base 22a at base number 2212 in the sequence of SEQ ID NO: 1, that is, a (adenine) of atg encoding methionine which is the translation start point of T-bet gene is the first position (starting point) ) Is the position of the gene polymorphism. Therefore, the -1993 site from the origin corresponds to the 219th base number of SEQ ID NO: 1, the 99th site from the origin to the 2309th base number of SEQ ID NO: 1, and the 390th site from the origin to the SEQ ID NO: 1 1, the 1298th site from the origin corresponds to the 3509th base number of SEQ ID NO: 1, and the 7725 site from the origin corresponds to the 9936th base number of SEQ ID NO: 1.

  In the T-bet gene shown in SEQ ID NO: 1, the gene polymorphic site at the -1993 site from the origin is present in the promoter region of the T-bet gene. Further, the gene polymorphic site at the 390th site from the origin is included in exon 1 of the T-bet gene. Exon 1 refers to an exon that appears first from the 5 ′ end of the coding strand.

  The method of the present invention reveals a genetic predisposition by detecting a genetic polymorphism, particularly a single nucleotide polymorphism, present in a specific gene associated with asthma, and determines the possibility of developing asthma, etc. Is the method.

  The above specific gene is a T-bet gene present on human chromosome 17q21, and gene polymorphisms exist in exons, introns, and promoter regions of genomic DNA containing the gene.

  In the present invention, detecting at least one kind of single nucleotide polymorphism means directly detecting a gene polymorphism on the gene side (that is, the coding strand side) and detecting a gene polymorphism existing on the complementary sequence side of the gene. It means both to estimate the polymorphism on the gene side from the result. However, since the base on the gene side and the base on the complementary sequence side may not have a complementary relationship in the gene polymorphic site, it is more preferable to directly detect the polymorphism existing on the gene side.

  Examples of the gene polymorphism to be detected in the present invention include a gene polymorphism existing in the sequence of the T-bet gene. More specifically, gene polymorphisms appearing at the following sites are mentioned:

(I) the -1993 base contained in the promoter region of the sequence described in SEQ ID NO: 1 (ii) the 390th base of the sequence described in SEQ ID NO: 1

  SEQ ID NO: 1 contains the genomic base sequence of the T-bet gene. That is, the nucleotide sequence of SEQ ID NO: 1 includes the promoter region, exon, and intron of the T-bet gene. In addition, the genetic polymorphisms appearing at the sites (i) and (ii) above have a linkage disequilibrium relationship (see Examples below).

  In this specification, the X-th base in a gene may be indicated by a combination of a number X indicating the position of the base and a symbol indicating the base. For example, “390A” indicates the base A at the 390th position, and “390T / C” indicates T or C at the 390th position. Furthermore, the notation “390A> G” indicates that A is a wild type and occupies a large number. Regarding linkage disequilibrium, for example, the notation “-1993C / 390G” indicates a combination in which the -1993 site is C and the 390 site is G.

  In the test method of the present invention, nucleic acid is collected from a subject or the like, and the base form is detected for the IL12B gene polymorphic site corresponding to the above (i) and / or (ii) in the nucleic acid. In addition, you may use the nucleic acid as electronic information already registered into the database etc. as a test subject's nucleic acid.

  The descriptions of the gene polymorphism sites in (i) and (ii) above specify the place where the gene polymorphism appears in the T-bet gene. The part corresponding to the above (i) and (ii) can be specified by performing sequence alignment. Sequence alignment is as described above. Further, (i) and (ii) specify the site, and the site may be specified using the entire sequence of SEQ ID NO: 1, or in the base sequence of SEQ ID NO: 1, from 10 including the site. A sequence consisting of about 30 bases, more specifically, a base sequence consisting of about 5 to 15 bases before and after sandwiching the site, more preferably about 10 bases before and after, can be extracted and specified as a nucleic acid fragment. Specifically, for example, the gene polymorphic site of (i) can be identified by a sequence such as SEQ ID NO: 4 or SEQ ID NO: 5 in the sequence listing. In the sequences of SEQ ID NO: 4 and SEQ ID NO: 5, the -1993 site corresponds to the 8th T or C from the 5 ′ end, respectively.

  By specifying a genetic polymorphism site corresponding to the above (i) and / or (ii) for a nucleic acid sequence derived from a subject, the genetic predisposition for the subject's asthma can be determined. Specifically, in case (i), it is T or C; in case (ii), it is A or G; and in both cases, T in (i) and (ii) It is determined whether or not a linkage disequilibrium of A or a linkage disequilibrium of C in (i) and G in (ii) is observed. Still another preferred form is a form that is identified as a combination of a pair of alleles.

  In another preferred embodiment, a gene polymorphic site in linkage disequilibrium relationship with any of the above (i) and (ii) is detected. By obtaining information on other relevant polymorphisms, a more detailed genetic predisposition for asthma can be elucidated.

  As will be described in detail in the following examples, the present inventors have clarified the relationship between the above-described genetic predisposition and susceptibility to asthma. That is, by identifying the genetic predisposition marker of the subject, the subject's susceptibility to asthma can be examined from a genetic viewpoint.

  In the case of the method for examining susceptibility to asthma, the genetic risk of suffering from asthma is determined from the base form of the gene polymorphic site identified from the nucleic acid derived from the subject as described above. In this specification, disease susceptibility testing refers to genetic factors such as determination of the presence or absence of disease occurrence, determination of the possibility of disease development (prediction of risk of morbidity / susceptibility), and elucidation of genetic factors of the disease. It means to examine the relationship with the disease. Disease determination can also be performed in combination with the results of the detection of the single nucleotide polymorphism described above, other gene polymorphism analysis, and other test results.

  A polynucleotide comprising or containing the above-listed base forms is a genetic predisposition marker for asthma, and bronchial asthma is detected by detecting each marker in the test method of the present invention. Genetic predispositions such as asthma and asthma with nasal polyps can be examined. The length of the polynucleotide as a marker may be appropriately adjusted to a length sufficient to identify a gene polymorphism site, particularly preferably a single nucleotide polymorphism.

When examining the susceptibility of asthma, the following forms are preferably adopted for determining the susceptibility.
When the combination of base forms of alleles at the gene polymorphism site corresponding to (i) above is a T homozygote, this is often seen in healthy individuals. On the other hand, if the combination of base forms of alleles at the polymorphic site corresponding to (i) is a C homozygote or a C and T heterozygote, this is a genetic risk of developing asthma. It can be determined that the sex is relatively high.

  In addition, when the combination of base forms of alleles at the polymorphic site corresponding to (ii) is a homozygote of A, this is often seen in healthy individuals. On the other hand, when the combination of base forms of alleles at the polymorphic site corresponding to (ii) is a homozygote of G or a heterozygote of G and A, it corresponds to at least one of them Can be determined to have a relatively high genetic risk of suffering from asthma.

  About the polymorphism of said (i) and (ii), you may test | inspect only about any one, More preferably, you may test | inspect about both (i) and (ii).

According to another embodiment of the present invention, the inspection can be performed as follows.
A nucleic acid sample (eg, tissue, cell, blood, etc.) is collected from the subject, and DNA or genomic DNA is extracted according to a conventional method. The obtained DNA sample is amplified by PCR (region containing a genetic predisposition marker), and various polymorphic sites (i) and (ii) of the T-bet gene region are detected using various single nucleotide polymorphism detection methods. ), The type of the base of the gene polymorphism at one or more locations is determined. As described above, the state of the individual is determined with reference to the determined T-bet gene polymorphism from the correlation between the SNPs obtained from the association analysis and the pathological condition (including severity) of bronchial asthma.

  More specifically, PCR is performed in the region of the DNA sample containing the genetic predisposition marker, 1) the type of base is determined by the SSCP method, or 2) the PCR amplification product is directly sequenced (Sanger method or Maxam -Gilbert method). Alternatively, using a probe that specifically hybridizes to a region containing a genetic predisposition marker, a polymorphic site is directly detected from the DNA sample or its PCR amplification product (such as an invader assay). Further, a single base extension reaction is performed using a primer having a sequence up to the vicinity of the genetic predisposition marker (immediately before), and the extended base is analyzed by MS (mass spectrometer).

  The polynucleotide of the present invention is suitable for detection and analysis of the polymorphic site. That is, the probe or primer specifically hybridizes with at least one nucleic acid selected from the group consisting of (I), (II) and (III) below, and (I), (II) and It is a primer that can contain at least one nucleic acid selected from the group consisting of (III) in the amplification product. Specific forms such as promoter and primer base lengths are the same as described above.

(I) Nucleic acid containing a gene polymorphic site at the -1993 site contained in the promoter region on the T-bet gene described in SEQ ID NO: 1 (II) Exon 1 on the T-bet gene described in SEQ ID NO: 1 Nucleic acid containing the gene polymorphic site at the 390th site contained therein (III) Nucleic acid having a sequence complementary to the nucleic acid of any of (I) and (II) above

  In the present invention, the probe and primer of the present invention are preferably provided as a test kit containing each of them as an active ingredient. In particular, the test kit of the present invention comprising a primer may contain DNA polymerase, four types of deoxynucleotide triphosphates (dNTP), a size marker, and the like. Furthermore, an appropriate buffer, cleaning agent, reaction stop solution and the like may be included. In addition, an antibody specific for the polymorphism of the T-bet gene can be used for detection.

  The test kit of the present invention is intended for detection of a genetic predisposition marker for bronchial asthma. If necessary, the test kit is combined with a test kit for other disease-related factors (markers), and the test results indicate that A complex state can be determined.

  The polymorphism (i) above is contained in the promoter region of the T-bet gene, and it has been clarified that it is related to the expression level of T-bet transcriptional activity. Specifically, it was confirmed that the amount of transcriptional activity increased in the case of “C” compared to the case of “T” in (i) (see Example 2 below). Further, it was found that the nuclear extract binds to an oligonucleotide containing the -1993 site, and that the affinity differs depending on the type of base at the -1993 site (see Example 3 below).

Based on such findings, the present invention also provides a method for analyzing the expression state of the T-bet gene and a method for screening for preventive and / or therapeutic agents for asthma.
The T-bet gene expression state analysis method of the present invention detects the base form of the gene polymorphic site corresponding to (i) above, and the base of the gene polymorphic site corresponding to (i) is C , Assuming that the expression level of the T-bet gene is relatively high, and when the base of the gene polymorphic site corresponding to (i) is T, the expression level of the T-bet gene is relatively low To be estimated. The analysis method of the present invention can be used for analysis of various biochemical reactions, diseases and the like associated with the T-bet gene.

The method for screening an agent for preventing and / or treating asthma according to the present invention comprises a recombinant comprising a human T-bet gene expression regulatory region and a base sequence encoding a detectable protein whose expression is regulated by the expression region. A candidate drug is administered to a cell line containing a nucleic acid, and the expression of the protein is detected. In a preferred embodiment, the promoter region of the human T-bet gene contains either the nucleotide sequence (iv) or (v). Although screening is repeated many times in the drug discovery process, the present invention is suitable as one of relatively early screening methods.
(Iv) T
(V) C

  That is, the screening method of the present invention obtains information for estimating the effect of a candidate compound by preparing a transformant incorporating a detectable expression product and measuring the expression level of the protein. is there. The sequence (iv) or (v) is incorporated into the -1993 site of the promoter region. The detectable expression product is not particularly limited as long as its expression can be detected, and examples thereof include various fluorescent proteins, luminescent proteins, generating enzymes, degrading enzymes, and resistance genes. More specifically, for example, luciferase, galactosidase, chloramphenicol acetyltransferase and the like can be used as a reporter gene. Construction of an expression cell line such as a protein, such as production of an expression vector and a transformant, can be performed according to a standard method described in Molecular Cloning (3rd.ed, Cold Spring Harbor Laboratory Press).

  As one preferred form, for example, in the case of expressing a gene having the base of “C” in (v), if the expression level is reduced due to the presence of a candidate drug, overexpression of T-bet is relevant. It can be a prophylactic / therapeutic drug candidate for the disease. As another embodiment, it is also possible to test the difference in the effect of the drug due to individual differences by testing the difference in the expression level due to the administration of the candidate drug for each expression system of (iv) and (v) It is.

  Further, as another embodiment, a mode in which the transcriptional activity of the T-bet gene is also measured. The transcriptional activity can be measured by introducing a T-bet gene fragment containing the single nucleotide polymorphism (i) above into a cell, culturing the cell, and analyzing the expression of the gene. According to a preferred embodiment, the transcriptional activity of a gene is measured by introducing a transcription unit having a reporter gene bound downstream of the T-bet gene fragment, culturing the cell, and then measuring the reporter activity. For example, when a single nucleotide polymorphism is present at the promoter site, a cell into which a transcription activity measurement construct having a reporter gene inserted downstream of a gene fragment containing the single nucleotide polymorphism is cultured, and the reporter activity is measured. Thus, the influence on transcriptional activity by single nucleotide polymorphism can be measured. As the reporter gene here, luciferase, galactosidase, chloramphenicol acetyltransferase and the like are used.

Example 1 Relevance studies Subjects Asthma was diagnosed by the National Institutes of Health, with minor modifications (National Heart, Lung, and Blood Institute, National Institutes of Health, 1997). Atopic asthma was diagnosed when one or more items were positive in the allergen-specific IgE immunoassay test or when the total IgE value was 400 kU / L. In the diagnosis of non-atopic asthma, the total IgE value was 400 kU / L or less and the allergen-specific IgE was negative (0.35 kU / L or less). Aspirin asthma patients are those who have had a history of asthma attacks due to two or more different NSAIDs, or who tested positive in the aspirin challenge test. Diagnosis of nasal polyps was determined based on the nose, clinical tests, endoscopy, computed tomography, and the like. Subjects were 376 children with atopic asthma (Child patients with atopic asthma, mean age 9.3 years, age range 1-15 years, total IgE average 1084 U / mL), 313 adult atopic asthma patients ( Average age 49 years, age range 20-81 years, average IgE value 775.7U / mL), 88 adult non-atopic asthma patients (mean age 59 years, age range 42-75 years, total IgE value) (Average 174.8U / mL), aspirin asthma patients (average age 53 years), asthmatic patients with 42 nasal polyps (average age 54 years, age range 23-75 years, average IgE value average 1084U / mL) Subject.

  Control subjects (Healthy controls) were healthy individuals in the same region who had no history of respiratory and asthma-like illness, and were randomly selected. (640 people, age range 18-83 years old) All subjects were Japanese, and after explaining the contents of this study and obtaining their consent (if the subject was 16 years of age or less, with parental consent) It was implemented.

2. Search for genetic polymorphisms and related research
As a result of searching for genetic polymorphisms on the T-bet gene in 24 asthmatic patients (12 children and 12 adults), we identified single nucleotide polymorphisms in 24 and presented allele frequencies. Among them, four single nucleotide polymorphisms (-1993T / C, 99C / G, 298T / C, 7725T / C) were selected from the allele frequency, linkage disequilibrium relationship, the position of SNPs, and the like. Furthermore, genotyping (genotyping) was performed by increasing the number of subjects, the allele frequency was compared with the control, and a statistical association study was performed by chi-square test or the like (Table 1). For genotyping, TaqMan system (Applied Biosystems, Foster City, CA, USA) was used, and the specific method followed the attached manual. Furthermore, the SEQENCHER program (Gene Code Corporation) was used to identify the gene polymorphism.

  Each gene polymorphism between the control and 4 populations (adult aspirin-asthma (AIA), pediatric atopic asthma, adult atopic asthma, adult non-atopic asthma) As a result of comparing the frequency of type appearance by statistical analysis, in the case of an adult aspirin asthma patient, the result showed a strong association with p-value = 0.004 (T allele vs. C allele) at the -1993 site of the promoter site.

  In addition, we conducted an association study of adult asthma patients with nasal polyps (NP) by comparing the allelic frequencies of -1993T / C and 390A / G in linkage disequilibrium with the control (Table). 2). As a result, p-value = 0.008 at the -1993 site, odds ratio 2.38 ((C allele homozygote + C allele heterozygote) vs. (T allele homozygote)), no. The results showed a strong association with p-value = 0.019, odds ratio 2.23 ((G allele homozygote + G allele and A allele heterozygote) pair (A allele homozygote)) at 390 sites. From the odds ratios shown in Table 2, the C-allele at the -1993 site, the T allele-to-C allele heterozygote, and the C allele homozygote are strongly associated with aspirin and asthma with nasal polyps. It was shown that there is sex. Furthermore, the G allele at site 390, the heterozygote of the A and G alleles, and the homozygote of the G allele have been shown to be strongly associated with aspirin and asthma with nasal polyps.

Example 2 Effect of SNPs in Promoter on Transcriptional Activity experimental method
A single-stranded polymorphism on the T-bet gene -1993T (below, SEQ ID NO: 2) or -1993C (below, SEQ ID NO: 3) oligonucleotide and a double-stranded DNA fragment consisting of its complementary strand were prepared.
In the sequence of SEQ ID NO: 2, the 16th base T from the 5 ′ end corresponds to the -1993 site. Further, in the sequence of SEQ ID NO: 3, the 16th base C from the 5 ′ end corresponds to the -1993 site. In addition, the underline part shown in the arrangement | sequence of the following sequence number 2 and 3 shows the site | part which added the restriction enzyme recognition site (XheI site).

(1) 5'- CTAGC GGAGAAATGGTGGGTAAGGT T- 3 (SEQ ID NO: 2)
(2) 5'- CTAGC GGAGAAATGGCGGGTAAGGT T- 3 '(SEQ ID NO: 3)

  The obtained double strand was introduced into pGL3-Basic Vector (Promega, Madison, Wis.), And two kinds of vectors for measuring transcriptional activity containing the DNA fragment of each allele upstream of the luciferase gene transcription unit were prepared. Transfer HEK293 cells and HeLa cells with the above transcription activity measurement vector and pRL-TK vector (Promega) (internal standard for transformation efficiency measurement) using Fugene 6 transfection reagent (Roche Diagnostics, Basel, Switzerland). Transfected. After 24 hours, cells were collected and luciferase activity was measured by Dual-Luciferase Reporter Assay System (Promega).

2. Experimental Results As shown in FIG. 1, in both of the two types of cells (HEK293, HeLa), cells into which the vector of -1993C was introduced showed high luciferase activity. In other words, it was found that the polymorphism at the -1993 site of this promoter in the T-bet gene that was related to asthma affected the transcriptional activity of T-bet.

Example 3 Experimental method for binding unknown nuclear factor to SNPs in promoter
We investigated whether it binds to double-stranded DNA consisting of oligonucleotides of the promoter site -1993T (SEQ ID NO: 4 below) or -1993C (SEQ ID NO: 5 below) and their complementary strands containing SNPs from the nuclear extract of HEK293 cells. . In each of SEQ ID NOs: 4 and 5, the eighth site from the 5 ′ end corresponds to the -1993 site. T in the sequence of SEQ ID NO: 4 and C in the sequence of SEQ ID NO: 5.

(3) 5'-GAAATGGTGGGTAAG-3 '(SEQ ID NO: 4)
(4) 5'-GAAATGGCGGGTAAG-3 '(SEQ ID NO: 5)

  The method for preparing the nuclear extract was based on the method of Dignam J, D et al., Nucleic Acid Res. 11, 1475-1489 (1983). EMSA (Electrophoretic mobility shift assays) was performed according to the manufacturer's instructions using DIG Gel Shift Kit (Roche). The nuclear extract obtained from HEK293 cells was mixed with DIG-labeled double-stranded DNA (3) or (4) above, × 1 Binding Buffer, Poly (dI: dC), and left on ice for 30 minutes. . As a sample for competition study, react with unlabeled double-stranded DNA (3) or (4) (preculture), and then react with DIG-labeled double-stranded DNA (3) or (4) What was made to use was used. Reactions were separated on a 6% non-denaturing polyacrylamide gel in 0.3 × concentration of Tris-borate-EDTA buffer. The sample separated by the gel was transferred to a nitrocellulose membrane, and a signal was detected by a chemiluminescence detection system (Roche).

2. Experimental results The results are shown in FIG. Two complexes were detected in lane 2 and lane 5. As shown in lane 2 and lane 5, the oligonucleotide corresponding to the -1993C allele has a stronger band than the oligonucleotide corresponding to the -1993T allele (approximately 1.2 times the -1993T allele). This indicates that the unknowns present in the nuclear extract are more tightly bound to the oligonucleotide corresponding to the -1993C allele. This result indicates that there is one or more unidentified substances in the nuclear extract that control the transcriptional activity of the T-bet gene by binding to this oligonucleotide region, which may be related to asthma. Show. In addition, the measurement of the binding between this nucleotide and an unidentified substance may be an index for searching for a target substance for asthma by controlling the transcription of T-bet.

  The present invention is useful in the fields of testing, prevention, treatment, drug discovery and the like related to asthma.

It is a figure which shows the result of a transcriptional activity measurement. It is a figure which shows the result of electrophoresis.

Claims (17)

A method for testing genetic predisposition for asthma, comprising a step of detecting a base form of a gene polymorphism site corresponding to the following (i) and / or (ii) in a nucleic acid collected from a subject.
(I) the base of the -1993 site contained in the promoter region on the T-bet gene described in SEQ ID NO: 1 (ii) the 390 site contained in exon 1 on the T-bet gene described in SEQ ID NO: 1 base   Furthermore, the asthma inheritance of Claim 1 including the process of comparing the base form of the gene polymorphic site specified from the nucleic acid derived from a test subject with the base form of the gene polymorphic site in the sequence of SEQ ID NO: 1. Predisposition test method. A genetic predisposition test method for asthma, comprising a step of detecting a genetic polymorphism site in linkage disequilibrium with any of the following (i) and (ii).
(I) the base of the -1993 site contained in the promoter region on the T-bet gene described in SEQ ID NO: 1 (ii) the 390 site contained in exon 1 on the T-bet gene described in SEQ ID NO: 1 base An asthma susceptibility test method comprising the following steps (a) and (b):
(A) a step of detecting a base form of a gene polymorphic site corresponding to the following (i) and / or (ii) in a nucleic acid collected from a subject (i) on the T-bet gene described in SEQ ID NO: 1 Base at the -1993 site contained in the promoter region (ii) Base at the 390th site contained in exon 1 on the T-bet gene described in SEQ ID NO: 1 (b) Gene polymorphism identified from the nucleic acid derived from the subject Determining the genetic risk of developing asthma from the base form of the site   The bronchial asthma according to claim 4, wherein in (b), the base form of the gene polymorphic site identified from the nucleic acid derived from the subject is compared with the base form of the gene polymorphic site in the sequence of SEQ ID NO: 1. Susceptibility testing method. In (b) above,
When the combination of base forms of alleles at the polymorphic site corresponding to (i) is a C homozygote or C and T heterozygote, and the allele at the polymorphic site corresponding to (ii) When the combination of base forms of genes is a homozygote of G or a heterozygote of G and A,
The morbidity test method according to claim 4, wherein when it falls under at least one of the conditions, it is determined that the genetic risk of suffering from asthma is relatively high. In (b) above,
When the combination of base forms of alleles at the polymorphic site corresponding to (i) is a homozygote of T, and the combination of base forms of alleles at the polymorphic site corresponding to (ii) is If it is a homozygote of A,
5. The susceptibility testing method according to claim 4, wherein if it falls under at least one of the conditions, it is determined that the genetic risk of suffering from asthma is relatively low. The susceptibility testing method according to any one of claims 4 to 7, comprising a step of detecting a gene polymorphism site in linkage disequilibrium with any of the following (i) and (ii).
(I) the base of the -1993 site contained in the promoter region on the T-bet gene described in SEQ ID NO: 1 (ii) the 390 site contained in exon 1 on the T-bet gene described in SEQ ID NO: 1 base   The susceptibility test method according to any one of claims 4 to 8, wherein the susceptibility of aspirin asthma is tested.   The susceptibility test method according to any one of claims 4 to 8, wherein susceptibility of asthma accompanied by nasal polyps is tested. When the base form of the gene polymorphic site corresponding to (i) below is detected and the base of the gene polymorphic site corresponding to (i) is C, the expression level of the T-bet gene is relatively high And a T-bet gene expression state analysis method that estimates that the expression level of the T-bet gene is relatively low when the base of the gene polymorphic site corresponding to (i) is T.
(I) the base of the -1993 site contained in the promoter region on the T-bet gene described in SEQ ID NO: 1 A genetic predisposition marker which is a nucleic acid selected from the group consisting of the following (I), (II) and (III).
(I) Nucleic acid containing a gene polymorphic site at the -1993 site contained in the promoter region on the T-bet gene described in SEQ ID NO: 1 (II) Exon 1 on the T-bet gene described in SEQ ID NO: 1 Nucleic acid containing the gene polymorphic site at the 390th site contained therein (III) Nucleic acid having a sequence complementary to the nucleic acid of any of (I) and (II) above A nucleic acid having a base length of 10 or more that specifically hybridizes with at least one nucleic acid selected from the group consisting of (I), (II) and (III) below.
(I) Nucleic acid containing a gene polymorphic site at the -1993 site contained in the promoter region on the T-bet gene described in SEQ ID NO: 1 (II) Exon 1 on the T-bet gene described in SEQ ID NO: 1 Nucleic acid containing the gene polymorphic site at the 390th site contained therein (III) Nucleic acid having a sequence complementary to the nucleic acid of any of (I) and (II) above   14. The nucleic acid of claim 13, which is a primer and / or probe that detects a genetic predisposition marker for asthma.   An asthma genetic predisposition detection kit comprising the primer and / or probe of claim 14.   A method for screening a preventive and / or therapeutic agent for asthma, comprising a human T-bet gene expression regulatory region and a base sequence encoding a detectable expression product whose expression is controlled by the expression regulatory region A screening method comprising administering a candidate drug to an expression cell line containing a recombinant nucleic acid, and detecting expression of the expression product directly or indirectly. The screening method according to claim 16, wherein the expression regulatory region includes a promoter region, and the base form of the gene polymorphic site in the promoter region is either (iv) or (v).
(Iv) T
(V) C

Images