JP5111763B2 - Genetic predisposition test for bronchial asthma - Google Patents

Description

  The present invention relates to a method for examining a genetic predisposition to bronchial asthma, and more particularly to a method for obtaining information on whether or not the patient is susceptible to bronchial asthma based on a predetermined genetic polymorphism.

  In the base sequence in the human genome, it has been clarified that there are individual differences in sequence at many sites among individuals. This difference is a genetic polymorphism. This difference in sequence is considered to be a cause of diversity such as phenotype and susceptibility to disease (susceptibility) for each individual. A single nucleotide polymorphism (also called SNP: Single Nucleotide Polymorphism) is a gene that is defined to exist at a frequency of 1% or more in the population at a site where a single base difference occurs in the DNA base sequence between individuals. It is polymorphic and is said to have 3-10 million locations in the human genome. SNPs can cause qualitative and quantitative changes in gene expression, and are important as markers in genetic analysis because of their high frequency in the genome. Studies on the relationship between gene functions and polymorphisms, drug metabolism and efficacy It is used in the determination of disease and the search for disease-related genes.

  Research on disease-related genes using gene polymorphisms including single nucleotide polymorphisms has been conducted to clarify single nucleotide polymorphisms strongly associated with diseases, gene polymorphisms causing differences in susceptibility to diseases, etc. ing. By clarifying the single nucleotide polymorphism site causing the disease and the related substance to the disease by identifying the gene, determining the risk of disease by determining the difference in the base sequence of the gene polymorphism, elucidating the mechanism of disease onset Disease-related genes due to genetic polymorphisms, such as the presentation of prevention guidelines for diseases, the development of drug development by clarifying the onset mechanism and target of the disease, and the use of polymorphism information for clinical trials of drugs, etc. Search and identification research has attracted attention.

Bronchial asthma is a complex disease caused by a combination of genetic and environmental factors.
Bronchial asthma is characterized by airway inflammation and varying degrees of airflow limitation and exhibits paroxysmal cough, wheezing, and dyspnea. Airflow limitation exists from mild to fatal altitudes, and is naturally and at least partially reversible upon treatment. Airway inflammation involves infiltration of many inflammatory cells such as eosinophils, T cells (Th2), and mast cells, and damages to the airway mucosal epithelium are observed. (According to the 1998 revised version of Asthma Prevention and Management Guidelines (Non-patent Document 1) created by the Ministry of Health and Welfare)

  The number of bronchial asthma is on the rise worldwide. According to the National Institutes of Health (NIH), there are more than 150 million bronchial asthma patients worldwide. There are more than 3 million bronchial asthma patients in Japan, and the prevalence rate is 1.2% in 1961 compared with 3.0% in 1996, more than double that of 35 years ago, and in children 35 years ago It is said to be about 6 times, showing a marked increase.

Asthma has a risk of death due to severe seizures, and the number of deaths has been flat due to progress in management methods such as the use of inhaled steroids and leukotriene receptor antagonists due to the spread of recent asthma treatment guidelines, and severity assessment by peak flow measurement Although it is in a state, approximately 6,000 people have died per year due to difficulty breathing due to seizures.
The existence of a genetic predisposition in bronchial asthma has been studied by twins and families since the establishment of molecular biology techniques. It has been found that the prevalence of asthma among first-degree relatives starting from asthma patients is 6 to 7 times higher than that of the general population, and that there is family accumulation. In twins, the involvement of genetic predispositions has been shown in many reports, such as monozygotic twins having higher coincidence of traits than dizygotic twins (see Non-Patent Documents 2 and 3).

  MyD88 (Myeloid Differentiation primary Response Gene 88) is a human MyD88 cDNA cloned by Bonnert et al., And the protein has a molecular weight of 33 kD consisting of 296 amino acids. The C-terminal side of the protein has high homology with the cytoplasmic domain of type 1 IL1 receptor (IL1RAP) (see Non-Patent Document 4).

  Physiological functions in mice have been studied using MyD88 knockout mice. MyD88 knockout mice showed suppression of inflammatory cytokine production induced by toll-like receptors, decreased responsiveness to IL1, and loss of physiological functions mediated by natural killer cell activation to IL18. This indicates that MyD88 is an important substance in the signal transduction pathway of IL1 receptor or IL18 receptor (see Non-Patent Document 5).

  However, there is no report that the gene polymorphism associated with the MyD88 gene is associated with asthma.

Prepared by the Ministry of Health and Welfare Immune and Allergy Research Group Asthma Prevention and Management Guidelines 1998 Revised Edition Laitinen T, Rasanen M, Kaprio J, Koskenvuo M, Laitinen LA. Importance of genetic factors in adolescent asthma-A population based twin-family study. Am J Respir Crit Care Med 157: 1-6,1998 Lichtenstein P, Svartengren M. Genes, environments, and sex: factors of importance in atopic disease in 7-9-yearsold Swedish twins. Allergy 52: 1079-1086, 1997 Bonnert TP, Garka K, Parnet P, Sonoda G, Testa JR, Sims JE. The cloning and characterization of human MyD88: a member of an IL-1 receptor related family. FEBS Lett. , 402, 81-84, 1997 Adachi O, Kawai T, Takeda K, Matsukoto M, Tsutsui H, Sakagami M, Nakanishi K, Akira S. Targeted disruption of the MyD88 gene results in loss of IL-1-and IL-18-mediated fuction, Immunity, 9, 143-150, 1998

  As described above, prevention / treatment of bronchial asthma and elucidation of the onset mechanism are desired. Bronchial asthma is thought to be associated with a genetic predisposition, but if it becomes possible to predict the onset risk and severity of patients, effective lifestyle guidance and preventive measures that take into account individual constitutions can be performed. It becomes possible. In addition, identification of genes involved in bronchial asthma is an important guideline for the development of more effective treatment methods and therapeutic drugs.

  Under the circumstances as described above, the main object of the present invention is to clarify a genetic polymorphism associated with bronchial asthma and to provide a method for examining a genetic predisposition for bronchial asthma.

  The present inventors focused on MyD88 as a gene associated with susceptibility to bronchial asthma and searched for its SNP, and identified a gene polymorphism associated with the disease. The present invention has been completed based on such knowledge. Therefore, the above problem is solved by the present invention described below. That is, the present invention provides a MyD88 gene polymorphism as a genetic predisposition marker (onset risk factor) for bronchial asthma and a susceptibility test for bronchial asthma. Specifically, the following [1] to [ 12].

[1] A genetic predisposition test for bronchial asthma comprising a step of detecting a base form of a gene polymorphic site corresponding to the following (i) and / or (ii) in a nucleic acid collected from a subject.
(I) The 3830th base from the translation start point of the MyD88 gene in the base sequence described in SEQ ID NO: 1 (ii) The -9382nd position from the translation start point of the MyD88 gene in the base sequence described in SEQ ID NO: 1 Base [2] In the above [1], further comprising the step of comparing the base form of the gene polymorphic site identified from the subject-derived nucleic acid with the base form of the gene polymorphic site in the sequence of SEQ ID NO: 1. The gene predisposition test method described.
[3] A method for examining susceptibility to bronchial asthma, including the following steps (a) and (b):
(A) a step of detecting a base form of a gene polymorphic site corresponding to the following (i) and / or (ii) in a nucleic acid collected from a subject: (i) a MyD88 gene in the base sequence described in SEQ ID NO: 1 The base 3830 from the translation start point of (ii) in the base sequence described in SEQ ID NO: 1, the base −9382 from the translation start point of the MyD88 gene (b) the gene polymorphism identified from the nucleic acid derived from the subject Comparing the base form of the site with the base form of the gene polymorphism site in the sequence shown in SEQ ID NO: 1 to determine the genetic risk of developing bronchial asthma [4]
When the base form of the gene polymorphic site corresponding to (i) is G, and when the base form of the gene polymorphic site corresponding to (ii) is G,
If it falls under at least one of the above, the susceptibility testing method according to the above [3], wherein it is determined that the genetic risk of suffering from bronchial asthma is relatively high.
[5] In (b),
When the base form of the gene polymorphic site corresponding to (i) is A, and when the base form of the gene polymorphic site corresponding to (ii) is C,
The morbidity test method according to [3], wherein when it falls under at least one of the above, it is determined that the genetic risk of suffering from bronchial asthma is relatively low.
[6] The susceptibility testing method according to any one of [3] to [5], wherein the susceptibility of adult bronchial asthma is tested.
[7] A genetic predisposition marker which is a nucleic acid selected from the group consisting of the following (I), (II) and (III).
(I) Nucleic acid containing the 3830th gene polymorphic site from the translation start point of MyD88 gene in the base sequence described in SEQ ID NO: 1 (II) Translation start point of MyD88 gene in the base sequence described in SEQ ID NO: 1 To (III) a nucleic acid having a sequence complementary to the nucleic acid of any one of (I) and (II) [8] The following (I) and (II) And a nucleic acid having a base length of 10 or more that specifically hybridizes with at least one nucleic acid selected from the group consisting of (III).
(I) Nucleic acid containing the 3830th gene polymorphic site from the translation start point of MyD88 gene in the base sequence described in SEQ ID NO: 1 (II) Translation start point of MyD88 gene in the base sequence described in SEQ ID NO: 1 To (III) a nucleic acid having a sequence complementary to any one of the nucleic acids (I) and (II) [9] a genetic predisposition marker for bronchial asthma The nucleic acid according to [8] above, which is a primer and / or probe to be detected.
[10] A genetic predisposition detection kit for bronchial asthma comprising the primer and / or probe of [9] above.
[11] A method for testing the sensitivity of a prophylactic and / or therapeutic agent for bronchial asthma, comprising a human MyD88 gene expression regulatory region, and a base sequence encoding a detectable expression product whose expression is controlled by the expression regulatory region A sensitivity test method comprising: administering a candidate drug to an expression cell line containing a recombinant nucleic acid comprising: and detecting expression of the expression product.
[12] The expression regulatory region includes a sequence 5 ′ upstream of the MyD88 gene, and the base form of the gene polymorphic site in the 5 ′ upstream region is either (iv) or (v) The sensitivity test method according to [11] above.
(Iv) C
(V) G

  According to the present invention, it is possible to examine the genetic predisposition of bronchial asthma. Since the test subject's susceptibility (susceptibility) to bronchial asthma can be predicted, life guidance and the like for prevention of bronchial asthma can be achieved. In addition, the onset of bronchial asthma can be delayed and detected early. In addition, the knowledge obtained in the present invention can be used for elucidating the onset mechanism of bronchial asthma and developing patient information in clinical trials.

Hereinafter, the present invention will be described in detail.
As used herein, “polynucleotide” means a substance in which two or more nucleotides are linked by a phosphodiester bond. “Polynucleotide” includes “ribonucleotide (RNA)” and “deoxyribonucleotide (DNA)”. Here, DNA includes cDNA and genomic DNA. The “polynucleotide” is not limited to these, but also includes artificially synthesized nucleic acids such as peptide nucleic acids, morpholino nucleic acids, methyl phosphonate nucleic acids, S-oligonucleic acids.

  As used herein, the term “nucleic acid” is used synonymously or interchangeably with the “polynucleotide” and means DNA or RNA. Furthermore, the terms “nucleic acid” and “polynucleotide” refer to isolated nucleic acids and polynucleotides, unless otherwise specified, which substantially exclude cellular material, culture media when prepared by recombinant DNA techniques and the like. Refers to a nucleic acid or polynucleotide that is not contained in and is substantially free of precursor chemicals or other chemicals when chemically synthesized.

  In this specification, the abbreviations of amino acids, peptides, base forms, nucleic acids and the like are defined by the provisions of IUPAC (International Union of Pure and Applied Chemistry) or IUBMB (International Union of Biochemistry and Molecular Biology), “base sequence or amino acid sequence. "Guidelines for the creation of statements including specifications" (edited by the Japan Patent Office) and customary symbols in this field. As used herein, “base form” refers to the type or sequence of bases. In addition, thymine (t) when the polynucleotide is DNA is uracil (u) for RNA, and can be read with each other unless otherwise specified. Information such as base form and amino acid sequence can be digitized and handled on a computer.

  As used herein, “gene polymorphism” means that the nucleotide sequence on the human genome is different among individuals or the sequence type is different. A “single nucleotide polymorphism (SNP)” refers to a gene polymorphism that appears as a single nucleotide nucleic acid difference. Further, the “nucleic acid fragment” refers to a nucleic acid having a partial sequence and / or a full-length sequence. The “gene region” refers to a translation region encoding a protein and / or a transcription region other than the protein coding region, a promoter, an intron region, and a non-translation region such as a function unidentified region near the gene.

  In the present specification, the “gene polymorphic site” refers to a site where there is a difference in the base form detected as the gene polymorphism. Polymorphisms can be identified as mutations such as base substitutions, deletions, and additions to a single base sequence. There may be a difference in the number of bases of the sequence due to deletion, addition, etc., but in this case, it can be specified by aligning the sequences as a site corresponding to the reference sequence. As one form of alignment, it is possible to align a sequence by processing a base sequence as electronic information on a computer. For example, by using various algorithms and software used in homology search such as FASTA, BLAST, etc., it is possible to align two types of sequences and specify corresponding sites. It can also be identified by comparing the base sequences of individuals using the Sequencher program.

  As used herein, “specifically hybridizes” is synonymous with the term “hybridizes under stringent conditions,” recognized by those skilled in the art, and includes two nucleic acids (or fragments). ) Sambrook, J., “Expression of cloned genes in E. coli”, Molecular Cloning: A laboratory manual, Cold Spring Harbor Laboratory Press, USA, 1989, pp. 9.47-9.62, pp. It means to hybridize with each other under the hybridization conditions described in 11.45-11.61.

  More specifically, the “stringent condition” refers to washing with 6.6 × SSC at about 45 ° C. and then washing with 2.0 × SSC at 50 ° C. For the selection of stringency, the salt concentration in the washing step can be selected, for example, from about 2.0 × SSC, 50 ° C. as low stringency to about 0.2 × SSC, 50 ° C. as high stringency. it can. Furthermore, the temperature of the washing step can be increased from a low stringency condition of about 22 ° C. to a high stringency condition of about 65 ° C.

  The origin of the nucleic acid test sample (also referred to as a specimen) used in the present invention is not limited as long as it is an arbitrary biological sample. For example, blood, skin, tissue, oral mucosal cells and the like are preferably used in view of the ease of collecting a sample, the content thereof, and the type of extraction reagent. In addition to the extracted genomic DNA, the sample may contain a partial base sequence of genomic DNA. That is, before analysis of a single nucleotide polymorphism site, a sample obtained by amplifying all or part of a base sequence (DNA fragment) that matches the purpose in a sample nucleic acid by any suitable method, such as PCR, is used as a nucleic acid test sample. May be used. DNA extraction can be performed using a known method, for example, a commercially available extraction kit such as “QIAamp mono kit” (manufactured by QIAGEN).

  The primer used in the present invention can be prepared by any suitable production method such as a chemical synthesis method. The primer contains a gene polymorphism on the MyD88 gene region, and does not contain a gene polymorphic site in the primer. Primers designed as such are preferred. The primer may have any suitable length that matches the detection method used, but is 10 nucleotides or longer, preferably 15 to 50 nucleotides, more preferably 15 to 30 nucleotides. Specifically, such a primer can be synthesized using, for example, an automatic synthesizer as a forward primer and a reverse primer based on single nucleotide polymorphism sites and / or base sequence information in the vicinity thereof.

  A primer may carry one or more labels if desired. Preferred labels include enzymes, biotin, fluorescent materials, haptens, antigens, antibodies, radioactive materials and luminophores. The primer preferably has a sequence complementary to the template nucleic acid, but if necessary, one or more non-complementary base pairs (mismatches) are introduced into the primer unless an undesirable effect occurs. Also good.

  The polynucleotide probe used in the present invention can be prepared by any suitable synthesis method. The polynucleotide probe may have any suitable length that matches the detection method and the like, but is 10 nucleotides or more in succession, preferably 15 to 50 nucleotides, more preferably 15 to 30 nucleotides. The probe includes a base sequence complementary to an allele of any one of the corresponding gene polymorphic sites in the MyD88 gene region. However, if necessary, one or more non-complementary base pairs may be introduced as long as the polynucleotide probe does not have an undesirable effect. Also, the probe may carry one or more labels, like the primer.

  The present invention also includes a nucleic acid fragment containing one or more gene polymorphic sites. For example, a nucleic acid amplified so as to include the gene polymorphic site by PCR or the like using a primer having a nearby sequence not including the gene polymorphic site. Nucleic acids containing one or more gene polymorphic sites may be present on separate nucleic acid fragments, such as multi-primer PCR amplification products, or there may be multiple gene polymorphisms on consecutive nucleic acid fragments May be. The length of the nucleic acid fragment is preferably 15b to 1 kb in consideration of conditions such as the limit of the amplifiable length of the sample in PCR, the accuracy of base complementation in the extension reaction, and the ease of analysis. Such a nucleic acid fragment can be used as a sample for determination of a gene polymorphism site, a probe for a chip microarray, or the like as a sample such as base sequence analysis (sequence) or SSCP. The nucleic acid fragment may carry one or more labels if necessary.

  Many methods are known as methods for detecting gene polymorphisms. For example, nucleotide sequence analysis (sequence), invader assay, Taqman PCR, base determination by MS (Mass Spectrometer), pyro sequencing, SnaPshot, allele specific primer method, restriction fragment length polymorphisms (RFLP), Detection of gene polymorphism by hybridization such as DNA microarray, SPR (surface plasmon resonance), SSCP (Single Strand Conformation Polymorphism), heteroduplex analysis, WAVE system (detection of base difference by chromatography), molecular beacon (Sniper method, etc.) ) And the like.

  The invader assay uses a detection reaction with cleavase, an allele-specific probe and a FRET probe. If the allele-specific probe is complementary to the polymorphic site and a triple chain is formed, the cleavase reaction proceeds and fluorescence is generated. It is a method of doing.

  Taqman PCR is a PCR using a Taqman probe and a PCR primer having a sequence complementary to each allele of the gene polymorphism part in the probe, and when the base sequence of the single nucleotide polymorphism site in the Taqman probe is complementary. In this method, fluorescence is generated.

  Base determination by MS is a method in which a single base extension reaction is performed using primers up to immediately before the gene polymorphism part, and the extended base is mass analyzed by MS.

Pyrosequencing is a method in which pyrophosphate generated in a base extension reaction is converted to ATP, measured by bioluminescence, and the presence or absence of complementary strand synthesis is determined by luminescence.
SnaPshot is a method in which a single base extension reaction using labeled ddNTP (a different label for each of four types of bases) is performed using primers up to immediately before the gene polymorphism site, and the extended base is discriminated by the type of label.

  The allele-specific primer method is designed to control the presence of primers and amplification products in PCR by designing primers that extend by PCR when the sequence of the gene polymorphism site is complementary, but not when mismatched. This is a method for determining genetic polymorphism.

  In any of such known detection methods, a desired gene polymorphism site can be detected according to the test method of the present invention using the probe, the primer, and / or the polynucleotide of the present invention. it can.

  In one embodiment of the present invention, a genetic polymorphism associated with the development of bronchial asthma can be detected, for example, as follows.

  Using a specimen from a bronchial asthma patient group (for example, an adult asthma patient group), a genetic polymorphism is determined, and a primary candidate polymorphism is selected from the genetic polymorphism (primary screening). Furthermore, the candidate polymorphism is narrowed down by increasing the number of specimens (secondary screening). On the other hand, the gene polymorphism of the candidate polymorphic site is similarly determined for the specimen from the control group of healthy subjects. Gene polymorphisms related to bronchial asthma are identified from the search results of disease-related gene polymorphisms by the creation of a high-density genetic polymorphism map of these gene polymorphisms and related analyzes such as patient-control studies. That is, the genetic polymorphism associated with the disease by these analyzes causes a significant difference in the allele appearance frequency between the bronchial asthma patient group and the control group.

Thus, in the present invention, polymorphisms were identified in the 5 ′ upstream region and 3′UTR (Untranslated Region) region of the MyD88 gene shown in (i) and (ii) below.
(I) the 3830th position of the sequence described in SEQ ID NO: 1 (ii) the -9382th position of the sequence described in SEQ ID NO: 1

  The sequence of SEQ ID NO: 1 shows the nucleotide sequence of the region from 38145157 to 38159514 of human chromosome 3, including the MyD88 gene. The base shown in the above (i) is the base number 13869 position of SEQ ID NO: 1, and the base shown in the above (ii) is the base number position 658 of SEQ ID NO: 1.

  FIG. 1 shows the polymorphic site in the MyD88 gene. The first gene polymorphic site 3830th shows the gene polymorphic site of (i) present in the 3′UTR region (untranslated region) of the structural gene. The second gene polymorphism site indicates a gene polymorphism site in the 5 ′ upstream region (ii) of the structural gene.

ATG A (adenine) encoding methionine which is the translation start point of the MyD88 gene in the sequence described in SEQ ID NO: 1 is the base “A” at base number position 10040 of SEQ ID NO: 1, It is the 38155196th base. The base shown in (i) is present at the 3830th position when the translation start point “A” is counted as the first position (starting point), and corresponds to the 381559025th position of human chromosome 3. The base (ii) corresponds to the position −9322 from the starting point, and corresponds to the 38145814th position of human chromosome 3. In the sequence of SEQ ID NO: 1, the 38157781 position is a stop codon for MyD88 translation.
In addition, throughout this specification, when referring to the base in SEQ ID NO: 1, instead of the actual base number in the base sequence, a number starting from “A” that is the translation start point may be indicated.

  In the test method of the present invention, nucleic acid is collected from a subject, and the base form is detected for the MyD88 gene polymorphic site corresponding to (i) and / or (ii) in the nucleic acid. The above descriptions (i) and (ii) specify the location where the genetic polymorphism in the MyD88 gene appears. The part corresponding to the above (i) and (ii) can be specified by performing sequence alignment. Sequence alignment is as described above. Further, (i) and (ii) specify the site, and the site may be specified using the entire sequence of SEQ ID NO: 1, or in the base sequence of SEQ ID NO: 1, from 10 including the site. A sequence consisting of about 30 bases, more specifically, a base sequence consisting of about 5 to 15 bases before and after sandwiching the site, more preferably about 10 bases before and after, can be extracted and specified as a nucleic acid fragment.

  In the test method of the present invention, the base form specified from the nucleic acid derived from the subject is compared with the base form described in SEQ ID NO: 1. The base form in the sequence of SEQ ID NO: 1 is “A” as (i), and “G” as (ii), and (i) and / or (ii) ) Will be compared with the base form of the site corresponding to.

  A polynucleotide consisting of or containing the base forms listed above is a genetic predisposition marker for bronchial asthma, and bronchial asthma by detecting each marker in the test method of the present invention, as a more suitable target It will be possible to examine the genetic predisposition for bronchial asthma.

  As will be described in detail in the following examples, the present inventors have clarified the relationship between the above-mentioned genetic predisposition and susceptibility to bronchial asthma. That is, by identifying the genetic predisposition marker of the subject, the subject's susceptibility to bronchial asthma can be examined from a genetic viewpoint.

  (I) In the base sequence described in SEQ ID NO: 1, in the case of the 3830th position from the translation start point of the MyD88 gene, a gene polymorphism having a base form of “A” is often found in healthy subjects. In contrast, gene polymorphisms with “G” at the same site are often seen in patients with bronchial asthma. Therefore, if the base form of the 3830th site of the subject is “A”, it can be determined that the genetic risk of developing bronchial asthma is relatively low. On the other hand, if the base form of the 3830th portion of the subject is “G”, it can be determined that the genetic risk of developing bronchial asthma is relatively high.

  (Ii) Among the nucleotide sequence set forth in SEQ ID NO: 1, as for the −9322 gene polymorphism from the translation start point of the MyD88 gene, there are many “C” in healthy subjects, and “G” in patients with bronchial asthma. There are many. Therefore, when the subject's −9382nd base form is “C”, it can be determined that the genetic risk of developing bronchial asthma is relatively low. On the other hand, if the test subject's −9382th base form is “G”, it can be determined that the genetic risk of developing bronchial asthma is relatively high.

  About (i) and the polymorphic site | part of (ii), you may test | inspect only about any one, More preferably, you may test | inspect about both (i) and (ii). The haplotype consisting of a combination in which the 3830th is “A” and the −9382 is “C”, and the haplotype consisting of a combination in which the 3830th is “G” and the −9382 is “G”, respectively. Probability of developing bronchial asthma from a genetic standpoint, particularly in subjects with haplotypes where 3830th is “A” and −9382 is “C” Is relatively low.

According to another embodiment of the present invention, the inspection can be performed as follows.
A nucleic acid sample (eg, tissue, cell, blood, etc.) is collected from the subject, and DNA or genomic DNA is extracted according to a conventional method. The obtained DNA sample was amplified by PCR (region including genetic predisposition marker), and various polymorphic sites (i) and (ii) of MyD88 gene region were detected using various single nucleotide polymorphism detection methods. Among them, the type of genetic polymorphic base at one or more locations is determined. As described above, the state of the individual is determined with reference to the determined MyD88 gene polymorphism from the correlation between the SNPs obtained from the association analysis and the pathological condition (including severity) of bronchial asthma.

  More specifically, PCR is performed in the region containing the genetic predisposition marker of the DNA sample, 1) the type of base is determined by the SSCP method, or 2) the PCR amplification product is directly sequenced (Sanger method or Maxam). -Gilbert method). Alternatively, using a probe that specifically hybridizes to a region containing a genetic predisposition marker, a polymorphic site is directly detected from the DNA sample or its PCR amplification product (such as an invader assay). Furthermore, a single base extension reaction is performed using a primer having a sequence up to the vicinity of the genetic predisposition marker (immediately before), and the extended base is analyzed by MS (mass spectrometer).

The polynucleotide of the present invention is suitable for detection and analysis of the polymorphic site. That is, the probe or primer specifically hybridizes with at least one nucleic acid selected from the group consisting of (I), (II) and (III) below, and (I), (II) and It is a primer that can contain at least one nucleic acid selected from the group consisting of (III) in the amplification product. Specific forms such as the primer base length are the same as described above.
(I) Nucleic acid containing the 3830th gene polymorphic site from the translation start point of MyD88 gene in the base sequence described in SEQ ID NO: 1 (II) Translation start point of MyD88 gene in the base sequence described in SEQ ID NO: 1 To (III) a nucleic acid having a sequence complementary to the nucleic acid of any one of (I) and (II) above

  In the present invention, the probe and primer of the present invention are preferably provided as a test kit containing each of them as an active ingredient. In particular, the test kit of the present invention comprising a primer may contain DNA polymerase, four types of deoxynucleotide triphosphates (dNTPs), a size marker, and the like. Furthermore, an appropriate buffer, cleaning agent, reaction stop solution and the like may be included.

  In addition, the probes and primers of the present invention can also be used for detection of antibodies specific for the MyD88 gene polymorphism.

  The test kit of the present invention is intended for detection of a genetic predisposition marker for bronchial asthma. If necessary, the test kit is combined with a test kit for other disease-related factors (markers), and the test results indicate that A complex state can be determined.

The polymorphism (ii) is contained in the 5 ′ upstream region of MyD88 and is considered to be related to the transcriptional activity of MyD88. Specifically, in the nucleotide sequence set forth in SEQ ID NO: 1, MyD88 transcription activity is greater in the case of “C” than in the case where the sequence at the −9322 site from the translation start point of the MyD88 gene is “G”. Increase was confirmed. Based on such knowledge, the present invention also provides a sensitivity test method for testing and judging the sensitivity of a prophylactic and / or therapeutic agent for bronchial asthma. The susceptibility test method of the present invention administers a candidate drug to a cell line containing a recombinant nucleic acid comprising a human MyD88 gene expression regulatory region and a base sequence encoding a detectable protein whose expression is regulated by the expression region. And detecting the expression of a detectable expression product whose expression is controlled by the expression regulatory region, for example, the expression of mRNA and / or protein. In a preferred embodiment, the expression control region includes a 5 ′ upstream sequence of the MyD88 gene, and the 5 ′ upstream region includes any of the following bases (iv) or (v): Can be mentioned. Although screening is repeated many times in the drug discovery process, the present invention is suitable as one of relatively early screening methods.
(Iv) C
(V) G

That is, the sensitivity test method of the present invention estimates the effect of a candidate compound by preparing a transformant incorporating a detectable expression product and measuring the expression level and activity of the mRNA and / or protein. To get information to do. The base (iv) or (v) described above is incorporated into the position −9382 in the 5 ′ upstream region of the MyD88 gene. The detectable expression product is not particularly limited as long as its expression can be detected, and examples thereof include various fluorescent proteins, luminescent proteins, generating enzymes, degrading enzymes, and resistance genes. Construction of an expression cell line such as a protein, such as production of an expression vector and a transformant, can be performed according to a standard method described in Molecular Cloning (3rd.ed, Cold Spring Harbor Laboratory Press).

  As one preferred form, for example, (iv) in the case of expressing a gene having a C sequence, if the expression level is reduced due to the presence of a candidate drug, a disease associated with overexpression of MyD88, more specifically, In particular, it can be a preventive / therapeutic agent for bronchial asthma and the like. As another embodiment, it is also possible to test the difference in the effect of the drug due to individual differences by testing the difference in the expression level due to the administration of the candidate drug for each expression system of (iv) and (v) It is.

  EXAMPLES Hereinafter, although an Example demonstrates this invention in more detail, this invention is not limited to these Examples.

Example 1
In order to evaluate whether genetic variants of MyD88 are associated with susceptibility to bronchial asthma, analysis of MyD88 gene polymorphisms was performed.

  All subjects suffering from asthma were diagnosed based on a slightly modified version of the National Institute of Health diagnostic criteria (National Institutes of Health, National Heart, Lung and Blood Institute 1997). The diagnosis of atopic asthma is based on whether it is positive for one or more allergens or if the total IgE in the serum is 400 kU / L or higher (Mao XQ, Shirakawa T, Yoshikawa T, Yoshikawa K, Kawai M, Sasaki S, Enomoto T, Hashimoto T, Furuyama J, Hopkin JM, Morimoto K. Association between genetic variants of mast-cell chymase and eczema, Lancet 1996; 348: 581-3.). As a control (control group), 559 individuals were randomly selected from the population who did not have atopic related diseases (age range 18-83 years, average age 44 years; male: female = 2.61: 1) 0.0). All races are Japanese, and everyone participates in the research in accordance with the rules of the Research Ethics Committee at the Institute of Phisical and Chemical Research (RIKEN), SNP Research Center. Written informed consent was obtained.

  Polymorphisms were detected by genotyping (genotyping) using Taqman system (Applied Biosystems, Foster City, CA, USA) or invader assay (Third Wave Technologies, Inc.). The specific method of genotyping followed the attached manual. Moreover, genotyping (genotyping) is performed by PCR-RFLP (PCR restriction fragment length polymorphism) analysis using EcoT22I, and the polymorphism of “A or G” is present in the untranslated region (UTR) at the 3 ′ end. The site was detected. This gene polymorphic site at the 3 ′ end is located at the 3830th position (SEQ ID NO: 1) based on the translation start point of the sequence of SEQ ID NO: 1 (10039th position of base sequence described in SEQ ID NO: position 3155196 of human chromosome 3). (Base number 14357 position: position 3145814 of SEQ ID NO: 1).

PCR-RFLP was performed according to a conventional method. That is, using a forward primer and a reverse primer having the following base sequences (each base sequence is as shown in SEQ ID NOs: 2 and 3 in the sequence listing), followed by heating at 95 ° C. for 2 minutes, 94 37 cycles of 30 ° C., 30 seconds, −55 ° C., 30 seconds, −72 ° C., and 30 seconds were performed, followed by PCR at 72 ° C. for 7 minutes. After digestion of the amplified product with the restriction enzyme EcoT22I, the length of the digested product was measured by electrophoresis. When the digestion product length was 120 bp, AA was determined, when 145 bp, GG, and when 2 products of 120 bp and 145 bp were recognized, AG was determined.
Forward primer sequence 5 'CCTAACCCATGTCCCTGAAC 3'
Reverse primer sequence 5 'TTTTGCTCTCTTCCTCTCTCTGTGATGCA 3'
PCR is described in Molecular Cloning (3rd. Ed), Cold Spring Harbor Laboratory Press, etc., and restriction enzyme cleavage is described in Molecular Cloning (2nd. Ed), Cold Spring Harbor Laboratory Press, etc.

  Allele frequencies in asthma and in controls were generated by contingency tables and compared by chi-square test. All genotype frequencies for the control population in this study followed the Hardy-Weinberg equilibrium. Samples taken from patients with control and adult asthma were analyzed.

As shown in Table 1, the gene polymorphism at the 3830th site from the translation start point of the MyD88 gene was highly related to adult asthma (p (significance probability) = 0.000083).
Also, - 9382 th monobasic including 3830-th region from the polymorphic site (- 9382, -5945, -5455, -5215, -5042, -1930,1803,3776,3830,4058,5129,11173) typing Then, 23 persons confirmed the linkage disequilibrium with the No. 3830. As a result, the number of major alleles and the number of minor alleles of No. 3830 was 35/11 (number of major alleles / number of minor alleles), whereas No. 9382 was 34/12, and linkage disequilibrium was observed between them. Other single nucleotide polymorphism sites were 45/1 to 44/2, and no linkage disequilibrium with 3830 was observed. From this, it was clarified that the polymorphism No. 9382 has a strong linkage disequilibrium relation with the polymorphism No. 3830.

  Furthermore, the genotype was analyzed using the above polymorphism. As shown in Table 1, the present inventors examined the relationship between the genotype of the 3830th polymorphism and adult asthma, and found that the AA type was significantly less than the AG or GG type. We found a large proportion of adults with asthma.

  MyD88 is a molecule that transmits innate immune system signals, and as a result, is known to cause various innate immune responses such as antiviral action and inflammatory reaction. Asthma symptoms are known to be often exacerbated by respiratory infections. The mechanism by which infection contributes to exacerbation of asthma is not clear, but it is known that the innate immune system is activated as a defense function at the forefront of infection and as a link to acquired immunity. As described above, the present inventors have revealed that two gene polymorphisms related to the MyD88 gene are involved in the development of asthma. Knowing the MyD88 gene polymorphism is expected to contribute to the prevention and treatment of asthma.

  The present invention is useful in the fields of examination, diagnosis, prevention, treatment, drug discovery and the like related to bronchial asthma.

It is a figure which shows the exon position of a MyD88 gene, and the outline of SNP.

Claims (6)

A genetic predisposition test method for bronchial asthma, comprising a step of detecting a base form of a gene polymorphic site corresponding to the following (i) and / or (ii) in a nucleic acid collected from a subject.
(I) The 3830th base from the translation start point of the MyD88 gene in the base sequence described in SEQ ID NO: 1 (ii) The -9382nd position from the translation start point of the MyD88 gene in the base sequence described in SEQ ID NO: 1 base   The genetic predisposition test according to claim 1, further comprising a step of comparing the base form of the gene polymorphic site identified from the nucleic acid derived from the subject with the base form of the gene polymorphic site in the sequence shown in SEQ ID NO: 1. Method. A method for testing susceptibility to bronchial asthma, comprising the following steps (a) and (b):
(A) a step of detecting a base form of a gene polymorphic site corresponding to the following (i) and / or (ii) in a nucleic acid collected from a subject: (i) a MyD88 gene in the base sequence described in SEQ ID NO: 1 The base 3830 from the translation start point of (ii) in the base sequence described in SEQ ID NO: 1, the base −9382 from the translation start point of the MyD88 gene (b) the gene polymorphism identified from the nucleic acid derived from the subject Comparing the base form of the site and the base form of the gene polymorphism site in the sequence of SEQ ID NO: 1 to determine the genetic risk of developing bronchial asthma In (b) above,
When the base form of the gene polymorphic site corresponding to (i) is a combination of GG or GA , and when the base form of the gene polymorphic site corresponding to (ii) is a combination of GG or GC ,
The morbidity test method according to claim 3, wherein when it falls under at least one of the conditions, it is determined that the genetic risk of suffering from bronchial asthma is relatively high. In (b) above,
When the base form of the gene polymorphic site corresponding to (i) is a combination of AA , and when the base form of the gene polymorphic site corresponding to (ii) is a combination of CC ,
The morbidity test method according to claim 3, wherein if it falls under at least one of the conditions, it is determined that the genetic risk of suffering from bronchial asthma is relatively low.   The susceptibility test method according to any one of claims 3 to 5, wherein the susceptibility of adult bronchial asthma is tested.

Images