JP2006067944A - Synapse maturation-disordered model animal - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a model animal having only disordered synapse maturation but having normal other drebrin-associated functions and a method for screening a candidate treating agent of the synapse maturation disorder by using the model animal. <P>SOLUTION: The drebrin A knockout mouse is prepared by isolating a mouse-derived drebrin gene, preparing a targeting vector inserted with loxP sequences so as to nip a drebrin A specific exon 11A, performing a homologous recombination for ES (embryonic stem) cells, transducing the recombinant ES cells into individuals, obtaining descendants F1 having the recombinant gene by using chimera individuals having the body cells derived from the ES cells in a high ratio as parents and mating the individual F1 with a mouse expressing Cre gene to obtain individual bodies losing the drebrin A specific exon 11A nipped by 2 loxP sequences, and mating the female and male of the individuals. <P>COPYRIGHT: (C)2006,JPO&NCIPI

Description

  The present invention relates to a synaptic maturity disorder model animal, a screening method for a prophylactic / therapeutic agent for synapse maturation disorder using the synapse maturation disorder model animal, and a test method for identifying a therapeutic agent for synapse maturation disorder.

  The present inventors have discovered the world's first actin-binding protein Drebrin (Drebrin) that is highly expressed in developing neurons (see, for example, Non-Patent Documents 1 and 2), and this drebrin changes the properties of actin fibers. It is involved in the morphogenesis of neurons, particularly the formation of protrusions (see, for example, Non-Patent Documents 3 to 5), and in neurons that are moving during development, they exist in the entire cell body and protrusions, It has already been proved that mature neurons specifically exist in the spine structure (see, for example, Non-Patent Documents 6 to 8). There are two isoforms of drebrin: embryonic type drebrin E and adult type drebrin A (see, for example, Non-Patent Document 9), and spines of mature neurons Drebrin A, which is specifically found in, is characterized by being expressed only in nerve cells (see, for example, Non-Patent Documents 10 and 11). Drebrin A has a sequence in which a region called “ins2” is added to drebrin E by an alternative splicing mechanism. That is, gtcgtccgtactgccctttcataaaggcatcggacagtggcccctccttcctcctct cccctcccctccctccctcccctccctatccctatccctgtcctcc In addition, the present inventors have found that when drebrin A is expressed in primary cultured neurons, it automatically gathers in the dendritic spine and increases its length. This discovery is the first report in the world where it has been discovered that the form of spine can be changed by changing the amount of protein synthesis (for example, see Non-Patent Document 13).

J. Neurochem. 44, 1210-1216, 1985 J. Biochem. 117, 231-236, 1995 J. Neurosci. Res. 38: 149-159, 1994 Exp. Cell Res. 215: 145-153, 1994 J. Biol. Chem. 269: 29928-29933, 1994 J. Neurosci. 15: 7161-7170, 1996 Dev. Brain Res. 29, 233-244, 1986 Brain Res. 413, 374-378, 1987 J. Biochem. 117, 231-236, 1995 Dev. Brain Res. 29, 233-244, 1986 Brain Res. 413, 374-378, 1987 Mol. Brain Res. 19, 101-114, 1993, Neuroreport 3, 109-112, 1992 J. Neurosci. 19, 3918-3925, 1999

  It has been found that a decrease in the actin-binding protein drebrin A of the dendritic spine causes a disorder in synaptic function, and a possibility of developing a therapeutic drug for synaptic dysfunction using this technique has been considered. However, when the expression of drebrin A is decreased in the conventional technique, the total amount of drebrin is decreased and the suppression of expression varies between animals. Therefore, it is possible to produce a large number of animals that suppress drebrin A expression. It was difficult. An object of the present invention is to provide a model animal in which only synapse maturation is impaired and other drebrin-related functions are normal, and a method for screening a candidate therapeutic drug for synapse maturation disorder using the model animal.

  The present inventors have intensively studied to solve the above problems, isolated a mouse-derived drebrin gene, prepared a targeting vector having a loxP sequence inserted so as to sandwich a drebrin A-specific exon 11A, and applied it to ES cells. Homologous recombination is performed, recombinant ES cells are introduced into an individual, a chimera individual having a high proportion of ES cell-derived somatic cells as a parent, a progeny F1 having a recombinant gene is obtained, and this individual F1 and Cre gene are expressed By mating with a mouse, an individual in which the drebrin A specific exon 11A sandwiched between two loxP sequences was deleted was obtained. It was found that the drebrin A knockout mouse obtained by crossing the male and female became a model animal in which only the synapse maturation was impaired and other drebrin-related functions were normal, and the present invention was completed.

  That is, the present invention is a non-human mammal obtained by ontogenizing a totipotent cell having a mutant gene in which the region containing exon 11a of the drebrin gene is deleted, and its progeny animal, wherein the drebrin is incorporated in the somatic cell chromosome. A synaptic maturation disorder model animal comprising a non-human animal having a mutated gene, losing the function of expressing drebrin A, and having the function of expressing drebrin E instead of drebrin A (Claim 1), Cre-loxP A synaptic maturation disorder model animal according to claim 1 or a region containing exon 11a of the drebrin gene, wherein the region contains exon 11a of the drebrin gene. The deleted mutant gene is a mutation in which all of exon 11a and part of exon 11b of the drebrin gene are deleted. The synapse according to any one of claims 1 to 3, wherein the synapse maturation disorder model animal (claim 3) or the non-human animal is a mouse. The present invention relates to a maturity disorder model animal (Claim 4).

  Further, the present invention provides a method for improving long-term potentiation of hippocampal synaptic transmission induced by tetanus stimulation by administering a test substance to a synaptic maturation disorder model animal according to any one of claims 1 to 4 before or after birth. A method for screening a prophylactic / therapeutic agent for synaptic maturation disorder to evaluate the degree (Claim 5), or a candidate for synaptic maturation disorder before or after birth for a synaptic maturation disorder model animal according to any one of claims 1 to 4. A test method for administering a therapeutic agent and identifying a therapeutic agent for synaptic maturation disorder using the degree of improvement in long-term potentiation of hippocampal synaptic transmission induced by tetanus stimulation (Claim 6), or any one of Claims 1 to 4 A prophylactic / therapeutic agent for synapse maturation disorders, wherein a test substance is administered to nerve cells derived from the described synapse maturation disorder model animals and the degree of synapse maturation disorders is evaluated A candidate therapeutic drug for synaptic maturation disorder is administered to a neuron derived from a synaptic maturation disorder model animal according to any one of claims 1 to 4 and a cleaning method (Claim 7), and the synapse is evaluated using the degree of synapse maturation disorder as an index The present invention relates to a test method for identifying a therapeutic agent for maturation disorder (claim 8).

  By using the synaptic maturity disorder model animal of the present invention, it becomes possible to screen for therapeutic drugs for synaptic maturity disorders and to test for identifying therapeutic drugs for synaptic maturity disorders.

  As a model animal for synaptic maturation disorder of the present invention, an allopotent cell having a mutant gene lacking the region containing exon 11a of the drebrin gene (drebrin mutant gene into which an isoform-invertible mutation has been introduced) is individually generated. The obtained non-human mammal and its progeny animals have the above-described drebrin mutant gene in the somatic chromosome, do not lose the function of expressing drebrin A, and have the function of expressing drebrin E instead of drebrin A The nonhuman animal is not particularly limited as long as it has a nonhuman animal, and examples of the nonhuman animal include mice, rats, rabbits, guinea pigs, hamsters, etc., and rodents such as mice can be preferably exemplified. it can. Moreover, the above-mentioned non-isoform-convertible type means that as a result of introducing a mutation, it does not convert to drebrin A. As the totipotent cells, ES (embryonic stem) cells, EG (embryonic germ) cells ES cells are established in mice, rats, monkeys, rabbits, and EG cells are established in pigs.

  Examples of the mutant gene in which the region containing exon 11a (ins2) of the drebrin gene is deleted include all or part of exon 11a of exogenous drebrin A gene and part of exon 11b of non-human animals. The exon 11a and the exon 11b are not transcribed, but the exon 11c is transcribed because it is not inactivated. As a result, drebrin E is expressed instead of drebrin A. Although it is not particularly limited as long as it is a drebrin mutant gene, it is preferably a mutant gene in which the region containing exon 11a of the drebrin gene is deleted using Cre-loxP, and in particular, all of exons 11a of the drebrin gene and one of exon 11b Particularly preferred is a mutated gene having a deleted portion. Hereinafter, a case where the non-human animal is a mouse will be described as an example.

  The synaptic maturation disorder model mouse of the present invention was screened for a mouse gene library using the drebrin A-specific insertion sequence shown in SEQ ID NO: 1 (corresponding to ins2, exon 11a) as a probe, and was positive containing the coding region of drebrin. The clone was cleaved with several restriction enzymes, a fragment containing the drebrin A specific insertion sequence (ins2) was isolated, and a neo-resistant gene sandwiched with loxP upstream of exon 11a and frt downstream by ex. Furthermore, another loxP is inserted downstream from this, and a gene such as a diphtheria toxin A fragment (DT-A) gene or a herpes simplex virus thymidine kinase (HSV-tk) gene is introduced into the 5 ′ end side to target vector. Or screen the drebrin A gene All or part of exon 11a and part of exon 11b of the drebrin A gene thus screened are replaced with a marker gene such as a neomycin resistance gene by homologous recombination, etc., and a diphtheria toxin A fragment on the 5 ′ end side A targeting vector is constructed by introducing a gene such as a (DT-A) gene or a herpes simplex virus thymidine kinase (HSV-tk) gene, the constructed targeting vector is linearized, and an electroporation method The ES cells are introduced into ES cells by the like, homologous recombination is performed, and ES cells that are resistant to antibiotics such as G418 and gancyclovir (GANC) are selected from the homologous recombinants. It is preferable to confirm whether or not the selected ES cell is the target recombinant by Southern blotting or the like.

  The recombinant ES cell is microinjected into a blastocyst of a mouse, and the blastocyst is returned to a temporary parent mouse to produce a chimeric mouse. When this chimeric mouse is mated with a wild-type mouse, a heterozygous mouse can be obtained, and a drebrin knockout mouse can be obtained by mating this heterozygous mouse. As a method for confirming that the drebrin gene in the drebrin knockout mouse is deficient on the chromosome, for example, genomic DNA is isolated from the mouse tail and examined by Southern blotting, or extracted from this mouse. Examples thereof include a method for examining proteins by immunoblot analysis and the like.

  For example, if the Cre-loxP system is used to delete the region containing exon 11a of the drebrin gene, it becomes possible to introduce mutations specifically in the brain, causing synaptic maturation disorder (synaptic vulnerability). Therefore, the mutant gene constructed so that the region containing exon 11a of the drebrin gene is deleted by using Cre-loxP becomes a model of various human psychiatric disorders. In place of the Cre-loxP system derived from the bacteriophage P1, the FLP-FRT system derived from Saccharomyces cerevisiae, the R-RS system derived from soy sauce yeast (Zygosaccharomyces rouxii), and the Gin-gix system derived from bacteriophage Mu Can be used.

  The synaptic maturity disorder model animal of the present invention is useful for analyzing the mechanism of the onset of synapse maturation disorder. When the synaptic maturation disorder model animal of the present invention is used, screening for synaptic maturation disorder therapeutic drugs and therapeutic drugs for synaptic maturation disorders Enables specific tests. That is, using such a synaptic maturation disorder model animal, screening for a prophylactic / therapeutic agent for synaptic maturation disorders such as schizophrenia, schizophrenic behavior, depression, senile brain function decline, Alzheimer's disease, Parkinson's disease, Tests can be conducted to identify these therapeutic agents for synaptic maturation disorders.

  As a method for screening a prophylactic / therapeutic agent for synaptic maturation disorder of the present invention, a test substance is administered before or after birth to the synaptic maturation disorder model animal of the present invention, and the degree of behavioral change and / or A method for evaluating the degree of improvement in long-term potentiation of hippocampal synaptic transmission induced by tetanus stimulation, or the administration of a test substance to nerve cells derived from the synaptic maturation disorder model animal of the present invention to evaluate the degree of synaptic maturation disorder The test method for identifying the therapeutic agent for synaptic maturation disorder of the present invention is a candidate method for treating a synaptic maturation disorder before or after birth to the synaptic maturation disorder model animal of the present invention. Administer drugs and use the degree of behavioral change and / or the improvement of long-term potentiation of hippocampal synaptic transmission induced by tetanus stimulation as an indicator Any method may be used as long as it is a method for administering a candidate therapeutic drug for a synapse maturation disorder to a nerve cell derived from a synaptic maturation disorder model animal of the present invention and evaluating the degree of the synapse maturation disorder, and changes in behavior It is preferable to evaluate the degree of improvement in the degree of long-term potentiation of hippocampal synaptic transmission and the evaluation of the degree of synaptic maturation disorder in comparison with the wild type as a control, particularly the wild type of the litter. Preferred examples of the test substance and the candidate therapeutic drug for synaptic maturation disorders include drugs that change the excitement of nerve cells, such as antipsychotics, neurostimulants, and anesthetics. Examples of behavioral changes include experiments that examine learning and memory, and experiments that incorporate reflexive behavior. Tetanus stimuli can include combined stimuli of conditional and unconditional stimuli. As the degree of improvement of long-term potentiation of hippocampal synaptic transmission, the degree of context-dependent fear reaction (freezing reaction, freezing) can be mentioned.

  When the preventive / therapeutic agent obtained by the method for screening a prophylactic / therapeutic agent for synaptic maturation disorder according to the present invention is used as a pharmaceutical, it can be administered orally or parenterally, but it can be administered parenterally such as intravenous administration. Is preferred. The parenteral preparation can be an injection, a transdermal preparation, a suppository, or the like. Oral administration agents can be solid preparations such as powders, granules, capsules and tablets, or liquid preparations such as syrups and elixirs. These preparations can be produced according to a conventional method by adding pharmacologically and pharmaceutically acceptable auxiliaries to the active ingredient. As an auxiliary agent, for example, in oral preparations and mucosal administration agents, light anhydrous silicic acid, excipients such as starch, lactose, crystalline cellulose and lactose calcium, disintegrants such as carboxymethyl cellulose, stearic acid Ingredients for preparations such as lubricants such as magnesium, and for injections, solubilizers or solubilizers such as physiological saline, mannitol, propylene glycol, suspending agents such as surfactants, etc. In the case of the above-mentioned formulation components, the formulation components such as aqueous or oily solubilizers, solubilizers, and adhesives are used. In addition, the dose can be appropriately determined according to the type of target disease, the age, sex, weight, symptom, and dosage form of the patient.

  Hereinafter, although the Example demonstrates the production method of the knockout mouse of this invention more concretely, the technical scope of this invention is not limited to these illustrations.

(Isolation of drebrin gene)
A B6J mouse BAC library (RPCI-23) (USA Children's Hospital Oakland Research Institute BAC / PAC Resources) was screened using the rat Drebrin cDNA type A-specific insertion sequence (ins2) as a probe, and positive including the coding region of Drebrin A clone was obtained.

(Construction of targeting vector)
Fragment HK (13.5 kb) containing positive type clone (total length of about 200 kbp) with some restriction enzymes and containing type A specific insert (corresponding to ins2, exon 11a) (see FIG. 1; drebrin gene HK 13.5 Kb) ) Was isolated. Using the PCR method, loxP was inserted 216 bases upstream of exon 11a, a neo resistance gene (pKG-neo) sandwiched by frt 154 bases downstream, and another loxP was further inserted 67 bases downstream of this. Thus, drebrin A-specific exon 11a is sandwiched between two loxPs together with a neo gene sandwiched between frts (... <exon 10> ... <loxP> ... <exon 11a> ... <frt · neo · frt> ... <LoxP>... <Exon 11c> (see FIG. 1; targeting vector). In addition, the diphtheria toxin A gene was inserted into the B site at the 5 ′ end of the targeting vector for negative selection of the subsequent recombinants. FIG. 1 shows an outline of construction of a targeting vector.

(Homologous recombination into ES cells)
The targeting clone constructed in Example 2 was linearized and introduced into ES cells (MS12) established in C57BL / 6J mice by electroporation (electroporation), and ES clones that survived and proliferated in the presence of G418 were obtained. Isolated. Among the isolated ES clones, those in which the targeting vector was homologously recombined were selected by Southern blotting (see FIG. 2). Specifically, ES cell genomic DNA was digested with KpnI, agarose gel electrophoresed, transferred to nylon membrane, hybridized with RI-labeled drebrin gene SacI-EcoRI fragment or exon 11A, and positive band detected by autoradiogram did. In the wild type, only about 5.8 kb band is detected by any probe, but in the case of homologous recombination, a band of about 7.9 kb is also detected in addition to the wild type band.

(Introduction of recombinant ES cells into individuals and production of Flox mice)
Recombinant ES cells were microinjected into ICR-derived morulas and transplanted into pseudopregnant foster mothers. With a chimera individual having a high proportion of somatic cells derived from ES cells as a parent, a progeny F1 having a recombinant gene was obtained. In addition, a fertilized egg obtained by crossing an individual F1 having a recombinant gene with C57BL / 6 is microinjected with an expression vector of the recombinant enzyme flippase, transplanted into a temporary parent, and lacking the neo gene sandwiched between recombinant frts. A lost individual was obtained. In this individual, the neo gene used for selection of recombinant ES cell clones is deleted (... <exon 10> ... <loxP> ... <exon 11a> ... <frt> ... <loxP> ... <exon 11c> ...) However, two loxPs are inserted in a form sandwiching exon 11a (ins2) specific to drebrin A. In this Flox mouse, the region sandwiched between loxP (including ins2) is lacking in conditionality by crossing with the mouse expressing the recombinant enzyme Cre for a limited time depending on the cell type, development time and drug induction. Can be lost.

(Preparation of drebrin A knockout mouse by gene recombination using Cre-loxP)
An individual F1 having a recombinant gene is used as one parent, and a transgenic mouse (E2A-Cre) expressing the recombinant enzyme Cre in all cells from the beginning of development is used as the other parent. A mouse heterozygous individual lacking the sandwiched region (including the ins2 and neo genes) was obtained. Drebrin A-specific knockout mice were obtained by crossing male and female heterozygous mice lacking drebrin A-specific exon 11A sandwiched between the two loxP sequences that resulted. Homozygous knockout individuals were identified by genotyping (by PCR) using tail DNA. That is, wild type (WT: 1,171 bp), knockout hetero (802 bp and 1,171 bp), and knockout homo (KO: 802 bp) were distinguished by using primers around exon 11A. In this drebrin A-specific knockout mouse, only drebrin A isoform is deleted, and drebrin E is expressed instead of drebrin A, so drebrin E isoform remains (... <exon 10> ... <loxP> ... <Exon 11c> ...).

(Drebrin expression)
(1) Western blot analysis 1
A 5-6 week old drebrin A knockout mouse (homo) and an 11 week old wild type mouse were anesthetized with ether, the cervical spine was dislocated, the cerebral cortex was taken out, and each 100 μg (wet weight) was used in Western. Blot analysis was performed. The results are shown in FIG. In FIG. 3, lanes 1, 3, and 5 are wild type mice, lanes 2, 4, and 6 are drebrin A knockout mice, and lanes 1 and 2 are M2F6 monoclonal antibodies that recognize both the C terminus of drebrin A and drebrin E. 2 and 4 lanes use anti-PSD95 antibody that recognizes the synaptic protein PSD95, and 5 and 6 lanes use anti-drebrin ADF-H domain serum that recognizes both the N-terminus of drebrin A and drebrin E. It was. The band in lane 1 of FIG. 3 shows drebrin A (originally, only drebrin A is expressed in the cerebral cortex), and lane 2 shows drebrin E (which has a molecular weight smaller than drebrin A). In knockout mice, drebrin A is expressed. Although it does not express, it turns out that drebrin E is newly expressed. Moreover, the band of 4 lanes is thinner than the band of 3 lanes of FIG. 3, suggesting that synaptic abnormalities occur in knockout mice. The 5 lane band in FIG. 3 shows drebrin A, 6 lane shows drebrin E (which has a lower molecular weight than drebrin A), and in this knockout mouse, drebrin A is not a drebrin degradation product having the N-terminal portion of drebrin. It can be seen that full-length drebrin E is expressed instead of.

(2) Western blot analysis 2
A homogenate of cerebral cortex of drebrin A knockout mouse (KO (-/-)) and wild type mouse (WT (WT / WT)) used in the above Western blot analysis 1 was run on an 8% gel to perform Western blot analysis. went. As the primary antibody, DAS2 antiserum (× 10000) that specifically recognizes drebrin A was used, and as the secondary antibody, HRP α mouse (× 10000) was used. The results are shown in FIG. FIG. 4 shows that drebrin A knockout mice (homo) do not express drebrin A expressed by wild-type mice.

(3) Western blot analysis 3
A 10-week-old drebrin A knockout mouse and a wild-type mouse (KO (WT / WT)) littered with ether were anesthetized with ether, the cervical vertebrae were dislocated, the brain was removed, and the cerebrum, cerebellum, and hippocampus were separated. Homogenize with x amount of sample buffer and perform Western blot analysis using 5 μL each. As the primary antibody, M2F6 monoclonal antibody (× 10000) that recognizes the C-terminal epitope of drebrin was used, and HRP α mouse (× 10000) was used as the secondary antibody. As with KO (WT / WT), Western blots were also used for knockout heterozygous (KO (WT /-)), drebrin A transgenic mice (No43 +), and wild-type mice (No43-) littered with (No43 +). Analysis was carried out. In addition, beta-actin (x10000) was used as a positive control in Western blot. The results are shown in FIG. In FIG. 5, KO (− / −), KO (WT / −), No 43+, and No 43− are shown from the left lane. In the cerebrum and hippocampus, only drebrin A is originally expressed, and drebrin E is expressed in the cerebellum. The bands of KO (WT / WT), (No43 +) and (No43-) in the cerebrum and hippocampus of FIG. 5 indicate drebrin A, and the two bands close to the top and bottom of KO (WT /-) are drebrin A and (drebrin A). It shows drebrin E (which has a lower molecular weight), and it can be seen that both drebrin A and drebrin E are expressed. The bands in the cerebellum in FIG. 5 all indicate drebrin E (originally expressed in the cerebellum).

(4) Summary From the results shown in FIGS. 3 to 5, drebrin A knockout mice (homo) do not express drebrin A (FIG. 4), but in cerebral cortex and hippocampus where drebrin A is primarily expressed, Drebrin E is expressed in place of A, and the total expression level of drebrin is comparable to the total expression amount of drebrin in wild-type mice. Therefore, only synaptic maturation due to drebrin A deficiency is impaired, and other drebrin-related It was suggested that the function was normal.

Context-dependent fear conditioning impairment due to drebrin A specific deletion
(1) Method Drebrin A-specific knockout mice (KO, n = 9) and their wild-type mice (WT, n = 10) were placed in a shock box and conditioned after 1 minute (10 dB tone of 70 dB for 10 seconds) And unconditional stimulation (shock shock from 0.5 mA floor, 1 second) was presented twice at 20 second intervals (shock 9 seconds after the start of the tone), and then returned to the home cage after 1 minute. . One day after conditioning, the mice were placed again in the shock box and examined for context-dependent fear responses (freezing, freezing).

(2) Results When WT was placed in a box that was shocked one day ago, it immediately caused a strong freezing (context-dependent fear response, average of 71.5 ± 4.9% over 2 minutes). On the other hand, in KO, the level of freezing was significantly lower than in WT (average of 44.3 ± 11.7% over 2 minutes, p <0.05). In behavioral tests to examine innate emotions, there was no significant difference between KO and WT. Thus, deletion of the drebrin A isoform does not affect basic behavior, but at least impairs some learning. Learning memory is thought to require functional and structural changes on the neural circuit associated with it, suggesting that drebrin A in dendritic spines is the key molecule.

It is a figure which shows the outline of construction | assembly of the targeting vector used for preparation of the drebrin A knockout mouse of this invention. It is a figure which shows the result of the Southern blot of the targeting vector used for construction | assembly of the drebrin A knockout mouse (KO (-/-)) of this invention. It is a figure which shows the expression result of the drebrin in the cerebral cortex of the drebrin A knockout mouse | mouth (KO (-/-)) of this invention (WT (WT / WT)), and the expression result of synaptic protein PSD95. It is a figure which shows the expression result of drebrin A in the cerebral cortex of the drebrin A knockout mouse | mouth (KO (-/-)) and wild type mouse | mouth (WT (WT / WT)) of this invention. Same as wild type mice (KO (WT / WT)), knockout heterozygous (KO (WT /-)), drebrin A transgenic mice (No43 +), and (No43 +) It is a figure which shows the expression result of drebrin A in the brain (cerebrum, cerebellum, hippocampus) of a wild type mouse (No43-).

Claims (8)

A non-human mammal obtained by ontogenizing a totipotent cell having a mutant gene in which the region containing exon 11a of the drebrin gene is deleted, and a progeny animal thereof, having the drebrin mutant gene in a somatic cell chromosome Synaptic maturation disorder model animals comprising non-human animals that do not lose the function of expressing drebrin A and have the function of expressing drebrin E instead of drebrin A. The model animal for synaptic maturation disorder according to claim 1, wherein the gene is a mutant gene in which the region containing exon 11a of the drebrin gene is deleted using Cre-loxP. The synapse according to claim 1 or 2, wherein the mutant gene in which the region containing exon 11a of the drebrin gene is deleted is a mutant gene in which all of exon 11a and part of exon 11b of the drebrin gene are deleted. Maturation disorder model animal. The synaptic maturity disorder model animal according to any one of claims 1 to 3, wherein the non-human animal is a mouse. A synapse for administering a test substance to a synaptic maturation disorder model animal according to any one of claims 1 to 4 before or after birth, and evaluating the degree of improvement in long-term potentiation of hippocampal synaptic transmission induced by tetanic stimulation. A screening method for a prophylactic / therapeutic agent for maturation disorders. A degree of improvement in long-term potentiation of hippocampal synaptic transmission induced by administering a candidate therapeutic drug for synaptic maturation disorder before or after birth to the synaptic maturation disorder model animal according to any one of claims 1 to 4 A test method for identifying drugs for treating synaptic maturity disorders using as an index. A screening method for a prophylactic / therapeutic agent for synaptic maturation disorders, comprising administering a test substance to nerve cells derived from the synaptic maturation disorder model animal according to any one of claims 1 to 4, and evaluating the degree of synaptic maturation disorders. A test method for administering a candidate therapeutic drug for a synaptic maturation disorder to nerve cells derived from the synaptic maturation disorder model animal according to any one of claims 1 to 4, and specifying the therapeutic drug for the synaptic maturation disorder using the degree of the synaptic maturation disorder as an index .