JP6323876B2 - Knock-in mouse - Google Patents

Description

  The present invention relates to a knock-in mouse that develops Alzheimer's disease under gene expression in a physiological range.

  Conventionally, Alzheimer's disease was thought to develop when amyloid β protein fibrillates and accumulates to form senile plaques. Amyloid β is a highly aggregated peptide consisting of about 40 amino acid residues produced by excising a part of amyloid precursor protein (APP) consisting of 695 or 770 amino acid residues with secretase. In recent years, however, the hypothesis that senile plaque formation is not the cause of Alzheimer's disease, and that the oligomer of amyloid β protein is the true etiology of Alzheimer's (for example, see Non-patent Document 1).

  The present inventors have discovered a type of Alzheimer's disease patient having a mutation that promotes oligomer formation of amyloid β protein, and named this Osaka mutation (see, for example, Non-Patent Document 2). The Osaka mutation is a mutation in which the No. 22 glutamic acid residue of amyloid β protein consisting of 42 or 40 amino acids is deleted. This mutation makes fibrosis of the amyloid β protein less likely to occur and oligomer formation occurs. It is thought to be promoted.

  The increase in Alzheimer's disease patients, the main cause of dementia, has become a major social concern in recent years, and early establishment of therapeutic agents and treatment methods is desired. In general, analysis of a therapeutic drug or a treatment method for a specific disease is performed using a model animal of the disease. Accordingly, the present inventors introduced a human mutant APP gene having an Osaka mutation to produce a transgenic mouse that overexpresses the human amyloid β protein having an Osaka mutation. However, it cannot be denied that the result obtained by the transgenic mouse may be an overexpression of the introduced gene or an artifact caused by introducing a foreign gene. Furthermore, since the human-type APP gene has been introduced into the mouse, human-type amyloid β protein is expressed in the mouse, and there is a possibility that the interaction between different species cannot be denied and the disease state is not accurately reflected.

  Such a problem of cross-species interaction can be avoided by creating an Alzheimer's disease model that produces mouse-type mutant amyloid β protein in mice. However, conventionally, it was generally considered that mouse-type amyloid β protein behaved differently from human-type. The amyloid β protein has 3 amino acid residue differences between the human type and the mouse type, and experimental results have been reported that accumulation of amyloid β protein is less likely to occur due to this amino acid residue difference (for example, Non-Patent Document 3). See). In addition, it is understood that it is natural to introduce a human gene because transgenic animals are usually used to examine therapeutic agents and treatment methods for humans, and mouse-type mutant amyloid β protein is intentionally introduced into mice. It has not been studied to create an Alzheimer's disease model by introducing a gene encoding. Accordingly, there has been no report of mouse-type genetic information having no human gene-derived protein or an Alzheimer's disease model mouse with a mouse-type abnormal protein alone.

Selkoe DJ, Science 298; 789-791, 2002 Tomiyama T et al. , Ann Eurol 63; 377-387, 2008. Thomas Dyrks et al. , FEBS LETTERS, vol. 324, number 2, 231-236

  The main object of the present invention is to provide a knock-in mouse that biosynthesizes a mutant amyloid β protein having an Osaka mutation under gene expression in a physiological range. Furthermore, it is a further object of the present invention to provide a method for screening a drug for preventing and / or treating Alzheimer's disease using the knock-in mouse, and a method for evaluating the efficacy of a drug for preventing and / or treating Alzheimer's disease.

  As described above, conventionally, it has been commonly recognized that mouse-type amyloid β protein cannot cause Alzheimer's disease because it has different properties from human-type amyloid β protein. However, as a result of intensive studies by the present inventors, the knock-in mouse prepared using the mutant APP gene encoding the mouse amyloid β protein having the Osaka mutation deficient in the 22nd glutamic acid, Contrary to recognition, we found that Alzheimer's disease develops. Furthermore, from a pathological and behavioral viewpoint, it was confirmed that this knock-in mouse faithfully reproduced the symptoms of human Osaka mutant Alzheimer's disease. The present invention has been completed as a result of further research based on such knowledge.

That is, the present invention provides the following knock-in mice, methods for screening Alzheimer's disease prevention and / or treatment drugs using the knock-in mice, and methods for evaluating the efficacy and efficacy of Alzheimer's disease prevention and / or treatment drugs.
Item 1. The knock-in mouse in which the mutant amyloid precursor protein (mutant APP) gene shown in the following (a) or (b) is knocked in and has the mutant APP gene homozygously:
(A) a mutant APP gene encoding a mouse mutant amyloid β protein consisting of the amino acid sequence represented by SEQ ID NO: 1, or (b) a fifth glycine counted from the N-terminus in the amino acid sequence represented by SEQ ID NO: 1 It consists of an amino acid sequence in which one or a plurality of amino acids other than the residue, the 10th phenylalanine residue, and the 13th arginine residue are substituted, deleted, inserted or added, and is expressed in the mouse body A mutant APP gene encoding a polypeptide that induces Alzheimer's disease.
Item 2. A method for screening a preventive and / or therapeutic agent for Alzheimer's disease,
The step of applying a test substance to the knock-in mouse according to Item 1 or a part of the living body thereof, and the presence or absence of improvement of Alzheimer's disease symptoms in the knock-in mouse or a part of the living body, to improve the symptoms of Alzheimer's disease A screening method comprising the step of selecting a test substance that has been prepared.
Item 3. Symptoms of Alzheimer's disease are at least one selected from the group consisting of amyloid β protein accumulation, amyloid β oligomer formation, tau protein phosphorylation, synapse loss, glial cell activation, neuronal loss and learning memory impairment Item 3. The screening method according to Item 2.
Item 4. A method for evaluating the efficacy of a preventive and / or therapeutic drug for Alzheimer's disease,
A method for evaluating efficacy, comprising: applying a test substance to the knock-in mouse according to item 1 or a part of the living body thereof; and investigating the effect of improving the symptoms of Alzheimer's disease in the knock-in mouse or a part of the living body thereof.
Item 5. Symptoms of Alzheimer's disease are at least one selected from the group consisting of amyloid β protein accumulation, amyloid β oligomer formation, tau protein phosphorylation, synapse loss, glial cell activation, neuronal loss and learning memory impairment Item 5. A method for evaluating drug efficacy according to Item 4.
Item 6. Use of the mutant amyloid precursor protein (mutant APP) gene shown in the following (a) or (b) for the production of a model animal of Alzheimer's disease:
(A) a mutant APP gene encoding a mouse mutant amyloid β protein consisting of the amino acid sequence represented by SEQ ID NO: 1, or (b) a fifth glycine counted from the N-terminus in the amino acid sequence represented by SEQ ID NO: 1 It consists of an amino acid sequence in which one or a plurality of amino acids other than the residue, the 10th phenylalanine residue, and the 13th arginine residue are substituted, deleted, inserted or added, and is expressed in the mouse body A mutant APP gene encoding a polypeptide that induces Alzheimer's disease.
Item 7. Symptoms of Alzheimer's disease are at least one selected from the group consisting of amyloid β protein accumulation, amyloid β oligomer formation, tau protein phosphorylation, synapse loss, glial cell activation, neuronal loss and learning memory impairment Item 7. The use according to Item 6.
Item 8. Use of the knock-in mouse according to Item 1 or a part of the living body thereof for screening for a preventive and / or therapeutic agent for Alzheimer's disease.
Item 9. Symptoms of Alzheimer's disease are at least one selected from the group consisting of amyloid β protein accumulation, amyloid β oligomer formation, tau protein phosphorylation, synapse loss, glial cell activation, neuronal loss and learning memory impairment Item 15. Use according to Item 8.
Item 10. Use of the knock-in mouse according to Item 1 or a part of the living body thereof for evaluating the efficacy of a prophylactic and / or therapeutic drug for Alzheimer's disease.
Item 11. Symptoms of Alzheimer's disease are at least one selected from the group consisting of amyloid β protein accumulation, amyloid β oligomer formation, tau protein phosphorylation, synapse loss, glial cell activation, neuronal loss and learning memory impairment Item 15. The use according to Item 10.

  The knock-in mouse of the present invention faithfully reproduces the symptoms of human Osaka mutant Alzheimer's disease and can be used as a disease model mouse for Osaka mutant Alzheimer's disease. Furthermore, since all of the knock-in mice of the present invention develop Alzheimer's disease under the action of a mouse-derived molecule, the effects of cross-species interaction are considered in the study of the mechanism and prevention and / or treatment of Alzheimer's disease. There is no need to consider, and a more accurate evaluation can be performed.

FIG. 1 (a) shows the structure of the mouse amyloid precursor protein (APP) gene, FIG. 1 (b) shows the structure of the APP gene into which the mutation introduced into the targeting vector has been introduced, and FIG. 1 (c). Indicates the structure of the APP gene in positive clone ES cells into which mutations have been introduced by the targeting vector. It is a photograph of brain sections of TG2576 mice (a) and homoKI mice (b) stained with β001 antibody. It is a photograph of brain sections of homoKI mice (b, d) and nonKI mice (a, c) stained with β001 antibody. It is a photograph of brain sections of homoKI mice, heteroKI mice and nonKI mice stained with anti-14F1 antibody. It is a photograph of brain sections of homoKI mice, heteroKI mice, and nonKI mice stained with antibody A11 antibody. It is a photograph of brain sections of homoKI mice, heteroKI mice, and nonKI mice stained with an anti-PHF-1 antibody. It is a graph showing the measurement result of the photograph of the brain section of the homo KI mouse | mouth, the hetero KI mouse | mouth, and the nonKI mouse | mouth stained with the anti- synaptophysin antibody, and a synaptic density. In the graph, * represents p value <0.05 for nonKI mice, ** represents p value <0.0001 for nonKI mice, and p value <0.05 for heteroKI mice. It is a photograph of brain sections of homoKI mice, heteroKI mice, and nonKI mice stained with anti-Iba1 antibody. It is a photograph of brain sections of homoKI mice, heteroKI mice, and nonKI mice stained with an anti-GFAP antibody. It is a graph showing the measurement result of the photograph of the brain section of a homoKI mouse | mouth, a heteroKI mouse | mouth, and a nonKI mouse | mouth with an anti-NeuN antibody, and the number of neurons. In the graph, * represents p value <0.05 for nonKI mice and heteroKI mice. It is a graph showing the result of a Morris water maze test.

In the present specification, amino acids, peptides, and proteins are represented using abbreviations adopted by the IUPAC-IUB Biochemical Nomenclature Committee (CBN) shown below.
A = Ala = alanine, C = Cys = cysteine,
D = Asp = aspartic acid, E = Glu = glutamic acid,
F = Phe = phenylalanine, G = Gly = glycine,
H = His = histidine, I = Ile = isoleucine,
K = Lys = Lysine, L = Leu = Leucine,
M = Met = methionine, N = Asn = asparagine,
P = Pro = proline, Q = Gln = glutamine,
R = Arg = arginine, S = Ser = serine,
T = Thr = threonine, V = Val = valine,
W = Trp = tryptophan, Y = Tyr = tyrosine

  Unless otherwise specified, the amino acid residue sequences of peptides and proteins are expressed from the N-terminus to the C-terminus from the left end to the right end.

[Knock-in mouse]
The knock-in mouse of the present invention is characterized in that the mutant amyloid precursor protein (mutant APP) gene shown in the following (a) or (b) is knocked in and has the mutant APP gene homozygously.
(A) a mutant APP gene encoding a mouse mutant amyloid β protein consisting of the amino acid sequence represented by SEQ ID NO: 1, or (b) a fifth glycine counted from the N-terminus in the amino acid sequence represented by SEQ ID NO: 1 It consists of an amino acid sequence in which one or a plurality of amino acids other than the residue, the 10th phenylalanine residue, and the 13th arginine residue are substituted, deleted, inserted or added, and is expressed in the mouse body A mutant APP gene encoding a polypeptide that induces Alzheimer's disease.

  More specifically, the knock-in mouse of the present invention can biosynthesize mouse-type mutant amyloid β protein from which the 22nd glutamic acid residue is deleted in mouse amyloid β protein due to the above characteristics. It can be used as a disease model mouse of Osaka mutant Alzheimer's disease.

  The knock-in mouse of the present invention is produced as follows. That is, the targeting vector containing the mutated APP gene of (a) or (b) is introduced into a mouse embryonic stem cell (ES cell), and the endogenous APP gene locus of (a) or (b) is obtained by homologous recombination. ES cell clones incorporating the mutated APP gene are selected. Then, the obtained ES cell clone is transplanted into a mouse host embryo to obtain a chimeric mouse, which is further mated to obtain the knock-in mouse of the present invention.

  The knock-in mouse of the present invention stably holds the mutant APP gene shown in (a) or (b) in a state where it can be expressed. Here, “stablely maintained” means that the DNA is permanently present in the knock-in mouse cell of the present invention in a state where it can be expressed, even if the DNA is integrated on the host chromosome. Although it may exist stably as extrachromosomal DNA, it is preferably retained in an integrated state on the chromosome. Furthermore, the knock-in mouse of the present invention is homozygous for the mutated APP gene shown in (a) or (b) above.

Hereinafter, the production method and characteristics of the knock-in mouse of the present invention will be described in detail.
<Preparation of targeting vector>
The targeting vector can be obtained by preparing a polynucleotide having the DNA base sequence of the mutant APP gene of (a) or (b) and inserting it into a known vector.

(Preparation of mutant APP gene)
The polynucleotide having the DNA base sequence of the mutant APP gene of (a) or (b) above is obtained by screening a mouse genomic DNA library, and further introducing a mutation into the APP gene. Can be prepared. The mouse APP gene (wild type) is known and is shown in SEQ ID NO: 2.

  A commercially available mouse genomic DNA library such as a BAC library can also be used. For example, 129 strain, C57BL / 6 strain, BALB / c strain, pure strain such as C3H strain, ICR strain, etc. It can also be prepared from a mouse genomic DNA library of a hybrid system such as that according to a conventionally known method.

  Since the mouse APP gene is known, it can be obtained by screening the aforementioned mouse genomic DNA using a primer designed based on the base sequence of the APP gene.

  Amyloid β protein is produced by being cleaved from amyloid precursor protein (APP) by β- or γ-secretase. The mouse amyloid precursor protein gene (APP gene) contains 18 exons, and the 22nd glutamic acid of amyloid β protein is encoded by exon 17. Therefore, in cloning, primers are designed so that a DNA fragment containing at least exon 17 of the APP gene is cloned. In addition, the region encoding exon 17 in SEQ ID NO: 2 corresponds to a region of 211440 to 211586 bases counted from the 5 ′ end of the base sequence, and the 22nd glutamic acid residue of amyloid β protein is 211452 to 21454 bases. Coded by (GAA).

  A polynucleotide encoding a mutant amyloid β protein having an Osaka mutation is obtained by introducing a mutation that deletes the 22nd glutamic acid residue from the N-terminus of the amyloid β protein into the obtained DNA fragment. Can do. The method for introducing the mutation is not particularly limited as long as the 22nd glutamic acid can be deleted, and can be performed according to a conventionally known method. Specific examples include the methods described in the examples described later. The

Moreover, mutant APP gene, for example, in the amino acid sequence shown in SEQ ID NO: 1, one or more, one or several, walk one to five amino acids are substituted, deleted, inserted or added amino acid It may consist of a sequence and may encode a polypeptide that induces Alzheimer's disease when expressed in the mouse (that is, it corresponds to the mutant APP gene shown in (b) above). However, the introduction of such a mutation is the sequence characteristic to the mouse amyloid β protein, ie, the fifth glycine residue and the tenth in the amino acid sequence shown in SEQ ID NO: 1, counting from the N-terminus. In the region of the phenylalanine residue and the 13th arginine residue.

  When amino acid substitution is performed, conservative substitution based on the nature of the side chain functional group is preferred. Natural amino acids are classified into nonpolar amino acids, uncharged amino acids, acidic amino acids and basic amino acids according to side chain functional groups. A conservative substitution refers to an amino acid residue in which the original amino acid residue and the amino acid residue after substitution are classified into the same category. Here, specific examples of “nonpolar amino acids” include alanine, valine, leucine, isoleucine, proline, methionine, phenylalanine, and tryptophan; “uncharged amino acids” include glycine, serine, threonine, cysteine, tyrosine, asparagine, And “amine amino acid” include aspartic acid and glutamic acid; “basic amino acid” includes lysine, arginine, and histidine, respectively.

When the amino acid is deleted, as long as it is possible to induce Alzheimer's disease by expressing the expressed polypeptide in the mouse body, for example, from the N-terminal or C-terminal of the amino acid sequence shown in SEQ ID NO: 1 For example, 1 to 5 amino acids may be deleted.

In the case of inserting an amino acid, the number and position of the inserted amino acid are not particularly limited as long as the expressed polypeptide can be induced in the mouse body to induce Alzheimer's disease. for example anywhere in the amino acid sequence, one or several, walk may be inserted 1-5 amino acid residues. In addition, when an amino acid is inserted, it is carried out while avoiding the position between the 21st alanine residue and the 22nd aspartic acid residue in the amino acid sequence represented by SEQ ID NO: 1.

When adding an amino acid, as long as the polypeptide expressed is capable of inducing Alzheimer's disease by expressing a mouse body, the number of amino acids to be added is not limited, 1-5 pieces are exemplified For example It is done.

  For the introduction of these mutations, conventionally known methods can be employed, and examples include site-specific mutagenesis. The site-directed mutagenesis method can be carried out, for example, by using a technique based on Inverse PCR or a commercial kit of QuikChange II Kit (manufactured by Stratagene). When introducing mutations at two or more sites, a mutated APP gene encoding the target polypeptide can be obtained by repeating the method according to the above method.

  Examples of the mutant amyloid comprising an amino acid sequence having such a mutation include those having a sequence identity of 25% or more, preferably 50% or more, more preferably 90% or more with respect to the amino acid sequence represented by SEQ ID NO: 1.

  For polypeptide sequence identity, the two polypeptides to be compared are optimally aligned, the number of positions where the amino acid matches in both sequences is divided by the total number of comparison amino acids, and the result multiplied by 100. Represented. Specifically, the sequence identity of polypeptides can be determined by using the Maximum matching program of “GENETYX Ver.10” (Genetics) with default parameters.

  In addition, the mutant APP gene shown in (b) has a complementary sequence to the mutant APP gene shown in (a) as long as it has the mutation described above (deletion of glutamic acid No. 22 in amyloid β protein). On the other hand, it may hybridize under stringent conditions and may develop Alzheimer's disease in mice. Here, stringent conditions include, for example, washing at 42 ° C. with a buffer containing 1 × SSC and 0.1% SDS after hybridization at 42 ° C. Higher stringent conditions include, for example, a washing treatment at 65 ° C. with a buffer containing 0.1 × SSC and 0.1% SDS after hybridization at 65 ° C. The stringency of hybridization is affected by factors other than the above-mentioned salt concentration, temperature conditions, etc., and those skilled in the art will realize stringency equivalent to the stringency under the specific conditions described above based on various factors The conditions that can be done can be set.

(Preparation of targeting vector containing mutant amyloid gene)
A mutated APP gene obtained as described above is inserted into a vector to prepare a targeting vector. The targeting vector is designed so that the 22nd glutamic acid is deleted by homologous recombination between the targeting vector and the APP gene in the genome. Moreover, in order to enable homologous recombination, the targeting vector contains regions homologous to the endogenous mouse APP gene at both ends (5 ′ side and 3 ′ side) of the introduced DNA fragment (mutated APP gene). You may go out. That is, examples of the targeting vector include those containing a sequence upstream of the amyloid gene, the mutant amyloid sequence, the positive selection marker gene, and a sequence downstream of the amyloid gene.

  Conventionally known gene drug resistance genes, reporter genes, and the like can be used as positive selection markers inserted into the targeting vector to confirm that the target mutant APP gene has been incorporated. Examples of drug resistance genes include neomycin resistance genes, hygromycin resistance genes, puromycin resistance genes, and the like. Examples of the reporter gene include β-galactosidase (lacZ) gene and GFP gene. These positive selectable marker genes are preferably incorporated as an expression cassette containing a promoter sequence so that they can be expressed in ES cells.

  Since the positive selection marker gene may interfere with the expression of the mutated APP gene, it is preferable to remove the positive selection marker after selection of homologous recombinants using a conventionally known genetic engineering technique. Examples of such a method include a method using a Cre-loxP system, a Flp-frt system, or a bacteriophage att system. For example, when the Cre-loxP system is used, it can be removed by placing a loxP sequence at both ends of the positive selection marker gene and allowing Cre recombinase to act. In addition, when the Flp-frt system is used, frt sequences can be arranged at both ends of the positive selection marker and removed by Flp recombinase.

  In a targeting vector, by inserting a marker gene for negative selection outside a region homologous to the endogenous APP gene, only clones targeted to the endogenous APP gene targeted by homologous recombination can be efficiently selected. it can. Examples of the negative selection marker gene include diphtheria toxin (DT) gene and thymidine kinase (TK) gene.

  The targeting vector is a conventionally known vector obtained by subjecting the mutated APP gene, the 5 ′ side arm and 3 ′ side arm homologous to the target sequence, a selection marker gene, etc., to a conventional genetic engineering technique using a restriction enzyme, DNA ligase or the like. It can be prepared by inserting into it.

  The vector is not particularly limited as long as it can be expressed in mouse ES cells and can be transformed. For example, plasmids derived from E. coli, retroviruses, lentiviruses, adeno-associated viruses, vaccinia viruses, baculoviruses, etc. Viruses are used. Among these, plasmids derived from Escherichia coli and the like are preferable vectors.

<Introduction into ES cells and selection of knock-in mice>
By introducing the targeting vector into mouse ES cells, a chimeric mouse capable of expressing the desired mutant amyloid β protein can be obtained, and the gene encoding the mutant amyloid β protein can be obtained by mating the obtained chimeric mice Knock-in mice that are homozygous for can be obtained.

  ES cells are derived from the inner cell mass (ICM) of a fertilized egg at the blastocyst stage, and can be cultured and maintained in an undifferentiated state in vitro. As a mouse ES cell used for producing the knock-in mouse of the present invention, an established cell line may be used, and known methods (for example, see Nature (1981) vol. 292, p. 154). You may use what was newly established according to). As mouse ES cell lines already established, RF8 cells (Meiner, V. et al., Proc. Natl. Acad. Sci. USA, 93: 14041-14046 (1996)), CGR8 cells (Nichols, J. et. al., Development, 110: 1341-1348 (1990)), MG 1.19 cells (Gassmann, M. et al., Proc. Natl. Acad. Sci., USA, 92: 1292-1296 (1995)). Can be mentioned. Further, for example, mouse ES cells 129SV (No. R-CMTI-1-15, No. R-CMTI-1A), C57 / BL6 (No. R-CMTI-2A) commercially available from Dainippon Pharmaceutical Co., Ltd. ), DBA-1 (No. R-CMTI-3A), etc. can be used. It is also possible to produce knock-in mice using mouse iPS cells. Even when mouse iPS cells are used, knock-in mice can be prepared according to the method using ES cells described later.

The culture conditions for the ES cell line can be appropriately selected and set from conventionally known conditions as long as the properties of ES cells as undifferentiated stem cells can be maintained. Examples thereof include a method of culturing under conditions of 5% CO ₂ and about 37 ° C. in the presence of LIF known as a differentiation inhibitor (for example, a concentration of 10 ³ U / ml). In addition, cell passage is usually performed twice a day and, for example, a method of singly cellizing by trypsin / EDTA solution (usually 0.125% trypsin / 0.01% EDTA) treatment and newly seeding is employed. it can. ES cell culture may be performed on feeder cells as necessary, and examples of the feeder cells include fibroblasts.

  For introduction of the targeting vector into ES cells, a conventionally known method can be used. For example, calcium phosphate coprecipitation method, electroporation method, lipofection method, aggregation method, microinjection (microinjection) Method, gene gun (particle gun) method, DEAE-dextran method, and the like, but electroporation is a preferable method from the viewpoint that the operation is relatively simple and relatively long DNA fragments can be introduced.

  Regarding the ES cells into which the targeting vector has been introduced, whether or not the introduced DNA has been incorporated is confirmed by using the above-mentioned drug selection gene, reporter gene or other positive selection marker gene, and confirming the transformant at the cell stage, You can choose. Also, confirmation of integration by homologous recombination can be performed using a negative selection marker gene. More specifically, for example, when a vector containing a neomycin resistance gene as a positive selectable marker gene and a diphtheria toxin (DT) gene as a negative selectable marker gene is used, the ES cell after gene introduction is expressed as G418 or the like. This can be confirmed by culturing in a medium supplemented with neomycin antibiotics and selecting resistant (surviving) ES cells. Alternatively, colonies may be obtained by culturing single cells of ES cells introduced with a targeting vector, and DNA extracted from these colonies may be confirmed using Southern hybridization, PCR method or the like.

  The ES cell in which the integration of the target DNA has been confirmed is returned to the mouse-derived embryo to produce a chimeric embryo, which is transplanted into a foster parent and further developed, thereby allowing the mutant amyloid gene to be heterozygous. A knock-in mouse can be obtained. The selection of the heterozygote can be performed by, for example, a conventionally known method such as Southern hybridization or PCR method on chromosomal DNA separated and extracted from the tail of a mouse.

  By crossing the heterozygotes thus obtained, a homozygous knock-in mouse can be usually obtained with a probability of 4/1. If ES cells contributed to the formation of primordial germ cells that will differentiate into eggs or sperm in the future, germline chimeric mice will be obtained, and the DNA introduced by mating will be genetically transferred. Knock-in mice fixed to can be prepared.

  Furthermore, the present invention provides a part of a living body, preferably an isolated tissue, cell, etc., obtained from the knock-in mouse. The isolated tissues include, for example, brain and brain parts corresponding to Alzheimer's lesions (eg, olfactory bulb, amygdaloid nucleus, basal sphere, hippocampus, hypothalamus, hypothalamus, cerebral cortex, medulla, cerebellum, etc.) Examples include tissue pieces. Moreover, as an isolated cell, a nerve cell etc. are mentioned, for example.

<Features of knock-in mouse>
The knock-in mouse of the present invention thus obtained usually exhibits at least one of the following characteristics after 8 months, preferably after 12 months, and more preferably after 18 months.

(I) In the knock-in mouse of the present invention, amyloid β protein accumulates in the form of oligomers in the hippocampal neurons. The amyloid β protein is detected by immunostaining using an anti-amyloid β antibody such as anti-14F1 antibody, β001 antibody (Lippa C et al., Arch. Neurol, 1999). Moreover, confirmation that the accumulated amyloid β protein forms an oligomer can be carried out, for example, by performing immunostaining using an anti-Al1 antibody or the like.

(Ii) In the brain of the knock-in mouse of the present invention, abnormal phosphorylated tau protein is increased by 60% or more, preferably 80% or more, and more preferably 90% or more, compared to the wild-type mouse. Abnormally phosphorylated tau protein can be detected by immunostaining using an anti-PHF1 antibody or the like.

(Iii) In the brain of the knock-in mouse of the present invention, the disappearance of synapses in the brain is 20% or more, preferably 40% or more, more preferably 50% or more, compared to the wild-type mouse. Synapse disappearance can be detected by immunostaining using an anti-synaptophysin antibody.

(Iv) In the hippocampus of the knock-in mouse of the present invention, activation microglia and activated astrocytes are increased by 60% or more, preferably 80% or more, and more preferably 90% or more, compared to the wild type mouse. Activated microglia and activated astrocytes can be detected by immunostaining using anti-Iba1 antibody against microglia and anti-GFAP antibody against astrocytes, respectively.

(V) The knock-in mouse of the present invention has 20% or more, preferably 40% or more, and more preferably 50% or more neuronal loss in the hippocampus of the brain compared to the wild-type mouse. Evaluation of neuronal loss can be performed, for example, by staining a brain section with an anti-NeuN antibody and counting the number of neurons in the hippocampus.

(Vi) The knock-in mouse of the present invention exhibits learning memory impairment as compared to the wild-type mouse. Evaluation of learning memory impairment, a known test system can be used, and specific examples include the Morris water maze test. For example, in the Morris water maze test, the wild-type mouse is shortened every time the test is repeated, and the escape latency is shortened by about 60 to 70% in 5 days, whereas the knock-in mouse of the present invention is Even if the test is repeated, the escape latency is shortened to about 10 to 50%, preferably about 10 to 30%, and exhibits symptoms of learning memory impairment.

[Screening method of preventive and / or therapeutic drug for Alzheimer's disease]
The present invention provides a method for screening a preventive and / or therapeutic agent for Alzheimer's disease using the knock-in mouse or a part of the living body thereof. The screening method comprises a step of applying a test substance to a knock-in mouse or a part of the living body thereof, and examining whether the knock-in mouse or a part of the living body has an improvement in the symptoms of Alzheimer's disease, thereby improving the symptoms of Alzheimer's disease And a step of selecting the test substance.

  In the screening method of the present invention, the test substance is not particularly limited as long as it may be effective for the prevention and / or treatment of Alzheimer's disease. For example, synthetic compounds, nucleic acids (for example, antisense nucleic acids, cDNA, siRNA, etc.), peptides, proteins, organic compounds, inorganic compounds, cell extracts, cell culture supernatants, plant extracts, culture products and the like, and may be in the form of a mixture thereof.

  In the screening method of the present invention, the method for applying the test substance can be appropriately changed depending on whether the evaluation object is a knock-in mouse or a part of the living body of the knock-in mouse. For example, when performed by administering a test substance to a knock-in mouse, the administration method of the test substance is not particularly limited as long as the test substance can affect the mouse brain, for example, intravenous administration, Examples include intraventricular administration, oral administration, and intraperitoneal administration. Alternatively, in the case of using a part of the living body of the knock-in mouse, the test substance can be added by adding it to a medium such as tissue culture or cell culture.

  Symptoms of Alzheimer's disease include amyloid β protein accumulation, amyloid β oligomer formation, tau protein phosphorylation, synapse loss, glial cell activation, neuronal loss, learning memory impairment, brain imaging and Examples include electrophysiological changes including electroencephalogram measurements. Any one of these symptoms may be evaluated, but a test substance that is more effective as a preventive and / or therapeutic agent for Alzheimer's disease is selected by evaluating two or more symptoms. be able to.

  The detection method or evaluation method of these symptoms is not particularly limited, and can be carried out by appropriately selecting from conventionally known methods according to the target symptoms. For example, in the case of in vivo screening performed by administering a test substance to a knock-in mouse, the brain of the knock-in mouse to which the test substance is administered is removed, and a frozen section of the brain or a paraffin-embedded section is prepared according to a conventional method. Detection is performed by immunostaining with an antibody that binds to the desired target protein for detection. About the evaluation method by immuno-staining, etc., it can carry out according to a conventionally well-known staining method using the antibody described in the above-mentioned <Characteristics of a knock-in mouse>. Alternatively, the accumulation of amyloid β protein can be detected by measuring the amount of amyloid β contained by homogenizing the removed brain and performing an immunoassay or the like. By comparing the results obtained by these methods between the test substance administration group and the non-administration group, the effectiveness of the test substance can be evaluated. When improvement in the symptoms of Alzheimer's disease is observed in the test substance administration group compared to the non-administration group, the test substance is selected as a prophylactic and / or therapeutic drug for Alzheimer's disease.

  Further, the difference in learning / memory ability may be compared between the administration group and the non-administration group by animal behavior analysis or the like. If a significant improvement in learning / memory impairment is observed in the test substance administration group compared to the non-administration group, the test substance is selected as a prophylactic and / or therapeutic agent for Alzheimer's disease. As a method for evaluating learning / memory impairment, the method described in <Characteristics of Knock-in Mouse> can be employed.

  In addition, a part of the living body derived from the knock-in mouse, preferably each part of the brain and brain corresponding to the lesion of Alzheimer (eg, olfactory bulb, amygdala, basal sphere, hippocampus, thalamus, hypothalamus, cerebral cortex, medulla oblongata) , Cerebellum, etc.) tissue pieces or cells (eg, nerve cells, etc.) are cultured under conditions according to the type of each tissue or cell, and a test substance is added thereto for a certain time (for example, 1 to 72 hours). After the incubation, the tissue pieces or cells are treated in the same manner as the brain in the in vivo screening, and the preventive and / or therapeutic drug for Alzheimer's disease is screened by comparing between the test substance administration group and the non-administration group. can do.

[Method for evaluating the efficacy of Alzheimer's disease drugs]
The present invention also provides a method for evaluating the efficacy of a prophylactic and / or therapeutic drug for Alzheimer's disease using the knock-in mouse or a part of the living body thereof. The method for evaluating drug efficacy includes a step of applying a test substance to a knock-in mouse or a part of the living body thereof, and a step of examining the effect of improving the symptoms of Alzheimer's disease in the knock-in mouse or a part of the living body thereof. To do.

  As a test substance, a novel compound for which the effect of a preventive and / or therapeutic agent for Alzheimer's disease has not been confirmed can be used, and its effectiveness as a preventive and / or therapeutic agent for Alzheimer's disease has already been suggested. Candidate compounds can also be used. Evaluation of drug efficacy is carried out by comparing whether the candidate compound is actually effective for the prevention and / or treatment of Alzheimer's disease, comparing the administration group of the test substance with the non-administration group for improvement of Alzheimer's symptoms. It can be carried out. Here, the method for examining the effect of improving the symptoms of Alzheimer's disease can be performed in the same manner as in the case of the above screening method.

  The present invention will be described more specifically in the following examples, but the present invention is not limited thereto.

(1) Production of knock-in mouse A knock-in mouse that produces amyloid β protein having an Osaka mutation was produced by the following method.
[Generation of gene targeting vector]
As shown in FIG. 1 (a), the genome of the mouse APP (amyloid precursor protein) gene is composed of 18 exons (in FIG. 1, numbers 1 to 18 represent the number of each exon). The Osaka mutation is a mutation in which the 22nd glutamic acid residue counted from the N-terminus of amyloid β protein is deleted, and the 22nd amino acid of amyloid β protein is encoded by exon 17. Therefore, a targeting vector for knocking in such a mutation was prepared. A specific method is described below.

  A genomic DNA library of mouse 129 strain was screened, and a restriction enzyme site of AscI was added to the end of the region containing the 5 ′ intron of exon 16 and the end of the region containing the 3 ′ intron of exon 17 A DNA fragment containing exons 16 and 17 was obtained. That is, a primer set of TV-A-F5 ′ (SEQ ID NO: 3) and TV-A-F3 ′ (NarI) (SEQ ID NO: 4), and TV-Am-M5 ′ (SEQ ID NO: 5) and TV- The DNA fragment was obtained by PCR using a primer set of Am-M3 ′ (AscI) (SEQ ID NO: 6). Here, the nucleic acid sequence GAA corresponding to the 22nd glutamic acid of the amyloid β protein encoded in exon 17 was deleted by using the primer shown in SEQ ID NO: 4.

  On the other hand, using the TV-AM-R5 ′ (PmeI) (SEQ ID NO: 7) and TV-Am-R3 ′ (AatII) (SEQ ID NO: 8) primers, PmeI is located at the end of the region containing the 3 ′ intron of exon 17. And the AatII restriction enzyme site was added and used as the 3 ′ arm of the pTV vector.

  Further, a lox P-neo-loxP cassette (neo cassette) was inserted into the 3 ′ intron of exon 17. The neo resistance gene is designed during LoxP (represented by triangles in FIG. 1 (b)) so that it is excluded from genomic DNA by mating with Cre mice. Further, a diphtheria toxin gene (DT) sequence was added to the 3 ′ end so that the obtained recombinant ES cells would be killed when the obtained targeting vector was randomly inserted on the chromosome.

  The targeting vector sequence thus constructed was ligated to the pTV vector by ligation using restriction enzyme sites (using NotI, Nar1 and Asc1 for ligation of the forearm and AscI, PmeI and AatII for ligation of the rear arm). Incorporation, a targeting vector construct plasmid in which a DNA fragment of mutant exon 17 was inserted between the neo cassette and exon 16 (the pTV vector may be represented as pTVFloxPGKneompA / A4) was constructed. The prepared plasmid was transformed into Escherichia coli and cultured, and then the plasmid was extracted, and a linear targeting vector cut with the restriction enzyme NotI was purified.

  The sequence of each primer used in the targeting vector is as follows. In the following sequences, the underlined portion indicates a restriction enzyme site. In addition, in the TV-A-F3 ′ (Nar1) sequence (SEQ ID NO: 4), it is shown that the base sequence GAA encoding the glutamic acid residue between C and A indicated by bold underline is deleted.

TV-A-F5 ′ (NotI) (SEQ ID NO: 3):
5'-ATAAGAAT GCGGCCGC GTAGGAAGGCCCAGCTAGAAGGAAATGGG-3 '

TV-A-F3 '(NarI) (SEQ ID NO: 4):
5'-CCGATGAT GGCGCC TTTGTTCGAACCCACAT CA GCAAAGAACACCTTCGAAAGGAAGCCG-3 '

TV-Am-M5 ′ (SEQ ID NO: 5):
5'-CGGCTTCCTTTCGAAGGTGTTCTTTGCT-3 '

TV-Am-M3 ′ (AscI) (SEQ ID NO: 6):
5'-T TGGCGCGCC AGTTAACTAGGCCTAATGTTCCTCCATGGTAACCACGCA-3 '

TV-AM-R5 ′ (PmeI) (SEQ ID NO: 7):
5'-AGCTTT GTTTAAAC AGGCTGTTGCCCTGAACTTCCACCTGAG-3 '

TV-Am-R3 ′ (AatII) (SEQ ID NO: 8):
5'-GGGGTTA GACGTC CCATTGGGTGTGACCCCACTTCAGAG-3 '

[Introduction of targeting construct into ES cells]
A linear targeting vector cleaved with NotI was introduced into ES cells by electroporation. Specifically, it is as follows.

ES cells (R1 cells: donated by Dr. Nagy, A (Canada)) were added to high glucose DMEM medium (Invitrogen) containing 20% fetal calf serum, essential amino acids, nucleosides, pyruvate, β mercaptoethanol, ESGRO (mouse) Using a medium supplemented with LIF (differentiation inhibitor), penicillin, and streptomycin, the cells were cultured at 37 ° C. and 5% CO ₂ until the logarithmic growth phase. The ES cells were trypsinized and dispersed into single cells, suspended in a medium at 10 ⁷ cells / ml, and pTVFloxPGKneompA / A4 (20) μg prepared as described above was added, Introduction was performed by electroporation.

  Furthermore, neomycin resistant ES colonies were selected by screening with antibiotic G418. Thereafter, a part of the cell mass was stocked. A DNA genome was extracted by alcohol extraction using a part of the stocked cell mass, and the DNA fragment obtained by digestion with Stu1 restriction enzyme was subjected to agarose electrophoresis. Since the StuI site exists in the neomycin resistance gene and the size of the StuI fragment varies depending on the insertion of the neomycin resistance gene, gene knock-in was confirmed using the neomycin gene introduced at an appropriate position of the APP gene as an index.

Southern blotting was performed from about 100 clones using the 5 ′ probe shown in SEQ ID NO: 9 to obtain two positive clones that hybridized. Furthermore, Southern blotting was performed using the 3 ′ probe shown in SEQ ID NO: 10 to confirm that homologous recombination had occurred. Furthermore, when it was confirmed by PCR that the mutant exon 17 was present, one positive clone was finally identified. One APP gene of the obtained positive clone was predicted to have the structure shown in FIG.
5 'probe (SEQ ID NO: 9)
5'-TCCCCCACCCCCTGATATAAAAGGGAAGACTACTTACAAGTTTTCACTAAAATCTCAGAAGTAACTTTAACTGCCGTGTTACTACTCGCATGTGGTGAGGGAGGCTGCATTAGAAAGAAATCACTGTTGATCTAACGAGGAAGTAGGTCAGGTTTTATAAAGGTTTGGAGGAAGATGAAAATAAGCAACCGGGGTGATTA

3 'Probe (SEQ ID NO: 10)
5'-TCCTCTCGTCTTCCAACGCGGCTTTACAGAGGCTTGGAGCTCATATTAATCCAGCAGACTCAAGCAAGCACCTCCTCTTCTCCTCACTGGGAGAGGTAGGACAAATATAGAAACAAGAAAAGCCATTAGCTACTGTAGAGAGATGTGTGCCCCGCACAGTCTGCGCATTGCGCTGTGTG

[Preparation of APP mutant mice]
The positive ES cell clone obtained as described above was aggregated with an 8-cell embryo obtained by mating C57BL / 6 and DBA2 mice, and returned to the uterus of ICR pseudopregnant mice (purchased from Japan SLC). Chimeric mice were obtained. These chimeric mice were crossed with C57BL / 6 mice (purchased from SLC, Japan), and F1 generation mice born were subjected to genome check to select mice having heterozygous mutant APP genes. A mouse having a mutant APP gene heterozygously was further backcrossed with a B6 mouse (C57BL / 6) for 20 generations or more to produce a congenic mouse. Among the obtained congenic mice, mice having homozygous mutant APP genes in the reproductive system were selected. Next, the selected mouse and CAG-Cre mouse (provided by Dr. Junichi Miyazaki, Osaka University School of Medicine) were crossed to remove the neo gene sandwiched between LoxP.

The knock-in mouse thus obtained biosynthesizes a mutant amyloid β protein having the following amino acid sequence. In the mutant amyloid β protein represented by SEQ ID NO: 1, the glutamic acid (E) is deleted between the amino acid sequences (AD) of the 21st to 22nd underlined amino acid sequences below.
DAEFFGHDGFEVRHQKLVFF AD VGSNKGAIIGLMVGGVVIA (SEQ ID NO: 1)

  The obtained knock-in mouse (sometimes referred to as homoKI) was subjected to 4, 6, 8, 12, 18, under the conditions of a temperature of about 25 ° C., a light / dark cycle of 12 hours / 12 hours, free drinking, and free feeding. Maintained for 24 months.

  Hetero knock-in (+/−) mouse (may be referred to as “heteroKI”), non-knock-in (− / −) mouse (may be referred to as “nonKI”), and TG2576 mouse as comparison targets, respectively, and similar to homoKI Maintained under the breeding conditions. In addition, C57BL / 6 mice were used as non-knock-in mice. Tg2576 mice (purchased from Taconic) are disease model mice that can reproduce senile plaques, which is one of the characteristics of Alzheimer's disease brain tissue changes (Holcomb L et al., Nature Medicine 4; 97-100). 1998). Male mice were used as test animals.

(2) Immunohistochemistry Samples used for each evaluation were prepared as follows. The mouse brain was fixed with 4% by volume paraformaldehyde and embedded in paraffin, and then a section having a thickness of 5 μm was prepared. The deparaffinization treatment was performed by repeating the immersion in 100% xylene for 30 minutes 5 times. Thereafter, further immersing was performed by repeating immersion in 100% alcohol for 10 minutes 5 times and further immersing in phosphate buffer for 10 minutes twice. Each sample subjected to such treatment was immunostained using the antibodies described in (A) to (E) below, and the pathological features of Alzheimer's disease were evaluated.

(A) Accumulation of Amyloid β and Form of Accumulated Amyloid β It is known that in patients with Alzheimer's disease, amyloid β protein accumulates abnormally in the hippocampus of the brain, which forms senile plaques. However, it is known that an amyloid β protein having an Osaka mutation is less likely to form amyloid fibrils (that is, less likely to form senile plaques), and promotes the formation of oligomers of amyloid β that are more neurotoxic (Tomiyama). T et al., Ann Neurol 63; 377-387, 2008). Furthermore, it has been suggested that the amyloid β protein having the Osaka mutation has a decreased extracellular secretion and accumulates in the neuronal cytoplasm (Nishitsuki K et al., Am J Pathol, 174; 957-969, 2009). ). Therefore, the formation of senile plaques, the accumulation of amyloid β protein, and the morphology of amyloid β in the brains of homoKI mice were observed.

(A-1) In order to observe the formation of senile plaques, immunostaining was performed on brains of 24-month-old homoKI and Tg2576 mice. Specifically, β001 antibody (prepared by the inventor: rabbit-derived polyclonal antibody, Lippa C et al.) That strongly binds to amyloid fibrils as a primary antibody against brain sections subjected to deparaffinization and hydration as described above , Arch. Neurol, 1999) at room temperature (about 25 ° C.) for 12 hours. After the primary antibody reaction, the brain section was washed with 100 mM Tris-HCL (pH 7.6) and 150 mM NaCl (Tris-buffered saline (TBS)), and then a biotin-labeled anti-mouse IgG antibody (Vectastein) as a secondary antibody. (CA, USA) and the same reaction as in the case of the primary antibody, followed by washing. Thereafter, an avidin biotin complex (Vectastein CA, USA) was applied to a brain section according to the product instruction manual, reacted at room temperature for 60 minutes, and then washed in the same manner as for the primary antibody. Then, it observed under the microscope.

  A photograph of the vicinity of the hippocampus of a brain section subjected to immunostaining is shown in FIG. As shown in FIG. 2, in the hippocampus of Tg2576 mice, the same senile plaques as in human Alzheimer's disease patients were observed throughout the cortex (FIG. 2 (a)). On the other hand, it was shown that senile plaques were not formed with homoKI (FIG. 2 (b)).

  Furthermore, when homoKI (FIG. 3 (b, d)) and nonKI (FIG. 3 (a, c)) were compared, abnormal accumulation of amyloid β protein in the neuronal cytoplasm was observed in homoKI, which was not found in nonKI. This result was very similar to the result of APP-Tg mice (Tomiyama T et al., J. Neurosci, 2010) into which the human-type Osaka mutation was introduced.

(A-2) To further observe the accumulation of amyloid β (Aβ) protein, the brain section after deparaffinization and hydration was first boiled in an aqueous hydrochloric acid solution adjusted to pH 2 for 10 minutes. Activation processing was performed. Thereafter, 14F1 (mouse-derived monoclonal antibody: manufactured by IBL, Gunma, Japan) was used as the primary antibody for Aβ protein, and immunostaining was performed using a biotin-labeled anti-mouse IgG antibody as the secondary antibody. The immunostaining was performed by the same method as in the case of using the β001 antibody described in (A-1) above.

  4 (1) and (2) show photographs of sections of the hippocampal CA1 region, CA3 region and DG region of each age-old mouse for each of homoKI, heteroKI and nonKI which were immunostained with an anti-14F1 antibody. From FIG. 4 (1), amyloid β accumulation was not observed at 6 months of age (A, G and M) in homoKI, but amyloid β was observed at 8 months of age (B to E, H to K and N to Q). Was confirmed. On the other hand, accumulation of amyloid β was not observed in non-KI at 24 months of age (FIG. 4 (1) F, L and R). Also, no accumulation of amyloid β was observed in the heteroKI mice (FIG. 4 (2)).

(A-3) In order to confirm the form of accumulated amyloid β, anti-amyloid β oligomer antibody A11 antibody (rabbit-derived polyclonal antibody: manufactured by CSR Japan) was used as a primary antibody according to the product instruction manual, and biotinylated anti-rabbit IgG Immunostaining was performed using the antibody as a secondary antibody. The immunostaining was performed by the same method as in the case of using the β001 antibody described in (A-1) above. FIG. 5 shows photographs of sections of hippocampal CA1 region, CA3 region and DG region of each month-old mouse for each of homoKI, heteroKI, and nonKI subjected to immunostaining. From FIG. 5, accumulation of amyloid β oligomers was observed in neurons in hippocampal CA1, CA3, and DG regions, similar to staining with 14F1 antibody (anti-amyloid β antibody) (FIGS. 5A to O). That is, the accumulated amyloid β was in the form of an oligomer, and it was shown that the symptoms of Osaka mutant Alzheimer's disease in humans were reproduced.

(B) Abnormal phosphorylation of tau protein As one of the lesions in Alzheimer's disease patients, a phenomenon is known in which tau protein is abnormally phosphorylated and fibrotically deposited in the cytoplasm. Tau protein is abundant in central neurons and is essential for the function of nerve axons that make up the neural network of the brain, but accumulates due to abnormal phosphorylation and causes neurofibrillary tangles. It is said to cause a decline.

In the detection of abnormally phosphorylated tau protein, 0.3% H ₂ O _{2 was applied to the} deparaffinized and hydrated brain sections in order to suppress endogenous peroxidase activity before the antibody reaction. / Methanol treatment was performed for 30 minutes, followed by incubation with calf serum diluted to 20% with TBS for 1 hour for blocking treatment.

  Next, an anti-PHF-1 antibody (mouse-derived monoclonal antibody: donated by Dr. Davies, P, Albert Einstein College of Medicine, NY), which is a phosphorylation-specific anti-tau antibody, was used as a primary antibody at a 1000-fold dilution. And allowed to react at room temperature (about 25 ° C.) for 12 hours. After the primary antibody reaction, the brain section was washed with 100 mM Tris-HCL (pH 7.6) and 150 mM NaCl (Tris-buffered saline (TBS)), and then a biotinylated anti-mouse IgG antibody was used as a secondary antibody. The reaction was carried out in the same manner as for the primary antibody, followed by washing. Thereafter, an avidin-biotin complex labeled with horseradish peroxidase (HRP) was bound to the secondary antibody, and the substrate was formed using DAB (3,3′-diaminobenzidine tetrahydrochloride: Dojindo Laboratories). When activated, color was developed and observed under a microscope.

  The result of immunostaining is shown in FIG. From FIG. 6, at 6 months of age, phosphorylated tau protein was not detected in any of homoKI, heteroKI, and nonKI (FIGS. 6A, F, and K). However, after 8 months of age, phosphorylated tau protein was observed in the mossy fibers in the hippocampal CA3 region of homoKI (FIGS. 6L to O). On the other hand, with heteroKI and nonKI, phosphorylated tau protein was not observed at 8, 12, and 18 months of age (FIGS. 4A to D and FI), and only at 24 months of age, there was a slight amount of mossy fibers in the hippocampal CA3 region. Phosphorylated tau protein was observed (FIGS. 6E and J).

(C) Synaptic degeneration In Alzheimer's disease patients, synaptic degeneration is considered to cause memory impairment. Therefore, observations were made on synaptic degeneration in homoKI. In order to observe synaptic degeneration, fluorescent staining of synaptophysin, which is a presynaptic marker protein, was performed to compare synaptic densities. Immunostaining was performed using an anti-synaptophysin antibody (mouse-derived monoclonal antibody: SVP-38; Sigma) as a primary antibody and a FITC-labeled anti-mouse antibody as a secondary antibody according to the instruction manual for the product. The immunostaining was performed by the same method as in the case of using the β001 antibody described in (A-1) above. Thereafter, observation was performed under a confocal fluorescence microscope.

  The synaptic density was measured using the NIH ImageJ software for staining luminance in the range of 30 μm × 60 μm in total 30 μm × 30 μm inside the pyramidal cell layer and 30 μm × 30 μm inside the pyramidal cell layer in the CA3 region in the hippocampus. It was quantified and expressed in arbitrary units (AU). The loss of neurons was evaluated by counting the number of cells that became positive by NeuN staining in the region within 150 μm in both directions along the cone cell centered on the apex of the curve of the CA3 region of the hippocampus. . The results are shown in FIG. (Statistical processing: ANOVA followed by Fisher's protected least significant difference test)

  As shown in FIG. 7, no difference in synaptic density was observed in any of the 6-month-old mice (FIGS. 7A, E and I). On the other hand, at 8 months of age, a significant phenomenon of synaptic density was observed in homoKI mice compared to nonKI mice and heteroKI mice (FIGS. 7B, F and J). At this time, there was no significant difference in synaptic density between nonKI mice and heteroKI mice. Similarly, at 12 months of age, the synaptic density of nonKI mice and heteroKI mice was similar, whereas a significant phenomenon of synaptic density was observed only in homoKI mice (FIGS. 7C, G and K). And at the age of 24 months, not only was there a difference in synaptic density between homoKI mice and nonKI mice, but there was also a decrease in synaptic density in heteroKI mice, the severity of synapse loss at this time, HomoKI mice were the most severe, followed by heteroK mice followed by nonKI mice (FIGS. 7D, H and L).

(D) Activation of glial cells It is known that activation of glial cells serves as an indicator of inflammation in the brain. Therefore, we observed the activation of glial cells in microglia and astrocytes. For the observation of microglia, an anti-Iba1 antibody (rabbit-derived polyclonal antibody: manufactured by Wako Pure Chemical Industries) was used as a primary antibody according to the product instruction manual. For observation of astrocytes, immunostaining was performed using an anti-GFAP antibody (mouse-derived monoclonal antibody: Cappel, manufactured by ICN Pharmaceuticals) according to the instruction manual for the product. The immunostaining was performed by the same method as that using the anti-PHF-1 antibody described in (B) above. The result of staining with the anti-Iba1 antibody is shown in FIG. 8, and the result of staining with the anti-GFAP antibody is shown in FIG.

  As shown in FIG. 8, when compared to each month of age for the honoKI mice, no clear microglia activation was seen until 8 months of age (FIGS. 8A and G). However, after 12 months of age, microglia was clearly activated, indicating that inflammation occurred in the brain (FIGS. 8B to D and H to J). Furthermore, no activation of microglia was observed in the hetero-KI mice and non-KI mice even at 24 months of age (FIGS. 8E, F, K, and L).

  In addition, as shown in FIG. 9, similar to the result of staining with the anti-Iba1 antibody, no clear activation of astrocytes was observed in the homoKI mice until 8 months of age (FIGS. 9A and G). However, after 12 months of age, clear activation of astrocytes was observed, indicating that inflammation was occurring in the brain (FIGS. 9B-D and HJ). Furthermore, no activation of astrocytes was observed in the hetero-KI mice and non-KI mice even at 24 months of age (FIGS. 9E, F, K and L).

(E) Nerve cell loss It is known that in Alzheimer's disease patients, a wide range of nerve cell loss is observed and the brain gradually contracts. Neuronal loss was evaluated by measuring the number of cells using as a marker the marker protein NeuN that is specifically expressed in mature neurons in 24-month-old homoKI, heteroKI and nonKI mice. As described above, the brain sections subjected to the deparaffinization treatment and the hydration treatment were subjected to an antigen activation treatment by boiling for 30 minutes in a citrate buffer (pH 6). Thereafter, an antibody against NeuN protein (anti-NeuN antibody: mouse-derived monoclonal antibody: manufactured by Millipore Bioscience Research Reagents) was immunostained as a primary antibody according to the product instruction manual. The immunostaining was performed by the same method as that using the anti-PHF-1 antibody described in (B) above. After immunostaining, the number of cells that became positive by staining with NeuN antibody in the region of 150 μm or less in both directions along the pyramidal cell array with the apex of the curve of the hippocampal CA3 region as the center was counted. (Statistical processing: ANOVA followed by Fisher's protected least significant difference test)

  The result of immunostaining using anti-NeuN antibody is shown in FIG. FIG. 10 shows representative examples of brain sections of (A) nonKI, (B) heteroKI, and (C) homoKI. As shown in FIG. 10, in the homoKI mouse at 24 months of age, a significant decrease in nerve cells was seen compared to the heteroKI mouse and the nonKI mouse. On the other hand, there was no significant difference in the number of neurons between the heteroKI mice and the nonKI mice.

  Summarizing the results of immunostaining of (A) to (E) above, it was shown that homoid β protein accumulated in oligomeric form in hippocampal neurons after 8 months of age in homoKI mice. On the other hand, senile plaques were not observed in any mouse. Simultaneously with the accumulation of amyloid β protein, abnormal phosphorylation of tau protein and loss of synapse occurred in homoKI mice from 8 months of age. Furthermore, activation of microglia and astrocyte glial cells was observed in the hippocampus in homomo KI mice after 12 months of age, and significant neuronal loss was observed in the hippocampal CA3 region in 24-month-old homo KI mice.

  In the homoKI mouse produced this time, all Alzheimer's disease characteristic pathological changes other than senile plaques have appeared as in the already known Tg2576 mouse. It was shown that Moreover, in the mutants having heterozygous Osaka mutations (heteroKI mice), the pathological changes as seen in homoKI mice did not occur until 24 months of age. It reproduces the onset of Alzheimer's disease.

(3) Morris water maze test Learning memory impairment due to Alzheimer's disease was evaluated by the Morris water maze test. The Morris water maze test is known as a behavioral analysis method for measuring spatial learning memory functions related to the hippocampus. The Morris water maze test was conducted by the following method.

(apparatus)
The apparatus was a cylindrical pool (diameter 96 cm, depth 60 cm) set on the floor. Water (room temperature) was poured into the pool to a depth of 30 cm, and the transparent platform was set to sink 1 cm below the water surface. In addition, the platform was made invisible to the swimming mouse by making the water cloudy with titanium oxide. The time to reach the platform was measured with the naked eye.

(procedure)
The Morris water maze experiment was conducted for 5 days. On the 1st to 5th days, the training was performed for the mice to memorize the position of the platform 5 times a day for each mouse. In the training, each swim was performed for 60 seconds, and the time to reach the platform (escape latency: seconds) was recorded.

  The Morris water maze test was performed on 10 10 month old non-KI mice and 10 9 month old homoKI mice, respectively, and the average value of escape latency (seconds) recorded in each group was calculated for each test day.

  The results of the Morris water maze test are shown in FIG. From FIG. 11, in the Morris water maze test, the escape latencies were shortened each time the non-KI tracked, whereas in the homoKI, the escape latencies were the same as those on the first day even after 5 days. That is, in homoKI, the spatial learning memory disorder that is characteristic of Alzheimer's disease has been reproduced. Therefore, it was shown that the knock-in mouse of the present invention is a model animal that faithfully reproduces both the features of Alzheimer's disease pathology and behavioral findings.

SEQ ID NO: 1 is the amino acid sequence of the mutant amyloid β protein.
SEQ ID NO: 3 is the nucleotide sequence of the TV-A-F5 ′ (NotI) primer.
SEQ ID NO: 4 is the base sequence of TV-A-F3 ′ (NarI) primer.
SEQ ID NO: 5 is the base sequence of TV-Am-M5 ′ primer.
SEQ ID NO: 6 is the base sequence of TV-Am-M3 ′ (AscI) primer.
SEQ ID NO: 7 is the base sequence of TV-AM-R5 ′ (PmeI) primer.
SEQ ID NO: 8 is the base sequence of TV-Am-R3 ′ (AatII) primer.
SEQ ID NO: 9 is the base sequence of the 5 ′ probe used for Southern hybridization.
SEQ ID NO: 10 is the base sequence of the 3 ′ probe used for Southern hybridization.

Claims (11)

The knock-in mouse in which the mutant amyloid precursor protein (mutant APP) gene shown in the following (a) or (b) is knocked in and has the mutant APP gene homozygously:
(A) a mutant APP gene encoding a mouse mutant amyloid β protein consisting of the amino acid sequence represented by SEQ ID NO: 1, or (b) a fifth glycine counted from the N-terminus in the amino acid sequence represented by SEQ ID NO: 1 It consists of an amino acid sequence in which one or a plurality of amino acids other than the residue, the 10th phenylalanine residue, and the 13th arginine residue are substituted, deleted, inserted or added, and is expressed in the mouse body A mutant APP gene encoding a polypeptide that induces Alzheimer's disease. A method for screening a preventive and / or therapeutic agent for Alzheimer's disease,
The step of applying a test substance to a lesioned part of the knock-in mouse or the living body thereof according to claim 1 and Alzheimer , and whether or not the knock-in mouse or a part of the living body is improved in symptoms of Alzheimer's disease Screening, and selecting a test substance that has improved the symptoms of Alzheimer's disease.   Symptoms of Alzheimer's disease are at least one selected from the group consisting of amyloid β protein accumulation, amyloid β oligomer formation, tau protein phosphorylation, synapse loss, glial cell activation, neuronal loss and learning memory impairment The screening method according to claim 2. A method for evaluating the efficacy of a preventive and / or therapeutic drug for Alzheimer's disease,
The step of applying a test substance to a lesioned part of Alzheimer 's knocked-in mouse or a part of the living body thereof according to claim 1, and the effect of improving the symptoms of Alzheimer's disease in the knock-in mouse or a part of the living body thereof A medicinal effect evaluation method including a process.   Symptoms of Alzheimer's disease are at least one selected from the group consisting of amyloid β protein accumulation, amyloid β oligomer formation, tau protein phosphorylation, synapse loss, glial cell activation, neuronal loss and learning memory impairment The method for evaluating drug efficacy according to claim 4. Use of the mutant amyloid precursor protein (mutant APP) gene shown in the following (a) or (b) for the production of a model animal of Alzheimer's disease (excluding humans) :
(A) a mutant APP gene encoding a mouse mutant amyloid β protein consisting of the amino acid sequence represented by SEQ ID NO: 1, or (b) a fifth glycine counted from the N-terminus in the amino acid sequence represented by SEQ ID NO: 1 It consists of an amino acid sequence in which one or a plurality of amino acids other than the residue, the 10th phenylalanine residue, and the 13th arginine residue are substituted, deleted, inserted or added, and is expressed in the mouse body A mutant APP gene encoding a polypeptide that induces Alzheimer's disease.   Symptoms of Alzheimer's disease are at least one selected from the group consisting of amyloid β protein accumulation, amyloid β oligomer formation, tau protein phosphorylation, synapse loss, glial cell activation, neuronal loss and learning memory impairment Use according to claim 6, wherein: Use of the knock-in mouse according to claim 1 or a part of the living body thereof , which is a lesion part of Alzheimer's disease, for the prevention and / or treatment of Alzheimer's disease.   Symptoms of Alzheimer's disease are at least one selected from the group consisting of amyloid β protein accumulation, amyloid β oligomer formation, tau protein phosphorylation, synapse loss, glial cell activation, neuronal loss and learning memory impairment Use according to claim 8, wherein: The use of the knock-in mouse according to claim 1 or a part of the living body thereof , which is a lesion part of Alzheimer, for the prevention and / or treatment of Alzheimer's disease.   Symptoms of Alzheimer's disease are at least one selected from the group consisting of amyloid β protein accumulation, amyloid β oligomer formation, tau protein phosphorylation, synapse loss, glial cell activation, neuronal loss and learning memory impairment Use according to claim 10, wherein: