JP2005278633A - Method for producing chicken type monoclonal antibody, and chicken type monoclonal antibody produced by the production method - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To establish a method for efficiently producing a chicken type monoclonal antibody and a structure-modified chicken type monoclonal antibody, to provide a chicken type monoclonal antibody produced by the production method, to provide an expression vector used for the production method, to provide a transformed cell into which the expression vector is transduced, and to provide a primer set. <P>SOLUTION: By the method for producing the chicken type monoclonal antibody, a perfect length chicken type monoclonal antibody (Full antibody), a structure-modified chicken type monoclonal antibody in which seven amino acids are deleted from the C-terminal side of the H chain (Δ7aa antibody), a structure-modified chicken type monoclonal antibody in which fifty five amino acid residues are deleted, while leaving the cysteine residue of CH2 domain, (ΔCH2 antibody), or a structure-modified chicken type monoclonal antibody in which both CH3 domain and CH4 domain are deleted (ΔFc antibody), can be produced. <P>COPYRIGHT: (C)2006,JPO&NCIPI

Description

  The present invention provides a method for producing a chicken monoclonal antibody using a host cell, particularly an animal cell, into which a gene encoding the L chain of a chicken antibody and a gene encoding an H chain have been introduced, and the production method. The present invention relates to a chicken monoclonal antibody.

  The present invention also relates to a primer set used for amplifying a gene encoding the L chain of a chicken antibody used in the above production method, and an expression vector used for expressing the L chain of a chicken antibody inserted with the gene. . Furthermore, a primer set used for amplifying the gene encoding the H chain of the chicken antibody used in the above production method, and an expression used for expressing the H chain of the chicken antibody inserted with the gene The present invention relates to a vector and a transformed cell into which the expression vector has been introduced.

  A monoclonal antibody (monoclonal antibody) is a single antibody that recognizes only a specific portion of an antigen. Such a monoclonal antibody has a very high specificity for an antigen, and its specificity is widely used for a tool for bioscience research including protein engineering and a reagent for detecting a specific substance. In particular, in recent years, its use as a therapeutic agent / diagnostic agent for various diseases has attracted attention, and some of them have been put into practical use. Monoclonal antibodies and their production technologies are being developed mainly in mammals including mouse, rat, and human, but other monoclonal antibodies (bird-type monoclonal antibodies) are also developed and produced. There are few examples of doing this.

  By the way, the present inventors have conducted research focusing on chicken-type antibodies as antibodies other than mammal-type antibodies. Chickens are phylogenetically lower than mammals, but are animals that have an elaborate immune system similar to mammals. In particular, because of its phylogenetic separation from mammals, it is useful for producing specific antibodies against proteins conserved in many mammals. That is, specific antibodies against proteins (antigens) that are difficult to produce using mice and rats can be produced in chickens. For example, N-glycolylneuraminic acid (hereinafter referred to as NeuGc), which is an antigen that serves as a human cancer marker, is present in most mammals except humans. However, since NeuGc does not exist in birds such as chickens, antibodies can be produced. In addition, since prion protein (hereinafter referred to as PrP), which is a pathogen of Creutzfeldt-Jakob disease and mad cow disease, has 90% or more homology among mammals, it is difficult to produce antibodies in mammals. However, since homology between mammals and chickens is on the order of 30%, it is possible to produce antibodies in chickens. In fact, the present inventors have succeeded in producing chicken monoclonal antibodies against the above NeuGc and PrP by the cell fusion method.

  Currently, methods for producing chicken-type antibodies, particularly chicken-type monoclonal antibodies, include cell fusion methods (see Non-Patent Literature 1 and Non-Patent Literature 2), and phage display methods (Non-Patent Literature 3, Non-Patent Literature 4, and Patent Literatures). 1) has already been established.

Another advantage of chicken-type antibodies is that they do not have cross-reactivity with mammalian-type antibodies, so by using chicken-type and mammalian-type monoclonal antibodies, high-sensitivity antigen detection without non-specific reaction is possible. It is possible to establish a system.
Asaoka, H. Nishinaka, S., Wakamiya, N., Matsuda, H., Murata, M., 1992. Two chicken monoclonal antibodies specific for heterophil Hanganutziu-Deicher antigens. Immunol. Lett. 32, 91-96. Matsuda, H., Mitsuda, h., Nakamura, N., Furusawa, S., Mohri, S., Kitamoto, T., 1999. A chicken monoclonal antibody with specificity for the N-terminal of human prion protein .FEMS Imunol Med. Microbiol. 23, 189-194 Yamanaka, HI, Inoue, T., Lkeda-tanaka, O., 1996. Chicken monoclonal antibody isolated by a phage display system. J. Immunol. 157, 1156-1162. Nakamura, N., Shimokawa, M., Miyamoto, K., Hojyo, S., Horiuchi, H., Furusawa, S., Matsuda, H., 2003. Two expression vectors for the phage-displayed chicken monoclonal antibody. Immunol. Methods 280, 157-164. JP 2003-9869 A (publication date: January 14, 2003)

  However, the method for producing a chicken monoclonal antibody by the cell fusion method has problems that its antibody production ability is low and a method for purifying the produced antibody has not been established. On the other hand, the method for producing a chicken monoclonal antibody by the phage display method described above is based on the fact that the structure of the produced antibody is different from that of a normal antibody, so that the reactivity with the antigen is low, and the structure of the expression vector is only the phage display antibody. There is a problem that it cannot be produced. Therefore, the conventional method for producing a chicken monoclonal antibody has not been satisfactory in terms of practicality.

  In addition, chicken-type antibody molecules have a larger molecular weight than mammalian-type IgG, and in order to effectively use them, it is necessary to delete or modify unnecessary amino acid regions.

  Therefore, the present invention has been made in view of the above-mentioned problems. The object of the present invention is to establish an efficient production method of a chicken monoclonal antibody, and further to a structure-modified chicken monoclonal antibody from which unnecessary amino acid regions are deleted. An object is to establish a production method and to provide a chicken monoclonal antibody produced by the production method, an expression vector and a primer set used in the production method.

  The present inventors have intensively studied to solve the above problems. As a result, a CHO cell was transfected with a gene encoding the L chain of HUC2-13 cloned from an anti-PrP chicken monoclonal antibody (HUC2-13) -producing hybridoma, and a gene encoding the H chain. It was discovered that a full-length anti-PrP chicken monoclonal antibody (hereinafter referred to as Full-PrP antibody) can be mass-produced by culturing.

  Furthermore, the present inventors have also made a structure-modified anti-PrP monoclonal antibody (hereinafter referred to as “Δ7aa-PrP antibody”) in which 7 amino acids have been deleted from the carboxyl-terminal (C-terminal) side of the H chain by the same method. Modified anti-PrP monoclonal antibody (hereinafter referred to as ΔCH2-PrP antibody) in which 55 amino acid residues have been deleted, and a structurally modified anti-PrP monoclonal antibody (hereinafter referred to as ΔFc-PrP) in which both the CH3 and CH4 regions have been deleted. (Referred to as antibody). In addition, the Full-PrP antibody, Δ7aa-PrP antibody, ΔCH2-PrP antibody, and ΔFc-PrP antibody produced by the above production method all had positive reactivity to the antigen (PrP).

  The present invention has been completed based on the above examination results.

  That is, in order to solve the above-mentioned problem, a method for producing a chicken monoclonal antibody according to the present invention comprises a primer selected from a L chain leader sequence of a chicken antibody and comprising a continuous oligonucleotide of at least 15 bases, Chicken antibody amplified using a primer set for L chain, which is selected from a base sequence of a gene encoding the constant region of the L chain of a type antibody and is a combination with a primer containing an oligonucleotide having at least 15 consecutive bases A vector for expression of L chain into which a gene encoding the L chain is inserted, a primer selected from the leader sequence of the H chain of the chicken antibody, and comprising a continuous oligonucleotide of at least 15 bases, and a chicken antibody The base sequence of the gene encoding the constant region of the H chain For expression of an H chain in which a gene encoding the H chain of a chicken-type antibody that is amplified using a primer set for H chain that is selected and combined with a primer consisting of a continuous oligonucleotide consisting of at least 15 bases is inserted It includes a step of transforming a vector into a host cell.

  The mechanism of obtaining diversity of antibody genes in birds such as chickens is different from that of mammals, and there is only one functional V gene that determines the diversity of antibodies in both H and L chains. Accordingly, in a gene encoding the H chain of a chicken monoclonal antibody (hereinafter referred to as H chain gene) or a gene encoding the L chain (hereinafter referred to as L chain gene), a leader sequence whose base sequence is unchanged, and If a primer is designed based on the base sequence in the constant region and amplification reaction such as PCR is performed using the primer, the L chain gene and H chain gene of various chicken monoclonal antibodies can be amplified with a pair of primers. Can do.

  A chicken monoclonal antibody is obtained by transforming a host cell using an L chain expression vector into which the L chain gene obtained by the amplification reaction is inserted, and an H chain expression vector into which the H chain gene is inserted. Transformed cells for production can be prepared. Furthermore, a chicken monoclonal antibody can be produced by culturing the transformed cell.

  In addition, in order to solve the above problems, a method for producing a chicken monoclonal antibody according to the present invention comprises a primer selected from a leader sequence of the L chain of a chicken antibody and containing a continuous oligonucleotide of at least 15 bases, Chicken antibody amplified using a primer set for L chain, which is selected from a base sequence of a gene encoding the constant region of the L chain of a type antibody and is a combination with a primer containing an oligonucleotide having at least 15 consecutive bases A vector for expression of L chain into which a gene encoding the L chain is inserted, a primer selected from the leader sequence of the H chain of the chicken antibody, and comprising a continuous oligonucleotide of at least 15 bases, and a chicken antibody H4 CH4 region, or CH3 region, or CH2 A gene encoding the H chain of a chicken-type antibody that is selected from the base sequence of a gene encoding the region and amplified using a primer set for H chain that is a combination with a primer comprising at least 15 or more consecutive oligonucleotides And a step of transforming a host cell with an H chain expression vector into which is inserted.

  The primer set for the L chain is designed based on the leader sequence whose base sequence is unchanged in the L chain gene and the base sequence on the constant region. As described above, in birds such as chickens, L chain genes of various chicken monoclonal antibodies can be amplified by performing amplification reactions such as PCR using the primers.

  Further, according to the above H chain primer set, H chain genes of various chicken monoclonal antibodies can be amplified in the same manner as described above. Furthermore, H chain genes of various sizes can be amplified depending on the primer setting position (CH4 region, CH3 region, or CH2 region). As shown in the examples described later, even antibodies lacking the CH4 region and CH3 region had binding activity for antigen. Even an antibody in which a part of the cysteine residue in the CH2 region has been deleted and has been partially deleted has an antigen-binding activity. Therefore, no problem arises in the activity of the finally produced antibody even in the case of a partially deleted H chain gene amplified using the above primers.

  A chicken monoclonal antibody is obtained by transforming a host cell using an L chain expression vector into which the L chain gene obtained by the amplification reaction is inserted, and an H chain expression vector into which the H chain gene is inserted. Transformed cells for production can be prepared. Furthermore, various chicken monoclonal antibodies can be produced by culturing the transformed cells.

  In addition, in the method for producing a chicken monoclonal antibody according to the present invention, the leader sequence of the L chain of the chicken antibody may have the base sequence shown in SEQ ID NO: 19 in order to solve the above-mentioned problems. .

  The base sequence shown in SEQ ID NO: 19 is an example of the base sequence of the L chain leader sequence of a chicken antibody (hereinafter referred to as the L chain leader sequence). What is necessary is just to design the base sequence of the primer for L chains based on the said base sequence information. However, the base sequence of the L chain leader sequence of the chicken antibody is not limited to the base sequence shown in SEQ ID NO: 19 as long as it functions as a leader sequence. Among the base sequences shown in SEQ ID NO: 19, It may be a base sequence in which one or several bases are deleted, substituted or added. Further, it may be a sequence complementary to the L chain leader sequence.

  Further, the method for producing a chicken monoclonal antibody according to the present invention is characterized in that the gene encoding the constant region of the L chain of the chicken antibody has the base sequence shown in SEQ ID NO: 20. Good.

  The base sequence shown in SEQ ID NO: 20 is an example of the base sequence of a gene (hereinafter referred to as CL gene) encoding the constant region of the L chain of a chicken antibody. What is necessary is just to design the base sequence of the primer for L chains based on the said base sequence information. However, the base sequence of the gene encoding the constant region of the L chain of the chicken antibody is not limited to the base sequence shown in SEQ ID NO: 20 as long as it encodes the constant region of the L chain of the chicken antibody. As long as it encodes the constant region of the L chain of a chicken antibody, the base sequence shown in SEQ ID NO: 20 may be a base sequence in which one or several bases have been deleted, substituted, or added. . Further, it may be a complementary sequence of the CL gene.

  The method for producing a chicken monoclonal antibody according to the present invention may be characterized in that the leader sequence of the H chain of the chicken antibody has the base sequence shown in SEQ ID NO: 21.

  The base sequence shown in SEQ ID NO: 21 is an example of the base sequence of a gene encoding the H chain leader sequence of a chicken antibody (hereinafter referred to as the H chain leader sequence). The base sequence of the H chain primer may be designed based on the base sequence information. However, the base sequence of the leader sequence of the H chain of the chicken antibody is not limited to the base sequence shown in SEQ ID NO: 21 as long as it functions as a leader sequence. Of the base sequence shown in SEQ ID NO: 21, It may be a base sequence in which one or several bases are deleted, substituted or added. Further, it may be a complementary sequence of the H chain leader sequence.

  The method for producing a chicken monoclonal antibody according to the present invention is characterized in that the gene encoding the constant region of the H chain of the chicken antibody has the base sequence shown in SEQ ID NO: 22. Good.

  The base sequence shown in SEQ ID NO: 22 is an example of the base sequence of a gene encoding the constant region of the H chain of a chicken antibody (hereinafter referred to as CH gene). The base sequence of the H chain primer may be designed based on the base sequence information. However, the base sequence of the gene encoding the constant region of the H chain of the chicken antibody is not limited to the base sequence shown in SEQ ID NO: 22 as long as it encodes the constant region of the H chain of the chicken antibody. The base sequence shown in SEQ ID NO: 22 may be a base sequence in which one or several bases are deleted, substituted, or added. Further, it may be a complementary sequence of the CH chain gene.

  Further, in the method for producing a chicken monoclonal antibody according to the present invention, the gene encoding the CH4 region of the H chain of the chicken antibody has the base sequence shown in SEQ ID NO: 23, and the CH3 of the H chain of the chicken antibody. The gene encoding the region has the base sequence shown in SEQ ID NO: 24, and the gene encoding the CH2 region of the H chain of the chicken antibody has the base sequence shown in SEQ ID NO: 25. There may be.

  The base sequence shown in SEQ ID NO: 23 is an example of the base sequence of a gene encoding the CH4 region of the H chain of a chicken antibody (hereinafter referred to as CH4 gene). The base sequence shown in SEQ ID NO: 24 is an example of the base sequence of a gene (referred to as CH3 gene) encoding the CH3 region of the H chain of the chicken antibody. The base sequence shown in SEQ ID NO: 25 is an example of the base sequence of a gene encoding the CH2 region of the H chain of a chicken antibody (hereinafter referred to as CH2 gene). The base sequence of the H chain primer may be designed based on the above base sequence information. However, the base sequence of the CH4 gene is not limited to the base sequence shown in the above-mentioned SEQ ID NO: 23, and any base sequence shown in SEQ ID NO: 23 can be used as long as it encodes the CH4 region of the H chain of the chicken antibody. It may be a base sequence in which one or several bases are deleted, substituted or added. Further, it may be a complementary sequence of the CH4 gene.

  Further, the base sequence of the CH3 gene is not limited to the base sequence shown in the above SEQ ID NO: 24, and any base sequence shown in SEQ ID NO: 24 can be used as long as it encodes the CH3 region of the H chain of the chicken antibody. Among them, a base sequence in which one or several bases are deleted, substituted, or added may be used. Further, it may be a complementary sequence of the CH3 gene.

  Further, the base sequence of the CH2 gene is not limited to the base sequence shown in the above SEQ ID NO: 25, and any base sequence shown in SEQ ID NO: 25 can be used as long as it encodes the CH2 region of the H chain of the chicken antibody. Among them, a base sequence in which one or several bases are deleted, substituted, or added may be used. Further, it may be a complementary sequence of the CH2 gene.

  In addition, the method for producing a chicken monoclonal antibody of the present invention is amplified using a first primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 1 and a primer having the base sequence shown in SEQ ID NO: 2. A combination of an L chain expression vector into which a gene encoding the L chain of a chicken antibody is inserted, a primer having the base sequence shown in SEQ ID NO: 3 and a primer having the base sequence shown in SEQ ID NO: 4 And a step of transforming a host cell using an H chain expression vector into which a gene encoding the H chain of a chicken antibody amplified using the second primer set is inserted. .

  With the first primer set according to the above configuration, the L chain gene can be amplified. In addition, according to the second primer set, the H chain gene of the full-length chicken antibody can be amplified. By transforming host cells using the L chain expression vector into which the L chain gene of the chicken antibody obtained by the amplification reaction has been inserted, and the H chain expression vector into which the H chain gene has been inserted, A transformed cell for producing a chicken monoclonal antibody can be prepared. Furthermore, a full-length chicken monoclonal antibody can be produced by culturing the transformed cells. The mechanism of obtaining the diversity of antibody genes in birds such as chickens is different from that of mammals, and there is one functional V gene that determines the diversity of antibodies. With the two primer set, it is possible to amplify the L chain gene and the H chain gene of a chicken antibody against various antigens.

  However, the base sequence of each primer shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4 is not limited to the base sequence as long as it can amplify the target gene. Alternatively, it may be a base sequence in which one or several bases are deleted, substituted, or added in the base sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4. Further, it may be a complementary sequence of each of the above base sequences.

  Further, the method for producing a chicken monoclonal antibody according to the present invention is amplified using a first primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 1 and a primer having the base sequence shown in SEQ ID NO: 2. A combination of an L chain expression vector into which a gene encoding the L chain of a chicken antibody to be inserted is inserted, a primer having the base sequence shown in SEQ ID NO: 3 and a primer having the base sequence shown in SEQ ID NO: 5 And a step of transforming a host cell with an H chain expression vector into which a gene encoding the H chain of a chicken antibody amplified using the third primer set is inserted. .

  According to the first primer set according to the above configuration, the L chain gene of a chicken antibody can be amplified. Further, according to the third primer set, a gene designed to delete 7 amino acids from the C-terminal side of the H chain of the chicken antibody can be amplified. By transforming host cells using the L chain expression vector into which the L chain gene of the chicken antibody obtained by the amplification reaction has been inserted, and the H chain expression vector into which the H chain gene has been inserted, A transformed cell for producing a chicken monoclonal antibody can be prepared. Furthermore, by culturing the transformed cells, a structurally modified chicken monoclonal antibody in which 7 amino acids have been deleted from the C-terminal side of the H chain of the chicken antibody can be produced. For the same reason as described above, it is possible to amplify the L-chain gene and the H-chain gene of chicken antibodies against various antigens using the first primer set and the third primer set.

  However, the base sequence of each primer shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4 is not limited to the base sequence as long as it can amplify the target gene. Alternatively, it may be a base sequence in which one or several bases are deleted, substituted, or added in the base sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4. Further, it may be a complementary sequence of each of the above base sequences.

  Further, the method for producing a chicken monoclonal antibody according to the present invention is amplified using a first primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 1 and a primer having the base sequence shown in SEQ ID NO: 2. A combination of an L chain expression vector into which a gene encoding the L chain of a chicken antibody is inserted, a primer having the base sequence shown in SEQ ID NO: 3 and a primer having the base sequence shown in SEQ ID NO: 7 A fifth primer set, which is a combination of a DNA fragment amplified using the fourth primer set and a primer having the base sequence shown in SEQ ID NO: 6 and a primer having the base sequence shown in SEQ ID NO: 4 Mixed with the DNA fragment to be amplified, and further has the base sequence shown in SEQ ID NO: 3. An H chain expression vector into which a gene encoding the H chain of a chicken antibody amplified using a second primer set which is a combination of a primer having a nucleotide sequence shown in SEQ ID NO: 4 is inserted; And a step of transforming a host cell using

  According to the first primer set according to the above configuration, the L chain gene of a chicken antibody can be amplified. Further, a DNA fragment amplified using a fourth primer set that is a combination of a primer having the base sequence shown in SEQ ID NO: 3 and a primer having the base sequence shown in SEQ ID NO: 7, and a base shown in SEQ ID NO: 6 A primer having a base sequence shown in SEQ ID NO: 3 by mixing a DNA fragment amplified using a fifth primer set which is a combination of a primer having a sequence and a primer having a base sequence shown in SEQ ID NO: 4 And the second primer set, which is a combination of the primer having the base sequence shown in SEQ ID NO: 4, and 55 amino acid residues are missing, leaving the cysteine residue in the CH2 region of the H chain of the chicken antibody. A gene designed to be lost can be amplified. By transforming host cells using the L chain expression vector into which the L chain gene of the chicken antibody obtained by the amplification reaction has been inserted, and the H chain expression vector into which the H chain gene has been inserted, A transformed cell for producing a chicken monoclonal antibody can be prepared. Furthermore, by culturing the above transformed cells, a structurally modified chicken monoclonal antibody in which 55 amino acid residues are deleted except for the cysteine residue in the CH2 region of the H chain of the chicken antibody can be produced. For the same reason as described above, the L chain gene and the H chain gene of chicken antibodies against various antigens are amplified by the first primer set, the second primer set, the fourth primer set, and the fifth primer set. Is possible.

  However, the base sequence of each primer shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 7 is not limited as long as it can amplify the target gene. Not limited to the base sequence, one or several bases are deleted from the base sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 7. , Substituted or added nucleotide sequences. Further, it may be a complementary sequence of each of the above base sequences.

  Further, the method for producing a chicken monoclonal antibody according to the present invention is amplified using a first primer set which is a combination of a primer having the base sequence shown in SEQ ID NO: 1 and a primer having the base sequence shown in SEQ ID NO: 2. A combination of an L chain expression vector into which a gene encoding the L chain of a chicken antibody is inserted, a primer having the base sequence shown in SEQ ID NO: 3 and a primer having the base sequence shown in SEQ ID NO: 8 And a step of transforming a host cell using an H chain expression vector into which a gene encoding the H chain of a chicken antibody amplified using the sixth primer set is inserted. .

  According to the first primer set according to the above configuration, the L chain gene of a chicken antibody can be amplified. Further, according to the sixth primer set, it is possible to amplify a gene designed to delete both the CH3 region and the CH4 region of the H chain of the chicken antibody. By transforming host cells using the L chain expression vector into which the L chain gene of the chicken antibody obtained by the amplification reaction has been inserted, and the H chain expression vector into which the H chain gene has been inserted, A transformed cell for producing a chicken monoclonal antibody can be prepared. Furthermore, by culturing the transformed cell, a structurally modified chicken monoclonal antibody in which both the CH3 region and CH4 region of the H chain of the chicken antibody are deleted can be produced. For the same reason as described above, it is possible to amplify the L-chain gene and H-chain gene of chicken-type antibodies against various antigens using the first primer set and the sixth primer set.

  However, the nucleotide sequence of each primer shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 8 is not limited to the nucleotide sequence as long as it can amplify the target gene. Alternatively, it may be a base sequence in which one or several bases are deleted, substituted, or added in the base sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 8. Further, it may be a complementary sequence of each of the above base sequences.

  In addition to the above configuration, the method for producing a chicken monoclonal antibody according to the present invention is characterized in that the host cell is an animal-derived cell. By setting it as the said structure, a chicken type monoclonal antibody can be produced suitably.

  Furthermore, the method for producing a chicken monoclonal antibody according to the present invention is characterized in that, in addition to the above configuration, the animal-derived cell is a CHO cell. Since CHO cells can be suspended in culture and have a short generation time and high proliferation ability, chicken monoclonal antibodies can be produced more efficiently.

  In addition to the above configuration, the method for producing a chicken monoclonal antibody according to the present invention is characterized in that the L chain expression vector and / or the H chain expression vector further have a purification tag. By adopting such a configuration, it becomes possible to easily purify the target chicken monoclonal antibody from the culture solution of the transformed cells for producing the chicken monoclonal antibody, and more easily produce the chicken monoclonal antibody. .

  On the other hand, the chicken monoclonal antibody according to the present invention is characterized by being produced using any one of the above-described methods for producing a chicken antibody according to the present invention. Therefore, the chicken monoclonal antibody according to the present invention is a full-length chicken monoclonal antibody (hereinafter referred to as a full antibody as appropriate), or a structurally modified chicken monoclonal antibody (hereinafter referred to as 7-amino acid deleted from the C-terminal side of the H chain). (Referred to as Δ7aa antibody as appropriate), or a structurally modified chicken monoclonal antibody (hereinafter referred to as ΔCH2 antibody as appropriate) in which 55 amino acid residues have been deleted leaving the cysteine residue in the CH2 region, or both the CH3 region and the CH4 region. It has various modes such as a deleted structurally modified chicken monoclonal antibody (hereinafter referred to as ΔFc antibody as appropriate).

  On the other hand, the L chain expression vector according to the present invention is an expression vector used for expressing the L chain of a chicken antibody, and is selected from the leader sequence of the L chain of a chicken antibody, and is at least 15 consecutive. For the L chain, which is a combination of a primer containing an oligonucleotide having at least 15 bases and a primer having a nucleotide sequence selected from the base sequence of a gene encoding the constant region of the L chain of a chicken antibody and containing at least 15 consecutive nucleotides A gene encoding the L chain of the chicken antibody amplified using the primer set is inserted.

  According to the said structure, it becomes possible to produce the L chain of a chicken type | mold antibody in the transformed cell into which the said L chain expression vector was introduce | transduced.

  In the L chain expression vector according to the present invention, the L chain leader sequence of the above chicken antibody may have the base sequence shown in SEQ ID NO: 19.

  The base sequence shown in SEQ ID NO: 19 is an example of the base sequence of the L chain leader sequence. What is necessary is just to design the base sequence of the primer for L chains based on the said base sequence information. However, the base sequence of the L chain leader sequence of the chicken antibody is not limited to the base sequence shown in SEQ ID NO: 19 as long as it functions as a leader sequence. Among the base sequences shown in SEQ ID NO: 19, It may be a base sequence in which one or several bases are deleted, substituted or added. Further, it may be a sequence complementary to the L chain leader sequence.

  In the L chain expression vector according to the present invention, the gene encoding the constant region of the L chain of the chicken antibody may have the base sequence shown in SEQ ID NO: 20.

  The base sequence shown in SEQ ID NO: 20 is an example of the base sequence of the CL gene. What is necessary is just to design the base sequence of the primer for L chains based on the said base sequence information. However, the base sequence of the CL gene is not limited to the base sequence shown in SEQ ID NO: 20 as long as it encodes the constant region of the L chain of the chicken antibody. Of the base sequence shown in SEQ ID NO: 20, It may be a base sequence in which one or several bases are deleted, substituted or added. Further, it may be a complementary sequence of the CL gene.

  The L chain expression vector according to the present invention is an expression vector used for expressing the L chain of a chicken-type antibody, and is represented by a primer having the base sequence shown in SEQ ID NO: 1 and SEQ ID NO: 2. A gene encoding the L chain of a chicken antibody amplified using a first primer set which is a combination with a primer having a nucleotide sequence is inserted. According to the said structure, it becomes possible to produce the L chain of a chicken-type antibody in the transformed cell into which the said expression vector was introduce | transduced.

  The base sequence of each primer shown in SEQ ID NO: 1 or SEQ ID NO: 2 is not limited to the base sequence as long as it can amplify the target gene. SEQ ID NO: 1 or SEQ ID NO: 2 may be a base sequence in which one or several bases are deleted, substituted, or added. Further, it may be a complementary sequence of each of the above base sequences.

  The L chain expression vector according to the present invention may have a purification tag. By adopting such a configuration, it becomes possible to easily purify the target chicken monoclonal antibody from the culture solution of the transformed cells for producing the chicken monoclonal antibody, and more easily produce the chicken monoclonal antibody. .

  The H chain expression vector according to the present invention is an expression vector used for expressing the H chain of a chicken antibody, and is selected from a leader sequence of the H chain of a chicken antibody, and has at least 15 consecutive bases. Primer for H chain which is a combination of a primer comprising the above oligonucleotide and a primer comprising at least 15 or more consecutive oligonucleotides selected from the base sequence of a gene encoding the constant region of the H chain of a chicken antibody A gene encoding the heavy chain of the chicken antibody amplified using the set is inserted.

  According to the said structure, it becomes possible to produce the H chain of a chicken-type antibody in the transformed cell into which the said H chain expression vector was introduced.

  The H chain expression vector according to the present invention is an expression vector used for expressing the H chain of a chicken antibody, and is selected from a leader sequence of the H chain of a chicken antibody, and has at least 15 consecutive bases. A primer comprising the above oligonucleotide, and a primer comprising at least 15 or more consecutive oligonucleotides selected from the base sequence of the gene encoding the CH4 region, CH3 region, or CH2 region of the H chain of the chicken antibody A gene encoding the H chain of the chicken antibody amplified using the H chain primer set which is a combination of the above is inserted.

  According to the said structure, it becomes possible to produce the H chain of a chicken-type antibody in the transformed cell into which the said H chain expression vector was introduced. Furthermore, it is possible to produce H-chains of chicken antibodies of various sizes depending on the set positions of the primers (CH4 region, CH3 region, or CH2 region).

  In the H chain expression vector according to the present invention, the leader sequence of the H chain of the chicken antibody may have the base sequence represented by SEQ ID NO: 21.

  The base sequence shown in SEQ ID NO: 21 is an example of the base sequence of a gene encoding the H chain leader sequence of a chicken antibody. The base sequence of the H chain primer may be designed based on the base sequence information. However, the base sequence of the H chain leader sequence of the chicken antibody is not limited to the base sequence shown in SEQ ID NO: 21 as long as it functions as a leader sequence. Among the base sequences shown in SEQ ID NO: 21, It may be a base sequence in which one or several bases are deleted, substituted or added. Further, it may be a complementary sequence of the H chain leader sequence.

  In the H chain expression vector according to the present invention, the gene encoding the constant region of the H chain of the chicken antibody may have the base sequence shown in SEQ ID NO: 22.

  The base sequence shown in SEQ ID NO: 22 is an example of the base sequence of the CH gene of the chicken antibody. The base sequence of the H chain primer may be designed based on the base sequence information. However, the base sequence of the gene encoding the constant region of the H chain of the chicken antibody is not limited to the base sequence shown in SEQ ID NO: 22 as long as it encodes the constant region of the H chain of the chicken antibody. The base sequence shown in SEQ ID NO: 22 may be a base sequence in which one or several bases are deleted, substituted, or added. Further, it may be a complementary sequence of the CH chain gene.

  In the H chain expression vector according to the present invention, the gene encoding the CH4 region of the H chain of the chicken antibody has the base sequence shown in SEQ ID NO: 23, and encodes the CH3 region of the H chain of the chicken antibody. And the gene encoding the H2 CH2 region of the chicken antibody may have the base sequence shown in SEQ ID NO: 25.

  The base sequence shown in SEQ ID NO: 23 is an example of the base sequence of the CH4 gene of a chicken antibody. The base sequence shown in SEQ ID NO: 24 is an example of the base sequence of CH3 gene of chicken antibody. The base sequence shown in SEQ ID NO: 25 is an example of the base sequence of the CH2 gene of the chicken antibody. The base sequence of the H chain primer may be designed based on the above base sequence information. However, the base sequence of the CH4 gene is not limited to the base sequence shown in SEQ ID NO: 23 as long as it encodes the CH4 region of a chicken antibody, and one or more of the base sequences shown in SEQ ID NO: 23 It may be a base sequence in which several bases are deleted, substituted or added. Further, it may be a complementary sequence of the CH4 gene.

  Further, the base sequence of the CH3 gene is not limited to the base sequence shown in SEQ ID NO: 24 as long as it encodes the CH3 region of the H chain of the chicken antibody. Among them, a base sequence in which one or several bases are deleted, substituted, or added may be used. Further, it may be a complementary sequence of the CH3 gene.

  Further, the base sequence of the CH2 gene is not limited to the base sequence shown in SEQ ID NO: 25 as long as it encodes the CH2 region of the H chain of the chicken antibody. Among them, a base sequence in which one or several bases are deleted, substituted, or added may be used. Further, it may be a complementary sequence of the CH2 gene.

  The H chain expression vector according to the present invention is an expression vector used for expressing the H chain of a chicken antibody, and comprises a primer having the base sequence shown in SEQ ID NO: 3 and SEQ ID NO: 4. A gene encoding the H chain of a chicken antibody amplified using a second primer set which is a combination with a primer having a base sequence is inserted. According to the said structure, it becomes possible to produce a full length chicken type | mold antibody H chain in the transformed cell into which the said expression vector was introduce | transduced.

  The base sequence of each primer shown in SEQ ID NO: 3 or SEQ ID NO: 4 is not limited to the base sequence as long as it can amplify the target gene, and SEQ ID NO: 3 or SEQ ID NO: 4 In the base sequence shown in (1), one or several bases may be deleted, substituted, or added. Further, it may be a complementary sequence of each of the above base sequences.

  The H chain expression vector according to the present invention is an expression vector used for expressing the H chain of a chicken antibody, and comprises a primer having the base sequence shown in SEQ ID NO: 3 and SEQ ID NO: 5. A gene encoding the H chain of a chicken antibody amplified using a third primer set which is a combination with a primer having a base sequence is inserted. According to the said structure, it becomes possible to produce the chicken antibody H chain | strand which deleted 7 amino acids from the C terminal side in the transformed cell into which the said expression vector was introduce | transduced.

  The base sequence of each primer shown in SEQ ID NO: 3 or SEQ ID NO: 5 is not limited to the base sequence as long as it can amplify the target gene, and SEQ ID NO: 3 or SEQ ID NO: 5 In the base sequence shown in (1), one or several bases may be deleted, substituted, or added. Further, it may be a complementary sequence of each of the above base sequences.

  The H chain expression vector according to the present invention is an expression vector used for expressing the H chain of a chicken antibody, and is represented by a primer having the base sequence shown in SEQ ID NO: 3 and SEQ ID NO: 7. A combination of a DNA fragment amplified using a fourth primer set that is a combination with a primer having a base sequence, a primer having a base sequence shown in SEQ ID NO: 6 and a primer having a base sequence shown in SEQ ID NO: 4 A DNA fragment to be amplified using the fifth primer set is a second combination of a primer having the base sequence shown in SEQ ID NO: 3 and a primer having the base sequence shown in SEQ ID NO: 4 The gene encoding the H chain of the chicken antibody amplified using the primer set is inserted. It is characterized in. According to the said structure, it becomes possible to produce the chicken antibody H chain which deleted the 55 amino acid residue except the cysteine residue of CH2 area | region in the transformed cell into which the said expression vector was introduce | transduced.

  However, the base sequence of each primer shown in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 7 is not limited to the base sequence as long as it can amplify the target gene. Alternatively, it may be a base sequence in which one or several bases are deleted, substituted, or added in the base sequence shown in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 7. Further, it may be a complementary sequence of each of the above base sequences.

  The H chain expression vector according to the present invention is an expression vector used for expressing the H chain of a chicken antibody, and is represented by a primer having the base sequence shown in SEQ ID NO: 3 and SEQ ID NO: 8. A gene encoding the H chain of a chicken antibody amplified using a sixth primer set that is a combination with a primer having a base sequence is inserted. According to the said structure, it becomes possible to produce the chicken antibody H chain | strand which deleted both CH3 area | region and CH4 area | region in the transformed cell into which the said expression vector was introduce | transduced.

  The base sequence of each primer shown in SEQ ID NO: 3 or SEQ ID NO: 8 is not limited to the base sequence as long as it can amplify the target gene. SEQ ID NO: 3 or SEQ ID NO: 8 In the base sequence shown in (1), one or several bases may be deleted, substituted, or added. Further, it may be a complementary sequence of each of the above base sequences.

  The H chain expression vector according to the present invention is further characterized in that the expression vector has a purification tag. By adopting such a configuration, it becomes possible to easily purify the target chicken monoclonal antibody from the culture solution of the transformed cells for producing the chicken monoclonal antibody, and more easily produce the chicken monoclonal antibody. .

  On the other hand, the transformed cell according to the present invention is a transformed cell used for producing a chicken monoclonal antibody, wherein the L-chain expression vector of the chicken antibody is introduced, and the H-chain expression vector is It is characterized by being introduced.

  According to the above configuration, chicken monoclonal antibodies of various modes such as Full antibody, Δ7aa antibody, ΔCH2 antibody, or ΔFc antibody can be efficiently produced.

  On the other hand, the H chain primer set according to the present invention is a primer set used for amplifying a gene encoding the L chain of a chicken antibody, and is selected from a leader sequence of the L chain of a chicken antibody. And a primer comprising an oligonucleotide having at least 15 bases and a primer selected from a base sequence of a gene encoding the constant region of the L chain of a chicken antibody and comprising a continuous oligonucleotide having at least 15 bases It is characterized by that. According to the said structure, the gene which codes the L chain of the chicken-type antibody with respect to various antigens can be amplified by amplification reaction, such as PCR.

  In the L chain primer set according to the present invention, the L chain leader sequence of the chicken antibody may have the base sequence shown in SEQ ID NO: 19.

  The base sequence shown in SEQ ID NO: 19 is an example of the base sequence of the L chain leader sequence. What is necessary is just to design the base sequence of the primer for L chains based on the said base sequence information. However, the base sequence of the L chain leader sequence of the chicken antibody is not limited to the base sequence shown in SEQ ID NO: 19 as long as it functions as a leader sequence. Among the base sequences shown in SEQ ID NO: 19, It may be a base sequence in which one or several bases are deleted, substituted or added. Further, it may be a sequence complementary to the L chain leader sequence.

  In the L chain primer set according to the present invention, the gene encoding the constant region of the L chain of the chicken antibody may have the base sequence shown in SEQ ID NO: 20.

  The base sequence shown in SEQ ID NO: 20 is an example of the base sequence of the CL gene. The base sequence of the L chain primer may be designed based on the base sequence information encoding the constant region of the L chain of the chicken antibody. However, the base sequence of the CL gene is not limited to the base sequence shown in SEQ ID NO: 20 as long as it encodes the constant region of the L chain of the chicken antibody. Of the base sequence shown in SEQ ID NO: 20, It may be a base sequence in which one or several bases are deleted, substituted or added. Further, it may be a complementary sequence of the CL gene.

  On the other hand, the primer set for L chain according to the present invention comprises a primer having a base sequence shown in SEQ ID NO: 1 and a base sequence shown in SEQ ID NO: 2 used for amplifying a gene encoding the L chain of a chicken antibody In combination with a primer having According to the said structure, the gene which codes the L chain of the chicken-type antibody with respect to various antigens can be amplified by amplification reaction, such as PCR.

  The base sequence of each primer shown in SEQ ID NO: 1 or SEQ ID NO: 2 is not limited to the base sequence as long as it can amplify the target gene. SEQ ID NO: 1 or SEQ ID NO: 2 may be a base sequence in which one or several bases are deleted, substituted, or added. Further, it may be a complementary sequence of each of the above base sequences.

  On the other hand, the H chain primer set according to the present invention is a primer set used for amplifying a gene encoding the H chain of a chicken antibody, and is selected from a leader sequence of the H chain of a chicken antibody. A primer comprising an oligonucleotide having at least 15 bases and a primer comprising at least 15 consecutive bases selected from a base sequence of a gene encoding the constant region of the H chain of a chicken antibody. It is characterized by that.

  According to the above configuration, genes encoding chicken antibody H chains against various antigens can be amplified by amplification reactions such as PCR.

  The H chain primer set according to the present invention is a primer set used for amplifying a gene encoding the H chain of a chicken antibody, and is selected from a leader sequence of the H chain of a chicken antibody, and is at least continuous. A primer comprising an oligonucleotide of 15 bases or more and a nucleotide sequence of a gene encoding the CH4 region, CH3 region, or CH2 region of the H chain of a chicken antibody, and consisting of at least 15 consecutive bases of oligonucleotides It is characterized by a combination with a primer.

  Further, according to the above H chain primer set, H chain genes of various chicken monoclonal antibodies can be amplified in the same manner as described above. Furthermore, H chain genes of various sizes can be amplified depending on the primer setting position (CH4 region, CH3 region, or CH2 region).

  In the H chain primer set according to the present invention, the H chain leader sequence of the chicken antibody may have the base sequence represented by SEQ ID NO: 21.

  The base sequence shown in SEQ ID NO: 21 is an example of an H chain leader sequence of a chicken antibody. The base sequence of the H chain primer may be designed based on the base sequence information. However, the base sequence of the H chain leader sequence of the chicken antibody is not limited to the base sequence shown in SEQ ID NO: 21 as long as it functions as a leader sequence. Among the base sequences shown in SEQ ID NO: 21, It may be a base sequence in which one or several bases are deleted, substituted or added. Further, it may be a complementary sequence of the H chain leader sequence.

  In the H chain primer set according to the present invention, the gene encoding the constant region of the H chain of the chicken antibody may have the base sequence shown in SEQ ID NO: 22.

  The base sequence shown in SEQ ID NO: 22 is an example of the base sequence of the CH gene of the chicken antibody. The base sequence of the H chain primer may be designed based on the base sequence information. However, the base sequence of the CH gene of the chicken antibody is not limited to the base sequence shown in SEQ ID NO: 22 as long as it encodes the constant region of the H chain of the chicken antibody, but is shown in SEQ ID NO: 22. A base sequence in which one or several bases are deleted, substituted, or added may be used. Further, it may be a complementary sequence of the H chain leader sequence.

  In the H chain primer set according to the present invention, the gene encoding the H4 CH4 region of the chicken antibody has the base sequence shown in SEQ ID NO: 23, and the H3 CH3 region of the chicken antibody The encoding gene may have the base sequence shown in SEQ ID NO: 24, and the gene encoding the CH2 region of the H chain of the chicken antibody may have the base sequence shown in SEQ ID NO: 25.

  The base sequence shown in SEQ ID NO: 23 is an example of the base sequence of the CH4 gene of a chicken antibody. The base sequence shown in SEQ ID NO: 24 is an example of the base sequence of CH3 gene of chicken antibody. The base sequence shown in SEQ ID NO: 25 is an example of the base sequence of the CH2 gene of the chicken antibody. The base sequence of the H chain primer may be designed based on the above base sequence information. However, the base sequence of the CH4 gene is not limited to the base sequence shown in SEQ ID NO: 23 as long as it encodes the CH4 region of the H chain of the chicken antibody. Of the base sequence shown in SEQ ID NO: 23, It may be a base sequence in which one or several bases are deleted, substituted or added. Further, it may be a complementary sequence of the CH4 gene.

  Further, the base sequence of the CH3 gene is not limited to the base sequence shown in SEQ ID NO: 24 as long as it encodes the CH3 region of the H chain of the chicken antibody. Among them, a base sequence in which one or several bases are deleted, substituted, or added may be used. Further, it may be a complementary sequence of the CH3 gene.

  Further, the base sequence of the CH2 gene is not limited to the base sequence shown in SEQ ID NO: 25 as long as it encodes the CH2 region of the H chain of the chicken antibody. Among them, a base sequence in which one or several bases are deleted, substituted, or added may be used. Further, it may be a complementary sequence of the CH2 gene.

  The primer set for H chain according to the present invention includes a primer having a base sequence shown in SEQ ID NO: 3 and a base sequence shown in SEQ ID NO: 4 that are used to amplify a gene encoding the H chain of a chicken antibody. In combination with a primer having According to the above configuration, genes encoding full-length chicken antibody H chains against various antigens can be amplified by amplification reactions such as PCR.

  The base sequence of each primer shown in SEQ ID NO: 3 or SEQ ID NO: 4 is not limited to the base sequence as long as it can amplify the target gene, and SEQ ID NO: 3 or SEQ ID NO: 4 In the base sequence shown in (1), one or several bases may be deleted, substituted, or added. Further, it may be a complementary sequence of each of the above base sequences.

  The primer set for H chain according to the present invention comprises a primer having a base sequence shown in SEQ ID NO: 3 and a base sequence shown in SEQ ID NO: 5 used for amplifying a gene encoding the H chain of a chicken antibody. In combination with a primer having According to the said structure, the gene designed so that 7 amino acids may be deleted from the C-terminal side of the H chain of the chicken antibody with respect to various antigens by amplification reaction, such as PCR, can be amplified.

  The base sequence of each primer shown in SEQ ID NO: 3 or SEQ ID NO: 5 is not limited to the base sequence as long as it can amplify the target gene, and SEQ ID NO: 3 or SEQ ID NO: 5 In the base sequence shown in (1), one or several bases may be deleted, substituted, or added. Further, it may be a complementary sequence of each of the above base sequences.

The primer set according to the present invention has a primer having a base sequence shown in SEQ ID NO: 3 and a base sequence shown in SEQ ID NO: 7, which is used to amplify a gene encoding the H chain of a chicken antibody. It is a combination of a primer, a primer having the base sequence shown in SEQ ID NO: 6, and a primer having the base sequence shown in SEQ ID NO: 4. According to the above configuration, genes designed to delete 55 amino acid residues except for cysteine residues in the CH2 region of the H chain of various chicken antibodies can be amplified by amplification reactions such as PCR. The nucleotide sequence of each primer shown in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 7 is not limited to this nucleotide sequence as long as it can amplify the target gene. Instead, it may be a base sequence in which one or several bases are deleted, substituted, or added in the base sequence shown in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 7. Further, it may be a complementary sequence of each of the above base sequences.

  The primer set according to the present invention includes a primer having a base sequence shown in SEQ ID NO: 3 and a primer having a base sequence shown in SEQ ID NO: 8, which are used to amplify a gene encoding the H chain of a chicken antibody. Is a combination. According to the above configuration, genes designed to delete both the CH3 region and the CH4 region of the H chain of chicken-type antibodies against various antigens can be amplified by amplification reactions such as PCR.

  The base sequence of each primer shown in SEQ ID NO: 3 or SEQ ID NO: 8 is not limited to the base sequence as long as it can amplify the target gene. SEQ ID NO: 3 or SEQ ID NO: 8 In the base sequence shown in (1), one or several bases may be deleted, substituted, or added. Further, it may be a complementary sequence of each of the above base sequences.

  Despite the fact that chicken monoclonal antibodies can be antibodies against antigens that are difficult to produce antibodies in mammals such as mice and rats, and have no merit in cross-reactivity with mammalian antibodies, Development and commercialization were delayed because no efficient production method was established.

  According to the method for producing chicken monoclonal antibodies according to the present invention, it is possible to efficiently mass-produce chicken monoclonal antibodies against various antigens using CHO cells or the like. In addition, a structurally modified chicken monoclonal antibody in which 7 amino acids have been deleted from the C-terminal side of the H chain, if necessary. A structurally modified chicken monoclonal antibody in which 55 amino acid residues have been deleted leaving the cysteine residue in the CH2 region. A structurally modified chicken monoclonal antibody in which both the region and the CH4 region are deleted can also be produced.

  Therefore, it is possible to establish a high-sensitivity antigen detection system that has no non-specific reaction. Furthermore, it is possible to provide diagnostic agents and diagnostic methods for various diseases using the highly sensitive antigen detection system. In addition, by applying the technique of the method for producing a monoclonal antibody according to the present invention to a human antibody, there is an effect that it becomes possible to provide therapeutic agents for various diseases.

  An embodiment of the present invention will be described as follows. Note that the present invention is not limited to this.

<Chicken antibody (monoclonal antibody)>
The “chicken antibody” produced in the present invention is an antibody (IgM, IgG, IgA) produced by a chicken against an antigen by the immune function of the chicken. Of these, a single antibody that recognizes only a specific portion of an antigen is called a “chicken monoclonal antibody”. In the following description, simply “chicken-type antibody” means that both polyclonal and monoclonal antibodies are included, and “chicken-type monoclonal antibody” means that only monoclonal antibodies are included. However, in the present invention, the “chicken antibody (monoclonal antibody)” may be an antibody having a structure similar to that of a natural antibody produced by the chicken itself. For example, the chicken antibody is encoded in a host cell other than the chicken. The term also includes an antibody produced by a transformed cell obtained by introducing a gene and an antibody produced by a known fage display method. Further, some of the amino acids of the antibody may be deleted or substituted, or those having an amino acid added (structure-modified chicken antibody (monoclonal antibody)). This is because a chicken-type antibody molecule has a molecular weight larger than that of a mammalian-type antibody (IgG), and thus a structure-modified chicken-type antibody (monoclonal antibody) from which unnecessary amino acids have been deleted may be preferable depending on applications.

<Acquisition of gene encoding chicken monoclonal antibody (L chain, H chain)>
The method for producing a chicken monoclonal antibody according to the present invention (hereinafter referred to as this production method) is obtained by introducing a gene encoding a target chicken monoclonal antibody into a host cell using an arbitrary expression vector, and obtaining the gene. The target chicken type antibody is produced by culturing the transformed cells. Therefore, it is necessary to first obtain a gene encoding a target chicken monoclonal antibody. Since an antibody molecule is composed of two sets of peptides in which an L chain and an H chain are associated, a gene encoding the L chain (L chain gene) and a gene encoding the H chain (H chain gene) are required. Become. The method for obtaining the gene is not particularly limited, but it is preferably obtained using an amplification reaction such as a known PCR method because a large amount of genes can be obtained easily and rapidly. In this production method, the L chain gene and the H chain gene are obtained particularly by an amplification reaction such as a PCR method.

<L-chain primer, H-chain primer>
This PCR method amplifies a target gene using genomic DNA or the like as a template using a set of a sense primer (forward primer) and an antisense primer (reverse primer) designed from the base sequence information of the target gene. Therefore, in order to carry out this production method, it is first necessary to design a primer for amplifying a target gene (L chain gene, H chain gene). A primer for amplifying the L chain gene is called an L chain primer, the set is called an L chain primer set, a primer for amplifying the H chain gene is called an H chain primer, and the set is called an H chain primer set.

  The primer sequence may be designed based on the sequence information of a known chicken monoclonal antibody. The antigen recognized by the chicken antibody is not particularly limited. This is because the primer sequences in the present invention are meaningful in designing in highly conserved regions in various antibody genes. By using primers designed in the highly conserved region, monoclonal antibodies that recognize various antigens can be amplified.

  For example, the primer sequence may be designed based on the base sequence information of the anti-PrP chicken monoclonal antibody prepared by the present inventors. The primer sequence is designed from germline (germline), and the base sequence information is available from L chain gene bank Accession No. M24403, H chain gene bank Accession No. M30319 and X07174. For designing the primer, known software may be used. For example, OLIGO 4.05 Primer Analysis Software (National Bioscience) can be used.

  As described above, the primer is designed on a base sequence highly conserved in chicken monoclonal antibodies against various antigens, in other words, on a base sequence common to various chicken monoclonal antibodies. Good.

  More specifically, the base sequence of the L chain of the chicken monoclonal antibody and the leader sequence of the variable region of the H chain (hereinafter referred to as V region) and the gene encoding the constant region (hereinafter referred to as constant region gene). A continuous oligo oligonucleotide may be used as a primer. This is because the leader sequence and the constant region gene are regions having a base sequence common to various chicken monoclonal antibodies. Here, the “leader sequence” is a sequence encoding the amino acid terminal domain of the secreted protein.

  Examples of the L chain leader sequence of the above chicken monoclonal antibody include those having the base sequence shown in SEQ ID NO: 19, and the base sequence of the constant region gene of the same L chain is, for example, the base sequence shown in SEQ ID NO: 20. The thing which has is mentioned. The leader sequence of the H chain of the chicken monoclonal antibody includes, for example, the one having the base sequence shown in SEQ ID NO: 21, and the base sequence of the constant region gene of the H chain is, for example, that shown in SEQ ID NO: 22. Can be mentioned. The base sequences of the above leader sequences and constant region genes are not limited to those listed in SEQ ID NOs as long as they encode the target region, and one to several bases are deleted. It may be substituted or added.

  By the way, the cysteine residue present at the C-terminus of the constant region of the L chain is an amino acid necessary for the H chain and the L chain to associate with each other by a disulfide bond (SS bond) to form an antibody molecule. Therefore, it can be said that it is preferable to design a primer at a position where a cysteine residue present at the C-terminus of the L chain constant region can be amplified.

  The constant region of the H chain of the chicken antibody is composed of a CH1 region, a CH2 region, a CH3 region, and a CH4 region. The primer used for amplifying the H chain of the chicken monoclonal antibody may be designed in any region of the gene encoding the CH1, CH2, CH3, and CH4 regions. It is preferable to design on the CH2 region. The antibody molecule is constituted by association of two H chain molecules and two L chain molecules through SS bonds. Therefore, in order to form an antibody molecule, a region for performing the SS bond is necessary. The CH1 region includes a region where the L chain and the H chain perform S—S bonds, and the CH2 region includes a region where the H chains perform S—S bonds. Therefore, in order to form an antibody molecule, it can be said that at least a region for performing S—S bonding and a CH1 region in the CH2 region are necessary.

  Therefore, as described above, the primer is preferably designed at a position where at least the necessary region can be amplified. More specifically, it can be said that it is preferable to design on the CH4 region, the CH3 region, and the CH2 region. When designing a primer on the CH4 region and CH3 region, the position is not particularly limited. However, when designing a primer on the CH2 region, the region for performing S—S bonding is positioned at a position where amplification is possible. It can be said that it is necessary to design a primer.

  Examples of the base sequence of the CH4 gene of the H chain of the above chicken monoclonal antibody include those having the base sequence shown in SEQ ID NO: 23, and the base sequence of the CH3 gene has the base sequence shown in SEQ ID NO: 24, for example. The base sequence of the CH4 gene is, for example, the one shown in SEQ ID NO: 25. The base sequence of the gene is not limited to those listed in the SEQ ID NO as long as it encodes the target region, and 1 to several nucleotides as long as it encodes the target region. The base may be deleted, substituted, or added.

  The length for designing the primer is not particularly limited as long as the target L chain gene or H chain gene can be amplified, but in the case of the L chain gene, 15 bases or more are preferable. More preferably, 20 bases or more. In the case of the H chain gene, 15 bases or more are preferable, 20 bases or more are more preferable, and 25 bases or more are most preferable. This is because, when an oligonucleotide within the above preferred range is used as a primer, non-specific annealing is likely to occur, and there is a high possibility that DNA other than the target will be amplified. In particular, when amplifying the H chain, it is preferable to use a long primer because of the large size to be amplified. On the other hand, the upper limit of the primer length is preferably 40 bases or less, more preferably 30 bases or less in the case of the L chain gene. In the case of the H chain gene, 40 bases or less is preferable, and 35 bases or less is more preferable. A longer primer is preferable because nonspecific annealing can be prevented. However, there are disadvantages in that it forms a secondary structure by binding within the primer sequence, and in terms of cost, time, and labor. For this reason, it can be said that it is preferable to use a primer having a length less than the above preferable half.

  Each primer is preferably designed with a restriction enzyme recognition sequence necessary for introduction into an expression vector. This is because the expression vector can be constructed more easily. In addition, when adding the said restriction enzyme recognition sequence, it cannot be overemphasized that it should pay attention so that a frame shift may not occur.

  Examples of various primers designed based on the above points are shown below, but the present invention is not limited thereto.

  An example of an L chain primer is a primer set (first primer set) capable of amplifying a full length L chain gene. The first primer set is a combination of a primer having the base sequence represented by ATATATAAGCTTGCCATGGCCTGGGCTCCTCTCCT (SEQ ID NO: 1) and a primer having the base sequence represented by TCTCTAGATTAGCACTCGGACCCTTCTCAG (SEQ ID NO: 2). The primer shown in SEQ ID NO: 1 is a primer designed on the leader sequence of the L chain gene, and a restriction enzyme HindIII recognition sequence (AAGCTT) used for insertion into a vector is added. The primer shown in SEQ ID NO: 2 is a primer designed on the constant region of the L chain gene, and is similarly added with a restriction enzyme XbaI recognition sequence (TCTAGA). The restriction enzyme recognition sequence to be added is not particularly limited, and the restriction enzyme site does not exist in the target L chain gene, and the restriction enzyme site can be used as a cloning site of an expression vector. From the viewpoint of the above, it is possible to use after selecting as appropriate. For example, when pcDNA3.1 / myc-His (A) (Invitrogen) is used as an expression vector, it is possible to add a BamHI recognition sequence and an EcoRI recognition sequence to the L chain primer.

  FIG. 2 shows the nucleotide sequence (SEQ ID NO: 9) between the HindIII recognition sequence and the XbaI recognition sequence of the amplification product (L chain gene) obtained by PCR using the HUC2-13 mRNA as a template, and The amino acid sequence (SEQ ID NO: 10) is shown. The underlined (solid line) of the base sequence in the figure is the HindIII recognition sequence, and the part surrounded by the open square in the figure is the primer sequence having the base sequence shown in SEQ ID NO: 1 (second half part) It is. The underlined (broken line) is the XbaI recognition sequence, and the portion surrounded by the shaded square in the figure is the complementary sequence (part of the second half) of the primer sequence having the base sequence shown in SEQ ID NO: 2.

  Here, in the figure, the underlined portion is the V region (VL region) in the L chain gene, and the portion with the arrow line is the leader sequence. Further, the region from position 382 to position 696 of the base sequence shown in the figure is a constant region (CL region) in the L chain gene. In the same figure, HindIII and XbaI shown at both ends of the base sequence indicate restriction enzyme recognition sites used for cloning into a vector. Furthermore, CL1 in the figure indicates the starting point of CL1, and the 3 ′ end direction thereafter indicates the CL1 region.

  As shown in FIG. 2, the first primer set is set on the leader sequence and the CL region. This is because the same sequence is conserved in chicken-type antibodies against all antigens in the leader sequence and the CL region. In other words, the VL region is a sequence that varies depending on the antigen, whereas the base sequence of the leader sequence and the CL region is unchanged. Therefore, if a primer is set in that region, it can be said that it is possible to amplify the L chain gene of a chicken monoclonal antibody against any antigen. However, this is based on the unique antibody gene diversity acquisition mechanism of birds and other birds. The diversity of antibody genes in mammals is acquired by rearranging one V gene and one J gene from the V gene group and J gene group existing in the V region. Therefore, since the V gene in the V region is different for each antibody, it is not possible to amplify an antibody gene for any antigen simply by designing one primer. In other words, in order to amplify an antibody gene against any antigen, a plurality of primers must be designed and used for amplification. On the other hand, the diversity of avian antibody genes is obtained by rearranging one V gene and one J gene in the V region, and further converting a part of the V gene into a large number of pseudogenes. ing. Therefore, the gene encoding the avian V region consists of only one V gene and J gene combination. Therefore, a region where the base sequence is unchanged, that is, the leader sequence is present in the base sequence encoding the V region. In other words, if a primer is designed in the leader sequence, a chicken monoclonal antibody against any antigen can be amplified by a combination of the primer and a primer designed on the constant region side. This is one of the main reasons for the completion of this production method. The above-described antibody diversity acquisition mechanism is a common mechanism in the L chain and the H chain.

  Next, an example of a primer for H chain is a set of primers (second primer set) capable of amplifying a full length H chain gene. The second primer set is a primer set used to amplify a full-length heavy chain gene. A combination with a primer having a base sequence. The primer shown in SEQ ID NO: 3 is a primer designed on the leader sequence of the L chain gene, and further has a restriction enzyme KpnI recognition sequence (GGTACC) used for insertion into a vector. The primer shown in SEQ ID NO: 4 is a primer designed on the constant region of the H chain gene, and is similarly added with a restriction enzyme PinAI recognition sequence (ACCGGT). The restriction enzyme recognition sequence to be added is not particularly limited, and the restriction enzyme site does not exist in the target heavy chain gene, and the restriction enzyme site can be used as a cloning site for an expression vector. From the viewpoint of the above, it is possible to use after selecting as appropriate. For example, when pcDNA4 / myc-His (A) (Invitrogen) is used as an expression vector, an XbaI recognition sequence can be added to the H chain primer.

  FIG. 3 shows a nucleotide sequence (SEQ ID NO: SEQ ID NO :) between the KpnI recognition sequence and the PinAI recognition sequence of the amplification product (H chain gene) obtained by PCR using the cDNA prepared from HUC2-13 mRNA as a template. 11) and the amino acid sequence (SEQ ID NO: 12). The underlined (solid line) of the base sequence in the figure is the KpnI recognition sequence, and the part surrounded by the open square in the figure is the primer sequence having the base sequence shown in SEQ ID NO: 3 (second half part) It is. The underlined (broken line) is the PinAI recognition sequence, and the portion surrounded by a shaded square in the figure is the complementary sequence (part of the second half) of the primer sequence having the base sequence shown in SEQ ID NO: 4.

  In this figure, the double underlined portion is the V region (VH region) in the H chain gene, and the portion with the arrow line is the leader sequence. The region after position 454 of the base sequence shown in the figure is a constant region (CH region) in the H chain gene. In particular, the region from position 454 to position 768 of the base sequence shown in the figure represents the CH1 region, the region from position 769 to 1050 represents the CH2 region, the region from position 1051 to 1377 represents the CH3 region, and position 1378. The ~ 1731 position indicates the CH4 region.

  In the same figure, KpnI and PinAI shown at both ends of the base sequence indicate restriction enzyme recognition sites used for cloning into the vector. Further, in the figure, CH1, CH2, CH3, and CH4 indicate the start points of the CH1, CH2, CH3, and CH4 areas, respectively, and the 3 ′ end directions thereafter are the CH1, CH2, CH3, and CH4 areas. It shows that there is.

  As shown in FIG. 3, the second primer set is set on the leader sequence and the CH region, and by this combination, the full-length heavy chain gene of the chicken monoclonal antibody against any antigen can be amplified.

  Another example of a primer for the H chain is a primer set (third primer set) capable of amplifying the H chain gene designed so that 7 amino acids are deleted from the C-terminal side of the H chain. It is done. The third primer set is a primer set used for amplifying an H chain gene designed so that 7 amino acids are deleted from the C-terminal side of the H chain, and the nucleotide sequence shown in TTGGTACCCACCATGAGCCCACTCGTCTCC (SEQ ID NO: 3) And a primer having a base sequence represented by TTACCGGTGCGCTGGCTGAAGCGCATG (SEQ ID NO: 5). The primer shown in SEQ ID NO: 3 is a primer designed on the leader sequence of the H chain gene, and further has a restriction enzyme KpnI recognition sequence (GGTACC) used for insertion into a vector. The primer shown in SEQ ID NO: 5 is a primer designed on the constant region of the H chain gene, and is similarly added with a restriction enzyme PinAI recognition sequence (ACCGGT). The restriction enzyme recognition sequence to be added is not particularly limited, and the restriction enzyme site does not exist in the target heavy chain gene, and the restriction enzyme site can be used as a cloning site for an expression vector. From the viewpoint of the above, it is possible to use after selecting as appropriate. For example, when pcDNA4 / myc-His (A) (Invitrogen) is used as an expression vector, for example, an XbaI recognition sequence can be added to the H chain primer.

  FIG. 4 shows the nucleotide sequence (SEQ ID NO: SEQ ID NO :) between the KpnI recognition sequence and the PinAI recognition sequence of the amplification product (H chain gene) obtained by PCR using the cDNA prepared from HUC2-13 mRNA as a template. 13) and the amino acid sequence (SEQ ID NO: 14). The underlined (solid line) of the base sequence in the figure is the KpnI recognition sequence, and the part surrounded by the open square in the figure is the primer sequence having the base sequence shown in SEQ ID NO: 3 (second half part) It is. The underlined (broken line) is the PinAI recognition sequence, and the portion surrounded by a shaded square in the figure is the complementary sequence (partial part of the latter half) of the primer sequence having the base sequence shown in SEQ ID NO: 5.

  In this figure, the double underlined portion is the V region (VH region) in the H chain gene, and the portion with the arrow line is the leader sequence. A region other than the VH region is a constant region (CH region) in the H chain gene. The region after position 454 of the base sequence shown in the figure is a constant region (CH region) in the H chain gene. In particular, the region from position 454 to position 768 of the base sequence shown in the figure represents the CH1 region, the region from position 769 to 1050 represents the CH2 region, the region from position 1051 to 1377 represents the CH3 region, and position 1378. ˜1707 position indicates the CH4 region.

  In the same figure, KpnI and PinAI shown at both ends of the base sequence indicate restriction enzyme recognition sites used for cloning into the vector. Further, in the figure, CH1, CH2, CH3, and CH4 indicate the start points of the CH1, CH2, CH3, and CH4 areas, respectively, and the 3 ′ end directions thereafter are the CH1, CH2, CH3, and CH4 areas. It shows that there is.

  As shown in FIG. 4, the third primer set is set on the leader sequence and the CH region, and this combination is designed to delete 7 amino acids from the C-terminal side of the H chain of the chicken monoclonal antibody against any antigen. The amplified heavy chain gene can be amplified.

  In addition, as another example of a primer for H chain, a primer set capable of amplifying an H chain gene designed to delete 55 amino acid residues while leaving a cysteine residue in the CH2 region of the H chain ( 2nd primer set, 4th primer set, 5th primer set). The fourth primer set is a combination of a primer having a base sequence represented by TTGGTACCCACCATAGCCCCACTCGTCTCCC (SEQ ID NO: 3) and a primer having a base sequence represented by CAAACACAACAGCTCCCACC (SEQ ID NO: 7), and the fifth primer set is This is a combination of a primer having the base sequence represented by GTGGAGCTGTTGTGTTTGAGCTGTTAGGGTGAGGCACC (SEQ ID NO: 6) and a primer having the base sequence represented by TTACCGGTTTTACCACCTGTTTCTGCAG (SEQ ID NO: 4). By mixing the DNA fragment amplified using the fourth primer set and the DNA fragment amplified using the fifth primer set, and further amplifying using the second primer set, the CH2 region of the H chain A heavy chain gene designed to delete 55 amino acid residues leaving cysteine residues can be amplified.

  FIG. 5 shows the nucleotide sequence (SEQ ID NO: 15) and amino acid sequence between the KpnI recognition sequence and the PinAI recognition sequence of the amplification product (H chain gene) obtained by PCR using the cDNA prepared from HUC2-13 mRNA as a template. (SEQ ID NO: 16) is shown. The underlined (solid line) of the base sequence in the figure is the KpnI recognition sequence, and the part surrounded by the open square in the figure is the primer sequence having the base sequence shown in SEQ ID NO: 3 (second half part) It is. The underlined (broken line) is the PinAI recognition sequence, and the portion surrounded by a shaded square in the figure is the complementary sequence (part of the second half) of the primer sequence having the base sequence shown in SEQ ID NO: 4. Although not specifically shown, the primer having the base sequence shown in SEQ ID NO: 6 is set at positions 805 to 841 of the base sequence shown in the figure, and has the base sequence shown in SEQ ID NO: 7. Is set at positions 804 to 822 of the base sequence shown in FIG.

  In this figure, the double underlined portion is the V region (VH region) in the H chain gene, and the portion with the arrow line is the leader sequence. In addition, the region of positions 454 to 1566 in the base sequence shown in the figure is a constant region (CH region). In particular, the region from position 454 to position 768 of the base sequence shown in the figure represents the CH1 region, the region from position 769 to 885 represents the CH2 region, the region from position 886 to 1212 represents the CH3 region, and position 1213 Positions ˜1566 indicate the CH4 region.

  In the same figure, KpnI and PinAI shown at both ends of the base sequence indicate restriction enzyme recognition sites used for cloning into the vector. Further, in the figure, CH1, CH2, CH3, and CH4 indicate the start points of the CH1, CH2, CH3, and CH4 areas, respectively, and the 3 ′ end directions thereafter are the CH1, CH2, CH3, and CH4 areas. It shows that there is.

  The fourth primer set, the fifth primer set, and the sixth primer set are set on the leader sequence and the CH region, and by combining these, the cysteine residue in the CH2 region of the H chain of the chicken monoclonal antibody against any antigen is selected. It is possible to amplify a heavy chain gene designed to delete 55 amino acid residues.

  Another example of the primer for the H chain is a primer set (sixth primer set) capable of amplifying the H chain gene designed so as to delete both the CH3 region and the CH4 region of the H chain. It is done. The sixth primer set is a primer set used for amplifying an H chain gene designed to delete both the CH3 region and CH4 region of the H chain, and the base shown in TTGGTACCCACTCATAGCCCACTCGTCTC (SEQ ID NO: 3) It is a combination of a primer having a sequence and a primer having a base sequence represented by TTACCGGTCGGGCATCCCTTGACTGTG (SEQ ID NO: 8). The primer shown in SEQ ID NO: 3 is a primer designed on the leader sequence of the L chain gene, and further has a restriction enzyme KpnI recognition sequence (GGTACC) used for insertion into a vector. The primer shown in SEQ ID NO: 8 is a primer designed on the constant region of the H chain gene, and is similarly added with a restriction enzyme PinAI recognition sequence (ACCGGT). The restriction enzyme recognition sequence to be added is not particularly limited, and the restriction enzyme site does not exist in the target heavy chain gene, and the restriction enzyme site can be used as a cloning site for an expression vector. From the viewpoint of the above, it is possible to use after selecting as appropriate.

  FIG. 6 shows the nucleotide sequence (SEQ ID NO: 17) and amino acids between the KpnI recognition sequence and the PinAI recognition sequence of the amplification product (H chain gene) obtained by PCR using the HUC2-13 mRNA as a template and the second primer set. The sequence (SEQ ID NO: 18) is shown. The underlined (solid line) of the base sequence in the figure is the KpnI recognition sequence, and the part surrounded by the open square in the figure is the primer sequence having the base sequence shown in SEQ ID NO: 3 (second half part) It is. Also, the underlined (broken line) is the PinAI recognition sequence, and the part surrounded by the shaded square in the figure is the complementary sequence (part of the second half) of the primer having the base sequence shown in SEQ ID NO: 8.

  In this figure, the double underlined portion is the V region (VH region) in the H chain gene, and the portion with the arrow line is the leader sequence. The region after position 454 of the base sequence shown in the figure is a constant region (CH region) in the H chain gene. In particular, the region at positions 454 to 768 in the base sequence shown in the figure represents the CH1 region, and the region at positions 769 to 1050 represents the CH2 region.

  In the same figure, KpnI and PinAI shown at both ends of the base sequence indicate restriction enzyme recognition sites used for cloning into the vector. Further, in the figure, CH1 and CH2 indicate the starting points of the CH1 region and the CH2 region, respectively, and thereafter the 3 ′ end direction indicates the CH1 region and the CH2 region.

  As shown in FIG. 6, the sixth primer set is set on the leader sequence and the CH region, and by this combination, the CH3 region and CH4 region of the H chain of the chicken monoclonal antibody against all antigens are deleted together. The designed heavy chain gene can be amplified.

  The sequence of each primer is not limited to the nucleotide sequence shown in each SEQ ID NO as long as it can amplify the target gene, and one or several bases are deleted, substituted, It may be an added base sequence. Further, it may be a complementary sequence of each of the above base sequences.

Next, a method for amplifying the L chain gene and the H chain gene of the chicken monoclonal antibody using each of the above primer sets will be described. The gene amplification method may be performed using the PCR method and its modification method, and the reaction conditions are not particularly limited. However, the H chain gene is often difficult to amplify. According to the earnest study by the present inventors, GC buffer I (manufactured by Takara Bio Inc.) and TAKARA LA Taq polymerase (manufactured by Takara Bio Inc.) used in the examples described later are the most preferable combination. In addition, the amount of amplification of the H chain gene is often small, and in such a case, it has been confirmed that the amplification reaction may be performed at least twice. The GC buffer I is known as a suitable buffer when the amplification region is GC rich or has a strong secondary structure.
On the other hand, for template DNA, for example, RNA may be extracted from a chicken monoclonal antibody-producing hybridoma against a desired antigen, cDNA may be synthesized by a known method (for example, Oligo-dT primer method) and used as a template.

<Construction of L chain expression vector and H chain expression vector>
A vector for introducing the L chain gene and the H chain gene obtained by the above-described method into a host cell and expressing the L chain and the H chain in the cell (hereinafter referred to as an L chain expression vector and an H chain expression vector) And the construction method thereof will be described.

  The L chain expression vector or the H chain expression vector is not particularly limited as long as it can express the L chain or H chain of a chicken monoclonal antibody in a host cell. It may be a vector or a linear shape. Therefore, basically, the L chain gene or H chain gene obtained may be constructed so as to be controllably linked downstream of the promoter. The type of promoter used is not particularly limited as long as it functions in the host cell. For example, for animal-derived cells, SV40, bovine papilloma virus (BPV) promoter, human cytomegalovirus promoter (CMV) and the like can be mentioned. In addition, the L chain expression vector or the H chain expression vector may contain various DNA segments other than the promoter. Examples of the DNA segment include a sequence to which a drug resistance gene (neomycin resistance gene / zeocin resistance gene, etc.), a terminator, and a purification tag (histidine tag, etc.) that serve as markers for gene transfer are added. A commercially available vector suitable for the host cell to be introduced may be used. In the examples described below, pcDNA3.1 / myc-His (A) (Invitrogen) and pcDNA4 / myc-His (A) (Invitrogen) are used as a base, L chain expression vector, and H chain expression. A vector is being constructed. In addition, pEF1 / myc-His (Invitrogen) and pSecTag2 / Hygro (Invitrogen) can be used as known vectors.

  The method for constructing each expression vector is not particularly limited, and a necessary gene sequence may be ligated using a normal genetic engineering technique. Alternatively, the above expression vectors may be constructed without subcloning the L chain gene or H chain gene obtained by PCR, or after subcloning into Escherichia coli using a subcloning vector such as pUC19 or pBluescript II. Each of the above expression vectors may be constructed.

<Transformation of host cell for L chain expression vector and H chain expression vector>
Host cells are transformed using the L chain expression vector and the H chain expression vector. The antibody molecule is a dimer in which two molecules of a complex in which an L chain and an H chain are formed by SS bonds (L chain-H chain complex) are bound. Therefore, it is necessary to introduce both the L chain gene and the H chain gene into the host cell.

  The following L chain gene expression vector and H chain gene expression vector were constructed by using the L chain gene and H chain gene amplified with each of the primer sets listed as specific examples, and the L chain expression vector and The same host may be transformed by appropriately combining H chain expression vectors. An example of an L chain expression vector is a full length L chain expression vector constructed using a full length L chain gene. An example of an H chain expression vector is a full length H chain gene (FullH H chain constructed using H chain expression vector (Full H chain expression vector) constructed using chain gene) and H chain gene designed to delete 7 amino acids from the C-terminal side (Δ7aa H chain gene) An H chain constructed using a chain expression vector (Δ7aa H chain expression vector) or an H chain gene (ΔCH2 H chain gene) designed to delete 55 amino acid residues leaving a cysteine residue in the CH2 region Chain expression vector (ΔCH2H chain expression vector), or an H chain gene (ΔFcH chain residue) designed to delete both the CH3 region and the CH4 region There is an H chain expression vector (ΔFc H chain expression vector) constructed using a gene).

  A full-length chicken monoclonal antibody (Full antibody) can be produced by introducing the L chain gene and the Full H chain gene into a host cell using the L chain expression vector and the Full H chain expression vector. In addition, if an L chain gene and a Δ7aa H chain gene are introduced into a host cell using an L chain expression vector and a Δ7aa H chain expression vector, a structurally modified chicken monoclonal antibody in which 7 amino acids are deleted from the C-terminal side of the H chain (Δ7aa antibody) can be produced. In addition, when the L chain gene and the ΔCH2 H chain gene are introduced into a host cell using the L chain expression vector and the ΔCH2 H chain expression vector, a structure in which 55 amino acid residues are deleted except for the cysteine residue in the CH2 region. Modified chicken monoclonal antibodies (ΔCH2 antibodies) can be produced. Further, when the L chain gene and the ΔFc H chain gene are introduced into a host cell using the L chain expression vector and the ΔFc H chain expression vector, the structurally modified chicken monoclonal antibody (ΔFc) in which both the CH3 region and the CH4 region are deleted. Antibody). FIG. 1 shows a schematic diagram of the structure of each monoclonal antibody.

  The host cell to be transformed is not particularly limited, and a host corresponding to each expression vector constructed above may be selected and used. That is, the host cell may be an animal-derived cell or a plant-derived cell. Animal-derived cells and plant-derived cells are meant to include cells, tissues, and organs. In particular, in the present invention aimed at mass production of chicken monoclonal antibodies, cells derived from animals having an immune system are preferable, and cells (cultured cells) that can be cultured in a liquid medium or the like are preferable. Examples of animal-derived cultured cells include Chinese hamster ovary cells (CHO cells), HeLa cells, melanoma cells, mouse 3T3 cells, and the like. Examples of plant-derived cultured cells include tobacco BY2 cells. In the examples described later, CHO cells are used as host cells. This is because the cells can be cultured in suspension, the generation time is as short as 12 hours, and the proliferation ability is high, which makes them suitable for mass production of chicken monoclonal antibodies.

  On the other hand, the transformation method is not particularly limited, and a method suitable for the host cell / expression vector may be selected and used. For example, conventionally known methods such as an electroporation method, a particle gun method, a calcium phosphate method, a protoplast / spheroplast method, a calcium phosphate method, a liposome method, and a DEAE dextran method can be suitably used. In particular, a general transformation method for plant-derived cells includes a transformation method using Agrobacterium (Agrobacterium method). However, the L chain gene and the H chain gene are preferably integrated into the genome of the host cell. By incorporating the antibody gene into the genome, it becomes possible to reliably transmit the gene contained in the vector structure to the daughter cells after cell division, and it is possible to maintain the production efficiency of chicken monoclonal antibodies. Because.

  The method for confirming whether or not the L chain gene and the H chain gene have been introduced into the host cell is not particularly limited, and various known methods can be used. Specifically, various markers may be used. For example, a gene deleted in the host cell is used as a marker, and a plasmid or the like containing this marker and a recombinant plant virus gene is introduced into the host cell as an expression vector. Thus, the introduction of the gene of the present invention can be confirmed from the expression of the marker gene. For example, in the examples described later, CHO cells are transformed, and CHO cells are transformed with a drug resistance marker (neomycin resistance gene / zeocin resistance gene) in a medium containing neomycin and zeocin. By culturing a candidate cell line for transformation, it becomes possible to select the grown cell line as a transformant. As other markers, puromycin resistance marker, bleomycin resistance marker, XGPRT gene, DHFR gene, thymidine kinase gene, etc. are effective for selection of animal cells, bialaphos resistance marker, kanamycin resistance marker, etc. are used for selection of plant cells. It is valid. In addition, there can be mentioned a so-called genomic PCR method in which genomic DNA prepared from a host cell is used as a template and the entire gene length of the introduced protein (transcription factor) is specifically amplified. If it can be confirmed by electrophoresis or the like that the gene encoding the target protein (transcription factor) is amplified by this method, the introduction of the gene can be confirmed.

<Culture of transformed cells (production of chicken monoclonal antibody)>
Next, chicken monoclonal antibodies are produced using the transformed cells obtained above. More specifically, the transformed cells are cultured, and the target chicken monoclonal antibody is purified from the culture. Here, the culture method, culture conditions, and the like of the transformed cell are not particularly limited as long as a suitable method for culturing the transformed cell is used. For example, when culturing animal cells, a suspension culture method, a carrier adhesion culture method, a hollow fiber culture method, or the like is preferable. In particular, the suspension culture method is more preferable because applicable cells are limited to lymphoid cells and the like, but a jar fermenter can be used and scale-up is easy. The transformed CHO cells employed in the examples described later are cells that can be suspended culture as described above. In addition, a medium for culturing animal cells is not limited, but serum may be added to amino acids, vitamins, glucose, and salts. In addition, a bicarbonate / carbon dioxide buffer solution is used as the buffer solution, and a CO ₂ incubator can be used as the incubator. In addition, phenol red may be added for pH monitoring. The culture condition is generally cultured at 37 ° C., but depending on the cell line, it may be 28 ° C. or 40 ° C. In the examples described later, the transformed CHO cells were cultured for 3 days under conditions of 5% CO ₂ and 37 ° C. using F12 media (GIBCO BRL) containing 10% fetal bovine serum (FBS). Incubating.

  On the other hand, the medium for culturing plant cells is not limited, but may contain inorganic salts, carbon sources, vitamins, and amino acids. In addition, coconut milk or yeast extract may be added to promote growth. In addition, plant hormones such as auxin and cytokinin, gibberellin, abscisic acid, and ethylene may be added. Moreover, although it is culture conditions, what is necessary is just to employ | adopt the optimal thing according to the cell to culture | cultivate light, temperature, the presence or absence of aeration, etc.

  Next, a method for preparing and purifying a target chicken monoclonal antibody will be described. The transformed cells into which the L chain gene and the H chain gene have been introduced produce the L chain and H chain of the target chicken monoclonal antibody in the cell. The produced L chain and H chain form an L chain-H chain complex by S—S bond in the cell, and further, a dimer of the L chain-H chain complex is formed to become an antibody molecule. . The antibody molecules produced at this time are secreted into the culture medium or accumulate in the cells. Whether the produced antibody molecule is secreted or accumulates in the cell depends on the type of transformant cell, the culture method, and the like. In the case where the chicken monoclonal antibody molecule produced as in the former is secreted into the culture solution, the culture solution supernatant is prepared by centrifugation, filtration, etc., and the chicken monoclonal antibody is prepared. On the other hand, when chicken monoclonal antibody accumulates in the cell, the cell may be disrupted by a known cell disruption method using glass beads or the like, and the chicken monoclonal antibody may be obtained from the disrupted cell. .

  If necessary, the chicken monoclonal antibody obtained by the above method may be purified by affinity chromatography or a method using a resin for purification. By carrying out the above purification, it is possible to remove proteases and contaminants that inhibit the antigen-antibody reaction, and the obtained chicken monoclonal antibody can be suitably used in a highly sensitive trace antigen detection system. In the examples described later, the histidine tag is designed to be added to the C-terminus of the produced chicken monoclonal antibody H chain. Since histidine has the property of adsorbing to nickel, the intended chicken monoclonal antibody can be easily purified by using a nickel column.

<Chick monoclonal antibody according to the present invention>
The chicken monoclonal antibody according to the present invention is produced by the above-described method for producing a chicken monoclonal antibody according to the present invention, and examples thereof include Full antibody, Δ7aa antibody, ΔCH2 antibody, and ΔFc antibody. The reason for producing structurally modified chicken monoclonal antibodies (Δ7aa antibody, ΔCH2 antibody, ΔFc antibody) in addition to the Full antibody is that the molecular weight of chicken antibody molecules is larger than that of mammalian antibodies (IgG). This is because although unnecessary amino acids are deleted, it may be preferable. For example, by reducing the size of the molecule, it can pass through the cell membrane and detect the antigen in the membrane.

  A chicken monoclonal antibody is an antibody against an antigen that cannot be produced in mammals such as mice and rats, and has no cross-reactivity with a mammal type antibody. By using animal-type monoclonal antibodies, it is possible to establish a highly sensitive antigen detection system free from non-specific reactions. Furthermore, it can be applied to diagnostic agents and diagnostic methods for various diseases using the highly sensitive antigen detection system. In addition, it is possible to provide therapeutic agents for various diseases by applying the technique for producing a monoclonal antibody according to the present invention to a human antibody.

  The present invention is not limited to the above-described embodiments, and various modifications are possible within the scope shown in the claims, and embodiments obtained by appropriately combining technical means disclosed in different embodiments. Is also included in the technical scope of the present invention.

  EXAMPLES Hereinafter, although an Example demonstrates this invention further in detail, this invention is not limited to this.

(Example 1: Production of anti-PrP chicken monoclonal antibody)
As an example, a chicken monoclonal antibody against human prion protein (PrP) was produced.

[Preparation of L chain gene and H chain gene]
The L chain gene and the H chain gene were prepared by PCR using cDNA synthesized from an anti-PrP chicken monoclonal antibody as a template. More specifically, it was as follows.

  RNA was extracted from the anti-PrP chicken monoclonal antibody (HUC2-13) prepared by the present inventors using the cell fusion method, and cDNA as a template was synthesized by the Oligo-dT primer method.

  On the other hand, the primer set used for PCR was used according to the gene to be amplified. Specifically, the set of primers capable of amplifying the full length L chain gene is the first primer set, and the set of primers capable of amplifying the full length H chain gene (Full H chain gene). Is the second primer set, and the primer set capable of amplifying the H chain gene (Δ7aa H chain gene) designed to delete 7 amino acids from the C-terminal side of the H chain is the third primer set A primer set capable of amplifying an H chain gene (ΔCH2 H chain gene) designed to delete 55 amino acid residues while leaving a cysteine residue in the CH2 region of the H chain includes a second primer set and The fourth primer set and the fifth primer set, designed to delete both the CH3 and CH4 regions of the H chain A primer set capable of amplifying a gene (ΔFc heavy chain gene) is the sixth primer set. Primers were designed using the OLIGO 4.05 Primer Analysis Software (National Bioscience) based on the nucleotide sequence information of HUC2-13.

  Here, the ΔCH2 heavy chain gene is obtained by mixing a DNA fragment amplified using the fourth primer set and a DNA fragment amplified using the fifth primer set, and further amplifying using the second primer set. Prepare by.

Next, PCR reaction conditions will be described. The composition of the reaction solution for the amplification of the L chain gene was 10 × KOD plus buffer 5 μl, 2.0 mM dNTP 5 μl, 25 mM MgSO ₄ 3.2 μl, 10 μM Primer 2.5 μl, KOD pulus DNA polymerase (manufactured by Toyobo) 1 μl, cDNA was 1 μl and H ₂ O was 29.8 μl. The reaction was carried out using a thermal cycler (MJ Japan Co., Ltd .; model name PTC-100). The reaction conditions were as follows: 94 ° C. for 2 minutes once, (94 ° C. for 15 seconds, 60 ° C. for 30 seconds, 68 ° C. for 1 minute) 30 times, 4 ° C. constant.

On the other hand, amplification of the H chain gene was performed twice. This is because the H chain has a long chain length and it was necessary to perform amplification twice in order to obtain the target amplification product. The composition of the first reaction solution was 2 × GC buffer I 25 μl, 2.5 mM dNTP 8 μl, 10 μM Primer 1 μl, TAKARA LA Taq polymerase (Takara Bio) 0.5 μl, cDNA 1 μl, H ₂ O 13.5 μl did. The reaction is performed using a thermal cycler (MJ Japan Co., Ltd .; model name PTC-100). The reaction conditions were as follows: 94 ° C. for 2 minutes once, (94 ° C. for 30 seconds, 55 ° C. for 30 seconds, 72 ° C. for 2 minutes) 30 times, 72 ° C. for 5 minutes once, and 4 ° C. constant.

After recovering the amplified PCR fragment, PCR was performed once again using it as a template. The composition of the second amplification reaction solution was 10 × KOD plus buffer 5 μl, 2.0 mM dNTP 5 μl, 25 mM MgSO ₄ 3.2 μl, 10 μM Primer 2.5 μl, KOD pulus DNA polymerase (Toyobo) 1 μl, PCR Fragments were 0.5 μl and H ₂ O 30.3 μl. The reaction is carried out using a thermal cycler (MJ Japan Co., Ltd .; model name PTC-100). The reaction conditions were as follows: 94 ° C. for 2 minutes once, (94 ° C. for 15 seconds, 60 ° C. for 30 seconds, 68 ° C. for 2 minutes) 30 times, 4 ° C. constant.

[Construction of L chain expression vector and H chain expression vector]
FIG. 7 shows a schematic diagram of a method for constructing an L chain expression vector and an H chain expression vector. FIG. 7A shows a method for constructing an L chain expression vector, and FIG. 7B shows a method for constructing an H chain expression vector (Full H chain expression vector).

The PCR fragment obtained by amplifying the L chain gene was inserted into the HindIII-XbaI site of pUC19 to construct pUCL-2. After confirming the base sequence of the antibody gene, pUCL-2 was digested with restriction enzymes HindIII and XbaI, and the restriction digested fragment was inserted into pcDNA3.1 / myc-His (A) (Invitrogen) and pcCKL-1 Built. This pcCKL-1 has a neomycin resistance gene, a CMV (human cytomegalovirus) promoter, and a BGH (bovine growth hormone) poly A signal. The restriction enzyme digestion was performed at 37 ° C. for 6 hours with a reaction solution composition of 10 × M buffer 3 μl, DNA 10 μl, HindIII (manufactured by New England Biolabs) 1 μl, XbaI (New England Biolabs) 1 μl, H ₂ O 15 μl. Reaction was performed.

  On the other hand, four types of H chain expression vectors were constructed: Full H chain expression vector, Δ7aa H chain expression vector, ΔCH2 H chain expression vector, and ΔFc H chain expression vector. As an example, a construction example of a Full H chain expression vector will be described. The other three vectors were constructed in the same manner.

  The full H chain gene amplified PCR fragment was inserted into the KpnI-HincII site of pBluescript II SK (+) to construct pBSHF-2. After confirming the base sequence of the antibody gene, pBSHF-2 was digested with restriction enzymes KpnI and PinAI, and the restriction enzyme digested fragment was inserted into pcDNA4 / myc-His (A) (Invitrogen) to construct pcCKH-1. . This pcCKH-1 has a zeocin resistance gene, a CMV promoter, and a BGH poly A signal. Moreover, it constructed so that a histidine tag might be attached to C terminal.

The restriction enzyme digestion was performed as follows. The PCR fragment was cleaved at 37 ° C. for 6 hours with a reaction solution composition of 10 μL buffer 3 μl, DNA 15 μl, KpnI (New England Biolabs) 1 μl, and H ₂ O 11 μl. PBluescript SK (+) was cleaved with a reaction solution composition of 10 μM buffer 2 μl, DNA 5 μl, HincII (New England Biolabs) 1 μl, KpnI (New England Biolabs) 1 μl, H ₂ O 12 μl, 37 ° C., 6 Time reaction was performed. On the other hand, pBSHF-2 and pcDNA4 / myc-His (A) were cleaved at 37 ° C. for 4 hours with a reaction solution composition of 10 × B buffer 3 μl, DNA 12 μl, PinAI (Roche) 1 μl, H ₂ O 24 μl. I did it. After the reaction, ethanol precipitation was performed and dissolved in 17 μl of H ₂ O. 2 μl of 10 × L buffer and 1 μl of KpnI (New England Biolabs) were added to the DNA solution and reacted at 37 ° C. for 4 hours.

[Acquisition of CHO cells producing anti-PrP chicken monoclonal antibody]
About 2 × 10 ⁵ CHO cells (Human Science Promotion Foundation) were added 2.5 μg each of L chain expression vector (pcCKL-1) and H chain expression vector (pcCKH-1) to PlyFect Transfection Reagent (Qiagen Was used for transfection. The transfection method was performed according to the operation manual.

48 hours after the start of transfection, the drug-resistant cells were selected using 400 μg / ml Geneticin (Sigma) and 200 μg / ml Zeocine (Invitrogen). Furthermore, the drug-resistant cells were cultured for 3 days under conditions of 5% CO ₂ and 37 ° C. using F12 media (GIBCO BRL) containing 10% fetal bovine serum (FBS). From the culture supernatant obtained by the culture, anti-PrP chicken monoclonal antibody-producing CHO cells were finally selected by the ELISA method described later. Anti-PrP chicken monoclonal antibody-producing CHO cells were obtained for each of the Full-PrP antibody, Δ7aa-PrP antibody, ΔCH2-PrP antibody, and ΔFc-PrP antibody. Hereinafter, the respective cells are referred to as Full-PrP antibody-producing CHO cells, Δ7aa-PrP antibody-producing CHO cells, ΔCH2-PrP antibody-producing CHO cells, and ΔFc-PrP antibody-producing CHO cells.

[ELISA method]
Each anti-PrP chicken monoclonal antibody-producing CHO cell was cultured under the culture conditions described above. The cells were aligned at about 1 × 10 ⁶ / plate and cultured for 3 days. The culture supernatant was examined for the reactivity to the antigen by ELISA.

  Antigen human prion protein 25-49 residue peptide (H25) was immobilized on an ELISA plate at 4 ° C. overnight. Blocking was performed at 37 ° C. for 1 hour with PBS containing 25% Block Ace (manufactured by Snow Brand Milk Products). After washing, each cell culture supernatant was added and incubated at 37 ° C. for 1 hour. After further washing, peroxidase-labeled anti-chicken IgG (H + L) (Kirekegaard and Perry Laboratories) was added as a secondary antibody and incubated at 37 ° C. for 1 hour. After washing, color was developed using o-phenylenediamine, and the absorption at 490 nm was measured. Table 1 shows the results.

  Thus, all of the antibodies produced by the obtained Full-PrP antibody-producing CHO cells, Δ7aa-PrP antibody-producing CHO cells, ΔCH2-PrP antibody-producing CHO cells, and ΔFc-PrP antibody-producing CHO cells were reactive to certain antigens. .

  From the above results, in order for the chicken monoclonal antibody to function as an antibody, the H chain does not necessarily have the full length, and it is not always necessary to have the CH4 region and the CH3 region. It turns out that it functions as an antibody if it has at least a region necessary for S—S bond between the L chain and H chain and a region necessary for S—S bond between H chains (cysteine residues in the CH2 region). It was.

[Detection of antibody protein by Western blotting]
A sample buffer was added to the same culture supernatant used in the ELISA method, boiled for 10 minutes, and SDS-PAGE was performed with 7.5% gel. After completion of the electrophoresis, the mixture was transferred to an Immuno-Blot PVDF membrane (manufactured by Bio-RAD) using a wet type blotter. After the transfer, blocking was performed with PBS containing 5% skim milk and 0.05% Tween 20. After washing, the mixture was reacted with a peroxidase-labeled anti-chicken IgG Fab fragment (Bethyl) as a secondary antibody at room temperature for 1 hour. After completion of the reaction, color was developed using ECL plus (Amersham Pharmacia). The signal was analyzed with an image analyzer (Fuji Film).

  The electropherogram is shown in FIG. FIG. 8 shows the results of Full-PrP antibody, Δ7aa-PrP antibody, ΔCH2-PrP antibody, and ΔFc-PrP antibody from the left end lane. Since the reducing agent β-mercaptoethanol is not added to the sample buffer, the SS bond is not cleaved. Therefore, it is possible to investigate whether the antibody produced by each antibody-producing CHO cell forms a dimer. Table 2 shows the estimated molecular weight (kDa) of each antibody calculated from the amino acid sequence deduced from the base sequence.

  The molecular weight on SDS-PAGE is greater than the estimated molecular weight. This is because sugar chain modification is performed (6 sites for Full-PrP antibody / Δ7aa-PrP antibody, 4 sites for ΔCH2-PrP antibody / ΔFc-PrP antibody). From these results, it was considered that all antibodies formed a dimer of H2L2 (indicated by an arrow in FIG. 8). However, in the Full-PrP antibody and the ΔFc-PrP antibody, HL monomers (indicated by arrows in FIG. 8) existed.

[Examination of Full-PrP antibody production]
The production amount of the Full-PrP antibody-producing CHO cells was measured by ELISA and compared with that of HUC2-13.

Full-PrP antibody-producing CHO cells and HUC2-13-producing hybridomas were aligned at 1 × 10 ⁶ cells / plate, and the culture supernatant after 24 hours of culture was collected and used for ELISA.

  In the ELISA method, mouse monoclonal antibody anti-chicken IgG (H) 1γ was immobilized on a plate. Otherwise, the same method as described above was used. For detection, an alkaline phosphatase-labeled anti-chicken IgG light chain was used. Color was developed using P-nitrophenyl phosphate and the absorbance at 405 nm was measured. A purified egg yolk antibody was used as a standard antibody.

The result of the Full-PrP antibody-producing CHO cells was 15 μg / 1 × 10 ⁶ cells / 24 h, whereas the HUC2-13-producing hybridoma was 1 μg / 1 × 10 ⁶ cells / 24 h. From this result, it was found that Full-PrP antibody-producing CHO cells expressed 15 times more antibody than HUC2-13-producing hybridomas. That is, it was found that the production method of chicken monoclonal antibody according to the present invention enables high production of the target antibody.

(Example 2: Purification of anti-PrP chicken monoclonal antibody)
In Example 1 above, the Full-PrP antibody and the ΔFc-PrP antibody in which the HL monomer was observed were purified by a nickel column. Purification using a nickel column can be performed because a histidine tag is added to the C-terminus of each produced chicken monoclonal antibody H chain. The method was as follows.

  Full-PrP antibody-producing CHO cells and ΔFc-PrP antibody-producing CHO cells were cultured with F12 media supplemented with 10% FBS, then replaced with serum-free F12 media, and cultured for 3-4 days. The culture supernatant was collected and dead cells were removed by filtration. The sample was mixed with ProBond resin (nickel resin manufactured by Invitrogen) equilibrated with purification buffer (50 mM Na-phosphate pH 7.5, 0.5 M NaCl), and the one that was not adsorbed to the resin by centrifugation was removed. . Thereafter, washing was performed with a purification buffer containing 10 mM imidazole. Antibody elution was performed using a purification buffer containing 100 mM or 200 mM imidazole. The elution fraction was subjected to SDS-PAGE under non-reducing conditions and reducing conditions. Band detection was performed by Coomassie staining. The result is shown in FIG.

  FIG. 9 shows, in order from the left end lane, Full-PrP antibody (SDS-PAGE under non-reducing conditions), ΔFc-PrP antibody (SDS-PAGE under non-reducing conditions), Full-PrP antibody (SDS-PAGE under reducing conditions), ΔFc. -PrP antibody results (SDS-PAGE under reducing conditions) are shown. In the figure, the H chain and L chain of each antibody are indicated by arrows.

  By using nickel resin, both the Full-PrP antibody and the ΔFc-PrP antibody could be almost purified. Furthermore, when SDS-PAGE was performed in a reduced state, it could be separated into H and L chains. Two L chains were detected. This is a polymer band that has undergone sugar chain modification and a low molecular band that has not undergone sugar chain modification. The detection of two such L chains is a phenomenon observed with chicken monoclonal antibodies and egg yolk antibodies.

  From the above results, it was found that the antibody produced by the method for producing a chicken monoclonal antibody according to the present invention can be purified by a simple operation.

  According to the method for producing chicken monoclonal antibodies according to the present invention, it becomes possible to efficiently mass-produce full-length chicken monoclonal antibodies against various antigens using CHO cells or the like. In addition, a structurally modified chicken monoclonal antibody in which 7 amino acids have been deleted from the C-terminal side of the H chain, if necessary. A structurally modified chicken monoclonal antibody in which 55 amino acid residues have been deleted leaving the cysteine residue in the CH2 region. A structurally modified chicken monoclonal antibody in which both the region and the CH4 region are deleted can also be produced.

  Therefore, it is possible to establish a high-sensitivity antigen detection system that has no non-specific reaction. Furthermore, there is an effect that it is possible to provide diagnostic agents for various diseases, diagnostic methods, and quality inspection methods for foods, chemicals, and the like using the sensitive antigen detection system. In addition, by applying the technique of the method for producing a monoclonal antibody according to the present invention to a human antibody, there is an effect that it becomes possible to provide therapeutic agents for various diseases.

  Therefore, the present invention can be effectively used in a wide range of fields including the pharmaceutical industry, food industry, and chemical industry. Furthermore, since vectors, host cells and the like introduced into the transformant according to the present invention can be marketed as chicken monoclonal antibody production kits, they can be applied to the reagent industry for experiments and research. Is possible.

It is a schematic diagram showing the structure of each monoclonal antibody (Full antibody, Δ7aa antibody, ΔCH2 antibody, ΔFc antibody). The nucleotide sequence (SEQ ID NO: 9) between the HindIII recognition sequence and the XbaI recognition sequence of the amplification product (L chain gene) obtained by PCR using HUC2-13 mRNA as a template and the amino acid sequence ( It is a figure which shows sequence number 10). The nucleotide sequence (SEQ ID NO: 11) and amino acid sequence (sequence) between the KpnI recognition sequence to the PinAI recognition sequence of the amplification product (H chain gene) obtained by PCR using HUC2-13 mRNA as a template and the second primer set. It is a figure which shows number 12). The nucleotide sequence (SEQ ID NO: 13) and amino acid sequence (sequence) between the KpnI recognition sequence and the PinAI recognition sequence of the amplification product (H chain gene) obtained by PCR using HUC2-13 mRNA as a template and the second primer set. It is a figure which shows number 14). The nucleotide sequence (SEQ ID NO: 15) and amino acid sequence (SEQ ID NO: 16) between the KpnI recognition sequence and the PinAI recognition sequence of the amplification product (H chain gene) obtained by PCR using the HUC2-13 mRNA as a template are shown. FIG. The nucleotide sequence (SEQ ID NO: 17) and amino acid sequence (sequence) between the KpnI recognition sequence to the PinAI recognition sequence of the amplification product (H chain gene) obtained by PCR using HUC2-13 mRNA as a template and the second primer set. It is a figure which shows number 18). (A) is the schematic which shows the construction method of the vector for L chain expression, (b) is the schematic which shows the construction method of the vector for H chain expression. In Example 1, it is a figure which shows the result of having detected Full-PrP antibody, (DELTA) 7aa-PrP antibody, (DELTA) CH2-PrP antibody, (DELTA) Fc-PrP antibody by the western blotting method. In Example 2, it is an electrophoretic diagram which shows the result of having refined with a nickel column about Full-PrP antibody and (DELTA) Fc-PrP antibody.

Claims (44)

A primer selected from a leader sequence of a light chain of a chicken-type antibody and comprising a continuous oligonucleotide of at least 15 bases;
A chicken type selected from a base sequence of a gene encoding a constant region of a light chain of a chicken antibody and amplified using a primer set for a light chain that is a combination with a primer containing an oligonucleotide having at least 15 consecutive bases An L chain expression vector into which a gene encoding the L chain of the antibody is inserted, and
A primer selected from a leader sequence of a heavy chain of a chicken-type antibody and comprising a continuous oligonucleotide of at least 15 bases;
A chicken type selected from a base sequence of a gene encoding the constant region of a heavy chain of a chicken antibody and amplified using a primer set for heavy chain which is a combination with a primer comprising oligonucleotides having at least 15 consecutive bases A method for producing a chicken monoclonal antibody, comprising the step of transforming a host cell with an H chain expression vector into which a gene encoding an antibody H chain is inserted. A primer selected from a leader sequence of a light chain of a chicken-type antibody and comprising a continuous oligonucleotide of at least 15 bases;
A chicken type selected from a base sequence of a gene encoding a constant region of a light chain of a chicken antibody and amplified using a primer set for a light chain that is a combination with a primer containing an oligonucleotide having at least 15 consecutive bases An L chain expression vector into which a gene encoding the L chain of the antibody is inserted, and
A primer selected from a leader sequence of a heavy chain of a chicken-type antibody and comprising a continuous oligonucleotide of at least 15 bases;
Primer set for H chain, which is a combination with a primer consisting of oligonucleotides of at least 15 consecutive bases selected from the base sequence of the gene encoding the CH4 region, CH3 region, or CH2 region of the H chain of the chicken antibody A method for producing a chicken monoclonal antibody, comprising the step of transforming a host cell with an H chain expression vector into which a gene encoding the H chain of a chicken antibody amplified using said method is inserted.   The method for producing a chicken monoclonal antibody according to claim 1 or 2, wherein the leader sequence of the L chain of the chicken antibody has the base sequence represented by SEQ ID NO: 19.   The production of chicken monoclonal antibody according to any one of claims 1 to 3, wherein the gene encoding the constant region of the L chain of the chicken antibody has the base sequence represented by SEQ ID NO: 20. Method.   The method for producing a chicken monoclonal antibody according to any one of claims 1 to 4, wherein the H chain leader sequence of the chicken antibody has the base sequence represented by SEQ ID NO: 21.   The chicken monoclonal antibody according to claim 1, 3 or 4, or 5, wherein the gene encoding the constant region of the heavy chain of the chicken antibody has the base sequence shown in SEQ ID NO: 22 Production method. The gene encoding the H4 CH4 region of the chicken antibody has the base sequence shown in SEQ ID NO: 23;
The gene encoding the CH3 region of the H chain of the chicken antibody has the base sequence shown in SEQ ID NO: 24,
The method for producing a chicken monoclonal antibody according to any one of claims 2 to 5, wherein the gene encoding the CH2 region of the H chain of the chicken antibody has the base sequence represented by SEQ ID NO: 25. . A primer having the base sequence shown in SEQ ID NO: 1,
An L chain expression vector in which a gene encoding the L chain of a chicken antibody amplified using a first primer set which is a combination with a primer having the base sequence shown in SEQ ID NO: 2 is inserted, and
A primer having the base sequence shown in SEQ ID NO: 3,
Using an H chain expression vector into which a gene encoding the H chain of a chicken antibody amplified by using a second primer set that is a combination with a primer having the base sequence shown in SEQ ID NO: 4 is inserted A method for producing a chicken monoclonal antibody, comprising a step of transforming a host cell. A primer having the base sequence shown in SEQ ID NO: 1,
An L chain expression vector in which a gene encoding the L chain of a chicken antibody amplified using a first primer set which is a combination with a primer having the base sequence shown in SEQ ID NO: 2 is inserted, and
A primer having the base sequence shown in SEQ ID NO: 3,
Using an H chain expression vector into which a gene encoding the H chain of a chicken antibody amplified using a third primer set which is a combination with a primer having the base sequence shown in SEQ ID NO: 5 is inserted A method for producing a chicken monoclonal antibody, comprising a step of transforming a host cell. A primer having the base sequence shown in SEQ ID NO: 1,
An L chain expression vector in which a gene encoding the L chain of a chicken antibody amplified using a first primer set which is a combination with a primer having the base sequence shown in SEQ ID NO: 2 is inserted, and
A primer having the base sequence shown in SEQ ID NO: 3,
A DNA fragment that is amplified using a fourth primer set that is a combination with a primer having the base sequence shown in SEQ ID NO: 7,
A primer having the base sequence shown in SEQ ID NO: 6,
Mixing with a DNA fragment amplified using a fifth primer set which is a combination with a primer having the base sequence shown in SEQ ID NO: 4;
Furthermore, a primer having the base sequence shown in SEQ ID NO: 3,
Using an H chain expression vector into which a gene encoding the H chain of a chicken antibody amplified by using a second primer set that is a combination with a primer having the base sequence shown in SEQ ID NO: 4 is inserted A method for producing a chicken monoclonal antibody, comprising a step of transforming a host cell. A primer having the base sequence shown in SEQ ID NO: 1,
An L chain expression vector in which a gene encoding the L chain of a chicken antibody amplified using a first primer set which is a combination with a primer having the base sequence shown in SEQ ID NO: 2 is inserted, and
A primer having the base sequence shown in SEQ ID NO: 3,
Using an H chain expression vector into which a gene encoding the H chain of a chicken antibody amplified by using a sixth primer set which is a combination with a primer having the base sequence shown in SEQ ID NO: 8 is inserted A method for producing a chicken monoclonal antibody, comprising a step of transforming a host cell.   The method for producing a chicken monoclonal antibody according to any one of claims 1 to 11, wherein the host cell is an animal-derived cell.   The method for producing a chicken monoclonal antibody according to claim 12, wherein the animal-derived cells are CHO cells.   14. The method for producing a chicken monoclonal antibody according to any one of claims 1 to 13, wherein the L chain expression vector and / or the H chain expression vector has a purification tag.   A chicken monoclonal antibody produced using the method for producing a chicken antibody according to any one of claims 1 to 14. An expression vector used for expressing a light chain of a chicken antibody,
A primer selected from a leader sequence of a light chain of a chicken-type antibody and comprising a continuous oligonucleotide of at least 15 bases;
A chicken type selected from a base sequence of a gene encoding a constant region of a light chain of a chicken antibody and amplified using a primer set for a light chain that is a combination with a primer containing an oligonucleotide having at least 15 consecutive bases An L chain expression vector into which a gene encoding the L chain of an antibody is inserted.   The L chain expression vector according to claim 16, wherein the L chain leader sequence of the chicken antibody has the base sequence represented by SEQ ID NO: 19.   The L chain expression vector according to claim 16 or 17, wherein the gene encoding the constant region of the L chain of the chicken antibody has the base sequence represented by SEQ ID NO: 20. An expression vector used for expressing a light chain of a chicken antibody,
A primer having the base sequence shown in SEQ ID NO: 1,
An L chain expression vector into which a gene encoding the L chain of a chicken antibody amplified using a first primer set which is a combination with a primer having the base sequence shown in SEQ ID NO: 2 is inserted.   20. The L chain expression vector according to any one of claims 16 to 19, wherein the L chain expression vector has a purification tag. An expression vector used for expressing a heavy chain of a chicken antibody,
A primer selected from a leader sequence of a heavy chain of a chicken-type antibody and comprising a continuous oligonucleotide of at least 15 bases;
A chicken type selected from a base sequence of a gene encoding the constant region of a heavy chain of a chicken antibody and amplified using a primer set for heavy chain which is a combination with a primer comprising oligonucleotides having at least 15 consecutive bases An H chain expression vector into which a gene encoding an antibody H chain is inserted. An expression vector used for expressing a heavy chain of a chicken antibody,
A primer selected from a leader sequence of a heavy chain of a chicken-type antibody and comprising a continuous oligonucleotide of at least 15 bases;
Primer set for H chain, which is a combination with a primer consisting of oligonucleotides of at least 15 consecutive bases selected from the base sequence of the gene encoding the CH4 region, CH3 region, or CH2 region of the H chain of the chicken antibody A vector for expression of an H chain, into which a gene encoding the H chain of a chicken antibody that is amplified using the above is inserted.   23. The H chain expression vector according to claim 21 or 22, wherein the H chain leader sequence of the chicken antibody has the base sequence represented by SEQ ID NO: 21.   24. The H chain expression vector according to claim 21 or 23, wherein the gene encoding the constant region of the H chain of the chicken antibody has the base sequence represented by SEQ ID NO: 22. The gene encoding the H4 CH4 region of the chicken antibody has the base sequence shown in SEQ ID NO: 23;
The gene encoding the CH3 region of the H chain of the chicken antibody has the base sequence shown in SEQ ID NO: 24,
24. The H chain expression vector according to claim 22 or 23, wherein the gene encoding the CH2 region of the H chain of the chicken antibody has the base sequence shown in SEQ ID NO: 25. An expression vector used for expressing a heavy chain of a chicken antibody,
A primer having the base sequence shown in SEQ ID NO: 3,
An H chain expression vector into which a gene encoding the H chain of a chicken antibody that is amplified using a second primer set that is a combination with a primer having the base sequence shown in SEQ ID NO: 4 is inserted. An expression vector used for expressing a heavy chain of a chicken antibody,
A primer having the base sequence shown in SEQ ID NO: 3,
An H chain expression vector into which a gene encoding an H chain of a chicken antibody amplified using a third primer set that is a combination with a primer having the base sequence shown in SEQ ID NO: 5 is inserted. An expression vector used for expressing a heavy chain of a chicken antibody,
A primer having the base sequence shown in SEQ ID NO: 3,
A DNA fragment that is amplified using a fourth primer set that is a combination with a primer having the base sequence shown in SEQ ID NO: 7,
A primer having the base sequence shown in SEQ ID NO: 6,
Mixing with a DNA fragment amplified using a fifth primer set which is a combination with a primer having the base sequence shown in SEQ ID NO: 4;
Furthermore, a primer having the base sequence shown in SEQ ID NO: 3,
An H chain expression vector into which a gene encoding the H chain of a chicken antibody that is amplified using a second primer set that is a combination with a primer having the base sequence shown in SEQ ID NO: 4 is inserted. An expression vector used for expressing a heavy chain of a chicken antibody,
A primer having the base sequence shown in SEQ ID NO: 3,
An H chain expression vector into which a gene encoding the H chain of a chicken antibody amplified using a sixth primer set that is a combination with a primer having the base sequence shown in SEQ ID NO: 8 is inserted.   30. The H chain expression vector according to any one of claims 21 to 29, wherein the H chain expression vector has a purification tag.   A transformed cell used for producing a chicken monoclonal antibody, wherein the L chain expression vector according to any one of claims 16 to 20 is introduced, and any one of claims 21 to 30. A transformed cell, wherein the H chain expression vector described in the item is introduced. A primer set used to amplify a gene encoding the L chain of a chicken antibody,
A primer selected from a leader sequence of a light chain of a chicken-type antibody and comprising a continuous oligonucleotide of at least 15 bases;
A primer set for L chain consisting of a combination with a primer comprising an oligonucleotide having at least 15 consecutive nucleotides selected from the base sequence of a gene encoding the constant region of the L chain of a chicken antibody.   The L chain primer set according to claim 32, wherein the L chain leader sequence of the chicken antibody has the base sequence shown in SEQ ID NO: 19.   34. The primer set for an L chain according to claim 32 or 33, wherein the gene encoding the constant region of the L chain of the chicken antibody has the base sequence represented by SEQ ID NO: 20. A primer set used to amplify a gene encoding the L chain of a chicken antibody,
A primer having the base sequence shown in SEQ ID NO: 1,
The primer set for L chains which is a combination with the primer which has a base sequence shown by sequence number 2. A primer set used for amplifying a gene encoding the heavy chain of a chicken antibody,
A primer selected from a leader sequence of a heavy chain of a chicken-type antibody and comprising a continuous oligonucleotide of at least 15 bases;
A primer set for H chain, which is selected from a base sequence of a gene encoding the constant region of the H chain of a chicken antibody, and is a combination with a primer comprising at least 15 or more consecutive oligonucleotides. A primer set used for amplifying a gene encoding the heavy chain of a chicken antibody,
A primer selected from a leader sequence of a heavy chain of a chicken-type antibody and comprising a continuous oligonucleotide of at least 15 bases;
Primer set for H chain, which is a combination with a primer consisting of oligonucleotides of at least 15 consecutive bases selected from the base sequence of the gene encoding the CH4 region, CH3 region, or CH2 region of the H chain of the chicken antibody .   The H chain primer set according to claim 36 or 37, wherein the H chain leader sequence of the chicken antibody has the base sequence represented by SEQ ID NO: 21.   The H chain primer set according to claim 36 or 38, wherein the gene encoding the constant region of the H chain of the chicken antibody has a base sequence represented by SEQ ID NO: 22. The gene encoding the H4 CH4 region of the chicken antibody has the base sequence shown in SEQ ID NO: 23;
The gene encoding the CH3 region of the H chain of the chicken antibody has the base sequence shown in SEQ ID NO: 24,
39. The H chain primer set according to claim 37 or 38, wherein the gene encoding the CH2 region of the H chain of the chicken antibody has the base sequence shown in SEQ ID NO: 25. A primer set used for amplifying a gene encoding the heavy chain of a chicken antibody,
A primer having the base sequence shown in SEQ ID NO: 3,
A primer set for H chain which is a combination with a primer having the base sequence shown in SEQ ID NO: 4. A primer set used for amplifying a gene encoding the heavy chain of a chicken antibody,
A primer having the base sequence shown in SEQ ID NO: 3,
A primer set for H chain which is a combination with a primer having the base sequence shown in SEQ ID NO: 5. A primer set used for amplifying a gene encoding the heavy chain of a chicken antibody,
A primer having the base sequence shown in SEQ ID NO: 3,
A primer having the base sequence shown in SEQ ID NO: 7,
A primer having the base sequence shown in SEQ ID NO: 6,
A primer set for H chain which is a combination with a primer having the base sequence shown in SEQ ID NO: 4. A primer set used for amplifying a gene encoding a heavy chain of a chicken antibody,
A primer having the base sequence shown in SEQ ID NO: 3,
A primer set for H chain which is a combination with a primer having the base sequence shown in SEQ ID NO: 8.

Images