JP4830115B2 - Antibody obtained by a method for producing a recombinant chicken divalent antibody from a chicken single chain variable region fragment (scFv) - Google Patents

Description

  The present invention relates to a method for producing a chicken bivalent antibody by dimerizing a single-chain variable region fragment (scFv) obtained by the phage display method, an antibody obtained by the method, and a representative of the antibody This is related to various usage examples.

  The inventors of the present invention have so far focused on chicken-type antibodies as non-mammalian antibodies. Chickens are phylogenetically lower than mammals, but are animals that have an elaborate immune system similar to mammals. In particular, since it is phylogenetically separated from mammals, it is useful for producing specific antibodies against proteins conserved in many mammals. That is, specific antibodies against proteins (antigens) that are difficult to produce using mice and rats can be produced in chickens. For example, since N-glycolylneuraminic acid (hereinafter referred to as “NeuGc”), an antigen serving as a human cancer marker, is present in most mammals except humans, antibodies are produced in mice, rats, and the like. However, it is not possible to produce antibodies in birds and other birds, since NeuGc does not exist. Also, prion protein (hereinafter referred to as “PrP”), which is a pathogen of Creutzfeldt-Jakob disease and mad cow disease, has 90% or more homology between mammals, and it is difficult to produce antibodies in mammals. However, since homology between mammals and chickens is on the order of 30%, it is possible to produce antibodies in chickens. In fact, the present inventors have succeeded in producing chicken monoclonal antibodies against NeuGc and PrP by the cell fusion method. Another advantage of chicken-type antibodies is that they have no cross-reactivity with mammalian-type antibodies, so by using chicken-type and mammalian-type monoclonal antibodies, high-sensitivity antigen detection without non-specific reactions is possible. It is possible to establish a system.

Currently, methods for producing chicken monoclonal antibodies include cell fusion methods (see Non-Patent Document 1 and Non-Patent Document 2) and phage display methods (see Non-Patent Document 3, Non-Patent Document 4 and Patent Document 1). Has been established. The present inventors have succeeded in producing a recombinant chicken antibody by introducing a gene recombination technique for the purpose of mass production, structural modification, functional modification, etc. of a chicken antibody. (See Patent Document 2 (see Japanese Patent Application No. 2004-325658 (filed on Nov. 9, 2004) and drawings))
However, the production of a chicken monoclonal antibody by the cell fusion method described above is not always a simple method because it requires a certain amount of time and a certain technique to produce a hybridoma. The above phage display method is a simple method for producing a chicken monoclonal antibody. The produced antibody is a single-chain variable region fragment (scFv) in which a light chain variable region and a heavy chain variable region are linked by a linker. However, there are problems such as low affinity for the antigen due to instability of the structure of the antigen binding site, low binding sensitivity of the secondary antibody for detection, and low detection sensitivity. In order to improve the above problems, a single-chain variable region fragment is dimerized using a part of the heavy chain constant region (CH3 region). In addition, a human scFv antibody is converted into a human monoclonal antibody. In this method, the variable region is amplified by PCR, and connected to the leader region or the constant region with a restriction enzyme. (Refer nonpatent literature 5). Furthermore, the above-mentioned recombinant chicken type antibody uses the gene of a chicken type monoclonal antibody secreted by the hybridoma, and as mentioned above, it is difficult to produce a hybridoma, and this is not always a simple method.

The present invention has been made in view of the above problems, and its object is to provide a single-chain variable region fragment (scFv) obtained by the phage display method as a simple method for producing a recombinant chicken bivalent antibody. It is to provide a method for producing a chicken antibody by quantification, an antibody obtained by the method, and a typical use example of the antibody.
Asaoka, H .; Nishinaka, S .; , Wakamiya, N .; Matsuda, H .; , Murata, M .; 1992. Two chicken monoclonal antigens specific for heterophil Hanganutziu-Deicher antigens. Immunol. Lett. 32, 91-96. Matsuda, H .; Mitsuda, h. Nakamura, N .; Furusawa, S .; Mohri, S .; Kitamoto, T .; 1999. A chicken monoantibody with specificity for the N-terminal of human prion protein. FEMS Immunol. Med. Microbiol. 23, 189-194 Yamanaka, H .; I. Inoue, T .; , Lkeda-tanaka, O .; , 1996. Chicken monoclonal anti-body isolated by a phase display system. J. et al. Immunol. 157, 1156-1162. Nakamura, N .; Shimokawa, M .; , Miyamoto, K .; Hojo, S .; Horiuchi, H .; Furusawa, S .; Matsuda, H .; , 2003. Two expression vectors for the phase-displayed chicken monoclonal antibody. J. et al. Immunol. Methods 280, 157-164. Boel E. et al. , Functional human monoclonal antibodies of all isotypes constructed from phage display library-derived single-chain Favorable fragments. Immunol. Methods 239 (2000), 153-166. JP 2003-9869 A (publication date: January 14, 2003) JP 2005-278633 A (publication date: October 13, 2005)

  The present inventors have intensively studied in order to solve the above problems, and have completed the present invention. That is, the method according to the present invention is a method for producing a recombinant chicken bivalent antibody in order to solve the above-described problem, and comprises a light chain variable region using a polynucleotide encoding a chicken single-stranded variable region fragment as a template. An amplification step of amplifying a gene and a heavy chain variable region gene; a light chain expression gene fragment linking a light chain leader sequence that functions in a host cell, the light chain variable region gene, and a light chain constant region gene of a chicken antibody A heavy chain leader sequence that functions in a host cell, the heavy chain variable region gene, and a heavy chain constant region gene of a chicken-type antibody, and a heavy chain expression gene fragment preparation step. Yes.

  In the method according to the present invention, the amplification step uses a first primer having the base sequence represented by SEQ ID NO: 1 and a second primer having the base sequence represented by SEQ ID NO: 2 in order to solve the above problems. And amplifying the light chain variable region gene and amplifying the heavy chain variable region gene using the seventh primer having the base sequence shown in SEQ ID NO: 7 and the eighth primer having the base sequence shown in SEQ ID NO: 8. It may be a process.

  In addition, in order to solve the above problems, the method for producing a chicken antibody according to the present invention is characterized in that the light chain leader sequence includes a third primer having the base sequence shown in SEQ ID NO: 3, and the base sequence shown in SEQ ID NO: 4. The polynucleotide amplified using the 4th primer which has these may be sufficient.

  Further, in the method for producing a chicken antibody according to the present invention, in order to solve the above-mentioned problem, the light chain constant region gene includes a fifth primer having the base sequence shown in SEQ ID NO: 5, and a base shown in SEQ ID NO: 6. The polynucleotide amplified using the 6th primer which has a sequence | arrangement may be sufficient.

  In addition, in order to solve the above problems, the method for producing a chicken antibody according to the present invention is characterized in that the light chain leader sequence includes a third primer having the base sequence shown in SEQ ID NO: 3, and the base sequence shown in SEQ ID NO: 4. And the light chain constant region gene has a fifth primer having the base sequence shown in SEQ ID NO: 5 and the base sequence shown in SEQ ID NO: 6 The polynucleotide amplified using the 6th primer may be sufficient.

  In the method according to the present invention, in order to solve the above problems, the heavy chain leader sequence includes a ninth primer having the base sequence represented by SEQ ID NO: 9, and a tenth primer having the base sequence represented by SEQ ID NO: 10. It may be a polynucleotide amplified using

  Further, in the method according to the present invention, in order to solve the above problems, the heavy chain constant region gene has an 11th primer having a base sequence represented by SEQ ID NO: 11 and a 12th primer having a base sequence represented by SEQ ID NO: 12. It may be a polynucleotide amplified using a primer.

  In the method according to the present invention, in order to solve the above problems, the heavy chain leader sequence includes a ninth primer having the base sequence represented by SEQ ID NO: 9, and a tenth primer having the base sequence represented by SEQ ID NO: 10. And the heavy chain constant region gene uses the eleventh primer having the base sequence shown in SEQ ID NO: 11 and the twelfth primer having the base sequence shown in SEQ ID NO: 12. The amplified polynucleotide may be used.

  Further, in the method according to the present invention, in order to solve the above-mentioned problems, the light chain expression gene fragment preparation step comprises using the light chain leader sequence; the light chain variable region gene; and the light chain constant region gene as a template. It may be a step of performing an amplification reaction using the third primer and the sixth primer.

  Further, in the method according to the present invention, in order to solve the above problems, the heavy chain expression gene fragment preparation step comprises using the heavy chain leader sequence; the heavy chain variable region gene; and the heavy chain constant region gene as a template. A step of performing an amplification reaction using the ninth primer and the twelfth primer may be used.

  On the other hand, the antibody according to the present invention is an antibody produced by the method according to the present invention in order to solve the above problems.

  In order to solve the above problems, the antibody according to the present invention has (a) the amino acid sequence represented by SEQ ID NO: 13; or (b) one or several amino acids substituted in the amino acid sequence represented by SEQ ID NO: 13. A light chain consisting of an amino acid sequence deleted, inserted, or added, and (c) the amino acid sequence shown in SEQ ID NO: 14; or (d) one or several amino acids in the amino acid sequence shown in SEQ ID NO: 14 It comprises a heavy chain consisting of an amino acid sequence substituted, deleted, inserted or added, and has an activity of binding to a prion protein.

  An antibody according to the present invention is an antibody comprising a light chain consisting of the amino acid sequence shown in SEQ ID NO: 13 and a heavy chain consisting of the amino acid sequence shown in SEQ ID NO: 14 in order to solve the above problem. There may be.

Further, the antibody according to the present invention may be an antibody labeled with an enzyme or a radioisotope that can be used as a marker for detection in order to solve the above-mentioned problems. The enzyme that can be used as the detection marker is preferably an enzyme that reacts with a substrate and develops color. For example, peroxidase, galactosidase and the like are used as enzymes that can be used as detection markers. Examples of the radioisotope that can be used as the detection marker include ¹⁴ C, ³ H, ³² P, ³⁵ S, ⁹⁰ Tc, ¹¹¹ In, ¹²⁵ I, and ¹³¹ I. According to the antibody labeled with the enzyme or radioisotope that can be used as the detection marker, the antigen (prion protein) can be detected by the direct method, the non-specific reaction is reduced, and the antigen is more sensitive. Can be detected. The labeling method may be performed by a conventionally known method.

  The prion protein detection kit according to the present invention is characterized by including the antibody according to the present invention in order to solve the above problems.

  In addition, the prion protein detection kit according to the present invention includes a step of detecting a prion protein using the antibody according to the present invention in order to solve the above-described problems.

  The prion disease diagnostic kit according to the present invention is characterized by including the antibody according to the present invention.

  The prion disease diagnosis method according to the present invention includes a step of detecting an abnormal prion protein in a sample prepared from a living body using the antibody according to the present invention.

  According to the method of the present invention, a recombinant chicken bivalent antibody having two antigen-binding sites can be produced from a single chain variable region fragment (scFv) obtained by the phage display method. Therefore, it is not necessary to prepare a hybridoma that has previously required time and technology for production and obtain a chicken-type antibody gene from the hybridoma. Therefore, it is possible to easily produce a recombinant chicken-type bivalent antibody. There is an effect that can be done. In addition, since the antibody obtained by the above method is a bivalent antibody having two antigen-binding sites, it has a high affinity with the antigen, and has an Fc region and a region to which a secondary antibody for detection binds. Since there are many, there exists an effect that an antigen can be detected with high sensitivity.

  The antibody according to the present invention is a recombinant chicken bivalent antibody. Therefore, it is possible to establish a high-sensitivity antigen detection system that has no non-specific reaction. Furthermore, it is possible to provide diagnostic agents and diagnostic methods for various diseases using the highly sensitive antigen detection system.

  For example, if a recombinant chicken bivalent antibody is produced from scFv that binds to a prion protein by the method according to the present invention, a highly sensitive detection system and a highly sensitive detection method for the prion protein can be established. Furthermore, by detecting abnormal prion protein using the high-sensitivity detection system and the high-sensitivity detection method, it is possible to diagnose prion diseases (such as Creutzfeldt-Jakob disease or bovine spongiform encephalopathy) with high sensitivity.

It is a figure explaining the outline of the construction method of pcCKL-3-15. It is a figure explaining the outline of the construction method of pcCKH-2. It is a figure which shows the base sequence of the oligonucleotide used for construction of pcCKH-2. It is a figure explaining the outline of the construction method of pcDHF3-15. In Example 2, it is a figure which shows the result of having detected abnormal prion protein (BSE-UK10PK) using each antibody, (a) shows the result of having detected by 44B1, (b) is T2. The results of detection are shown, (c) shows the results of detection using a 3-15 bivalent antibody, and (d) shows the results of detection using a 3-15 monovalent antibody. In Example 3, it is a figure which shows the result of having detected BSE using the HRP labeled secondary antibody, (a) shows the detection result of BSE by the direct method using HRP labeled Ab3-15, (b ) Shows the detection result of BSE by the direct method using HRP-labeled T2.

  An embodiment of the present invention will be described as follows. Note that the present invention is not limited to this.

  The method of the present invention is a method for producing a recombinant chicken bivalent antibody, wherein a light chain variable region gene and a heavy chain variable region gene are produced using a polynucleotide encoding a chicken single-stranded variable region fragment as a template. Amplifying step to amplify; light chain leader sequence that functions in host cell, light chain variable region gene, and light chain constant region gene of chicken type antibody linking gene expression step for light chain expression; heavy function that functions in host cell A step of preparing a heavy chain expression gene fragment by linking a chain leader sequence, the heavy chain variable region gene, and a heavy chain constant region gene of a chicken-type antibody; hosting the light chain expression gene fragment and the heavy chain expression gene fragment And a step of culturing the host cell.

Here, “chicken-type bivalent antibody” means a chicken-type antibody having two antigen-binding sites per molecule. In other words, it means an antibody having a bivalent valence with an antigen. That is, two homologous light chains (light chain variable region and light chain constant region) and two heavy chains (heavy chain variable region and heavy chain constant region), respectively, are linked by a disulfide bond (SS bond). An antibody having the structure described above. However, it does not have to be a full-length antibody molecule, and may be a structure in which _two heavy chains can be bound by an SS bond, that is, a structure having at least an F (ab ′) ₂ fragment. On the other hand, an antibody obtained by the phage display method (so-called “phage display antibody”) has a light chain variable region and a heavy chain variable region connected by a linker, and the two variable regions are close to each other, thereby allowing one antigen-binding site to be bound. Forming. Accordingly, a phage display antibody is an antibody having one antigen binding site per molecule. Here, the phage display antibody in which the light chain and the heavy chain are connected by a linker may be referred to as a single chain variable region fragment (single chain FV (scFv)) or a single chain antibody.

  In this specification, the “chicken antibody” refers to an antibody (IgM, IgA, IgY) produced by a chicken against an antigen by the immune function of the chicken. Of these, a single antibody that recognizes only a specific portion of an antigen is called a “chicken monoclonal antibody”. However, in the present invention, the “chicken antibody” may be an antibody having the same structure as the natural antibody produced by the chicken itself. For example, a gene encoding a chicken antibody is introduced into a host cell other than the chicken. This also includes antibodies produced by transformed cells obtained in this manner, and antibodies produced by known phage display methods. Further, a part of the amino acid of the antibody may be deleted or substituted, or an amino acid may be added (structure-modified chicken antibody).

  Each step in the method of the present invention will be described below.

<Amplification process>
The amplification step is a step of amplifying a light chain variable region gene and a heavy chain variable region gene using a polynucleotide encoding a chicken single-stranded variable region fragment as a template.

  The “chicken single chain variable region fragment” means a single chain variable region fragment in which a light chain variable region and a heavy chain variable region of a chicken antibody are connected by a linker. In the present specification, for convenience, the single-chain variable region fragment is referred to as “scFv”.

  The polynucleotide encoding scFv as a template (hereinafter referred to as “scFv polynucleotide”) can be obtained, for example, by recovering DNA from a phage displaying a desired scFv. The scFv polynucleotide may be a polynucleotide fragment or a plasmid, or may be obtained by chemical synthesis from its sequence information.

  The scFv polynucleotide includes a light chain variable region that binds to a desired antigen and a region encoding a heavy chain variable region. Accordingly, the light chain variable region gene (in other words, “polynucleotide encoding the light chain variable region”) and the heavy chain variable region gene (in other words, “polynucleotide encoding the heavy chain variable region”) are the scFv polynucleotides. Amplification can be performed by carrying out a known DNA amplification method such as a PCR method or a modification method thereof using as a template.

  In the above amplification reaction, it is necessary to appropriately design and use primers for amplifying the light chain variable region gene and the heavy chain variable region gene. The primer can be designed based on the nucleotide sequence information of each primer used to amplify various light chain variable region genes and heavy chain variable region genes during the phage display method.

  For chicken-type antibodies, one set of each primer designed as described above, that is, a primer used to amplify the light chain variable region and a primer used to amplify the heavy chain variable region is prepared. If so, it can be used for almost all scFv polynucleotides derived from phage selected from the same phage library. That is, almost all the light chain variable region genes or heavy chain variable region genes of antibodies against various antigens can be amplified with one set of primers.

  This is achieved by a unique antibody gene diversity acquisition mechanism of birds and other birds. That is, the diversity of antibody genes in mammals is acquired by rearranging one V gene and one J gene from the V gene group and J gene group existing in the V region. Therefore, when performing the phage display method, various light chain variable region genes and heavy chain variable region genes cannot be amplified with only one set of primers. That is, in order to amplify various light chain variable region genes and heavy chain variable region genes, a plurality of primer sets must be designed and used for amplification.

  On the other hand, the diversity of avian antibody genes such as chickens is due to the rearrangement of one V gene and one J gene present in the V region, and a portion of the V gene comprising many pseudogenes and genes. Earn by converting. Therefore, the gene encoding the avian V region consists of only one V gene and J gene combination. Therefore, if a primer is designed in a region where the nucleotide sequence is unchanged in the nucleotide sequence encoding the V region, almost all light chain variable region genes and heavy chain variable region genes can be amplified with one set of primers. It can be done. This is one of the great advantages of the present invention.

  As a primer for amplifying a light chain variable region gene applicable to the method of the present invention, for example, the first primer having the base sequence of GCAGGCAGCGCTGAACTCAGCC (SEQ ID NO: 1) and the base sequence of CTGGCCGAGGACGGTCAGGGTT (SEQ ID NO: 2) The 2nd primer which has is mentioned. Moreover, as a primer for amplifying the heavy chain variable region gene applicable to the method of the present invention, for example, a seventh primer having a base sequence of CTGATGGGCGCCGTGACGTT (SEQ ID NO: 7) and a base sequence of GGAGGAGACGATGAACTTCGGT (SEQ ID NO: 8) The 8th primer which has is mentioned. The primer applicable to the present invention is not limited to the above-mentioned primer, and may have a base sequence in which one or several bases are substituted, deleted, inserted or added. Primers consisting of the complementary sequences of

  The first primer, second primer, seventh primer and eighth primer were designed from the following viewpoints. However, the primer design method is not limited to this.

  The chicken-type phage display antibody expression plasmid synthesizes cDNA from mRNA extracted from the spleen of a chicken immunized with a desired antigen using reverse transcriptase, and the primers shown below (primers for light chain variable region amplification (CLSB, CLF)) The light chain variable region gene and the heavy chain variable region gene are amplified using the heavy chain variable region amplification primers (CHB, CHSF) and inserted into the plasmid pPDS (for details, see “Yamanaka. H I. et al Chicken monoantibodies isolated by a phase display system. J. Immunol. 1996, 157: 1156-1162). The base sequence of CLBSB is TCTGACGGTCGCGCGTGACTCAGCC (SEQ ID NO: 15), the base sequence of CLF is ATTAGCGCGCTTAAGGACGGTCAGGGGTT (SEQ ID NO: 16), the base sequence of CHB is CTGATGCGGGCCGTGACGTT (SEQ ID NO: 17), and TCSCGCTGGTCGG is there.

  The chicken-type phage display antibody obtained by the above method amplifies the light chain variable region gene and the heavy chain variable region gene constituting the antibody using the primers (CLSB, CLF, CHB, CHSF), It always has the base sequence of the primer (CLSB, CLF, CHB, CHSF). Therefore, if a primer to be applied in the present invention is designed based on the base sequence of the primers (CLSB, CLF), the light chain variable region gene of chicken antibody against any antigen can be amplified, and the primer (CHB , CHSF), the light chain variable region gene of chicken antibody against any antigen can be amplified by designing the primer to be applied in the present invention based on the nucleotide sequence.

  The first primer is designed based on a partial base sequence of CLSB, the second primer is designed based on a partial base sequence of CLF, and the seventh primer is a base sequence of CHB. The sequence is used as it is, and the eighth primer is designed based on a partial base sequence of CHSF. Regarding the first primer, the second primer, and the eighth primer, a base sequence that does not exist in the base primer is added to a part of the base sequence of the base primer. This base sequence is performed later. Base sequence used for linking a light chain variable region gene and a leader sequence or a light chain variable region gene and a light chain constant region gene in a light chain expression gene fragment preparation step and a heavy chain expression gene fragment preparation step It is a base sequence that exists as a complementary sequence in the two nucleotide chains to be linked.

  In addition, what is necessary is just to employ | adopt after considering suitably conditions, such as PCR method implemented in the said process.

<Gene fragment preparation step for light chain expression>
This step is a step of preparing a gene fragment used for light chain expression by linking a light chain leader sequence that functions in a host cell, the light chain variable region gene, and a light chain constant region gene of a chicken antibody. is there.

  A “leader sequence” is a nucleotide chain that encodes the amino acid terminal domain of a secreted protein, and a nucleotide chain that encodes a secretion signal when a protein synthesized in the cell is secreted outside the cell. The “light chain leader sequence” means a nucleotide chain encoding a light chain secretion signal of an antibody synthesized in a host cell.

  The leader sequence used in the present invention is not particularly limited as long as the encoded polypeptide functions as a secretion signal in the host, and a conventionally known one may be appropriately selected and used. As the light chain leader sequence, for example, the leader sequence of anti-PrP chicken monoclonal antibody (HUC2-13, see Patent Document 2 for details) prepared by the present inventors using the cell fusion method, pSecTag2 (manufactured by Invitrogen) ) Murine Ig kappa-chain V-J2-C leader sequence and the like can be used. The method for obtaining the light chain leader sequence is not particularly limited, and the leader sequence may be obtained by chemical synthesis from the above known base sequence information, or a hybridoma that produces any of the above monoclonal antibodies. Alternatively, cDNA synthesized from the mRNA may be obtained by PCR or the like using as a template.

  As a primer used when acquiring the light chain leader sequence by PCR or the like, for example, a third primer having a base sequence of GCCATGGCCTGGGCTCCTCTCCT (SEQ ID NO: 3) and a fourth primer having a base sequence of GGCTGAGTCAGCGCTGCCTGC (SEQ ID NO: 4) Is mentioned. The third primer may contain a base sequence (AAGCTT) for adding a restriction enzyme site (HindIII) used for cloning. That is, AAGCTTGCCATGGCCTGGGCTCCTCTCCT (SEQ ID NO: 19) may be used. The third primer may further have a base sequence unrelated to the leader sequence added to the 5 'end. For example, a primer having a base sequence (ATATAT) added to the 5 ′ end of the third primer having the base sequence shown in SEQ ID NO: 19, that is, a primer having the base sequence of ATATATAAGCTTGCCATGGCCTGGGCTCCCTCTCT (SEQ ID NO: 20) may be used. The base sequence (ATATAT) is a sequence that is cleaved from the light chain leader sequence by a restriction enzyme (HindIII) upon introduction into a vector, and the type of base and the combination of bases are not particularly limited.

  In the third primer, HindIII is added as described above, but the method of the present invention is not limited to this, and is included in the type of cloning site of the vector to be introduced and the light chain leader sequence. It may be adopted after being appropriately selected based on the information on the restriction enzyme site.

  On the other hand, the “light chain constant region gene of a chicken antibody” means a polynucleotide encoding the light chain constant region of a chicken antibody. The light chain constant region of a chicken antibody is common to almost all chicken antibodies, and the light chain constant region information is obtained from the base sequence information of a conventionally known chicken monoclonal antibody. A gene may be obtained by chemical synthesis or the like. As the base sequence information of the light chain constant region, for example, the germline base sequence information (gene bank Accession No. M24403) of the chicken antibody gene light chain prepared by the present inventors using the cell fusion method can be used. . The method for obtaining the light chain constant region gene is not particularly limited, and may be obtained by chemical synthesis from the above known base sequence information, or mRNA of a hybridoma producing any of the above monoclonal antibodies. Alternatively, it may be obtained by PCR or the like using cDNA synthesized from the template. The light chain constant region to be amplified only needs to have a region capable of forming an S—S bond with the heavy chain, and does not have to be a full length.

  As primers used for obtaining the light chain constant region gene by PCR or the like, for example, a fifth primer having the base sequence of AACCCTGACCGTCCCTCGGCCA (SEQ ID NO: 5) and a sixth primer having the base sequence of TTAGCACTCGGACCCTTCTCAG (SEQ ID NO: 6) A primer is mentioned. The sixth primer may contain a base sequence (TCTAGA) for adding a restriction enzyme site (XbaI) used for cloning. That is, TCTAGATTTAGCACTCGGACCTCTTCAG (SEQ ID NO: 21) may be used. Further, the sixth primer consisting of the base sequence shown in SEQ ID NO: 21 may have a base sequence unrelated to the light chain constant region gene added to the 5 'end. For example, a primer having a base sequence (TC) added to the 5 'end of the sixth primer, that is, a primer consisting of the base sequence of TCTCTAGATTTAGCACTCGGACCCTTCAG (SEQ ID NO: 22) may be used. The base sequence (TC) is a sequence that is cleaved from the light chain constant region gene by a restriction enzyme (XbaI) upon introduction into a vector, and the type of base and the combination of bases are not particularly limited. .

  In the sixth primer, XbaI is added as described above. However, the method of the present invention is not limited to this. The cloning site type of the vector to be introduced, the light chain constant region gene, What is necessary is just to employ | adopt after selecting suitably based on the information of the restriction enzyme site contained.

  Next, regarding a method for preparing a light chain expression gene fragment by linking a light chain leader sequence, a light chain variable region gene, and a light chain constant region gene, a light chain leader amplified using the above third and fourth primers The sequence, the light chain constant region gene amplified using the fifth and sixth primers, and the light chain variable region gene amplified using the first and second primers will be described as examples. In addition, this process is not limited to this.

  In this step, for example, the light chain leader sequence amplified using the third and fourth primers, the light chain constant region gene amplified using the fifth and sixth primers, and amplified using the first and second primers The light chain variable region gene can be used as a template to carry out an amplification reaction such as a PCR method using the third primer and the sixth primer. The first primer and the fourth primer are in a complementary relationship, and it can be said that the amplified fragments amplified using both primers are in a state where annealing can occur via the complementary sequence. That is, it can be said that the 3 'end of the light chain leader sequence and the 5' end of the light chain variable region can be linked by annealing. Similarly, the second primer and the fifth primer are partially complementary, and it can be said that amplified fragments amplified using both primers are in a state where annealing can occur via the complementary sequence. That is, it can be said that the 3 'end of the light chain variable region and the 5' end of the light chain constant region can be linked by annealing.

  Thus, the light chain leader sequence amplified using the third and fourth primers, the light chain constant region gene amplified using the fifth and sixth primers, and the light chain variable amplified using the first and second primers When region genes are mixed and subjected to an annealing reaction, the above-mentioned polynucleotides linked to each other, that is, light chain expression gene fragments can be prepared. Furthermore, the base sequence of the third primer is present at the 5 ′ end of the light chain expression gene fragment, and the base sequence (complementary sequence) of the sixth primer is present at the 3 ′ end of the light chain expression gene fragment. If an amplification reaction is carried out using both primers, the gene fragment for light chain expression can be amplified in large quantities.

  If the light chain expression gene fragment is not amplified as described above, the light chain leader sequence amplified using the third and fourth primers, and the light chain variable region gene amplified using the first and second primers Using the third primer and the second primer as a template, an amplification reaction such as PCR is performed to link the light chain leader sequence and the light chain variable region gene, and then the light chain leader sequence and the light chain variable region gene are An amplification reaction may be performed using the linked polynucleotide and the light chain constant region gene amplified using the fifth and sixth primers as templates, and further using the third and sixth primers.

  Conversely, the light chain variable region gene amplified using the first and second primers and the light chain constant region gene amplified using the fifth and sixth primers were used as templates and the first and sixth primers were used. A light chain variable region gene and a light chain constant region gene are ligated by performing an amplification reaction such as a PCR method, and a polynucleotide comprising the light chain variable region gene and the light chain constant region gene linked; The amplification reaction may be performed using the third primer and the sixth primer using the light chain leader sequence amplified using 4 primers as a template.

  In addition, what is necessary is just to employ | adopt after considering suitably conditions, such as PCR method implemented in the said process. Further, the linkage of the light chain leader sequence, the light chain variable region gene, and the light chain constant region gene is not limited to the above method, and may be performed by appropriately selecting a normal genetic engineering technique. The primer applicable to this step is not limited to the primer as long as it can amplify the target gene (polynucleotide), and one or several bases are substituted, deleted, inserted or It may have an added base sequence, or may be a primer composed of these complementary sequences.

<Step of preparing heavy chain expression gene fragment>
This step is a step of preparing a gene fragment used for heavy chain expression by linking a heavy chain leader sequence that functions in a host cell, the heavy chain variable region gene, and a heavy chain constant region gene of a chicken antibody. is there.

  A “leader sequence” is a nucleotide chain that encodes the amino acid terminal domain of a secreted protein, and a nucleotide chain that encodes a secretion signal when a protein synthesized in the cell is secreted outside the cell. The “heavy chain leader sequence” means a nucleotide chain encoding a secretion signal of an antibody heavy chain synthesized in a host cell.

  The leader sequence used in the present invention is not particularly limited as long as the encoded polypeptide functions as a secretion signal in the host, and a conventionally known one may be appropriately selected and used. As the heavy chain leader sequence, for example, the leader sequence of an anti-PrP chicken monoclonal antibody (HUC2-13, see Patent Document 2 for details) prepared by the present inventors using a cell fusion method can be used. The method for obtaining the heavy chain leader sequence is not particularly limited, and the leader sequence may be obtained by chemical synthesis from the above known base sequence information, or a hybridoma producing any one of the above monoclonal antibodies. Alternatively, cDNA synthesized from the mRNA may be obtained by PCR or the like using as a template.

  As primers used when the heavy chain leader sequence is obtained by the PCR method or the like, for example, a ninth primer having a base sequence of ACCATGAGCCCACTCGTCCTCC (SEQ ID NO: 9) and a tenth primer having a base sequence of AACGTCACGCCGCCATCAG (SEQ ID NO: 10) Is mentioned. The ninth primer may contain a base sequence (GGTACC) for adding a restriction enzyme site (KpnI) used for cloning. That is, GGTACCACCATGAGCCCACTACTGTCTCC (SEQ ID NO: 23) may be used. Further, the ninth primer may contain a base sequence that is unrelated to the leader sequence. For example, it may be a primer having a base sequence (TT) added to the 5 'end of the ninth primer consisting of the base sequence shown in SEQ ID NO: 23, that is, a primer consisting of the base sequence of TTGGTACCCACCATGAGCCCACTCGTCTC (SEQ ID NO: 24). The base sequence (TT) is a sequence that is cleaved from the heavy chain leader sequence by a restriction enzyme (KpnI) upon introduction into a vector, and the type of base and the combination of bases are not particularly limited.

  In the ninth primer, KpnI is added as described above. However, the method of the present invention is not limited to this, and is included in the type of cloning site of the vector to be introduced and the heavy chain leader sequence. It may be adopted after being appropriately selected based on the information on the restriction enzyme site.

  On the other hand, the “heavy chain constant region gene of a chicken antibody” means a polynucleotide encoding the heavy chain constant region of a chicken antibody. The heavy chain constant region of the chicken antibody is common to almost all chicken antibodies, and the heavy chain constant region information is obtained from the base sequence information of a conventionally known chicken monoclonal antibody. A gene may be obtained by chemical synthesis or the like. As the base sequence information of the heavy chain constant region, for example, the base sequence information (gene bank Accession No. M30319 and X07174) of the germline of the chicken antibody gene heavy chain prepared by the present inventors using the cell fusion method can be used. It is. The method for obtaining the heavy chain constant region gene is not particularly limited, and may be obtained by chemical synthesis from the above known base sequence information, or mRNA of a hybridoma that produces any of the above monoclonal antibodies. Alternatively, it may be obtained by PCR or the like using cDNA synthesized from the template. In addition, since the heavy chain constant region gene to be amplified has a large base size, it is difficult to amplify the full length. Therefore, it is not particularly necessary to amplify the full length.

  As a primer used when acquiring a heavy chain constant region gene (part) by PCR method etc., for example, the 11th primer which has the base sequence of ACCGAAGTCATCGTCTCCTCC (sequence number 11), and the base sequence of CAAACACAACAGCTCCCACC (sequence number 12) The 12th primer which has is mentioned. The heavy chain constant region gene (partial) amplified using the eleventh and twelfth primers contains a HindIII site that can be used for introduction into a vector. The eleventh and twelfth primers are designed so that the heavy chain constant region gene (part) obtained by these primers contains a HindIII site. Therefore, as long as the primer is designed so that the heavy chain constant region gene obtained by amplification contains the HindIII, it is not limited to the primer having the base sequences of SEQ ID NOs: 11 and 12. However, it is preferable to design the primer so that at least 6 bp or more of base is added from the end of the HindIII site. The restriction enzyme site contained in the heavy chain constant region gene obtained by amplification is not limited to HindIII, but the type of cloning site of the vector to be introduced, other restriction enzymes contained in the heavy chain constant region gene The selection can be made appropriately based on the information on the site.

  Next, a method for preparing a heavy chain expression gene fragment by ligating a heavy chain leader sequence, a heavy chain variable region gene, and a heavy chain constant region gene, and a heavy chain leader amplified using the ninth and tenth primers The sequence, the heavy chain constant region gene amplified using the seventh and eighth primers, and the heavy chain variable region gene amplified using the eleventh and twelfth primers will be described as examples. In addition, this process is not limited to this.

  In this step, for example, the heavy chain leader sequence amplified using the ninth and tenth primers, the heavy chain constant region gene amplified using the eleventh and twelfth primers, and the seventh and eighth primers are used for amplification. It can be carried out by carrying out an amplification reaction such as PCR using the 9th primer and the 12th primer using the heavy chain variable region gene as a template. The 10th primer and the 7th primer are in a complementary relationship, and it can be said that the amplified fragments amplified using both primers are in a state where annealing can occur through the complementary sequence. That is, it can be said that the 3 'end of the heavy chain leader sequence and the 5' end of the heavy chain variable region gene can be linked by annealing. Similarly, the eighth primer and the eleventh primer are in a complementary relationship, and it can be said that the amplified fragments amplified using both primers are in a state where annealing can occur via the complementary sequence. That is, it can be said that the 3 'end of the heavy chain variable region and the 5' end of the heavy chain constant region can be linked by annealing.

  Thus, the heavy chain leader sequence amplified using the ninth and tenth primers, the heavy chain constant region gene amplified using the eleventh and twelfth primers, and the heavy chain variable amplified using the seventh and eighth primers When the region genes are mixed and an annealing reaction is performed, the above-ligated polynucleotides, that is, heavy chain expression gene fragments can be prepared. Further, the base sequence of the ninth primer is present at the 5 ′ end of the heavy chain expression gene fragment, and the base sequence (complementary sequence) of the twelfth primer is present at the 3 ′ end of the heavy chain expression gene fragment. When an amplification reaction is carried out using both primers, the heavy chain expression gene fragment can be amplified in large quantities.

  If the heavy chain expression gene fragment is not amplified as described above, the heavy chain leader sequence amplified using the ninth and tenth primers and the heavy chain variable region gene amplified using the seventh and eighth primers Using the 9th primer and the 8th primer as a template, an amplification reaction such as PCR is performed to link the heavy chain leader sequence and the heavy chain variable region gene, and then the heavy chain leader sequence and the heavy chain variable region gene are An amplification reaction may be performed using the ligated polynucleotide and the heavy chain constant region gene amplified using the 11th and 12th primers as a template and further using the 9th and 12th primers.

  Conversely, using the heavy chain variable region gene amplified using the seventh and eighth primers and the heavy chain constant region gene amplified using the eleventh and twelfth primers as templates, the seventh primer and the twelfth primer were used. A heavy chain variable region gene and a heavy chain constant region gene are ligated by performing an amplification reaction such as a PCR method, and further, a polynucleotide comprising the heavy chain variable region gene and the heavy chain constant region gene linked; The amplification reaction may be performed using the ninth primer and the twelfth primer using the heavy chain leader sequence amplified using ten primers as a template.

  As described above, the heavy chain variable region gene amplified using the eleventh and twelfth primers is a part of the heavy chain variable region gene. Therefore, the heavy chain constant region gene (part), the heavy chain leader sequence amplified using the ninth and tenth primers, and the heavy chain expression gene fragment ligated with the seventh and eighth primers are chicken-type antibodies. It encodes part of the heavy chain, and does not encode the full length. When the heavy chain expression gene fragment encoding a part of the heavy chain of the chicken antibody encodes the full length, the HindIII digested fragment of the full length heavy chain constant region gene and the heavy chain expression gene fragment And a HindIII digested fragment thereof may be ligated. As a result, a heavy chain expression gene fragment encoding the full length of the heavy chain of the chicken antibody can be obtained.

  In addition, what is necessary is just to employ | adopt after considering suitably conditions, such as PCR method implemented in the said process. The connection of the heavy chain leader sequence, the heavy chain variable region gene, and the heavy chain constant region gene is not limited to the above method, and a normal genetic engineering technique may be selected as appropriate. The primer applicable to the present invention is not limited to the primer as long as it can amplify the target gene (polynucleotide), and one or several bases are substituted, deleted, inserted or added. It may have a base sequence that has been made, or may be a primer comprising these complementary sequences.

<Transformation process>
The method according to the present invention includes a step of obtaining a transformant by introducing the gene fragment for light chain expression and the gene fragment for heavy chain expression obtained in the above step into a host cell (transformation step). Preferably it is.

(Construction of light chain expression vector and heavy chain expression vector)
Hereinafter, a vector for introducing a light chain expression gene fragment and a heavy chain expression gene fragment into a host cell and expressing the light chain and heavy chain in the cell (hereinafter referred to as “light chain expression vector” and “heavy chain”). The vector will be referred to as “chain expression vector”) and the construction method thereof.

  The light chain expression vector or the heavy chain expression vector is not particularly limited as long as the light chain or heavy chain of the chicken monoclonal antibody can be expressed in the host cell, and the cyclic structure is not limited. It may be a vector or a linear shape. Therefore, basically, the obtained light chain expression gene fragment or heavy chain expression gene fragment may be constructed to be controllably linked downstream of the promoter. The type of promoter used is not particularly limited as long as it functions in the host cell. For example, for animal-derived cells, SV40, bovine papilloma virus (BPV) promoter, human cytomegalovirus promoter (CMV) and the like can be mentioned. In addition, the light chain expression vector or heavy chain expression vector may contain various DNA segments other than the promoter. Examples of the DNA segment include a sequence to which a drug resistance gene (neomycin resistance gene, zeocin resistance gene, etc.) serving as a gene transfer marker, a terminator, and a purification tag (histidine tag, etc.) are added. A commercially available vector suitable for the host cell to be introduced may be used. In Examples described later, pcDNA3.1 / myc-His (A) (Invitrogen) and pcDNA4 / myc-His (A) (Invitrogen) are used as a base, light chain expression vector, and heavy chain expression. A vector is being constructed. In addition, pEF1 / myc-His (Invitrogen) and pSecTag2 / Hygro (Invitrogen) can be used as known vectors.

  The method for constructing each expression vector is not particularly limited, and a necessary gene sequence may be ligated using a normal genetic engineering technique. In addition, the above expression vectors may be constructed without subcloning the light chain expression gene fragment or the heavy chain expression gene fragment obtained by PCR, or Escherichia coli or the like using a subcloning vector such as pUC19 or pBluescript II. Each of the above expression vectors may be constructed after subcloning.

(Transformation of host cell for light chain expression vector and heavy chain expression vector)
Host cells are transformed using the light chain expression vector and the heavy chain expression vector. The antibody molecule is a dimer in which two molecules of a complex (light chain-heavy chain complex) in which a light chain and a heavy chain are formed by S—S bonds are combined. Therefore, it is necessary to introduce both the light chain expression gene fragment and the heavy chain expression gene fragment into the host cell.

  The host cell to be transformed is not particularly limited, and a host corresponding to each expression vector constructed above may be selected and used. That is, the host cell may be an animal-derived cell or a plant-derived cell. Animal-derived cells and plant-derived cells are meant to include cells, tissues, and organs. In particular, in the present invention aimed at mass production of chicken monoclonal antibodies, cells derived from animals having an immune system are preferable, and cells (cultured cells) that can be cultured in a liquid medium or the like are preferable. Examples of animal-derived cultured cells include Chinese hamster ovary cells (CHO cells), Hela cells, melanoma cells, mouse 3T3 cells, and the like. Examples of plant-derived cultured cells include tobacco BY2 cells. In the examples described later, CHO cells are used as host cells. This is because the cells are suitable for mass production of antibodies because they can be cultured in suspension, have a short generation time of 12 hours, and have a high proliferation ability.

  On the other hand, the transformation method is not particularly limited, and a method suitable for the host cell and the expression vector may be selected and used. For example, conventionally known methods such as an electroporation method, a particle gun method, a calcium phosphate method, a protoplast / spheroplast method, a liposome method, and a DEAE dextran method can be suitably used. In particular, a general transformation method for plant-derived cells includes a transformation method using Agrobacterium (Agrobacterium method). However, the light chain expression gene fragment and the heavy chain expression gene fragment are preferably integrated into the genome of the host cell. By incorporating the antibody gene into the genome, it becomes possible to reliably transfer the gene contained in the vector composition to daughter cells after cell division, and it is possible to maintain the production efficiency of chicken antibodies. It is.

  The method for confirming whether or not the light chain expression gene fragment and the heavy chain expression gene fragment have been introduced into the host cell is not particularly limited, and various known methods can be used. Specifically, various markers may be used. For example, a gene deleted in the host cell is used as a marker, and a plasmid or the like containing this marker and a recombinant plant virus gene is introduced into the host cell as an expression vector. Thus, the introduction of the gene of the present invention can be confirmed from the expression of the marker gene. For example, in the examples described later, CHO cells are transformed, and CHO cells are transformed with a drug resistance marker (neomycin resistance gene, zeocin resistance gene) in a medium containing neomycin and zeocin. By culturing a candidate cell line for transformation, it becomes possible to select the grown cell line as a transformant. As other markers, puromycin resistance marker, bleomycin resistance marker, XGPRT gene, DHFR gene, thymidine kinase gene, etc. are effective for selection of animal cells, bialaphos resistance marker, kanamycin resistance marker, etc. are used for selection of plant cells. It is valid. In addition, there can be mentioned a so-called genomic PCR method in which genomic DNA prepared from a host cell is used as a template and the entire gene length of the introduced protein (transcription factor) is specifically amplified. If it can be confirmed by electrophoresis or the like that the gene encoding the target protein (transcription factor) is amplified by this method, the introduction of the gene can be confirmed.

<Culture process of transformant (production of recombinant chicken divalent antibody)>
The method according to the present invention preferably further includes a step of culturing the above transformant to produce a recombinant chicken bivalent antibody.

Next, a process for producing a recombinant chicken bivalent antibody using the transformant obtained above will be described. More specifically, the transformant may be cultured, and the target recombinant chicken bivalent antibody may be purified from the culture. Here, the culture method and culture conditions of the transformant may be any method suitable for culturing the transformant, and are not particularly limited. For example, when culturing animal cells, a suspension culture method, a carrier adhesion culture method, a hollow fiber culture method and the like are suitable. In particular, the suspension culture method is more preferable because applicable cells are limited to lymphoid cells and the like, but a jar fermenter can be used and scale-up is easy. The transformed CHO cells employed in the examples described later are cells that can be cultured in suspension as described above. In addition, a medium for culturing animal cells is not limited, but serum may be added to amino acids, vitamins, glucose, and salts. In addition, a bicarbonate / carbon dioxide buffer solution is used as the buffer solution, and a CO ₂ incubator can be used as the incubator. In addition, phenol red may be added for pH monitoring. The culture condition is generally cultured at 37 ° C., but depending on the cell line, it may be 28 ° C. or 40 ° C. In the examples described later, the transformed CHO cells were cultured using F12media (GIBCO BRL) containing 10% fetal bovine serum (FBS) for 3 days under conditions of 5% CO ₂ and 37 ° C. Is doing.

  On the other hand, the medium for culturing plant cells is not limited, but may contain inorganic salts, carbon sources, vitamins, and amino acids. In addition, coconut milk or yeast extract may be added to promote growth. In addition, plant hormones such as auxin and cytokinin, gibberellin, abscisic acid, and ethylene may be added. Moreover, although it is culture conditions, what is necessary is just to employ | adopt the optimal thing according to the cell to culture | cultivate light, temperature, the presence or absence of aeration, etc.

  Next, the preparation method and purification method of the target recombinant chicken type bivalent antibody will be described. The transformant into which the light chain expression gene fragment and the heavy chain expression gene fragment have been introduced produces the light chain and heavy chain of the desired recombinant chicken bivalent antibody in the cell. The produced light chain and heavy chain form a light chain-heavy chain complex by S—S bond in the cell, and further, a dimer of the light chain-heavy chain complex is formed to become an antibody molecule. . The antibody molecules produced at this time are secreted into the culture medium or accumulate in the cells. Whether the produced antibody molecule is secreted or accumulates in the cell depends on the type of transformant cell, the culture method, and the like. When the recombinant chicken type bivalent antibody produced as in the former is secreted into the culture solution, the culture solution supernatant may be prepared by centrifugation, filtration, etc. to obtain a recombinant chicken type bivalent antibody. . On the other hand, when the recombinant chicken bivalent antibody accumulates in the cell, the cell is disrupted by a known cell disruption method using glass beads or the like, and the recombinant chicken bivalent antibody is obtained from the disrupted cell. Just get it.

  If necessary, the recombinant chicken divalent antibody obtained by the above method may be purified by a method using affinity chromatography or a resin for purification. By performing the above purification, it is possible to remove proteases and contaminants that inhibit the antigen-antibody reaction, and the obtained recombinant chicken-type divalent antibody can be suitably used by a highly sensitive trace antigen detection system. In the examples described later, the histidine tag is designed to be added to the C-terminus of the produced recombinant chicken-type divalent antibody heavy chain. Since histidine has the property of adsorbing to nickel, the desired recombinant chicken bivalent antibody can be easily purified by using a nickel column.

<Recombinant Chicken Bivalent Antibody According to the Present Invention>
The antibody (recombinant chicken bivalent antibody) according to the present invention is a recombinant chicken bivalent antibody obtained by the method according to the present invention. Examples of such antibodies include anti-PrP phage display antibody 3-15 (Nakamura et al Establishment of a chicken Monoclonal antigen panel agan magma prion protein protein J. Vet. Med. And antibodies obtained by the above-described method of the present invention (hereinafter referred to as “3-15 bivalent antibody”). The details of the method for obtaining the 3-15 bivalent antibody are described in the Examples.

  3-15 bivalent antibody has (a) the amino acid sequence shown in SEQ ID NO: 13; or (b) one or several amino acids in the amino acid sequence shown in SEQ ID NO: 13 are substituted, deleted, inserted, or A light chain comprising an added amino acid sequence, and (c) the amino acid sequence shown in SEQ ID NO: 14; or (d) one or several amino acids are substituted or deleted in the amino acid sequence shown in SEQ ID NO: 14 An antibody comprising a heavy chain consisting of an amino acid sequence inserted, or added, and having an activity of binding to a prion protein.

  The above “one or more amino acids are substituted, deleted, inserted, or added” means substitution, deletion, insertion, or the like by a known mutant polypeptide production method such as site-directed mutagenesis. It means that as many amino acids as can be added (preferably 10 or less, more preferably 7 or less, most preferably 5 or less) are substituted, deleted, inserted or added.

  The base sequence of the polynucleotide encoding the light chain consisting of the amino acid sequence shown in SEQ ID NO: 13 is shown in SEQ ID NO: 27. The nucleotide sequence of the polynucleotide encoding the heavy chain consisting of the amino acid sequence shown in SEQ ID NO: 14 is shown in SEQ ID NO: 28. The polynucleotide encoding the light chain and the polynucleotide encoding the heavy chain of the 3-15 bivalent antibody are not limited to SEQ ID NOs: 27 and 28, and each base can be appropriately changed according to the codon table. .

  Such a 3-15 bivalent antibody is a bivalent antibody prepared using an anti-PrP phage display antibody 3-15 (hereinafter referred to as “3-15 monovalent antibody” as a template) and has binding activity to PrP. As shown in the Examples, the 3-15 bivalent antibody had a much higher PrP binding capacity than the 3-15 monovalent antibody, and the PrP antibody currently used in the BSE definitive test It had the same PrP binding ability as [44B1 (see Virology 320 (2004) p40-51) and T2] Furthermore, the detection background was lower than that of 44B1, and PrP was detected with higher sensitivity. I found out that

<Use of 3-15 bivalent antibody>
The 3-15 bivalent antibody can detect PrP in a sample with high sensitivity. Moreover, prion disease can be diagnosed by detecting abnormal PrP using a 3-15 bivalent antibody. Here, “prion disease” is a general term for diseases that develop due to PrP (particularly abnormal PrP), such as Creutzfeldt-Jakob disease, bovine spongiform encephalopathy (BSE), scrapie that develops in sheep and goats, Grestmann-Straussle syndrome (GSS), crew disease and the like are known. In addition, the detection method of PrP is not specifically limited, What is necessary is just to employ | adopt well-known methods, such as ELISA method, a Western blot method, and RIA method. Further, the conditions in the above method may be performed under standard conditions, and the amount of antibody used for detection may be selected after appropriately selecting optimal conditions.

  Examples of the method for detecting PrP by Western blotting and the method for diagnosing prion disease include the following methods. When detecting PrP (normal PrP and abnormal PrP), a sample obtained from a living body (for example, brain crush fluid, cerebrospinal fluid, spinal fluid, etc.) is subjected to polyacrylamide gel electrophoresis without treatment with proteinase K. Provide. When diagnosing prion disease (detecting abnormal PrP), a sample obtained from a living body (for example, brain crush fluid, cerebrospinal fluid, spinal fluid, etc.) is treated with proteinase K, and then subjected to polyacrylamide gel electrophoresis. Provide. Thereafter, the prion protein may be detected by Western blotting. In addition, abnormal PrP has proteinase K resistance, and if a sample treated with proteinase K as described above is detected using a 3-15 bivalent antibody, whether or not abnormal PrP is contained in the sample, That is, it can be diagnosed whether it is prion disease.

  The sample to which the above method can be applied is not particularly limited as long as it is an organism-derived cell that expresses PrP, and examples thereof include human, bovine, horse, sheep, and goat-derived cells. The sample is preferably in the state of a cell extract.

  On the other hand, the 3-15 bivalent antibody can be used in a PrP detection kit or a prion disease diagnostic kit. The PrP detection kit or the prion disease diagnostic kit can detect PrP or abnormal PrP as long as it contains at least a 3-15 divalent antibody, but may include other configurations. Examples of other configurations include proteinase K, electrophoresis gel, electrophoresis reagent, western blotting reagent, normal PrP, and abnormal PrP.

  The present invention is not limited to the above-described embodiments, and various modifications are possible within the scope shown in the claims, and embodiments obtained by appropriately combining technical means disclosed in different embodiments. Is also included in the technical scope of the present invention.

  EXAMPLES Hereinafter, although an Example demonstrates this invention further in detail, this invention is not limited to this.

(Example 1: Production of 3-15 bivalent antibody)
As an example of the present invention, a recombinant chicken bivalent antibody against human prion protein (PrP) was produced.

[Construction of gene fragment for light chain expression]
Preparation of the light chain variable region gene was carried out using plasmid phAb3-15 for expression of anti-PrP phage antibody 3-15 (Nakamura et al Establishment of a monoclonal monoclonal panel 8 ag. Migrant prion. Using the first primer (SEQ ID NO: 1) and the second primer (SEQ ID NO: 2) as a template, PCR was performed.

  The light chain constant region gene was prepared by using a recombinant anti-PrP chicken antibody light chain expression plasmid (pcCKL-1, as described in Patent Document 2 (Japanese Patent Application No. 2004-325658 (November 9, 2004)). The application was performed by PCR using the 5th primer (SEQ ID NO: 5) and the 6th primer (SEQ ID NO: 22) using the description and drawings) as a template.

  The light chain leader sequence was prepared by a recombinant anti-PrP chicken antibody expression plasmid constructed by the inventors (pcCKL-4, in which the V region of pcCKL-1 was converted to the chicken monoclonal antibody HUNN-1. For HUNN-1, “Nakamura et al Establishment of a Chicken Monoclonal antibodies panel agin magnarian prion protein J. Vet. Med. Sci. 66 807” ), Using the fourth primer (SEQ ID NO: 4) by PCR.

  PCR was performed under the following conditions. The composition of the PCR reaction solution was 10 μl PCR buffer (manufactured by Toyobo Co., Ltd.) 5 μl; 2 mM dNTP 5 μl; 25 mM MgSO 4 3.2 μl (final conc. 1.6 mM); primer (10 μM) 2.5 μl each (final conc. 5 μM); template DNA 1 μl; KOD-plus (Toyobo Co., Ltd.) 1 μl, and finally diluted to 50 μl with distilled water. The reaction was carried out under the conditions of (1) 94 ° C. for 2 minutes; (2) 94 ° C. for 15 seconds; (3) 55 ° C. for 30 seconds; (4) 68 ° C. for 2 minutes; 30 cycles of 2) to (4) were performed.

  PCR was performed using the third primer (SEQ ID NO: 20) and the sixth primer (SEQ ID NO: 22) using the light chain variable region gene, light chain constant region gene, and light chain leader sequence obtained above as templates. The PCR conditions are the same as in the above (1) to (4), except that 0.5 μl each of the light chain variable region gene, light chain constant region gene, and light chain leader sequence as template DNA is added per 50 μl of the reaction solution. According to

The amplified fragment (about 700 bp) obtained by the above PCR is cleaved with HindIII and XbaI, and inserted into the HindIII and XbaI sites of pcDNA3.1 / myc-His (A) (Invitrogen) to insert pcCKL-3-15. It was constructed. The pcCKL-3-15 was confirmed not to be mutated by sequencing. PcCKL-3-15 has a neomycin resistance gene, a CMV (human cytomegalovirus) promoter, and a BGH (bovine growth hormone) poly A signal. The restriction enzyme digestion was performed at 37 ° C. for 6 hours with a reaction solution composition of 10 × M buffer 3 μl, DNA 10 μl, HindIII (New England Biolabs) 1 μl, XbaI (New England Biolabs) 1 μl, H ₂ O15 μl. I did it.

  An outline of the above method is shown in FIG.

[Construction of gene fragments for heavy chain expression]
(1. Construction of pcCKH-2)
An outline of the method for constructing pcCKH-2 is shown in FIG. pcDNA4 / myc-His (A) (Invitrogen) was digested with HindIII, blunt-ended using Klenow fragment, and the HindIII site present in the original was deleted by self-ligation. Recombinant anti-PrP chicken antibody heavy chain expression plasmid constructed by the inventors (pcCKH-1, Patent document 2 (Japanese Patent Application No. 2004-325658 (filed on Nov. 9, 2004)) for the construction method) The anti-PrP chicken-type antibody gene fragment obtained by digesting KpnI and PinAI was inserted into the KpnI and PinA sites of the above plasmid. Oligonucleotides (SEQ ID NOs: 25 and 26) shown in FIG. 2 (b) were synthesized and inserted into the KpnI-HindIII site of the plasmid to construct pcCKH-2.

(2. Heavy chain leader sequence, heavy chain variable region gene, heavy chain constant region gene amplification, and construction of heavy chain expression plasmid pcDHF3-15)
The outline of the construction method of pcDHF3-15 is shown in FIG.

  Preparation of heavy chain variable region gene was carried out using plasmid phAb3-15 for expression of anti-PrP phage antibody 3-15 (Nakamura et al Establishment of a monoclonal antigenic panel aganist magma pian. PCR was carried out using the seventh primer (SEQ ID NO: 7) and the eighth primer (SEQ ID NO: 8) as a template.

  The heavy chain constant region gene (partially) was prepared by a recombinant anti-PrP chicken antibody heavy chain expression plasmid constructed by the present inventors (pcCKH-1, the construction method of which is described in Patent Document 2 (patent application). 2004-325658 (filed on Nov. 9, 2004) and the drawings) was used as a template, and PCR was performed using the 11th primer (SEQ ID NO: 11) and 12th primer (SEQ ID NO: 12).

  The light chain leader sequence was prepared by PCR using pcCKH-1 as a template and the ninth primer (SEQ ID NO: 24) and the tenth primer (SEQ ID NO: 10).

PCR was performed under the following conditions. The composition of the PCR reaction solution was 10 × PCR buffer (manufactured by Toyobo Co., Ltd.) 5 μl; 2 mM dNTP 5 μl; 25 mM MgSO ₄ 3.2 μl (final conc. 1.6 mM); primer (10 μM) 2.5 μl each (final conc. 0) 5 μM); template DNA 1 μl; KOD-plus (Toyobo Co., Ltd.) 1 μl, and finally diluted to 50 μl with distilled water. The reaction was carried out under the conditions of (1) 94 ° C. for 2 minutes; (2) 94 ° C. for 15 seconds; (3) 55 ° C. for 30 seconds; (4) 68 ° C. for 2 minutes; 30 cycles of 2) to (4) were performed.

PCR was performed using the 9th primer (SEQ ID NO: 24) and 12th primer (SEQ ID NO: 12) using the heavy chain variable region gene, heavy chain constant region gene, and heavy chain leader sequence obtained above as templates. The composition of the PCR reaction solution was 10 × PCR buffer (manufactured by Toyobo Co., Ltd.) 5 μl; 2 mM dNTP 5 μl; 25 mM MgSO ₄ 2 μl (final conc. 1 mM); primer (10 μM) 1.5 μl each (final conc. 0.3 μM); Each template DNA was 0.5 μl; KOD-plus (Toyobo Co., Ltd.) 1 μl, and finally made up to 50 μl with distilled water. The reaction was carried out under the conditions of (1) 94 ° C. for 2 minutes; (2) 94 ° C. for 15 seconds; (3) 55 ° C. for 30 seconds; (4) 68 ° C. for 2 minutes; 30 cycles of 2) to (4) were performed.

  The amplified fragment (about 800 bp) obtained by PCR was cleaved with KpnI and HindIII, and inserted into the KpnI-HindIII site of pcCKH-2 to construct pcDHF3-15. The pcDHF3-15 was confirmed not to be mutated by sequencing. PcDHF3-15 has a zeocin resistance gene, a CMV (human cytomegalovirus) promoter, and a BGH (bovine growth hormone) poly A signal.

[Transformation of CHO cells]
About 2 × 10 ⁵ CHO cells (Human Science Promotion Foundation) were transfected with pcCKL-3-15 and pcDHF3-15 (2.5 μg each) using PlyFect Transfection Reagent (Qiagen). . The transfection method was performed according to the operation manual.

48 hours after the start of transfection, the drug-resistant cells were selected using 400 μg / ml Geneticin (Sigma) and 200 μg / ml Zeocine (Invitrogen). Further, the drug-resistant cells were cultured for 3 days under conditions of 5% CO ₂ and 37 ° C. using F12 media (GIBCO BRL) containing 10% fetal bovine serum (FBS). A clone having high specificity for PrP was finally selected from the culture supernatant obtained by the culture by ELISA, which will be described later.

The ELISA method was performed as follows. Each clone was cultured, and the number of cells was adjusted to about 1 × 10 ⁶ / Plate and cultured for 3 days. The culture supernatant was examined for the reactivity to the antigen by ELISA. Antigen recombinant mouse prion protein (prepared by the inventors) was immobilized on an ELISA plate at 4 ° C. overnight. Blocking was performed with PBS containing 25% Block Ace (manufactured by Snow Brand Milk Products) at 37 ° C. for 1 hour. After washing, each cell culture supernatant was added and incubated at 37 ° C. for 1 hour. After further washing, peroxidase-labeled anti-chicken IgG (H + L) (manufactured by Kirekegaard and Perry Laboratories) was added as a secondary antibody and incubated at 37 ° C. for 1 hour. After washing, color was developed using o-phenylenediamine and the absorption at 490 nm was measured. A clone having a high absorbance was selected.

(Example 2: Detection of abnormal PrP with 3-15 bivalent antibody)
〔Method〕
(1. Preparation of sample solution)
As an abnormal PrP sample, a medulla part was collected from a BSE bovine brain (BSE-UK10) imported from the United Kingdom, and this was crushed with glass beads and then treated with proteinase K. A sample solution for SDS-PAGE was added to the abnormal PrP sample to prepare a sample solution. The sample solution was boiled for 6 minutes and subjected to SDS-PAGE with a 12% gel.

More specifically, a sample solution was prepared as follows.
To 50% (w / v) BSE bovine brain emulsion prepared from distilled BSE bovine brain (BSE-UK10) imported from the UK (source: Prion Disease Center, National Institute of Animal Health) TN Buffer (100 mM NaCl, 50 mM Tris-Hcl (pH 7.6)) was added to prepare a 20% (w / v) BSE bovine brain emulsion.

  250 μl of 20% (w / v) normal bovine brain emulsion was added to 250 μl of this 20% (w / v) BSE bovine brain emulsion to prepare 500 μl of a final concentration of 10% (w / v) BSE bovine brain emulsion. The 20% (w / v) normal bovine brain emulsion is a normal bovine (02-B-230, BSE surveillance in Japan) confirmed to be negative using Plateria BSE (Bio-Rad). 800 μl of TN Buffer was added to 200 mg of the brain tissue of (sample), and it was prepared using a multi-bead shocker (4000 rpm, 60 seconds) manufactured by Yasui Instruments Co., Ltd.

  To the 10% (w / v) BSE bovine brain emulsion, 6.25 ml of 40 mg / ml collagenase and 2 ml of 10 mg / ml DNase were added, mixed, and digested at 37 ° C. for 30 minutes.

  Thereafter, 25 μl of 2-Butanol was added to the reaction solution and mixed, 1 ml of 20 mg / ml proteinase K was added and mixed, and digested at 37 ° C. for 30 minutes.

  Further, 2.5 ml of 0.4M Pefabloc (Roche diagnostics) was added to the reaction mixture and mixed to stop the proteinase K reaction.

  250 ml of Butanol-Methanol solution was added to the reaction solution and mixed, followed by centrifugation at 15000 rpm for 10 minutes at 20 ° C. to recover the precipitate.

  After drying the precipitate at room temperature, 100 μl of 1 × SDS-PAGE sample buffer was added and boiled at 100 ° C. for 6 minutes to obtain a sample solution.

(2. Western blotting)
Electrophoresis was performed for 40 minutes at a constant voltage of 200 V using a Western precast gel (NuPAGE 12% Bis-TrisGel, Invitrogen).

  After completion of the electrophoresis, the mixture was transferred to a polyvinyl membrane (Immuno-Blot PVDF membrane (manufactured by Bio-RAD)) at a constant voltage of 90 v for 40 minutes using a wet type blotter. After the transfer, blocking was performed with PBS containing 5% skim milk (Block Ace (manufactured by Snow Brand Milk Products)) and 0.05% Tween20. After washing the membrane, abnormal PrP (BSE-UK10PK) was detected using a 3-15 bivalent antibody as a primary antibody. As a comparison, 3-15 monovalent antibodies, 44B1 (obtained from Dr. Horiuchi, Prionology Course, Graduate School of Veterinary Medicine, Hokkaido University) and T2 (obtained from the Institute of Animal Health) Detected. Each antibody was added onto the polyvinyl membrane so that the amount of antibody per membrane was 20 ng, and reacted at room temperature for 60 minutes.

  In the secondary antibody reaction, HRP anti-chicken IgG (H + L) diluted 3000 times was used when detecting 3-15 bivalent antibody, and HRP anti-mouse IgG (when detecting 44B1 and T2). H + L) diluted 3000 times was used.

  As the 3-15 bivalent antibody, the culture supernatant of transformed CHO cells was used, and the amount of the antibody was measured by ELISA. On the other hand, the 3-15 monovalent antibody was expressed as a soluble form, subjected to affinity purification with a histidine tag, and further subjected to gel filtration purification. The amount of protein was measured and used as the amount of antibody. Color development was detected using Fluor Chem IS-8044 (manufactured by Invitrogen) after emitting light using Super Signal West Dura Extended Duration Substrate (manufactured by PIERCE).

〔result〕
The results are shown in FIG. FIG. 4 (a) shows the result of detection with 44B1, FIG. 4 (b) shows the result of detection with T2, and FIG. 4 (c) shows the result of using a 3-15 bivalent antibody. The detection results are shown, and FIG. 4 (d) shows the detection results using a 3-15 monovalent antibody. Each lane in the figure shows the results of electrophoresis of abnormal PrP (BSE-UK10PK) at concentrations of 5 mg / lane, 2.5 mg / lane, and 1.3 mg / lane from the left.

  From the results of FIGS. 4A to 4D, the 3-15 bivalent antibody recognizes all three types of abnormal PrP (disaccharide chain type, monosaccharide chain type, and sugar-free chain type) due to glycosylation. We were able to. Each band in FIG. 4 shows a disaccharide chain type abnormal PrP, a monosaccharide chain type abnormal PrP, and a sugar-free chain type abnormal PrP from the top.

  In addition, from the results of (a) to (d) in FIG. 4, the 3-15 bivalent antibody has an abnormal PrP binding ability substantially equivalent to the antibody (44B1, T2) currently used in the BSE confirmation test. It was. Furthermore, it was found that the detection background is lower than that of 44B1, and PrP can be detected with higher sensitivity.

  On the other hand, the 3-15 monovalent antibody had a low detection sensitivity for abnormal PrP, whereas the 3-15 bivalent antibody clearly had a high detection sensitivity. Therefore, it was found that the antigen can clearly be detected with high sensitivity by using a monovalent antibody (scFv) obtained by the phage display method as a bivalent antibody using the method of the present invention.

(Example 3: Detection of abnormal PrP with HRP-labeled 3-15 bivalent antibody)
〔Method〕
An HRP-labeled 3-15 bivalent antibody (hereinafter referred to as “HRP-labeled 3-15 bivalent antibody”) and HRP-labeled T2 (hereinafter referred to as “HRP-labeled T2”) were used. The antibody was labeled with HRP using Peroxidase-Labeling-Kit (manufactured by Doujin Chemical Laboratory Co., Ltd.) according to the attached manual. The antibody was diluted 3000 times and used to detect abnormal PrP (BSE-UK10PK). PBS-T (0.2% Tween 20-PBS) was used for antibody dilution.

  Except for the above, this example was performed according to the method of Example 2.

〔result〕
The results are shown in FIG. FIG. 5 (a) shows the detection result of abnormal PrP (BSE-UK10PK) by the direct method using HRP-labeled 3-15 bivalent antibody, and FIG. 5 (b) shows the direct result using HRP-labeled T2. The abnormal PrP (BSE-UK10PK) detection result by the method is shown. In each of the lanes in FIGS. 5A and 5B, the abnormal PrP (BSE-UK10PK) from the left is 2.5 mg / lane, 1.3 mg / lane, 0.6 mg / lane, 0.3 mg / lane, 0 Each result of electrophoresis performed at a concentration of 15 mg / lane is shown.

  From the results shown in FIG. 5, it was found that by using the HRP-labeled 3-15 bivalent antibody, there is little non-specific reaction and abnormal PrP (BSE-UK10PK) can be detected with very high sensitivity. Therefore, it was shown that BSE diagnosis can be performed easily and with high sensitivity by using the HRP-labeled 3-15 divalent antibody.

  According to the method of the present invention, a recombinant chicken bivalent antibody having two antigen-binding sites can be produced from a single chain variable region fragment (scFv) obtained by the phage display method. Therefore, since it is not necessary to obtain a chicken-type antibody gene from a hybridoma that has been time-consuming and time-consuming to produce, a recombinant chicken-type bivalent antibody can be easily produced. In addition, since the antibody obtained by the above method is a bivalent antibody having two antigen-binding sites, it has a high affinity with the antigen, and has an Fc region and a region to which a secondary antibody for detection binds. Since there are many, there exists an effect that an antigen can be detected with high sensitivity.

  The antibody according to the present invention is a recombinant chicken bivalent antibody. Therefore, it is possible to establish a high-sensitivity antigen detection system that has no non-specific reaction. Furthermore, it is possible to provide diagnostic agents and diagnostic methods for various diseases using the highly sensitive antigen detection system.

  For example, if a recombinant chicken bivalent antibody is produced from scFv that binds to a prion protein by the method according to the present invention, a highly sensitive detection system and a highly sensitive detection method for the prion protein can be established. Furthermore, by detecting abnormal prion protein using the high-sensitivity detection system and the high-sensitivity detection method, it is possible to diagnose prion diseases (such as Creutzfeldt-Jakob disease or bovine spongiform encephalopathy) with high sensitivity.

  Therefore, the present invention can be effectively used in a wide range of industries including antibodies, such as the pharmaceutical industry, the test chemical industry, and the food industry. Furthermore, it can be applied to the reagent industry for experiments and research.

Claims (6)

(A) the amino acid sequence shown in SEQ ID NO: 13; or
(B) an amino acid sequence in which one or several amino acids are substituted, deleted, inserted or added in the amino acid sequence shown in SEQ ID NO: 13;
A light chain consisting of, and
(C) the amino acid sequence shown in SEQ ID NO: 14; or
(D) an amino acid sequence in which one or several amino acids are substituted, deleted, inserted or added in the amino acid sequence shown in SEQ ID NO: 14;
An antibody comprising a heavy chain consisting of: and having an activity of binding to a prion protein . A light chain consisting of the amino acid sequence shown in SEQ ID NO: 13, and
An antibody comprising a heavy chain consisting of the amino acid sequence shown in SEQ ID NO: 14 . The antibody according to claim 1 or 2, which is labeled with an enzyme or a radioisotope that can be used as a marker for detection . A detection kit for prion protein comprising the antibody according to any one of claims 1 to 3 . A method for detecting a prion protein, comprising a step of detecting a prion protein using the antibody according to any one of claims 1 to 3 . A diagnostic kit for prion diseases comprising the antibody according to any one of claims 1 to 3 .

Images