WO2015033086A1

WO2015033086A1 - Dna construct

Info

Publication number: WO2015033086A1
Application number: PCT/GB2014/000319
Authority: WO
Inventors: Fay Louise SAUNDERS
Original assignee: Fujifilm Diosynth Biotechnologies Uk Limited
Priority date: 2013-09-04
Filing date: 2014-08-18
Publication date: 2015-03-12
Also published as: GB201315714D0

Abstract

A DNA construct comprising a hamster beta-actin promoter operably linked to a cytomegalovirus enhancer is provided. Preferably the promoter is Chinese hamster beta- actin promoter, and the enhancer is the hCMV Major Intermediate Early enhancer. The DNA constructs can be employed for the production of polypeptides of interest, especially antibodies and antibody fragments.

Description

DNA Construct

The present invention concerns a DNA construct, and especially a vector, for use in the expression of recombinant polypeptides in mammalian cells.

Many polypeptides of potential or actual commercial interest are expressed in mammalian cells. Polynucleotides encoding the polypeptide are expressed under the control of a promoter. Many different promoters are available. In some instances, the promoter is employed in conjunction with an enhancer, which can increase levels of transcription. One example is the so-called CAG promoter, which comprises a cytomegalovirus enhancer and a chicken beta-actin promoter. EP1707629 discloses the use of a cytomegalovirus enhancer in combination with mouse beta-actin.

According to a first aspect of the present invention, there is provided a DNA construct, preferably a vector, comprising a hamster beta-actin promoter operably linked to a cytomegalovirus enhancer.

Hamster beta-actin promoters that can be employed include Syrian (or Golden), Russian Dwarf Campbell, Russian Dwarf Winter White (or Siberian), Roboroviski and preferably Chinese hamster beta-actin promoters. In many embodiments, the hamster beta actin promoter has the nucleotide sequence:

TCTCTC I I I I I I I I I I I I I I I I I I I I I T I I I I I CCAAAAGGAGGGGAGAGGGGGTAAAAA AATGCTGCACTGTGCGGCTAGGCCGGTGAGTGAGCGGCGCGGAGCCAATCAGCGC TCGCCGTTCCGAAAGTTGCCTTTTATGGCTCGAGTGGCCGCTGTGGCGTCCTATAAA ACCCGGCGGCGCAACGCGCAGCCACTGTCGAGTCCGCGTCCACCCGCGAGCACAG GCCTTTCGCAGCTCTTTCTTCGCCGCTCCACACCCGCCACCAGGTAAGCAGGGACA ACAGGCCCAGCCGGCCACAGCCCTCCCGTGGGCAGTGACCGCGCTGCAGGGTCGC GGGGGACACTCGGCGCGGACACCGGGGAAGGCTGGAGGGTGGTGCCGGGCCGCG GAGCGGACACTTTCAGATCCAACTTTCAGTCCAGGGTGTAGACCCTTTACAGCCGCA TTGCCACGGTGTAGACACCGGTGGACCCGCTCTGGCTCAGAGCACGCGGCTTGGG GGAACCCATTAGGGTCGCAGTGTGGGCGCTATGAGAGCCGATGCAGCTTTCGGGTG TTGAACCGTATCTGCCCACCTTGGGGGGAGGACACAAGGTCGGGAGCCAAACGCCA CGATCATGCCTTGGTGGCCCATGGGTCTTTGTCTAAACCGGTTTGCCCATTTGGCTT GCCGGGCGGGCGGGCGCGGCGGGCCCGGCTCGGCCGGGTGGGGGCTGGGTTGC CACTGCGCTTGCGCGCTCTATGGCTGGGTATTGGGGCGCGTGCACGCTGGGGAGG GAGCCCTTCCTCTTCCCCCTCTCCCAAGTTAAACTTGCGCGTGCGTATTGAGACTTG GAGCGCGGCCACCGGGGTTGGGCGAGGGCGGGGCCGTTGTCCGGAAGGGGCGGG GTCGCAGAGGATTCGGGGCGCCTGCTCGCGCTTCCTGCTGGGTGTGGTCGCCTCC CGCGCGCGCACTAGACCGCCCGGCGGGGGGGCGAAGGCGGGTCTTGCGCCCGTT TGGGGAGGGGGCGGAGACCTGGCTTCCTGCCGTGGGGCCGCCTCCGGACCAGCGT TTGCCTCTTATGGTAATAACGCGGCCGGCCTGGGCTTCATTTGTCCCCTGAGTTTGG GCGCGCGCCCCCTGGCGGCCCGAGACCGCGGCTTGCCGGAAGTGGGCAGGGCGG CAACGGCTGCGCCTAGTGGCCCGCCAGTGACCGCGACCCTCTTTTGTGCCCTGATA TAGTTCGCC (SEQ ID NO. 1) wherein the underlined nucleotides represent CCAAT and TATAA box motifs which are binding sites for transcription factors, and the bold nucleotide represent the predicted transcriptional start point.

Cytomegalovirus enhancers which can be employed include human, mouse, rat, Guinea pig cytomegalovirus enhancers, preferably human cytomegalovirus (hCMV) enhancers. Most preferably, the cytomegalovirus enhancer is the enhancer for the Major Immediate Early gene of cytomegalovirus, especially of hCMV. In many embodiments, the enhancer has the nucleotide sequence:

TAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTC GTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGT AACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGC CCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTCCGGCCCCCTATTGACGTCA ATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTC CTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTG GCAGTACACCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCA CCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAA ATGTCGTAATAACCCCGCCCCGTTGAC (SEQ ID NO. 2)

The hamster beta actin promoter and cytomegalovirus enhancer are operable linked such that the strength of the promoter is increased compared with the promoter in the absence of the enhancer, and in many embodiments, the beta actin promoter and the enhancer are contiguous. The enhancer may be located upstream or downstream of the promoter. In certain embodiments, the 5' terminus of the enhancer is directly attached to the 3'-terminus of the promoter. In many preferred embodiments, the 3' terminus of the enhancer is directly attached to the 5'-terminus of the promoter.

The DNA constructs of the present invention preferably comprise a polynucleotide encoding a polypeptide of interest operably linked to the promoter.

In certain embodiments, the DNA constructs of the present invention comprise a polynucleotide encoding a secretion leader operably linked to the promoter and to the polynucleotide encoding the polypeptide of interest. Examples of secretion leaders that can be employed are well known in the art, and include albumin, collagen and IgG secretion leaders. In certain preferred embodiments, the DNA constructs comprises a polynucleotide encoding a fibronectin secretion leader.

Fibronectin secretion leaders that can be employed in the present invention include mammalian and reptilian fibronectin secretion leaders. Examples of reptilian fibronectin secretion leaders include Xenopus laevis fibronectin secretion leaders. Examples of mammalian fibronectin secretion leaders in include human, rat, murine, bovine, porcine, canine, feline and Chinese hamster fibronectin secretion leaders, and functional equivalents thereof, such as human fibronectin sequence leader having the sequence MLRGPGPGLLLLAVQCLGTAVPSTGA (SEQ ID NO. 3). In certain embodiments, the Chinese hamster fibronectin secretion leader having the amino acid sequence MLRGPGPGLLLAVLCLGTAVRCTEA (SEQ ID NO. 4) and functional equivalents thereof is preferred.

A functionally equivalent signal peptide is one that shares 70% or greater identity with an amino acid sequence, preferably 75% or greater identity, more preferably 80% or greater identity and most preferably 90% or greater identity, such as 95% identity or more, and which retains the ability to secrete the recombinant polypeptide.

In many embodiments, secretion leader, polynucleotide and polypeptide of interest sequences which are operably linked are contiguous and in the same reading frame.

Preferably, the linkage between the fibronectin secretion leader sequence and the polynucleotide encoding the target polypeptide is such that the signal peptide sequence is attached to the N-terminal of the recombinant polypeptide. In certain embodiments, the recombinant polypeptide comprises an N-terminal tag, the linkage between the secretion leader sequence and the polynucleotide encoding the recombinant polypeptide being such that the signal peptide sequence being attached to the tag, preferably to the N- terminus of the tag.

The polynucleotide encoding the fibronectin secretion leader sequence is preferably attached at the 5' end of the polynucleotide encoding the target polypeptide and preferably has the sequence ATGCTCAGGGGTCCGGGACCCGGGCTGCTGCT GGCCGTCCTGTGCCTGGGGACAGCGGTGCGCTGTACCGAAGCC (SEQ ID NO. 5).

In certain highly preferred embodiments of the present invention, the fibronectin secretion leader is selected to correspond to the host cell employed for expression of the polypeptide of interest. For example, human fibronectin is employed in human-derived cells, rat fibronectin is employed in rat cells, and particularly Chinese hamster fibronectin is employed in Chinese hamster ovary cells.

The DNA construct may be integrated into the host cell genome or comprised within an extrachromosomal element such as a plasmid.

The DNA constructs typically also comprise a selectable marker appropriate to the host cell in which the polypeptide of interest is to be expressed. Selectable markers for mammalian cells, and especially for Chinese hamster ovary cells include glutamine synthetase and dihydrofolate reductase marker systems, especially a dihydrofolate reductase marker system comprising a dihydrofolate reductase expression cassette further comprising a murine phosphoglycerate kinase promoter. .

The DNA constructs employed preferably comprise features conventional in the art appropriate for expression of the polypeptide of interest in the appropriate host cell. For example, mammalian expression vectors typically comprise a polyadenylation sequence, such as human betaglobin polyA sequence, bovine growth hormone polyA sequence and SV40 early or late poly A sequences.

The DNA constructs of the present invention can be employed to express polypeptides, especially recombinant polypeptides, especially proteins in host cells.

Preferred host cells are mammalian cells, such as baby hamster kidney cells, human embryonic kidney cell lines, for example HEK 293 cells, human retina-derived cell lines, for example PER.C6 cells, and murine lymphoid cell lines, for example NSO and SP2 cells, and most preferably Chinese hamster ovary cells, and in particular CHO K1 , DG44, DUXKB1 1 and CHO pro3- cells.

The DNA constructs of the present invention are commonly employed in the form of a plasmid. The plasmids may be autonomously replicating plasmids or integrative plasmids.

Polypeptides which can be expressed by the process of the present invention include therapeutic proteins and peptides, including cytokines, growth factors, antibodies, antibody fragments, immunoglobulin like polypeptides, enzyme, vaccines, peptide hormones, chemokines, receptors, receptor fragments, kinases, phosphatases, isomerases, hydrolyases, transcription factors and fusion polypeptides.

Antibodies which can be expressed include monoclonal antibodies, polyclonal antibodies and antibody fragments having biological activity, including multivalent and/or multispecific forms of any of the foregoing.

Naturally occurring antibodies typically comprise four polypeptide chains, two identical heavy (H) chains and two identical light (L) chains inter-connected by disulfide bonds. Each heavy chain comprises a variable region (V_H) and a constant region (C_H), the C_H region comprising in its native form three domains, C_H1 , C_H2 and C_H3. Each light chain comprises a variable region (V_L) and a constant region comprising one domain, C_L.

The V_H and V_L regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR). Each V_H and V_L is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1 , CDR , FR2, CDR2, FR3, CDR3, FR4.

Antibody fragments which can be expressed comprise a portion of an intact antibody, said portion having a desired biological activity. Antibody fragments generally include at least one antigen binding site. Examples of antibody fragments include: (i) Fab fragments having V_L, C_L, V_H and C_H1 domains; (ii) Fab derivatives, such as a Fab' fragment having one or more cysteine residues at the C-terminus of the C_H1 domain, that can form bivalent fragments by disulfide bridging between two Fab derivatives; (iii) Fd fragment having V_H and C_H1 domains; (iv) Fd derivatives, such as Fd derivatives having one or more cysteine residues at the C-terminus of the C_H1 domain; (v) Fv fragments having the V_u and V_H domains of a single arm of an antibody; (vi) single chain antibody molecules such as single chain Fv (scFv) antibodies in which the V_L and V_H domains are covalently linked; (vii) V_H or V_L domain polypeptide without constant region domains linked to another variable domain (a V_H or V_L domain polypeptide) that is with or without constant region domains, (e.g., V_H-V_H, V_H-V_L, or V_L-V_L) (viii) domain antibody fragments, such as fragments consisting of a V_H domain, or a V_L domain, and antigen-binding fragments of either V_H or V_L domains, such as isolated CDR regions; (ix) so-called "diabodies" comprising two antigen binding sites, for example a heavy chain variable domain (V_H) connected to a light chain variable domain (V_L), in the same polypeptide chain; and (x) so- called linear antibodies comprising a pair of tandem Fd segments which, together with complementary light chain polypeptides, form a pair of antigen binding regions.

Preferred antibody fragments that can be prepared are mammalian single variable domain antibodies, being an antibody fragment comprising a folded polypeptide domain which comprises sequences characteristic of immunoglobulin variable domains and which specifically binds an antigen (i.e., dissociation constant of 500 nM or less, such as 400 nM or less, preferably 250 nM or less, and most preferably 100 nM or less), and which binds antigen as a single variable domain; that is, without any complementary variable domain. Single variable domain antibodies include complete antibody variable domains as well as modified variable domains, for example in which one or more loops have been replaced by sequences which are not characteristic of antibody variable domains or antibody variable domains which have been truncated or comprise N- or C-terminal extensions, as well as folded fragments of variable domains. Preferred single variable domains which can be prepared are selected from the group of V_H and V_L, including V_kappa and Via_mbda- Most preferably the single variable domains are human or camelid domains, including humanised camelid domains.

Where the target polypeptide comprises two or more chains, particularly where the target polypeptide is an antibody or a fragment antibody comprising two or more chains, a polynucleotide encoding at least one of the chains, especially the light chain of an antibody or antibody fragment, is operably linked to a DNA construct of the present invention. In certain embodiments, polynucleotides encoding each of the chains is operably linked to a DNA construct of the present invention. In other embodiments, where the target polypeptide is an antibody or a fragment antibody comprising two or more chains, polynucleotides encoding for the light chain(s) are operably linked to a DNA construct of the present invention, and polynucleotides encoding for the remaining chains, especially heavy chains, are operably linked to a DNA construct not according to the present invention, particularly a construct comprising the promoter and enhancer regions of an hCMV-Major Immediate Early promoter or a housekeeping gene promoter, especially an hEF1a promoter. The polynucleotides encoding the two or more chains may be comprised within the same expression cassette, but are preferably comprised in different expression cassettes. Where different expression cassettes are employed, the promoters and enhancers may be the same or different. The expression cassettes may be located on different vectors, but are preferably on the same vector. Most preferably, expression cassette for the target polypeptide comprises a bovine growth hormone polyA sequence.

When the DNA constructs of the present invention are employed to express polypeptides, expression methods known in the art are employed. Preferred expression methods include culturing host cells in growth medium, and then recovering the expressed polypeptide. The term "growth medium" refers to a nutrient medium used for growing the host cells. In many embodiments, a nutrient solution is employed. Suitable growth media for given host cells and methods of recovering polypeptides are well known in the art.

In many embodiments, the polypeptide recovery comprises one or more of filtration, centrifugation, diafiltration, ion-exchange chromatography, affinity

chromatography, such as Protein A affinity chromatography, Hydrophobic Interaction Chromatography (HIC), Gel Filtration and HPLC.

Host cells transfected with, and process for the preparation of polypeptides using, DNA constructs according to the first aspect of the invention form further aspects of the present invention.

The present invention is illustrated without limitation by the following example.

Example

Vector construction

Double gene vectors were constructed which either contained a hCMV-MIE promoter, comprising both promoter and enhancer regions of hCMV-MIE (Genbank Accession number M60321) driving expression of both the hy1 FL heavy chain of an anti-MUC-1 MAb and the human lambda light chain of an anti-MUC-1 MAb (Vector A) or the same hCMV-MIE promoter driving expression of the hy1 FL heavy chain (HC) of an anti-MUC-1 MAb and a hybrid promoter comprising the enhancer region from the hCMV-MIE promoter of SEQ ID NO. 2 coupled at its 3'-end to the 5' end of a CHO Actin promoter of SEQ ID NO. 1 driving expression of the human lambda light chain (LC) of an anti-MUC-1 MAb (Vector B). Each expression cassette within the double gene vector consisted of the promoter functionally linked to a polynucleotide sequence of SEQ ID No. 5 encoding the CHO fibronectin signal peptide which was linked in frame to a polynucleotide sequence encoding the HC or LC mature polypeptide. Correct mRNA processing was ensured by the presence of a bovine growth hormone poly A sequence.

To allow selection of stable cell lines the vectors also contained a copy of the mouse dyhydrofolate reductase (dhfr) gene under control of the murine phosphoglycerate (mPGK) promoter and the hygromycin resistance gene under the control of the thymidine kinase (TK) promoter. Routine subculture of CHO DG44 cells:

CHO DG44 cells were routinely cultured in suspension shaker flasks in OptiCHO medium (Life Technologies) supplemented with 8 mM L-glutamine (Life Technologies). Cells were seeded at a concentration of 2 x 10⁵ cells/ml, and cells were split every 3 days. Flasks were cultured at 37°C, 7.5% C0₂ in a orbital shaking incubator at 140 rpm.

Transfections for generation of stable cell lines

Cells used for transfections were grown in cell suspension culture, as detailed above. Cells from growing cultures were centrifuged and re-suspended to a concentration of 2x10⁷ cells/mL. A 0.1 mL volume of the cell suspension and 4 ig of linearised plasmid DNA were added to an electroporation cuvette. The cuvette was then placed in the Amaxa nucleofector (Lonza) and nucleofected. Following transfection, the cells were added to 20ml pre-warmed OptiCHO medium supplemented with 8mM Glutamine in a T75 flask. Transfected cells were incubated at 37°C, 7.5% C0₂. Following the removal of hypoxanthine and thymidine (HT) (48hrs post transfection) from the medium and addition of 75Mg/ml Hygromycin B (Invitrogen) (144hrs post transfection) cells were plated out into 96 well plates at 5000 cells/well (2.5 x 10⁴/mL). The plates were incubated at 37°C in an atmosphere of 7.5% C0₂ in air. The plates were monitored for colony growth up to approximately three weeks after transfection. Supernatant from 80 wells containing cell growth were harvested and analysed for the Antibody using an Octet (Forte Bio) protein A assay. The results are given in Table 1 below.

Table 1

The results show that cells transfected with a DNA construct according to the present invention produced significantly higher maximum expression level and mean expression levels that DNA constructs based solely on the well-known hCMV MIE promoter.

Claims

A DNA construct, preferably a vector, comprising a hamster beta-actin promoter operably linked to a cytomegalovirus enhancer.

A DNA construct according to claim 1 , wherein the hamster beta-actin promoter is a Chinese hamster beta-actin promoter.

A DNA construct according to claim 2, wherein the Chinese hamster beta-actin promoter has the sequence of SEQ ID NO. 1.

A DNA construct according to any preceding claim, wherein the cytomegalovirus enhancer is an hCMV Major Immediate Early gene enhancer.

A DNA construct according to claim 4, wherein the hCMV Major Immediate Early gene enhancer has the sequence of SEQ ID No. 2.

A DNA construct according to any preceding claim comprising an expression cassette for a polypeptide of interest operably linked to the promoter.

A DNA construct according to claim 6, wherein the polypeptide of interest comprises an antibody comprising a heavy chain and a light chain.

A DNA construct according to claim 7, wherein a light chain is operably linked to a hamster beta-actin promoter operably linked to a cytomegalovirus enhancer, and a heavy chain is operably linked to an hCMV promoter operably linked to an hCMV Major Immediate Early gene enhancer.

A host cell transfected with a DNA construct according to any preceding claim.

A process for the preparation of a polypeptide of interest, which comprises culturing a host cell transfected with a DNA construct according to any one of claims 6 to 8.

A process according to claim 10, which further comprises the step of recovering and optionally purifying the polypeptide of interest.

A process according to either of claims 10 and 1 1 , wherein the host cell is a CHO cell.