CN114014927A

CN114014927A - Preparation and application of heavy chain high-affinity antibody for resisting chicken infectious bursal disease virus

Info

Publication number: CN114014927A
Application number: CN202111522398.1A
Authority: CN
Inventors: 任桂萍; 郭笑辰; 孙文影
Original assignee: Northeast Agricultural University
Current assignee: Northeast Agricultural University
Priority date: 2021-12-13
Filing date: 2021-12-13
Publication date: 2022-02-08
Anticipated expiration: 2041-12-13
Also published as: CN114014927B

Abstract

The invention discloses preparation and application of a heavy chain high-affinity antibody for resisting chicken infectious bursal disease virus. The invention provides a heavy chain high-affinity antibody gene for resisting infectious bursal disease virus, a eukaryotic expression vector carrying the heavy chain high-affinity antibody gene for resisting the infectious bursal disease virus is transfected into a CHO-K1 cell, the cell highly expressing the heavy chain high-affinity antibody for resisting the infectious bursal disease virus is obtained by multiple screening with a flow cytometer, and the high-affinity heavy chain antibody for resisting the infectious bursal disease virus is prepared. The recombinant protein expressed by the CHO cell strain containing the heavy chain high affinity antibody gene of the anti-chicken infectious bursal disease virus can prevent and treat the chicken infectious bursal disease, provides a candidate drug for preventing and treating the chicken infectious bursal disease, and opens up a new situation on the prevention and treatment history of the chicken infectious bursal disease.

Description

Preparation and application of heavy chain high-affinity antibody for resisting chicken infectious bursal disease virus

Technical Field

The invention relates to preparation and application of a heavy chain high-affinity antibody for resisting chicken infectious bursal disease virus, belonging to the technical field of biology.

Background

Infectious Bursal Disease (IBD) is an acute, highly contagious Infectious Disease caused by IBDV. IBDV mainly attacks chicks and young chickens of 3-12 weeks old and damages the central immune organ of the chickens, namely bursa of fabricius, and has the characteristics of high propagation speed, strong infectivity, high infection rate and death rate. The disease is distributed in the world at present, is one of the most important diseases in the poultry industry, and has huge economic loss caused by immune failure.

Currently, the primary method of preventing IBD is vaccination. However, the commonly used vaccine for preventing IBD is a moderate virulence vaccine, which causes different degrees of damage to the chicken bursa of fabricius, resulting in immunosuppression, thereby enhancing the body's susceptibility to other pathogens and reducing the reactivity to other vaccines. Many chicken farms, especially small chicken farms, select egg yolk antibodies for the prevention and treatment of IBD, but egg yolk antibodies are receiving increasing attention in addition to the problems of poor product quality control and their horizontal and vertical spread of disease. In the work for the prevention of IBD, there is an urgent need for a naturally animal heavy chain high affinity antibody that can prevent and treat IBD. With the development of genetic engineering technology, the genetic engineering antibody technology is brought forward. At present, the animal heavy chain antibody product is still blank in the field of veterinary medicine, and the invention aims to develop the chicken source recombinant heavy chain high-affinity antibody for preventing and treating IBD.

The heavy chain full-length antibody contains complete constant region regions, and can be endowed with high affinity and antigen specific binding capacity through strict processing modification of a cell apparatus in the biological expression process, so the requirements on the quality and quantity of the production are more strict, and the selection of an expression system is also important. Prokaryotes do not contain numerous organelles modified by protein processing, and therefore, the E.coli expression system can only be used for producing antibody fragments such as Fab, Fab', scFv and the like which have small volume, simple structure and do not need glycosylation; lower eukaryote expression systems, such as yeast and filamentous fungi, can be used for full-length antibody production, but their glycosylation patterns are different from those of mammals, such as yeast glycosylation pattern is a polymaltose pattern, which has a short half-life, limited physiological activity and even toxicity to human body. The closest to human in protein modification systems is a mammalian expression system, which can perform appropriate folding, assembly and post-translational modification on proteins and is dominant in clinical application, and at present, Chinese hamster ovary cells (CHO cells) are the most ideal eukaryotic expression host, and the proteins expressed by the system are closer to natural proteins in configuration and conformation, and are the first choice system for recombinant glycosylated protein production.

At present, many of antibody drugs approved by FDA are produced by CHO cells, and the CHO-K1 cells are Glutamine Synthetase (GS) deficient cells capable of suspension growth, so that transfected CHO cells can be screened by using co-amplification genes, namely, GS genes are added at the upstream of an expression vector as a screening marker, and GS suppressor Methionine Sulfoxide (MSX) is used for pressurized screening, and along with the gradual increase of the concentration of MSX in a culture medium, the GS genes drive exogenous genes connected in series with the GS genes to be co-transcribed, so that the transcription efficiency of target genes is increased, and the high-efficiency expression of the exogenous genes is realized. Because the GS screening marker cannot visually monitor and sort positive cells, the Enhanced Green Fluorescent Protein (EGFP) gene is introduced to the vector, and the EGFP is a GFP mutant and has higher fluorescence intensity, and can generate green fluorescence under the excitation of light with wavelength of 488nm, so that the detection and sorting are performed by a flow cytometer.

The invention constructs the heavy chain variable region in the selected animal source scFv antibody with high affinity and neutralization activity in the laboratory into a heavy chain full-length antibody, transfects CHO cells, and selects the cell strain of the chicken source recombinant heavy chain high affinity antibody capable of stably expressing the anti-IBDV. The research obtains the recombinant antibody with high affinity of the animal-derived heavy chain of the anti-chicken infectious bursal disease virus, and animal experiments show that the heavy chain antibody has the effect of preventing and treating the chicken infectious bursal disease. The invention establishes a platform for developing the animal source heavy chain therapeutic antibody in the field of veterinarians and lays a foundation for promoting the industrialization of the animal therapeutic antibody.

Disclosure of Invention

The invention aims to provide preparation and application of a heavy chain high-affinity antibody for resisting infectious bursal disease virus.

The invention provides a heavy chain high-affinity antibody gene for resisting chicken infectious bursal disease virus.

The invention provides a heavy chain high-affinity full-length antibody plasmid of a eukaryotic expression vector.

The invention provides a CHO-K1 monoclonal cell strain capable of stably and efficiently expressing a heavy chain high-affinity antibody of an anti-chicken infectious bursal disease virus, which is obtained by transfecting a peedeal-H-IRES-EGFP-H plasmid without endotoxin into a CHO-K1 cell strain, pressurizing by methionine sulfoxide, screening for multiple times by a flow cytometer and sorting by the flow cytometer. The obtained heavy chain high affinity antibody for resisting the chicken infectious bursal disease virus can neutralize IBDV, and achieves the effect of preventing and treating IBD.

Drawings

FIG. 1 shows transfected CHO-K1 cells

FIG. 2 is a screen of CHO-K1 positive cells after transfection

FIG. 3 shows CHO-K1 cells after triple screening

FIG. 4 shows the monoclonal cell positive rate detection

FIG. 5 is an ELISA assay for H antibody

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged. CHO-K1 cells were purchased from cell companies. Fetal bovine serum, IMDM medium, DMEM medium, serum-free MEM medium, OptiCHO serum-free medium: gibco Corp. L-Glutamine, methionine sulfoxide Sigma.

Example 1 construction of the heavy chain full-Length recombinant eukaryotic expression vector peedeal-H-IRES-EGFP-H

1.1 construction of Pee12.4-H-IRES-EGFP recombinant vector

1. PCR amplifying VH gene segment by using primers F1 and R1 and scFv plasmid with neutralization activity preserved in laboratory as template; the CH gene fragment was PCR amplified using primers F2 and R2, using the immunized chicken bursa of Fabricius cDNA as template.

F1:5'CGCGGATCCACTGGTGCCGTGACGTTGGACGAG 3'

R1:5'CTAGCTAGCGGAGGAGACGATGACTTCGGTCC 3'

F2:5'CTAGCTAGCGCGAGCCCCACATCGCCCCCCCGAT 3'

R2:5'CCGGAATTCATTATTTACCAGCCTGTTTCTGCAGCGTG 3'

2. The VH fragment and the Pkappa vector were digested simultaneously with BamHI and NheI, and the resultant digested products were subjected to 1% agarose gel electrophoresis to recover the VH fragment and the large fragment of the Pkappa vector.

3. And connecting the VH segment after gel recovery with a Pkappa vector with the same enzyme cutting site to construct a recombinant vector Pkappa-VH.

4. The recombinant plasmid Pkappa-VH was digested simultaneously with HindIII and NheI, the CH fragment was digested simultaneously with NheI and EcoRI, the plasmid containing IRES-EGFP was digested simultaneously with EcoRI, the Pee12.4 vector was digested simultaneously with HindIII and EcoRI, and the above digested product was electrophoresed through 1% agarose gel to recover the desired VH fragment containing kappa leader, the CH fragment, the IRES-EGFP fragment and the Pee12.4 vector, and the large fragment was recovered as a vector fragment. The VH segment, the CH segment and the IRES-EGFP segment containing the kappa leader are connected with the large segment of the Pee12.4 vector to construct a recombinant vector Pee12.4-VH-CH-IRES-EGFP, which is named as Pee12.4-H-IRES-EGFP.

1.2 construction of Pee6.4-VH-CH recombinant vector

1. The recombinant vector Pkappa-VH obtained in 1.1 was digested simultaneously with HindIII and NheI and the CH fragment obtained in 1.1 was digested simultaneously with NheI and EcoRI, the Pee6.4 vector was digested simultaneously with HindIII and EcoRI, and the resultant digested simultaneously was subjected to electrophoresis on 1% agarose gel to recover the desired fragment of VH containing kappa leader, the CH fragment and the Pee6.4 vector as vector fragments. The VH segment and CH segment containing kappa leader were ligated to the large fragment of the Pee6.4 vector to construct a recombinant vector Pee6.4-VH-CH, which was named Pee6.4-H.

1.3 construction of recombinant plasmid peedeal-H-IRES-EGFP-H

The Pee12.4-H-IRES-EGFP obtained in 1.1 and the Pee6.4-H obtained in 1.2 are simultaneously digested by NotI and SalI, the large fragments are recovered, and the two recovered large fragments are connected to construct a recombinant plasmid peedeual-H-IRES-EGFP-H.

Example 2 CHO-K1 cell line for obtaining anti-IBDV heavy chain recombinant full-length antibody

CHO-K1 cells are a Glutamine Synthetase (GS) -deficient Chinese hamster ovary cell line, a CHO-K1 cell line is recovered from a cell bank, passaged twice in a DMEM medium containing 10% fetal bovine serum and glutamine, when the cells are in a logarithmic growth phase, inoculated into a cell culture flask at a cell density of 1 x 10^6cells/mL, cultured in a 37 ℃ and 5% CO2 incubator until the confluence is 70-80%, digested with trypsin, digested with serum, stopped at 1000rpm for 5min, washed once with PBS after centrifugation, and the cells are diluted and counted in a serum-free MEM medium (serum-free medium for MEM transfection of GIBCO) so that the concentration of the cells reaches 1 x 10^7 cells/mL. 5 μ g of purified endotoxin-free peedal-H-IRES-EGFP-H plasmid DNA was taken and transferred to CHO-K1 by Lipofectamine 3000 kit. And transferring the transfected cells into a complete culture medium containing 10% fetal calf serum for recovery culture. After 24-30h of transfection, 10% fetal bovine serum IMDM medium containing 50. mu.M GS suppressor Methionine Sulfoxide (MSX) without glutamine was replaced and pressure-cultured. The morphology of the transfected cells is shown in FIG. 1, and the transfected cells are designated as H cells.

Example 3 screening of CHO-K1 cell line stably and efficiently expressing anti-IBDV heavy chain full-length recombinant antibody

According to the invention, an Enhanced Green Fluorescent Protein (EGFP) gene is introduced into the Pee12.4 vector, green fluorescence can be generated under the excitation of light with wavelength of 488nm, and detection and sorting can be carried out by a flow cytometer. After transfection, 10% fetal bovine serum IMDM medium containing 50 μ M MSX without glutamine was used for pressure culture to eliminate untransferred and transiently transfected CHO-K1 cells, and flow cytometry sterile sorting was performed after the stably transfected clones grew into cell culture flasks.

The sorting steps are as follows: cells were trypsinized, the digestion was stopped by adding serum, 1000rpm, 5min, centrifuged, and the cells were washed twice with PBS, 500. mu.L PBS resuspended cells, and untransfected blank cells were treated as control. The cells with high positive rate identified by the flow cytometer are sorted into a six-hole plate containing a 10% fetal bovine serum IMDM culture medium containing 50 mu M MSX and no glutamine, cultured and observed in a 5% CO2 incubator at 37 ℃, and subjected to the next round of screening after the cells grow to about 5-10 multiplied by 10^6 cells.

After three rounds of screening are completed, mixed clone groups with the positive rate of more than 90% are obtained, and then the cells are subjected to enlarged culture and frozen storage, and a seed cell bank is established. The results of flow cytometry for testing the anti-IBDV CHO-K1 cell line are shown in FIG. 2, and the cell morphology under a fluorescence microscope after three-screening is shown in FIG. 3.

Example 4 CHO-K1 monoclonal cell line for obtaining a stable and highly expressed anti-IBDV heavy chain high-affinity full-length recombinant antibody

And (3) screening stable and high-efficiency expressed monoclonal cell strains from the mixed clone groups obtained by the three-screening by using a 96-well plate monoclonal screening method.

The monoclonal sorting method was as follows: add 200. mu.L of pre-preheated at 37 ℃ sterile 10% fetal bovine serum IMDM medium containing 50. mu.M MSX and no glutamine into each well of 96-well plate. The cell processing step is as the sorting step of example 3, after the screening is completed, the 96-well plate is placed in a constant temperature incubator at 37 ℃ and 5% CO2 for culture, after 1-2 weeks, the growth condition of the cells is observed by using a fluorescence microscope, the culture medium is replaced, when the proliferation of the monoclonal cells reaches more than 1000 cells, the cells are transferred to a 24-well culture plate, the cells are sequentially expanded and cultured according to the increase of the proliferation number of the cells, and the fluorescence intensity of each monoclonal cell strain is detected by using a flow cytometer under the condition of 488nm excitation light. The results of the flow cytometry screening of the anti-IBDV monoclonal cell line are shown in FIG. 4. And (3) culturing the obtained anti-IBDV monoclonal cell strain to be full, then replacing a serum-free culture medium to culture the cell for 4-5 days, collecting cell supernatant, and detecting the affinity of the heavy chain full-length recombinant antibody (H antibody) of the anti-IBDV by using an ELISA method. The ELISA detection method is as follows, the result is shown in figure 5, and the ELISA result shows that the heavy chain full-length recombinant antibodies of the anti-IBDV can be specifically combined with the VP2 protein, the combining ability of different monoclonal cell strains is different, and the combining ability of the H3 monoclonal cell strain is the highest, so the H3 cell strain is selected as the anti-IBDV expression cell strain, and the cell is amplified, cultured and frozen. And establishing a seed cell bank.

ELISA method for detecting the affinity of the heavy chain full-length recombinant antibody (H antibody) of anti-IBDV:

IBDV VP2 antigen protein was diluted to 20. mu.g/mL with the coating solution and coated on an ELISA plate overnight at 4 ℃. The collected cell supernatants were added separately, without antibody as negative control, and 3 replicate wells were set for each sample. Adding goat anti-chicken antibody marked by HRP as a second antibody, and detecting the A value at the wavelength of 450nm by using a microplate reader.

Example 5 neutralizing Activity of anti-IBDV heavy chain high affinity full-length recombinant antibodies

DF1 cells in logarithmic growth phase were seeded in 96-well cell culture plates, and the heavy chain full-length antibody solution of H3 (i.e., the heavy chain antibody solution prepared in example 4) and 100TCID, which were diluted with a gradient of DMEM medium, were mixed₅₀The IBDV virus solution (strain B87) was mixed in equal volume and incubated at 37 ℃ for 1h, then inoculated into a monolayer of cells, 8 wells per gradient; setting a normal control without adding the antibody solution and without adding the virus solution, and setting a virus control without adding the antibody solution and only adding the virus solution. And (3) putting the cell culture plate into a fine incubator, culturing at 37 ℃ and 5% CO2 for 5-7 days continuously, and recording the growth state of the cells every day. The results are shown in Table 1.

TABLE 1 results of determination of neutralizing Activity of anti-IBDV heavy chain high affinity full-length recombinant antibodies

The results showed that the H3 antibody has neutralizing activity against anti-IBDV with a minimum protein concentration of 0.12. mu.g/ml to block or inhibit CPE.

Example 6: toxic substance counteracting treatment test

The 28-day-old SPF chickens were randomly divided into 4 groups of 10 chickens. In addition to the saline group, 3 groups of chickens received IBDV BC6/85 strain 0.2mL (100 BID) orally per chicken₅₀). And (3) treating the H3 heavy chain antibody group and the yolk antibody group for three times 6H, 24H and 48H after challenge, injecting 1mL of antibody with the concentration of 1mg/mL each time, not treating the normal group and the challenge group, observing and recording the morbidity of SPF chickens in each group day by day, completely killing the SPF chickens 96H after challenge, and counting the number of bursal disease of the chickens in each group. The results are shown in Table 2.

TABLE 2 challenge test

The results indicate that the H3 heavy chain antibody can treat IBD.

Example 7: challenge prevention test

SPF-chickens 25 days old were randomly divided into 4 groups of 10 chickens each. In addition to the saline solution group and the challenge group, 1mL of H3 heavy chain antibody and yolk antibody with a concentration of 1mg/mL were injected into each chicken in the other 2 groups. When the virus is attacked at 28 days old, 0.2mL (100 BID) of IBDV BC6/85 strain is orally taken₅₀). And observing and recording the morbidity of SPF chickens in each group day by day, completely killing the SPF chickens 96 hours after virus attack, and counting the number of bursal disease of the chickens in each group. The results are shown in Table 3.

TABLE 3 challenge prevention test

The results indicate that the H3 heavy chain antibody can prevent IBD.

Sequence listing

<110> northeast university of agriculture

<120> preparation and application of heavy chain high affinity antibody for resisting chicken infectious bursal disease virus

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 549

<212> PRT

<213> Chicken (Gallus Gallus)

<400> 1

Ala Val Thr Leu Asp Glu Ser Gly Gly Gly Leu Gln Thr Pro Gly Gly

1 5 10 15

Ala Leu Ser Leu Val Cys Lys Ala Ser Gly Phe Thr Phe Ser Ser Tyr

20 25 30

Ala Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Leu

35 40 45

Ala Gly Ile Ser Ser Ser Gly Arg Tyr Thr Tyr Tyr Gly Ala Ala Val

50 55 60

Lys Gly Arg Ala Thr Ile Ser Arg Asp Asn Gly Gln Ser Thr Val Arg

65 70 75 80

Leu Gln Leu Asn Asn Leu Arg Ala Glu Asp Thr Gly Thr Tyr Tyr Cys

85 90 95

Ala Lys Asp Ser Trp Ser Leu Asn Val Gly Ser Ile Asp Ala Trp Gly

100 105 110

His Gly Thr Glu Val Ile Val Ser Ser Ala Ser Ala Ser Pro Thr Ser

115 120 125

Pro Pro Arg Leu Tyr Pro Leu Ser Ala Cys Cys Ser Asp Ser Ala Val

130 135 140

Pro Pro Ala Val Gly Cys Leu Leu Ser Pro Ser Ser Ala Gly Gly Ile

145 150 155 160

Ser Trp Glu Gly Ser Gly Gly Thr Ala Val Ala Gly Arg Val Ser Gly

165 170 175

Thr Pro Val Lys Leu Ser Phe Val Arg Leu Ser Pro Gly Glu Lys Arg

180 185 190

Lys Ser Phe Val Cys Ser Ala Ala Pro Gly Gly Ala Leu Leu Lys Lys

195 200 205

Glu Val Gln Val Cys Arg Val Asp Pro Val Pro Pro Val Ala Pro Glu

210 215 220

Val Gln Val Leu His Ala Ser Ser Cys Thr Pro Ser Gln Ser Glu Ser

225 230 235 240

Val Glu Leu Leu Cys Leu Val Thr Gly Phe Ser Pro Ala Ser Ala Glu

245 250 255

Val Glu Trp Leu Val Asp Gly Val Gly Gly Leu Leu Val Ala Ser Gln

260 265 270

Ser Pro Ala Val Arg Ser Gly Ser Thr Tyr Ser Leu Ser Ser Arg Val

275 280 285

Asn Val Ser Gly Thr Asp Trp Arg Glu Gly Lys Ser Tyr Ser Cys Arg

290 295 300

Val Arg His Pro Ala Thr Asn Thr Val Val Glu Asp His Val Lys Gly

305 310 315 320

Cys Pro Asp Gly Ala Gln Ser Cys Ser Pro Ile Gln Leu Tyr Ala Ile

325 330 335

Pro Pro Ser Pro Gly Glu Leu Tyr Ile Ser Leu Asp Ala Lys Leu Arg

340 345 350

Cys Leu Val Val Asn Leu Pro Ser Asp Ser Ser Leu Ser Val Thr Trp

355 360 365

Thr Arg Glu Lys Ser Gly Asn Leu Arg Pro Asp Pro Met Val Leu Gln

370 375 380

Glu His Phe Asn Gly Thr Tyr Ser Ala Ser Ser Ala Val Pro Ala Ser

385 390 395 400

Thr Gln Asp Trp Leu Ser Gly Glu Arg Phe Thr Cys Thr Val Gln His

405 410 415

Glu Glu Leu Pro Leu Pro Leu Ser Lys Ser Val Tyr Arg Asn Thr Gly

420 425 430

Pro Thr Thr Pro Pro Leu Ile Tyr Pro Phe Ala Pro His Pro Glu Glu

435 440 445

Leu Ser Leu Ser Arg Val Thr Leu Ser Cys Leu Val Arg Gly Phe Arg

450 455 460

Pro Arg Asp Ile Glu Ile Arg Trp Leu Arg Asp His Arg Ala Val Pro

465 470 475 480

Ala Thr Glu Phe Val Thr Thr Ala Val Leu Pro Glu Glu Arg Thr Ala

485 490 495

Asn Gly Ala Gly Gly Asp Gly Asp Thr Phe Phe Val Tyr Ser Lys Met

500 505 510

Ser Val Glu Thr Ala Lys Trp Asn Gly Gly Thr Val Phe Ala Cys Met

515 520 525

Ala Val His Glu Ala Leu Pro Met Arg Phe Ser Gln Arg Thr Leu Gln

530 535 540

Lys Gln Ala Gly Lys

545

<210> 2

<211> 1650

<212> DNA

<213> Chicken (Gallus Gallus)

<400> 2

gccgtgacgt tggacgagtc cgggggcggc ctccagacgc ccggaggagc gctcagcctc 60

gtctgcaagg cctccgggtt caccttcagc agttatgcca tgggttgggt gcgacaggcg 120

cccggcaaag ggctggagtg gcttgcaggt attagcagca gtggtagata cacatactac 180

ggggcggcgg tgaagggccg tgccaccatc tcgagggaca acgggcagag cacagtgagg 240

ctgcagctga acaacctcag ggctgaggac accggcacct actactgcgc caaagattct 300

tggagtctta atgttggtag tatcgacgca tggggccacg ggaccgaagt catcgtctcc 360

tccgctagcg cgagccccac atcgcccccc cgattgtacc ctctatccgc ctgttgttcc 420

gactcggctg tcccgccggc cgtgggctgc ctgttgtccc cttcgtccgc cggcggcatc 480

tcctgggagg gctccggagg tacggcggtg gccggcagag tttcggggac ccccgtgaag 540

ctcagcttcg tccgcctcag ccccggcgag aagaggaaaa gcttcgtctg cagcgccgcc 600

cccggggggg cgctgctcaa aaaggaggtg caggtctgcc gggtagatcc cgtaccgcct 660

gtagccccgg aggtgcaggt cctccacgcc tcctcctgca ccccgagcca atcggaatcg 720

gtggagctgt tgtgtttggt gacggggttc tccccggcgt cggcggaggt cgaatggttg 780

gtggacggag tggggggact tttggtggcc tcccaaagcc cggcggtccg cagcggatcc 840

acctacagcc tgagcagccg cgtcaacgtc agcggcaccg attggaggga agggaagagt 900

tacagctgta gggtgaggca ccccgcaacc aacaccgtgg tggaggatca cgtcaaggga 960

tgcccggacg gcgctcagag ctgcagcccc atccagctgt acgccatccc acccagcccg 1020

ggcgagctgt acatcagctt agacgccaaa ctgaggtgcc tggtggtcaa cctgcccagc 1080

gattccagcc tcagcgtcac ctggaccagg gagaagagtg ggaacctccg gcccgacccg 1140

atggtcctcc aagaacactt caacggcacc tacagcgcca gcagcgccgt ccccgccagc 1200

acccaggatt ggttatccgg ggagaggttc acctgcaccg tgcagcacga ggagctgccc 1260

ctgccgctca gcaagagcgt ctacaggaac acgggaccca ccaccccacc tctgatctac 1320

cccttcgccc cccacccgga agagctgtcc ctctcccgcg tcaccctgag ctgcctggtc 1380

cgcggcttcc gcccacgtga catcgagatc cggtggctcc gcgaccaccg cgccgttccc 1440

gccaccgaat tcgtcaccac cgccgtccta ccggaagaga gaaccgcaaa cggcgccggc 1500

ggtgacggcg acaccttctt cgtgtacagt aagatgagcg tggagaccgc caagtggaac 1560

ggcgggacgg tgttcgcctg catggcggtg cacgaggcgc tgcccatgcg cttcagccag 1620

cgcacgctgc agaaacaggc tggtaaataa 1650

Claims

1. A heavy chain high affinity antibody against chicken infectious bursal disease virus;

the heavy chain high-affinity antibody H for resisting the chicken infectious bursal disease virus is as follows (a): (a) the protein is composed of 1 st-549 th amino acid residues from the N terminal of a sequence 1 in a sequence table.

2. A heavy chain high affinity antibody gene encoding the anti-chicken infectious bursal disease virus of claim 1.

3. The gene of claim 2, wherein: in the gene, the DNA molecule for coding the heavy chain high-affinity antibody H of the anti-chicken infectious bursal disease virus is as follows (1): (1) the DNA molecule shown by 1-1650 th nucleotides from 5' end of the sequence 2 in the sequence table.

4. A CHO cell line containing the heavy chain high affinity antibody gene (plasmid is Peedual-H-IRES-EGFP-H) against the infectious bursal disease virus according to claim 2.

5. The CHO cell line according to claim 4, wherein the host cell is CHO-K1.

6. An expression cassette, recombinant vector, transgenic cell line or recombinant bacterium comprising the gene of any one of claims 1 to 4.

7. The preparation of the anti-chicken infectious bursal disease virus heavy chain high affinity antibody drug or the polypeptide fragment with the same function according to any one of claims 1-4.

8. Use of the anti-chicken infectious bursal disease virus heavy chain high affinity antibody drug according to any one of claims 1-4 in the preparation of a product; the function of the product is as follows (I): the (I) can prevent and treat chicken infectious bursal disease.