CN113493509A

CN113493509A - Tetravalent high-affinity antibody for resisting chicken infectious bursal disease virus and preparation and application thereof

Info

Publication number: CN113493509A
Application number: CN202110834722.7A
Authority: CN
Inventors: 任桂萍; 郭笑辰; 刘金淼
Original assignee: Northeast Agricultural University
Current assignee: Northeast Agricultural University
Priority date: 2021-07-23
Filing date: 2021-07-23
Publication date: 2021-10-12
Anticipated expiration: 2041-07-23
Also published as: CN113493509B

Abstract

The invention discloses a tetravalent high-affinity antibody for resisting chicken infectious bursal disease virus, and preparation and application thereof. The invention provides two tetravalent high affinity antibody genes for resisting infectious bursal disease virus, two eukaryotic expression vectors carrying the tetravalent high affinity antibody genes for resisting infectious bursal disease virus are respectively transfected into CHO-K1 cells, and the cells for highly expressing the tetravalent high affinity antibody for resisting infectious bursal disease virus are obtained by screening for many times by using a flow cytometer. The recombinant proteins expressed by the CHO cell strains containing the tetravalent high-affinity antibody genes for resisting the infectious bursal disease virus can prevent and treat the infectious bursal disease, provide a candidate drug for preventing and treating the infectious bursal disease, and open up a new situation in the prevention and treatment history of the infectious bursal disease.

Description

Tetravalent high-affinity antibody for resisting chicken infectious bursal disease virus and preparation and application thereof

Technical Field

The invention relates to a tetravalent high-affinity antibody for resisting chicken infectious bursal disease virus and preparation and application thereof, belonging to the technical field of biology.

Background

Infectious Bursal Disease (IBD) is an acute, highly contagious Infectious Disease caused by IBDV. IBDV mainly attacks chicks and young chickens of 3-12 weeks old and damages the central immune organ of the chickens, namely bursa of fabricius, and has the characteristics of high propagation speed, strong infectivity, high infection rate and death rate. The disease is distributed in the world at present, is one of the most important diseases in the poultry industry, and has huge economic loss caused by immune failure.

Currently, the primary method of preventing IBD is vaccination. However, the commonly used vaccine for preventing IBD is a moderate virulence vaccine, which causes different degrees of damage to the chicken bursa of fabricius, resulting in immunosuppression, thereby enhancing the body's susceptibility to other pathogens and reducing the reactivity to other vaccines. Many chicken farms, especially small chicken farms, select egg yolk antibodies for the prevention and treatment of IBD, but egg yolk antibodies are receiving increasing attention in addition to the problems of poor product quality control and their horizontal and vertical spread of disease. In the work for the prevention of IBD, there is an urgent need for tetravalent high affinity antibodies of animal origin that can prevent and treat IBD. With the development of genetic engineering technology, the genetic engineering antibody technology is brought forward. The animal homologous tetravalent antibody product is still blank in the veterinary field at present, and the invention aims to develop the chicken source recombinant tetravalent high-affinity antibody for preventing and treating IBD.

Tetravalent full-length antibodies contain intact constant region regions that are modified by stringent cellular machinery during biological expression to confer high affinity and antigen-specific binding, and therefore, the quality and quantity requirements for their production are more stringent and the choice of expression system is of critical importance. Prokaryotes do not contain numerous organelles modified by protein processing, and therefore, the E.coli expression system can only be used for producing antibody fragments such as Fab, Fab', scFv and the like which have small volume, simple structure and do not need glycosylation; lower eukaryote expression systems, such as yeast and filamentous fungi, can be used for full-length antibody production, but their glycosylation patterns are different from those of mammals, such as yeast glycosylation pattern is a polymaltose pattern, which has a short half-life, limited physiological activity and even toxicity to human body. The closest to human in protein modification systems is a mammalian expression system, which can perform appropriate folding, assembly and post-translational modification on proteins and is dominant in clinical application, and at present, Chinese hamster ovary cells (CHO cells) are the most ideal eukaryotic expression host, and the proteins expressed by the system are closer to natural proteins in configuration and conformation, and are the first choice system for recombinant glycosylated protein production.

At present, many of antibody drugs approved by FDA are produced by CHO cells, and the CHO-K1 cells are Glutamine Synthetase (GS) deficient cells capable of suspension growth, so that transfected CHO cells can be screened by using co-amplification genes, namely, GS genes are added at the upstream of an expression vector as a screening marker, and GS suppressor Methionine Sulfoxide (MSX) is used for pressurized screening, and along with the gradual increase of the concentration of MSX in a culture medium, the GS genes drive exogenous genes connected in series with the GS genes to be co-transcribed, so that the transcription efficiency of target genes is increased, and the high-efficiency expression of the exogenous genes is realized. Because the GS screening marker cannot visually monitor and sort positive cells, an Enhanced Green Fluorescent Protein (EGFP) gene is introduced to the downstream of a light chain, the EGFP is a GFP mutant and has higher fluorescence intensity, and green fluorescence can be generated under the excitation of light with wavelength of 488nm, so that the detection and sorting are carried out by a flow cytometer.

The invention respectively transfects CHO cells with two animal source tetravalent full-length antibodies (the structure schematic diagram is shown in figure 1 and figure 2), and screens out a cell strain of chicken source recombinant tetravalent high-affinity antibodies which can stably express the IBDV. The invention obtains two animal-derived tetravalent high-affinity recombinant antibodies for resisting the infectious bursal disease virus, and animal experiments show that the two tetravalent antibodies have the effects of preventing and treating the infectious bursal disease. The invention establishes a platform for developing the animal source quadrivalent therapeutic antibody in the field of veterinarians and lays a foundation for promoting the industrialization of the animal therapeutic antibody.

Disclosure of Invention

The invention aims to provide a tetravalent high-affinity antibody for resisting chicken infectious bursal disease virus, and preparation and application thereof.

The invention provides two tetravalent high-affinity antibody genes for resisting chicken infectious bursal disease virus.

The invention provides tetravalent high-affinity full-length antibody plasmids of two eukaryotic expression vectors.

The invention provides two CHO-K1 monoclonal cell strains capable of stably and efficiently expressing tetravalent high-affinity antibodies against chicken infectious bursal disease virus, which are obtained by transfecting endotoxin-free peedal-IRES-EGFP-D1 and peedal-IRES-EGFP-D2 plasmids into a CHO-K1 cell strain respectively, pressurizing by methionine sulfoxide, screening for multiple times by a flow cytometer and sorting by the flow cytometer. The obtained tetravalent high-affinity antibodies of the two chicken infectious bursal disease viruses can neutralize IBDV, so that the effects of preventing and treating IBD are achieved.

Drawings

FIG. 1 is a schematic diagram showing the construction of a peedal-IRES-EGFP-D1 tetravalent full-length antibody

FIG. 2 is a schematic diagram showing the construction of a peedal-IRES-EGFP-D2 tetravalent full-length antibody

FIG. 3 shows CHO-K1 cells after transfection

FIG. 4 is a screen of CHO-K1 positive cells after transfection

FIG. 5 shows CHO-K1 cells after triple screening

FIG. 6 shows the monoclonal cell positive rate detection

FIG. 7 shows ELISA detection of monoclonal cells

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. CHO-K1 cells: the laboratory stores. Fetal bovine serum, IMDM medium, DMEM medium, serum-free MEM medium, OptiCHO serum-free medium: gibco Corp. L-Glutamine, methionine sulfoxide Sigma.

Example 1 construction of two tetravalent full-Length recombinant eukaryotic expression vectors, peedal-IRES-EGFP-D1 and peedal-IRES-EGFP-D2

1.1 construction of Pee12.4-L1-IRES-EGFP recombinant vector

1. PCR amplifying VL1 gene fragment by using primers F1 and R1 and a laboratory-preserved scFv1 plasmid with neutralizing activity as a template; the CL gene fragment was PCR-amplified using primers F2 and R2 and the immunized chicken bursa of Fabricius cDNA as template, and the L1 gene fragment was PCR-amplified using primers F1 and R2 and the PCR-amplified products VL1 and CL as template.

F1:5'CGCGGATCCACTGGTGCGCTGACTCAGCCGTCCTCGGTGTC 3'

R1:5'TGATGGTGGGGGCCACCTTGGGCTGACCTAGGACGGTCAGGG 3'

F2:5'CGGGACAACCCTGACCGTCCTAGGTCAGCCCAAGGTGGCCCCCACCATCA 3'

R2:5'CTAGCTAGCATTAGCACTCGGACCTCTTCAGGGTCTTC 3'

2. The obtained L1 fragment and the Pkappa vector were digested simultaneously with BamHI and NheI, and the product of the double digestion was electrophoresed through 1% agarose gel to recover the L1 fragment and the large fragment of the Pkappa vector.

3. And connecting the recovered L1 fragment with a Pkappa vector with the same enzyme cutting site to construct a recombinant vector Pkappa-L1.

4. The recombinant plasmid Pkappa-L1 was digested simultaneously with HindIII and NheI, the IRES-EGFP-containing plasmid was digested simultaneously with NheI and EcoRI, the Pee12.4 vector was digested simultaneously with HindIII and EcoRI, and the resulting digested product was electrophoresed through 1% agarose gel to recover the L1-target fragment containing kappa leader, the IRES-EGFP fragment and the Pee12.4 vector, and the large fragment was recovered as a vector fragment. The L1 fragment containing kappa leader and the IRES-EGFP fragment are connected with the large fragment of the Pee12.4 vector to construct a recombinant vector Pee12.4-L1-IRES-EGFP.

1.2 construction of Pee6.4-VH1-CH recombinant vector

1. PCR amplification of VH1 gene fragment using primers F3 and R3 and a laboratory-preserved scFv1 plasmid as a template; the CH gene fragment was PCR amplified using primers F4 and R4, using the immunized chicken bursa of Fabricius cDNA as template.

F3:5'CGCGGATCCACTGGTGCCGTGACGTTGGACGAG 3'

R3:5'CTAGCTAGCGGAGGAGACGATGACTTCGGTCC 3'

F4:5'CTAGCTAGCGCGAGCCCCACATCGCCCCCCCGAT 3'

R4:5'CCGGAATTCATTATTTACCAGCCTGTTTCTGCAGCGTG 3'

2. The VH fragment and the Pkappa vector were digested simultaneously with BamHI and NheI, respectively, and the resultant digested products were subjected to 1% agarose gel electrophoresis to recover the VH fragment and the large fragment of the Pkappa vector.

3. The obtained VH1 fragment was ligated with a Pkappa vector of the same restriction enzyme site to construct a recombinant vector Pkappa-VH 1. The recombinant plasmid Pkappa-VH1 was digested simultaneously with HindIII and NheI, the CH fragment was digested simultaneously with NheI and EcoRI, the Pee6.4 vector was digested simultaneously with HindIII and EcoRI, and the resulting digested product was electrophoresed through 1% agarose gel to recover the kappa leader-containing VH1 target fragment, CH fragment and Pee6.4 vector, and the large fragment was recovered as a vector fragment. The VH1 segment and CH segment containing kappa leader are connected with the large fragment of the Pee6.4 vector to construct a recombinant vector Pee6.4-VH 1-CH.

1.3 construction of recombinant plasmid peedeal-IRES-EGFP-D1

1. PCR was performed using primers F5 and R5 to amplify the scFv21 gene fragment using a laboratory-preserved scFv2 plasmid as a template. The obtained scFv21 fragment was linked with the recombinant vector Pee6.4-VH1-CH digested with HindIII using a seamless cloning kit to construct a recombinant vector Pee6.4-scFv21-VH 1-CH.

F5:5'CAGTCACCGTCCTTGACACGAAGCTTGCTCGAGCCACCATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGATCCACTGGTGCCGTGACGTTGGACGAGTCCGG 3'

R5:5'GACTCGTCCAACGTCACGGCAGAACCACCACCACCAGAACCACCACCACCACCTAGGACGGTCAGGGTTGTCCCG 3'

2. The scFv22 gene fragment was PCR-amplified using primers F6 and R6, using a laboratory-preserved scFv2 plasmid with neutralizing activity as a template. The obtained scFv22 fragment is connected with a recombinant vector Pee12.4-L1-IRES-EGFP cut by SmaI by using a seamless cloning kit to construct a recombinant vector Pee12.4-scFv 22-L1-IRES-EGFP.

F6:5'CAACCCTGACCGTCCTAGGTGGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGCCGTGACGTTGGACGAGTC 3'

R6:5'GGCTGAGTCAGCGCGGATCCAGAACCACCACCACCAGAACCACCACCACCACCTAGGACGGTCAGGGTTG 3'

3. The scFv11 gene fragment was PCR-amplified using primers F7 and R7, using a laboratory-preserved scFv1 plasmid with neutralizing activity as a template. The obtained scFv11 fragment is connected with a recombinant vector Pee12.4-scFv22-L1-IRES-EGFP cut by SmaI by using a seamless cloning kit to construct a recombinant vector Pee12.4-scFv11-scFv 22-L1-IRES-EGFP.

F7:5'GGGTACTGCTGCTCTGGGTTCCCGGGTCCACTGGTGCCGTGACGTTGGACGAG TC 3'

R7:5'GACTCGTCCAACGTCACGGCAGAACCACCACCACCAGAACCACCACCACCACCTAGGACGGTCAGGGTTG 3'

4. The obtained Pee6.4-scFv21-VH1-CH and Pee12.4-scFv11-scFv22-L1-IRES-EGFP plasmids are simultaneously digested by NotI and SalI, large fragments are recovered, the two recovered large fragments are connected, and a recombinant plasmid peedeual-IRES-EGFP-D1 is constructed.

1.4 construction of recombinant plasmid peedeal-IRES-EGFP-D2

1. PCR was performed using primers F8 and R8 to amplify the scFv12 gene fragment using a laboratory-preserved scFv1 plasmid as a template. The obtained scFv12 fragment was linked to the recombinant vector Pee6.4-scFv21-VH1-CH digested with EcoRI in 1.3 using a seamless cloning kit to construct the recombinant vector Pee6.4-scFv21-VH1-CH-scFv 12.

F8:5'CTGCAGAAACAGGCTGGTAAAGGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGCCGTGACGTTGGACGAGT 3'

R8:5'GATTATGATCAATGAATTCATCAACCTAGGACGGTCAGGGT 3'

2. The obtained Pee6.4-scFv21-VH1-CH-scFv12 and the recombinant vector Pee12.4-scFv22-L1-IRES-EGFP in 1.3 are simultaneously digested by NotI and SalI, large fragments are recovered, the two recovered large fragments are connected, and the recombinant plasmid peedaual-IRES-EGFP-D2 is constructed.

Example 2 CHO-K1 cell line for obtaining two tetravalent recombinant full-length antibodies of anti-IBDV

CHO-K1 cells are a Glutamine Synthetase (GS) -deficient Chinese hamster ovary cell line, a CHO-K1 cell line is recovered from a cell bank, passaged twice in a DMEM medium containing 10% fetal bovine serum and glutamine, when the cells are in a logarithmic growth phase, inoculated into a cell culture flask at a cell density of 1 x 10^6cells/mL, cultured in a 37 ℃ and 5% CO2 incubator until the confluence is 70-80%, digested with trypsin, digested with serum, stopped at 1000rpm for 5min, washed once with PBS after centrifugation, and the cells are diluted and counted in a serum-free MEM medium (serum-free medium for MEM transfection of GIBCO) so that the concentration of the cells reaches 1 x 10^7 cells/mL. 5 mu g of purified and endotoxin-free plasmid DNA of peedeual-IRES-EGFP-D1 and peedeual-IRES-EGFP-D2 were taken, and the plasmids were transferred to CHO-K1 by Lipofectamine 3000 kit. And transferring the transfected cells into a complete culture medium containing 10% fetal calf serum for recovery culture. After 24-30h of transfection, 10% fetal bovine serum IMDM medium containing 50. mu.M GS suppressor Methionine Sulfoxide (MSX) without glutamine was replaced and pressure-cultured. The morphology of the transfected cells is shown in FIG. 3, and the transfected cells were designated D1 and D2, respectively.

EXAMPLE 3 screening of CHO-K1 cell line stably and efficiently expressing two anti-IBDV tetravalent full-length recombinant antibodies

According to the invention, an Enhanced Green Fluorescent Protein (EGFP) gene is introduced into the Pee12.4 vector, green fluorescence can be generated under the excitation of light with wavelength of 488nm, and detection and sorting can be carried out by a flow cytometer. After transfection, 10% fetal bovine serum IMDM medium containing 50 μ M MSX without glutamine was used for pressure culture to eliminate untransferred and transiently transfected CHO-K1 cells, and flow cytometry sterile sorting was performed after the stably transfected clones grew into cell culture flasks.

The sorting steps are as follows: cells were trypsinized, the digestion was stopped by adding serum, 1000rpm, 5min, centrifuged, and the cells were washed twice with PBS, 500. mu.L PBS resuspended cells, and untransfected blank cells were treated as control. The cells with high positive rate identified by the flow cytometer are sorted into a six-hole plate containing a 10% fetal bovine serum IMDM culture medium containing 50 mu M MSX and no glutamine, cultured and observed in a 5% CO2 incubator at 37 ℃, and subjected to the next round of screening after the cells grow to about 5-10 multiplied by 10^6 cells.

After three rounds of screening are completed, mixed clone groups with the positive rate of more than 90% are obtained, and then the cells are subjected to enlarged culture and frozen storage, and a seed cell bank is established. The results of three rounds of screening flow cytometry on the anti-IBDV CHO-K1 cell line are shown in FIG. 4, and the cell morphology under a fluorescence microscope after three screens is shown in FIG. 5.

Example 4 CHO-K1 monoclonal cell line obtaining two anti-IBDV tetravalent high-affinity full-length recombinant antibodies with stable and high-efficiency expression

And (3) screening stable and high-efficiency expressed monoclonal cell strains from the mixed clone groups obtained by the three-screening by using a 96-well plate monoclonal screening method.

The monoclonal sorting method was as follows: add 200. mu.L of pre-preheated at 37 ℃ sterile 10% fetal bovine serum IMDM medium containing 50. mu.M MSX and no glutamine into each well of 96-well plate. The cell processing step is as the sorting step of example 3, after the screening is completed, the 96-well plate is placed in a constant temperature incubator at 37 ℃ and 5% CO2 for culture, after 1-2 weeks, the growth condition of the cells is observed by using a fluorescence microscope, the culture medium is replaced, when the proliferation of the monoclonal cells reaches more than 1000 cells, the cells are transferred to a 24-well culture plate, the cells are sequentially expanded and cultured according to the increase of the proliferation number of the cells, and the fluorescence intensity of each monoclonal cell strain is detected by using a flow cytometer under the condition of 488nm excitation light. The results of the flow cytometry screening of the anti-IBDV monoclonal cell line are shown in FIG. 6. And (3) culturing the obtained anti-IBDV monoclonal cell strain to be full, then replacing a serum-free culture medium to culture the cell for 4-5 days, collecting cell supernatant, and detecting the affinity of the tetravalent full-length recombinant antibody of the anti-IBDV by using an ELISA method. The ELISA detection method is as follows, the results are shown in FIG. 7, and the ELISA results show that the tetravalent full-length recombinant antibodies of two anti-IBDV can be specifically combined with VP2 protein, the combining ability of different monoclonal cell strains is different, the combining ability of the L1-3 and L2-4 monoclonal cell strains is the highest, so that the L1-3 and L2-4 cell strains are selected as anti-IBDV expression cell strains, and cells are amplified, cultured and frozen. And establishing a seed cell bank.

ELISA method for detecting the affinity of anti-IBDV:

IBDV VP2 antigen protein was diluted to 20. mu.g/mL with the coating solution and coated on an ELISA plate overnight at 4 ℃. The collected cell supernatants were added separately, without antibody as negative control, and 3 replicate wells were set for each sample. Adding goat anti-chicken antibody marked by HRP as a second antibody, and detecting the A value at the wavelength of 450nm by using a microplate reader.

Example 5 neutralizing Activity of two tetravalent high affinity full-length recombinant antibodies to anti-IBDV

DF1 cells in the logarithmic growth phase were seeded in a 96-well cell culture plate, and the tetravalent full-length antibody solutions of L1-3 and L2-4 (i.e., the tetravalent antibody solution prepared in example 4) and 100TCID, which were diluted with a DMEM medium gradient, were used₅₀The IBDV virus solution (strain B87) was mixed in equal volume and incubated at 37 ℃ for 1h, then inoculated into a monolayer of cells, 8 wells per gradient; setting a normal control without adding the antibody solution and without adding the virus solution, and setting a virus control without adding the antibody solution and only adding the virus solution. And (3) putting the cell culture plate into a fine incubator, culturing at 37 ℃ and 5% CO2 for 5-7 days continuously, and recording the growth state of the cells every day. The results are shown in Table 1.

TABLE 1 results of the determination of the neutralizing Activity of two tetravalent high affinity full length recombinant antibodies to anti-IBDV

The results showed that both the tetravalent antibodies L1-3 and L2-4 had neutralizing activity, with minimum protein concentrations of 0.06. mu.g/ml and 0.12. mu.g/ml for blocking or inhibiting CPE, respectively.

Example 6: toxic substance counteracting treatment test

28-day-old SPF chickens were randomly divided into 5 groups of 10 chickens. In addition to the saline group, four groups each of the chickens took 0.2mL (100 BID) of IBDV BC6/85 orally₅₀). Treating the L1-3 tetravalent antibody group, the L2-4 tetravalent antibody group and the yolk antibody group for three times 6h, 24h and 48h after challenge, injecting 1mL of antibody with the concentration of 1mg/mL each time, not treating the normal group and the challenge group, observing and recording the disease onset condition of SPF (specific pathogen free) chickens day by dayAnd (4) counting the number of bursal disease of the chickens in each group after 96h of killing after the virus attack. The results are shown in Table 2.

The results indicate that both the L1-3 and L2-4 tetravalent antibodies can treat IBD.

Example 7: challenge prevention test

SPF-chickens 25 days old were randomly divided into 5 groups of 10 chickens each. Except for the saline group and the challenge group, 1mL of 1mg/mL L1-3 tetravalent antibody, L2-4 tetravalent antibody, and yolk antibody were injected into each chicken of the three groups. When the virus is attacked at 28 days old, 0.1mL (100 BID) of IBDV BC6/85 strain is orally taken₅₀). And observing and recording the morbidity of SPF chickens in each group day by day, completely killing the SPF chickens 96 hours after virus attack, and counting the number of bursal disease of the chickens in each group. The results are shown in Table 3.

The results indicate that both the L1-3 and L2-4 tetravalent antibodies can prevent IBD.

Sequence listing

<110> northeast university of agriculture

<120> tetravalent high-affinity antibody for resisting chicken infectious bursal disease virus, preparation and application thereof

<141> 2021-07-23

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 808

<212> PRT

<213> Infectious bursal disease virus (Infectious bursal disease virus)

<400> 1

Ala Val Thr Leu Asp Glu Ser Gly Gly Gly Leu Gln Thr Pro Gly Gly

1 5 10 15

Ala Leu Ser Leu Val Cys Lys Ala Ser Gly Phe Ser Ile Ser Ser Tyr

20 25 30

Ser Met Ala Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ala Gly Ile Tyr Ser Ser Gly Ser Ser Thr Tyr Tyr Gly Ser Ala Val

50 55 60

Lys Gly Arg Ala Thr Ile Ser Arg Asp Asn Gly Gln Ser Thr Val Arg

65 70 75 80

Leu Gln Leu Asn Asn Leu Arg Ala Glu Asp Thr Gly Thr Tyr Tyr Cys

85 90 95

Ala Arg Gly Gly Cys Ser Thr Tyr Gly Cys Gly Gly Tyr Ala Gly Ser

100 105 110

Ile Asp Ala Trp Gly His Gly Thr Glu Val Ile Val Ser Ser Ala Ser

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ala

130 135 140

Leu Thr Gln Pro Ser Ser Val Ser Ala Asn Pro Gly Glu Thr Val Lys

145 150 155 160

Ile Thr Cys Ser Gly Gly Gly Ser Ser Tyr Gly Tyr Ser Trp His Gln

165 170 175

Gln Lys Ser Pro Gly Ser Ala Pro Val Thr Val Ile Tyr Asn Asn Thr

180 185 190

Asn Arg Pro Ser Asn Ile Pro Ser Arg Phe Ser Gly Ser Lys Ser Gly

195 200 205

Ser Thr Ala Thr Leu Thr Ile Thr Gly Val Gln Ala Asp Asp Glu Ala

210 215 220

Ile Tyr Phe Cys Gly Ser Ala Asp Ser Ser Tyr Val Gly Ile Phe Gly

225 230 235 240

Ala Gly Thr Thr Leu Thr Val Leu Gly Gly Gly Gly Gly Ser Gly Gly

245 250 255

Gly Gly Ser Ala Val Thr Leu Asp Glu Ser Gly Gly Gly Leu Gln Thr

260 265 270

Pro Gly Gly Ala Leu Ser Leu Val Cys Lys Ala Ser Gly Phe Thr Phe

275 280 285

Ser Ser Tyr Ala Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu

290 295 300

Glu Trp Leu Ala Gly Ile Ser Ser Ser Gly Arg Tyr Thr Tyr Tyr Gly

305 310 315 320

Ala Ala Val Lys Gly Arg Ala Thr Ile Ser Arg Asp Asn Gly Gln Ser

325 330 335

Thr Val Arg Leu Gln Leu Asn Asn Leu Arg Ala Glu Asp Thr Gly Thr

340 345 350

Tyr Tyr Cys Ala Lys Asp Ser Trp Ser Leu Asn Val Gly Ser Ile Asp

355 360 365

Ala Trp Gly His Gly Thr Glu Val Ile Val Ser Ser Ala Ser Ala Ser

370 375 380

Pro Thr Ser Pro Pro Arg Leu Tyr Pro Leu Ser Ala Cys Cys Ser Asp

385 390 395 400

Ser Ala Val Pro Pro Ala Val Gly Cys Leu Leu Ser Pro Ser Ser Ala

405 410 415

Gly Gly Ile Ser Trp Glu Gly Ser Gly Gly Thr Ala Val Ala Gly Arg

420 425 430

Val Ser Gly Thr Pro Val Lys Leu Ser Phe Val Arg Leu Ser Pro Gly

435 440 445

Glu Lys Arg Lys Ser Phe Val Cys Ser Ala Ala Pro Gly Gly Ala Leu

450 455 460

Leu Lys Lys Glu Val Gln Val Cys Arg Val Asp Pro Val Pro Pro Val

465 470 475 480

Ala Pro Glu Val Gln Val Leu His Ala Ser Ser Cys Thr Pro Ser Gln

485 490 495

Ser Glu Ser Val Glu Leu Leu Cys Leu Val Thr Gly Phe Ser Pro Ala

500 505 510

Ser Ala Glu Val Glu Trp Leu Val Asp Gly Val Gly Gly Leu Leu Val

515 520 525

Ala Ser Gln Ser Pro Ala Val Arg Ser Gly Ser Thr Tyr Ser Leu Ser

530 535 540

Ser Arg Val Asn Val Ser Gly Thr Asp Trp Arg Glu Gly Lys Ser Tyr

545 550 555 560

Ser Cys Arg Val Arg His Pro Ala Thr Asn Thr Val Val Glu Asp His

565 570 575

Val Lys Gly Cys Pro Asp Gly Ala Gln Ser Cys Ser Pro Ile Gln Leu

580 585 590

Tyr Ala Ile Pro Pro Ser Pro Gly Glu Leu Tyr Ile Ser Leu Asp Ala

595 600 605

Lys Leu Arg Cys Leu Val Val Asn Leu Pro Ser Asp Ser Ser Leu Ser

610 615 620

Val Thr Trp Thr Arg Glu Lys Ser Gly Asn Leu Arg Pro Asp Pro Met

625 630 635 640

Val Leu Gln Glu His Phe Asn Gly Thr Tyr Ser Ala Ser Ser Ala Val

645 650 655

Pro Ala Ser Thr Gln Asp Trp Leu Ser Gly Glu Arg Phe Thr Cys Thr

660 665 670

Val Gln His Glu Glu Leu Pro Leu Pro Leu Ser Lys Ser Val Tyr Arg

675 680 685

Asn Thr Gly Pro Thr Thr Pro Pro Leu Ile Tyr Pro Phe Ala Pro His

690 695 700

Pro Glu Glu Leu Ser Leu Ser Arg Val Thr Leu Ser Cys Leu Val Arg

705 710 715 720

Gly Phe Arg Pro Arg Asp Ile Glu Ile Arg Trp Leu Arg Asp His Arg

725 730 735

Ala Val Pro Ala Thr Glu Phe Val Thr Thr Ala Val Leu Pro Glu Glu

740 745 750

Arg Thr Ala Asn Gly Ala Gly Gly Asp Gly Asp Thr Phe Phe Val Tyr

755 760 765

Ser Lys Met Ser Val Glu Thr Ala Lys Trp Asn Gly Gly Thr Val Phe

770 775 780

Ala Cys Met Ala Val His Glu Ala Leu Pro Met Arg Phe Ser Gln Arg

785 790 795 800

Thr Leu Gln Lys Gln Ala Gly Lys

805

<210> 2

<211> 724

<212> PRT

<213> Infectious bursal disease virus (Infectious bursal disease virus)

<400> 2

Ala Val Thr Leu Asp Glu Ser Gly Gly Gly Leu Gln Thr Pro Gly Gly

1 5 10 15

Ala Leu Ser Leu Val Cys Lys Ala Ser Gly Phe Thr Phe Ser Ser Tyr

20 25 30

Ala Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Leu

35 40 45

Ala Gly Ile Ser Ser Ser Gly Arg Tyr Thr Tyr Tyr Gly Ala Ala Val

50 55 60

Lys Gly Arg Ala Thr Ile Ser Arg Asp Asn Gly Gln Ser Thr Val Arg

65 70 75 80

Leu Gln Leu Asn Asn Leu Arg Ala Glu Asp Thr Gly Thr Tyr Tyr Cys

85 90 95

Ala Lys Asp Ser Trp Ser Leu Asn Val Gly Ser Ile Asp Ala Trp Gly

100 105 110

His Gly Thr Glu Val Ile Val Ser Ser Ala Ser Gly Gly Gly Gly Ser

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ala Leu Thr Gln Pro Ser

130 135 140

Ser Val Ser Ala Asn Pro Gly Glu Thr Val Lys Ile Thr Cys Ser Gly

145 150 155 160

Ser Ser Gly Cys Gly Tyr Gly Trp Tyr Gln Gln Lys Ser Pro Gly Ser

165 170 175

Ala Pro Val Thr Val Ile Tyr Asn Asn Asn Asn Arg Pro Ser Asp Ile

180 185 190

Pro Ser Arg Phe Ser Gly Ser Lys Ser Gly Ser Thr Ala Thr Leu Thr

195 200 205

Ile Thr Gly Val Gln Ala Glu Asp Glu Ala Val Tyr Tyr Cys Gly Ser

210 215 220

Ala Asp Ser Ser Ser Thr Gly Ala Pro Phe Gly Ala Gly Thr Thr Leu

225 230 235 240

Thr Val Leu Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ala Val

245 250 255

Thr Leu Asp Glu Ser Gly Gly Gly Leu Gln Thr Pro Gly Gly Ala Leu

260 265 270

Ser Leu Val Cys Lys Ala Ser Gly Phe Ser Ile Ser Ser Tyr Ser Met

275 280 285

Ala Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ala Gly

290 295 300

Ile Tyr Ser Ser Gly Ser Ser Thr Tyr Tyr Gly Ser Ala Val Lys Gly

305 310 315 320

Arg Ala Thr Ile Ser Arg Asp Asn Gly Gln Ser Thr Val Arg Leu Gln

325 330 335

Leu Asn Asn Leu Arg Ala Glu Asp Thr Gly Thr Tyr Tyr Cys Ala Arg

340 345 350

Gly Gly Cys Ser Thr Tyr Gly Cys Gly Gly Tyr Ala Gly Ser Ile Asp

355 360 365

Ala Trp Gly His Gly Thr Glu Val Ile Val Ser Ser Ala Ser Gly Gly

370 375 380

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ala Leu Thr

385 390 395 400

Gln Pro Ser Ser Val Ser Ala Asn Pro Gly Glu Thr Val Lys Ile Thr

405 410 415

Cys Ser Gly Gly Gly Ser Ser Tyr Gly Tyr Ser Trp His Gln Gln Lys

420 425 430

Ser Pro Gly Ser Ala Pro Val Thr Val Ile Tyr Asn Asn Thr Asn Arg

435 440 445

Pro Ser Asn Ile Pro Ser Arg Phe Ser Gly Ser Lys Ser Gly Ser Thr

450 455 460

Ala Thr Leu Thr Ile Thr Gly Val Gln Ala Asp Asp Glu Ala Ile Tyr

465 470 475 480

Phe Cys Gly Ser Ala Asp Ser Ser Tyr Val Gly Ile Phe Gly Ala Gly

485 490 495

Thr Thr Leu Thr Val Leu Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly

500 505 510

Ser Gly Ser Ala Leu Thr Gln Pro Ser Ser Val Ser Ala Lys Pro Gly

515 520 525

Glu Thr Val Lys Ile Thr Cys Ser Gly Ser Ser Gly Cys Gly Tyr Gly

530 535 540

Trp Tyr Gln Gln Lys Ser Pro Gly Ser Ala Pro Val Thr Val Ile Tyr

545 550 555 560

Asn Asn Asn Asn Arg Pro Ser Asp Ile Pro Ser Arg Phe Ser Gly Ser

565 570 575

Lys Ser Gly Ser Thr Ala Thr Leu Thr Ile Thr Gly Val Gln Ala Glu

580 585 590

Asp Glu Ala Val Tyr Tyr Cys Gly Ser Ala Asp Ser Ser Ser Thr Gly

595 600 605

Ala Pro Phe Gly Ala Gly Thr Thr Leu Thr Val Leu Gly Gln Pro Lys

610 615 620

Val Ala Pro Thr Ile Thr Leu Phe Pro Pro Ser Lys Glu Glu Leu Asn

625 630 635 640

Glu Ala Thr Lys Ala Thr Leu Val Cys Leu Ile Asn Asp Phe Tyr Pro

645 650 655

Ser Pro Val Thr Val Asp Trp Val Ile Asp Gly Ser Thr Arg Ser Gly

660 665 670

Glu Thr Thr Ala Pro Gln Arg Gln Ser Asn Ser Gln Tyr Met Ala Ser

675 680 685

Ser Tyr Leu Ser Leu Ser Ala Ser Asp Trp Ser Ser His Glu Thr Tyr

690 695 700

Thr Cys Arg Val Thr His Asp Gly Thr Ser Ile Thr Lys Thr Leu Lys

705 710 715 720

Arg Ser Glu Cys

<210> 3

<211> 1062

<212> PRT

<213> Infectious bursal disease virus (Infectious bursal disease virus)

<400> 3

Ala Val Thr Leu Asp Glu Ser Gly Gly Gly Leu Gln Thr Pro Gly Gly

1 5 10 15

Ala Leu Ser Leu Val Cys Lys Ala Ser Gly Phe Ser Ile Ser Ser Tyr

20 25 30

Ser Met Ala Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ala Gly Ile Tyr Ser Ser Gly Ser Ser Thr Tyr Tyr Gly Ser Ala Val

50 55 60

Lys Gly Arg Ala Thr Ile Ser Arg Asp Asn Gly Gln Ser Thr Val Arg

65 70 75 80

Leu Gln Leu Asn Asn Leu Arg Ala Glu Asp Thr Gly Thr Tyr Tyr Cys

85 90 95

Ala Arg Gly Gly Cys Ser Thr Tyr Gly Cys Gly Gly Tyr Ala Gly Ser

100 105 110

Ile Asp Ala Trp Gly His Gly Thr Glu Val Ile Val Ser Ser Ala Ser

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ala

130 135 140

Leu Thr Gln Pro Ser Ser Val Ser Ala Asn Pro Gly Glu Thr Val Lys

145 150 155 160

Ile Thr Cys Ser Gly Gly Gly Ser Ser Tyr Gly Tyr Ser Trp His Gln

165 170 175

Gln Lys Ser Pro Gly Ser Ala Pro Val Thr Val Ile Tyr Asn Asn Thr

180 185 190

Asn Arg Pro Ser Asn Ile Pro Ser Arg Phe Ser Gly Ser Lys Ser Gly

195 200 205

Ser Thr Ala Thr Leu Thr Ile Thr Gly Val Gln Ala Asp Asp Glu Ala

210 215 220

Ile Tyr Phe Cys Gly Ser Ala Asp Ser Ser Tyr Val Gly Ile Phe Gly

225 230 235 240

Ala Gly Thr Thr Leu Thr Val Leu Gly Gly Gly Gly Gly Ser Gly Gly

245 250 255

Gly Gly Ser Ala Val Thr Leu Asp Glu Ser Gly Gly Gly Leu Gln Thr

260 265 270

Pro Gly Gly Ala Leu Ser Leu Val Cys Lys Ala Ser Gly Phe Thr Phe

275 280 285

Ser Ser Tyr Ala Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu

290 295 300

Glu Trp Leu Ala Gly Ile Ser Ser Ser Gly Arg Tyr Thr Tyr Tyr Gly

305 310 315 320

Ala Ala Val Lys Gly Arg Ala Thr Ile Ser Arg Asp Asn Gly Gln Ser

325 330 335

Thr Val Arg Leu Gln Leu Asn Asn Leu Arg Ala Glu Asp Thr Gly Thr

340 345 350

Tyr Tyr Cys Ala Lys Asp Ser Trp Ser Leu Asn Val Gly Ser Ile Asp

355 360 365

Ala Trp Gly His Gly Thr Glu Val Ile Val Ser Ser Ala Ser Ala Ser

370 375 380

Pro Thr Ser Pro Pro Arg Leu Tyr Pro Leu Ser Ala Cys Cys Ser Asp

385 390 395 400

Ser Ala Val Pro Pro Ala Val Gly Cys Leu Leu Ser Pro Ser Ser Ala

405 410 415

Gly Gly Ile Ser Trp Glu Gly Ser Gly Gly Thr Ala Val Ala Gly Arg

420 425 430

Val Ser Gly Thr Pro Val Lys Leu Ser Phe Val Arg Leu Ser Pro Gly

435 440 445

Glu Lys Arg Lys Ser Phe Val Cys Ser Ala Ala Pro Gly Gly Ala Leu

450 455 460

Leu Lys Lys Glu Val Gln Val Cys Arg Val Asp Pro Val Pro Pro Val

465 470 475 480

Ala Pro Glu Val Gln Val Leu His Ala Ser Ser Cys Thr Pro Ser Gln

485 490 495

Ser Glu Ser Val Glu Leu Leu Cys Leu Val Thr Gly Phe Ser Pro Ala

500 505 510

Ser Ala Glu Val Glu Trp Leu Val Asp Gly Val Gly Gly Leu Leu Val

515 520 525

Ala Ser Gln Ser Pro Ala Val Arg Ser Gly Ser Thr Tyr Ser Leu Ser

530 535 540

Ser Arg Val Asn Val Ser Gly Thr Asp Trp Arg Glu Gly Lys Ser Tyr

545 550 555 560

Ser Cys Arg Val Arg His Pro Ala Thr Asn Thr Val Val Glu Asp His

565 570 575

Val Lys Gly Cys Pro Asp Gly Ala Gln Ser Cys Ser Pro Ile Gln Leu

580 585 590

Tyr Ala Ile Pro Pro Ser Pro Gly Glu Leu Tyr Ile Ser Leu Asp Ala

595 600 605

Lys Leu Arg Cys Leu Val Val Asn Leu Pro Ser Asp Ser Ser Leu Ser

610 615 620

Val Thr Trp Thr Arg Glu Lys Ser Gly Asn Leu Arg Pro Asp Pro Met

625 630 635 640

Val Leu Gln Glu His Phe Asn Gly Thr Tyr Ser Ala Ser Ser Ala Val

645 650 655

Pro Ala Ser Thr Gln Asp Trp Leu Ser Gly Glu Arg Phe Thr Cys Thr

660 665 670

Val Gln His Glu Glu Leu Pro Leu Pro Leu Ser Lys Ser Val Tyr Arg

675 680 685

Asn Thr Gly Pro Thr Thr Pro Pro Leu Ile Tyr Pro Phe Ala Pro His

690 695 700

Pro Glu Glu Leu Ser Leu Ser Arg Val Thr Leu Ser Cys Leu Val Arg

705 710 715 720

Gly Phe Arg Pro Arg Asp Ile Glu Ile Arg Trp Leu Arg Asp His Arg

725 730 735

Ala Val Pro Ala Thr Glu Phe Val Thr Thr Ala Val Leu Pro Glu Glu

740 745 750

Arg Thr Ala Asn Gly Ala Gly Gly Asp Gly Asp Thr Phe Phe Val Tyr

755 760 765

Ser Lys Met Ser Val Glu Thr Ala Lys Trp Asn Gly Gly Thr Val Phe

770 775 780

Ala Cys Met Ala Val His Glu Ala Leu Pro Met Arg Phe Ser Gln Arg

785 790 795 800

Thr Leu Gln Lys Gln Ala Gly Lys Gly Gly Gly Gly Ser Gly Gly Gly

805 810 815

Gly Ser Ala Val Thr Leu Asp Glu Ser Gly Gly Gly Leu Gln Thr Pro

820 825 830

Gly Gly Ala Leu Ser Leu Val Cys Lys Ala Ser Gly Phe Thr Phe Ser

835 840 845

Ser Tyr Ala Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu

850 855 860

Trp Leu Ala Gly Ile Ser Ser Ser Gly Arg Tyr Thr Tyr Tyr Gly Ala

865 870 875 880

Ala Val Lys Gly Arg Ala Thr Ile Ser Arg Asp Asn Gly Gln Ser Thr

885 890 895

Val Arg Leu Gln Leu Asn Asn Leu Arg Ala Glu Asp Thr Gly Thr Tyr

900 905 910

Tyr Cys Ala Lys Asp Ser Trp Ser Leu Asn Val Gly Ser Ile Asp Ala

915 920 925

Trp Gly His Gly Thr Glu Val Ile Val Ser Ser Ala Ser Gly Gly Gly

930 935 940

Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ala Leu Thr Gln

945 950 955 960

Pro Ser Ser Val Ser Ala Asn Pro Gly Glu Thr Val Lys Ile Thr Cys

965 970 975

Ser Gly Ser Ser Gly Cys Gly Tyr Gly Trp Tyr Gln Gln Lys Ser Pro

980 985 990

Gly Ser Ala Pro Val Thr Val Ile Tyr Asn Asn Asn Asn Arg Pro Ser

995 1000 1005

Asp Ile Pro Ser Arg Phe Ser Gly Ser Lys Ser Gly Ser Thr Ala Thr

1010 1015 1020

Leu Thr Ile Thr Gly Val Gln Ala Glu Asp Glu Ala Val Tyr Tyr Cys

1025 1030 1035 1040

Gly Ser Ala Asp Ser Ser Ser Thr Gly Ala Pro Phe Gly Ala Gly Thr

1045 1050 1055

Thr Leu Thr Val Leu Gly

1060

<210> 4

<211> 470

<212> PRT

<213> Infectious bursal disease virus (Infectious bursal disease virus)

<400> 4

Ala Val Thr Leu Asp Glu Ser Gly Gly Gly Leu Gln Thr Pro Gly Gly

1 5 10 15

Ala Leu Ser Leu Val Cys Lys Ala Ser Gly Phe Ser Ile Ser Ser Tyr

20 25 30

Ser Met Ala Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ala Gly Ile Tyr Ser Ser Gly Ser Ser Thr Tyr Tyr Gly Ser Ala Val

50 55 60

Lys Gly Arg Ala Thr Ile Ser Arg Asp Asn Gly Gln Ser Thr Val Arg

65 70 75 80

Leu Gln Leu Asn Asn Leu Arg Ala Glu Asp Thr Gly Thr Tyr Tyr Cys

85 90 95

Ala Arg Gly Gly Cys Ser Thr Tyr Gly Cys Gly Gly Tyr Ala Gly Ser

100 105 110

Ile Asp Ala Trp Gly His Gly Thr Glu Val Ile Val Ser Ser Ala Ser

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ala

130 135 140

Leu Thr Gln Pro Ser Ser Val Ser Ala Asn Pro Gly Glu Thr Val Lys

145 150 155 160

Ile Thr Cys Ser Gly Gly Gly Ser Ser Tyr Gly Tyr Ser Trp His Gln

165 170 175

Gln Lys Ser Pro Gly Ser Ala Pro Val Thr Val Ile Tyr Asn Asn Thr

180 185 190

Asn Arg Pro Ser Asn Ile Pro Ser Arg Phe Ser Gly Ser Lys Ser Gly

195 200 205

Ser Thr Ala Thr Leu Thr Ile Thr Gly Val Gln Ala Asp Asp Glu Ala

210 215 220

Ile Tyr Phe Cys Gly Ser Ala Asp Ser Ser Tyr Val Gly Ile Phe Gly

225 230 235 240

Ala Gly Thr Thr Leu Thr Val Leu Gly Gly Gly Gly Gly Ser Gly Gly

245 250 255

Gly Gly Ser Gly Ser Ala Leu Thr Gln Pro Ser Ser Val Ser Ala Lys

260 265 270

Pro Gly Glu Thr Val Lys Ile Thr Cys Ser Gly Ser Ser Gly Cys Gly

275 280 285

Tyr Gly Trp Tyr Gln Gln Lys Ser Pro Gly Ser Ala Pro Val Thr Val

290 295 300

Ile Tyr Asn Asn Asn Asn Arg Pro Ser Asp Ile Pro Ser Arg Phe Ser

305 310 315 320

Gly Ser Lys Ser Gly Ser Thr Ala Thr Leu Thr Ile Thr Gly Val Gln

325 330 335

Ala Glu Asp Glu Ala Val Tyr Tyr Cys Gly Ser Ala Asp Ser Ser Ser

340 345 350

Thr Gly Ala Pro Phe Gly Ala Gly Thr Thr Leu Thr Val Leu Gly Gln

355 360 365

Pro Lys Val Ala Pro Thr Ile Thr Leu Phe Pro Pro Ser Lys Glu Glu

370 375 380

Leu Asn Glu Ala Thr Lys Ala Thr Leu Val Cys Leu Ile Asn Asp Phe

385 390 395 400

Tyr Pro Ser Pro Val Thr Val Asp Trp Val Ile Asp Gly Ser Thr Arg

405 410 415

Ser Gly Glu Thr Thr Ala Pro Gln Arg Gln Ser Asn Ser Gln Tyr Met

420 425 430

Ala Ser Ser Tyr Leu Ser Leu Ser Ala Ser Asp Trp Ser Ser His Glu

435 440 445

Thr Tyr Thr Cys Arg Val Thr His Asp Gly Thr Ser Ile Thr Lys Thr

450 455 460

Leu Lys Arg Ser Glu Cys

465 470

<210> 5

<211> 2427

<212> DNA

<213> Infectious bursal disease virus (Infectious bursal disease virus)

<400> 5

gccgtgacgt tggacgagtc cgggggcggc ctccagacgc ccggaggagc gctcagcctc 60

gtctgcaagg cctccgggtt ctccatcagc agttacagca tggcttgggt gcgccaggcg 120

cccggcaagg ggctggagtg ggtcgcgggt atttacagca gtggtagtag cacatactac 180

gggtcggcgg tgaagggccg tgccaccatc tcgagggaca acgggcagag cacagtgagg 240

ctgcagctga acaacctcag ggctgaggac accggcacct actactgcgc cagaggtggt 300

tgtagtactt acggttgtgg tggttatgct ggtagcatcg acgcatgggg ccacgggacc 360

gaagtcatcg tctcctccgc tagcggtggt ggtggttctg gtggtggtgg ttctggtggt 420

ggtggatccg cgctgactca gccgtcctcg gtgtcagcga acccgggaga aaccgtcaag 480

atcacctgct ccgggggtgg cagcagctat ggttacagct ggcaccagca gaagtctcct 540

ggcagtgccc ctgtcactgt gatctataac aacaccaaca gaccctcgaa catcccttca 600

cgattctccg gttccaaatc cggctccaca gccacattaa ccatcactgg ggtccaagcc 660

gacgacgagg ctatctactt ctgtgggagt gcagacagca gctatgttgg tatatttggg 720

gccgggacaa ccctgaccgt cctaggtggt ggtggtggtt ctggtggtgg tggttctgcc 780

gtgacgttgg acgagtccgg gggcggcctc cagacgcccg gaggagcgct cagcctcgtc 840

tgcaaggcct ccgggttcac cttcagcagt tatgccatgg gttgggtgcg acaggcgccc 900

ggcaaagggc tggagtggct tgcaggtatt agcagcagtg gtagatacac atactacggg 960

gcggcggtga agggccgtgc caccatctcg agggacaacg ggcagagcac agtgaggctg 1020

cagctgaaca acctcagggc tgaggacacc ggcacctact actgcgccaa agattcttgg 1080

agtcttaatg ttggtagtat cgacgcatgg ggccacggga ccgaagtcat cgtctcctcc 1140

gctagcgcga gccccacatc gcccccccga ttgtaccctc tatccgcctg ttgttccgac 1200

tcggctgtcc cgccggccgt gggctgcctg ttgtcccctt cgtccgccgg cggcatctcc 1260

tgggagggct ccggaggtac ggcggtggcc ggcagagttt cggggacccc cgtgaagctc 1320

agcttcgtcc gcctcagccc cggcgagaag aggaaatcct tcgtctgcag cgccgccccc 1380

gggggggcgc tgctcaaaaa ggaggtgcag gtctgccggg tagatcccgt accgcctgta 1440

gccccggagg tgcaggtcct ccacgcctcc tcctgcaccc cgagccaatc ggaatcggtg 1500

gagctgttgt gtttggtgac ggggttctcc ccggcgtcgg cggaggtcga atggttggtg 1560

gacggagtgg ggggactttt ggtggcctcc caaagcccgg cggtccgcag cggatccacc 1620

tacagcctga gcagccgcgt caacgtcagc ggcaccgatt ggagggaagg gaagagttac 1680

agctgtaggg tgaggcaccc cgcaaccaac accgtggtgg aggatcacgt caagggatgc 1740

ccggacggcg ctcagagctg cagccccatc cagctgtacg ccatcccacc cagcccgggc 1800

gagctgtaca tcagcttaga cgccaaactg aggtgcctgg tggtcaacct gcccagcgat 1860

tccagcctca gcgtcacctg gaccagggag aagagtggga acctccggcc cgacccgatg 1920

gtcctccaag aacacttcaa cggcacctac agcgccagca gcgccgtccc cgccagcacc 1980

caggattggt tatccgggga gaggttcacc tgcaccgtgc agcacgagga gctgcccctg 2040

ccgctcagca agagcgtcta caggaacacg ggacccacca ccccacctct gatctacccc 2100

ttcgcccccc acccggaaga gctgtccctc tcccgcgtca ccctgagctg cctggtccgc 2160

ggcttccgcc cacgtgacat cgagatccgg tggctccgcg accaccgcgc cgttcccgcc 2220

accgagttcg tcaccaccgc cgtcctaccg gaagagagaa ccgcaaacgg cgccggcggt 2280

gacggcgaca ccttcttcgt gtacagtaag atgagcgtgg agaccgccaa gtggaacggc 2340

gggacggtgt tcgcctgcat ggcggtgcac gaggcgctgc ccatgcgctt cagccagcgc 2400

acgctgcaga aacaggctgg taaatga 2427

<210> 6

<211> 2175

<212> DNA

<213> Infectious bursal disease virus (Infectious bursal disease virus)

<400> 6

gccgtgacgt tggacgagtc cgggggcggc ctccagacgc ccggaggagc gctcagcctc 60

gtctgcaagg cctccgggtt caccttcagc agttatgcca tgggttgggt gcgacaggcg 120

cccggcaaag ggctggagtg gcttgcaggt attagcagca gtggtagata cacatactac 180

ggggcggcgg tgaagggccg tgccaccatc tcgagggaca acgggcagag cacagtgagg 240

ctgcagctga acaacctcag ggctgaggac accggcacct actactgcgc caaagattct 300

tggagtctta atgttggtag tatcgacgca tggggccacg ggaccgaagt catcgtctcc 360

tccgctagcg gtggtggtgg ttctggtggt ggtggttctg gtggtggtgg atccgcgctg 420

actcagccgt cctcggtgtc agcaaacccg ggagaaaccg tcaagatcac ctgctccggg 480

agtagtggct gtggttatgg ctggtaccag cagaagtctc ctggcagtgc ccctgtcact 540

gtgatctata acaacaacaa cagaccctcg gacatccctt cacgattctc cggttccaaa 600

tccggctcca cagccacatt aaccatcact ggggtccaag ccgaggacga ggctgtctat 660

tactgtggga gtgcagacag cagcagtact ggtgctccat ttggggccgg gacaaccctg 720

accgtcctag gtggtggtgg tggttctggt ggtggtggtt ctgccgtgac gttggacgag 780

tccgggggcg gcctccagac gcccggagga gcgctcagcc tcgtctgcaa ggcctccggg 840

ttctccatca gcagttacag catggcttgg gtgcgccagg cgcccggcaa ggggctggag 900

tgggtcgcgg gtatttacag cagtggtagt agcacatact acgggtcggc ggtgaagggc 960

cgtgccacca tctcgaggga caacgggcag agcacagtga ggctgcagct gaacaacctc 1020

agggctgagg acaccggcac ctactactgc gccagaggtg gttgtagtac ttacggttgt 1080

ggtggttatg ctggtagcat cgacgcatgg ggccacggga ccgaagtcat cgtctcctcc 1140

gctagcggtg gtggtggttc tggtggtggt ggttctggtg gtggtggatc cgcgctgact 1200

cagccgtcct cggtgtcagc gaacccggga gaaaccgtca agatcacctg ctccgggggt 1260

ggcagcagct atggttacag ctggcaccag cagaagtctc ctggcagtgc ccctgtcact 1320

gtgatctata acaacaccaa cagaccctcg aacatccctt cacgattctc cggttccaaa 1380

tccggctcca cagccacatt aaccatcact ggggtccaag ccgacgacga ggctatctac 1440

ttctgtggga gtgcagacag cagctatgtt ggtatatttg gggccgggac aaccctgacc 1500

gtcctaggtg gtggtggtgg ttctggtggt ggtggttctg gatccgcgct gactcagccg 1560

tcctcggtgt cagcaaaacc gggagaaacc gtcaagatca cctgctccgg gagtagtggc 1620

tgtggttatg gctggtacca gcagaagtct cctggcagtg cccctgtcac tgtgatctat 1680

aacaacaaca acagaccctc ggacatccct tcacgattct ccggttccaa atccggctcc 1740

acagccacat taaccatcac tggggtccaa gccgaggacg aggctgtcta ttactgtggg 1800

agtgcagaca gcagcagtac tggtgctcca tttggggccg ggacaaccct gaccgtccta 1860

ggtcagccca aggtggcccc caccatcacc ctcttcccac cgtcaaagga ggagctgaac 1920

gaagccacca aggccaccct ggtgtgcctg ataaacgact tctaccccag cccagtgact 1980

gtggattggg tgatcgatgg ctccacccgc tctggcgaga ccacagcacc acagcggcag 2040

agcaacagcc agtatatggc cagcagctac ctgtcactgt ctgccagcga ctggtcaagc 2100

cacgagacct acacctgcag ggtcacacac gacggcacct ctatcacgaa gaccctgaag 2160

aggtccgagt gctga 2175

<210> 7

<211> 3189

<212> DNA

<213> Infectious bursal disease virus (Infectious bursal disease virus)

<400> 7

gccgtgacgt tggacgagtc cgggggcggc ctccagacgc ccggaggagc gctcagcctc 60

gtctgcaagg cctccgggtt ctccatcagc agttacagca tggcttgggt gcgccaggcg 120

cccggcaagg ggctggagtg ggtcgcgggt atttacagca gtggtagtag cacatactac 180

gggtcggcgg tgaagggccg tgccaccatc tcgagggaca acgggcagag cacagtgagg 240

ctgcagctga acaacctcag ggctgaggac accggcacct actactgcgc cagaggtggt 300

tgtagtactt acggttgtgg tggttatgct ggtagcatcg acgcatgggg ccacgggacc 360

gaagtcatcg tctcctccgc tagcggtggt ggtggttctg gtggtggtgg ttctggtggt 420

ggtggatccg cgctgactca gccgtcctcg gtgtcagcga acccgggaga aaccgtcaag 480

atcacctgct ccgggggtgg cagcagctat ggttacagct ggcaccagca gaagtctcct 540

ggcagtgccc ctgtcactgt gatctataac aacaccaaca gaccctcgaa catcccttca 600

cgattctccg gttccaaatc cggctccaca gccacattaa ccatcactgg ggtccaagcc 660

gacgacgagg ctatctactt ctgtgggagt gcagacagca gctatgttgg tatatttggg 720

gccgggacaa ccctgaccgt cctaggtggt ggtggtggtt ctggtggtgg tggttctgcc 780

gtgacgttgg acgagtccgg gggcggcctc cagacgcccg gaggagcgct cagcctcgtc 840

tgcaaggcct ccgggttcac cttcagcagt tatgccatgg gttgggtgcg acaggcgccc 900

ggcaaagggc tggagtggct tgcaggtatt agcagcagtg gtagatacac atactacggg 960

gcggcggtga agggccgtgc caccatctcg agggacaacg ggcagagcac agtgaggctg 1020

cagctgaaca acctcagggc tgaggacacc ggcacctact actgcgccaa agattcttgg 1080

agtcttaatg ttggtagtat cgacgcatgg ggccacggga ccgaagtcat cgtctcctcc 1140

gctagcgcga gccccacatc gcccccccga ttgtaccctc tatccgcctg ttgttccgac 1200

tcggctgtcc cgccggccgt gggctgcctg ttgtcccctt cgtccgccgg cggcatctcc 1260

tgggagggct ccggaggtac ggcggtggcc ggcagagttt cggggacccc cgtgaagctc 1320

agcttcgtcc gcctcagccc cggcgagaag aggaaatcct tcgtctgcag cgccgccccc 1380

gggggggcgc tgctcaaaaa ggaggtgcag gtctgccggg tagatcccgt accgcctgta 1440

gccccggagg tgcaggtcct ccacgcctcc tcctgcaccc cgagccaatc ggaatcggtg 1500

gagctgttgt gtttggtgac ggggttctcc ccggcgtcgg cggaggtcga atggttggtg 1560

gacggagtgg ggggactttt ggtggcctcc caaagcccgg cggtccgcag cggatccacc 1620

tacagcctga gcagccgcgt caacgtcagc ggcaccgatt ggagggaagg gaagagttac 1680

agctgtaggg tgaggcaccc cgcaaccaac accgtggtgg aggatcacgt caagggatgc 1740

ccggacggcg ctcagagctg cagccccatc cagctgtacg ccatcccacc cagcccgggc 1800

gagctgtaca tcagcttaga cgccaaactg aggtgcctgg tggtcaacct gcccagcgat 1860

tccagcctca gcgtcacctg gaccagggag aagagtggga acctccggcc cgacccgatg 1920

gtcctccaag aacacttcaa cggcacctac agcgccagca gcgccgtccc cgccagcacc 1980

caggattggt tatccgggga gaggttcacc tgcaccgtgc agcacgagga gctgcccctg 2040

ccgctcagca agagcgtcta caggaacacg ggacccacca ccccacctct gatctacccc 2100

ttcgcccccc acccggaaga gctgtccctc tcccgcgtca ccctgagctg cctggtccgc 2160

ggcttccgcc cacgtgacat cgagatccgg tggctccgcg accaccgcgc cgttcccgcc 2220

accgagttcg tcaccaccgc cgtcctaccg gaagagagaa ccgcaaacgg cgccggcggt 2280

gacggcgaca ccttcttcgt gtacagtaag atgagcgtgg agaccgccaa gtggaacggc 2340

gggacggtgt tcgcctgcat ggcggtgcac gaggcgctgc ccatgcgctt cagccagcgc 2400

acgctgcaga aacaggctgg taaaggtggt ggtggttctg gtggtggtgg ttctgccgtg 2460

acgttggacg agtccggggg cggcctccag acgcccggag gagcgctcag cctcgtctgc 2520

aaggcctccg ggttcacctt cagcagttat gccatgggtt gggtgcgaca ggcgcccggc 2580

aaagggctgg agtggcttgc aggtattagc agcagtggta gatacacata ctacggggcg 2640

gcggtgaagg gccgtgccac catctcgagg gacaacgggc agagcacagt gaggctgcag 2700

ctgaacaacc tcagggctga ggacaccggc acctactact gcgccaaaga ttcttggagt 2760

cttaatgttg gtagtatcga cgcatggggc cacgggaccg aagtcatcgt ctcctccgct 2820

agcggtggtg gtggttctgg tggtggtggt tctggtggtg gtggatccgc gctgactcag 2880

ccgtcctcgg tgtcagcaaa cccgggagaa accgtcaaga tcacctgctc cgggagtagt 2940

ggctgtggtt atggctggta ccagcagaag tctcctggca gtgcccctgt cactgtgatc 3000

tataacaaca acaacagacc ctcggacatc ccttcacgat tctccggttc caaatccggc 3060

tccacagcca cattaaccat cactggggtc caagccgagg acgaggctgt ctattactgt 3120

gggagtgcag acagcagcag tactggtgct ccatttgggg ccgggacaac cctgaccgtc 3180

ctaggttga 3189

<210> 8

<211> 1413

<212> DNA

<213> Infectious bursal disease virus (Infectious bursal disease virus)

<400> 8

gccgtgacgt tggacgagtc cgggggcggc ctccagacgc ccggaggagc gctcagcctc 60

gtctgcaagg cctccgggtt ctccatcagc agttacagca tggcttgggt gcgccaggcg 120

cccggcaagg ggctggagtg ggtcgcgggt atttacagca gtggtagtag cacatactac 180

gggtcggcgg tgaagggccg tgccaccatc tcgagggaca acgggcagag cacagtgagg 240

ctgcagctga acaacctcag ggctgaggac accggcacct actactgcgc cagaggtggt 300

tgtagtactt acggttgtgg tggttatgct ggtagcatcg acgcatgggg ccacgggacc 360

gaagtcatcg tctcctccgc tagcggtggt ggtggttctg gtggtggtgg ttctggtggt 420

ggtggatccg cgctgactca gccgtcctcg gtgtcagcga acccgggaga aaccgtcaag 480

atcacctgct ccgggggtgg cagcagctat ggttacagct ggcaccagca gaagtctcct 540

ggcagtgccc ctgtcactgt gatctataac aacaccaaca gaccctcgaa catcccttca 600

cgattctccg gttccaaatc cggctccaca gccacattaa ccatcactgg ggtccaagcc 660

gacgacgagg ctatctactt ctgtgggagt gcagacagca gctatgttgg tatatttggg 720

gccgggacaa ccctgaccgt cctaggtggt ggtggtggtt ctggtggtgg tggttctgga 780

tccgcgctga ctcagccgtc ctcggtgtca gcaaaaccgg gagaaaccgt caagatcacc 840

tgctccggga gtagtggctg tggttatggc tggtaccagc agaagtctcc tggcagtgcc 900

cctgtcactg tgatctataa caacaacaac agaccctcgg acatcccttc acgattctcc 960

ggttccaaat ccggctccac agccacatta accatcactg gggtccaagc cgaggacgag 1020

gctgtctatt actgtgggag tgcagacagc agcagtactg gtgctccatt tggggccggg 1080

acaaccctga ccgtcctagg tcagcccaag gtggccccca ccatcaccct cttcccaccg 1140

tcaaaggagg agctgaacga agccaccaag gccaccctgg tgtgcctgat aaacgacttc 1200

taccccagcc cagtgactgt ggattgggtg atcgatggct ccacccgctc tggcgagacc 1260

acagcaccac agcggcagag caacagccag tatatggcca gcagctacct gtcactgtct 1320

gccagcgact ggtcaagcca cgagacctac acctgcaggg tcacacacga cggcacctct 1380

atcacgaaga ccctgaagag gtccgagtgc tga 1413

Claims

1. Two tetravalent high affinity antibodies against chicken infectious bursal disease virus;

the tetravalent high-affinity antibody D1 for resisting the chicken infectious bursal disease virus is (a) and (b) as follows: (a) protein consisting of 1 st-808 th amino acid residues from the N terminal of a sequence 1 in a sequence table; (b) protein consisting of 1 st-724 th amino acid residues from the N terminal of a sequence 2 in a sequence table;

the tetravalent high-affinity antibody D2 for resisting the chicken infectious bursal disease virus is as follows (c) and (D): (c) protein consisting of 1 st to 1062 nd amino acid residues from the N terminal of a sequence 3 in a sequence table; (d) the protein consisting of 1 st-470 th amino acid residues from the N terminal of a sequence 4 in a sequence table.

2. Encoding the two tetravalent high affinity antibody genes of claim 1 that are resistant to infectious bursal disease virus.

3. The gene of claim 2, wherein: in the gene, the DNA molecules for coding the tetravalent high-affinity antibody D1 of the chicken infectious bursal disease virus are (1) and (2) as follows: (1) a DNA molecule shown by 1-2427 th nucleotides from the 5' end of a sequence 5 in the sequence table; (2) a DNA molecule shown by 1-2175 th nucleotides from 5' tail end of a sequence 6 in a sequence table;

in the gene, the DNA molecules for coding the tetravalent high-affinity antibody D2 of the chicken infectious bursal disease virus are as follows (3) and (4): (3) DNA molecules shown by 1 st-3189 th nucleotides from 5' tail end of a sequence 7 in a sequence table; (4) DNA molecule shown by 1-1413 th nucleotides from 5' end of sequence 8 in the sequence table.

4. Two CHO cell strains containing tetravalent high-affinity antibody genes (plasmids are Peedual-IRES-EGFP-D1 and Peedual-IRES-EGFP-D2) for resisting chicken infectious bursal disease virus.

5. The CHO cell line according to claim 4, wherein the host cell is CHO-K1.

6. An expression cassette, recombinant vector, transgenic cell line or recombinant bacterium comprising the gene of any one of claims 1 to 4.

7. A tetravalent high affinity antibody drug against chicken infectious bursal disease virus according to any of claims 1-4 for use in the preparation of a product related formulation.

8. Use of a tetravalent high affinity antibody drug against chicken infectious bursal disease virus according to any of claims 1-4 in the manufacture of a product; the function of the product is as follows (I): the (I) can prevent and treat chicken infectious bursal disease.