CN100564527C

CN100564527C - Botulinum toxin type A receptor combination region Hc and proteins encoded thereof and application

Info

Publication number: CN100564527C
Application number: CNB2007100895882A
Authority: CN
Inventors: 俞炜源; 余云舟; 孙志伟; 刘志刚; 王双
Original assignee: Institute of Bioengineering Chinese Academy of Military Medical Sciences
Current assignee: Institute of Bioengineering Chinese Academy of Military Medical Sciences
Priority date: 2006-10-23
Filing date: 2007-04-03
Publication date: 2009-12-02
Anticipated expiration: 2027-04-03
Also published as: CN101054582A

Abstract

The invention discloses a botulinum toxin type A receptor combination region Hc and proteins encoded and application.Its objective is provides a botulinum toxin type A receptor combination region Hc and proteins encoded and its thereof application in preparation botulinum toxin type A vaccine.This gene is one of following nucleotide sequence: the 1) dna sequence dna of SEQ ID NO:1 in the sequence table; 2) dna sequence dna of SEQ ID NO:2 in the code sequence tabulation; 3) with sequence table in the dna sequence dna that limits of SEQ ID NO:1 have 90% above homology and have the nucleotide sequence of excitating organism botulinum toxin type A generation immanoprotection action; 4) nucleotide sequence of the dna sequence dna hybridization that under the rigorous condition of height, can limit with SEQ ID NO:1 in the sequence table.Botulinum toxin type A receptor combination region Hc of the present invention and proteins encoded thereof will play a significant role in preparation botulinum toxin type A vaccine, have a extensive future.

Description

Botulinum toxin type A receptor combination region Hc and proteins encoded thereof and application

Technical field

The present invention relates to gene and proteins encoded thereof and application, particularly relate to a botulinum toxin type A receptor combination region Hc and proteins encoded thereof and its application in preparation botulinum toxin type A vaccine.

Background technology

Botulinus toxin (Botulinum Toxin, BoNT) be the strongest albumen of present known virulence, 1.0g the botulinus toxin crystallisate is enough to kill 1,000,000 people, the extracellular toxin that is produced in anaerobic environment by Clostridium botulinum (Clostridium botulinum) has 7 serotypes (A-G), wherein, A, botulinum toxin type B are to cause the common type that the people poisons, and E, F type cause that once in a while food poisoning is popular, C, D type only cause that then animal, bird poison, and the G type causes that the report of poisoning is less.Clinical observation shows that botulinum toxin type A is compared other type can cause more serious toxicity symptom, and causes higher mortality ratio.Botulinus toxin poisoning morbidity risk rate in the crowd is little, but its toxicity is big, and the lethality rate height is very harmful to public health security, must cause people's great attention.Extensively exist at nature owing to produce the Clostridium botulinum of botulinus toxin, and its gemma to external world environment have stronger resistibility, botulinus toxin is poisoned and is remained a very serious public health problem.In recent years, the epidemic situation of numerical example sausage poisoning all takes place in the many areas of China, even has colony's botulinus toxin poisoning to take place.Especially botulinum toxin type A also is used to make biological weapon by dozens of country (as USSR (Union of Soviet Socialist Republics) and Iraq), and it also can be utilized to make bio-terrorism by terroristic organization simultaneously.Therefore, no matter the study on prevention of carrying out botulinus toxin is to national Biosafety, public health security, and still the life and health safety to people all has important and practical meanings.

At present, toxoid vaccine (PBT) is owing to exist many shortcomings, and is long as complex process, dangerous property, bad, immune cycle of protectiveness; can't apply; and fail to obtain the FDA approval, therefore, development is efficient, safe, new generation vaccine is imperative easily.Botulinus toxin is formed (light chain 50KD, heavy chain 100KD) by two chains that disulfide linkage connects; light chain is the toxic component of BoNT; and heavy chain is the toxoreceptor in conjunction with neurocyte, is protectiveness combination and to enter neurocyte necessary, but itself does not have a neurotoxicity.The 50KDa C-terminal (abbreviating Hc as) of heavy chain participates in the nerve-specific combination, and immunological experiment has proved that this receptor area is a protective antigen.The research of botulinus toxin new generation vaccine mainly concentrates on recombinant protein Hc subunit vaccine and nucleic acid vaccine both direction, this new generation vaccine has following advantage than toxoid vaccine: expense is low, production process is safer, repeatedly can produce stronger immunne response by excitating organism after the immunity.

In intestinal bacteria, express the Hc fragment effectively and can protect mouse to resist the botulinus toxin attack of high dosage, have good immunogenicity.But only part not fully up to expectations is: no matter be primary in the past, still botulinum toxin type A Hc gene Recombinant Protein Expression amount in intestinal bacteria of majorizing sequence synthetic is lower, usually be inclusion body, and unstable products, this has limited its use to a certain extent.In order to solve the expression problem of recombinant protein Hc; the researchist attempts utilizing and efficiently expresses botulinum toxin type A recombinant protein Hc and achieving success in the Yeast system; the botulinum toxin type A Hc gene of synthetic has obtained efficiently expressing (Smith LA. in Yeast system; Toxicon; 1998; 36:1539-1548), in addition, can induce the protective immunological reaction of generation at the botulinus toxin of high dosage with the recombinant protein Hc immune animal (mouse and non-human primate) of purifying.Next milestone is to be that candidate Hc subunit vaccine carries out clinical trial with it.Recently, there are two pieces of bibliographical information primary botulinum toxin type A Hc genes in intestinal bacteria, to obtain solubility expression effectively, the expression level of its purifying is 10-20mg/L, used prokaryotic expression carrier is pET28, expression condition is for cultivating 20 hours or spend the night (MahmoodTavallaie, et al, FEBS down at 25 ℃ or 16 ℃, 2004,572:299-306; Baldwin MR, et al, Infection andImmunity, 2005,73 (10): 6998-7005).Natural botulinum toxin type A receptor binding domain Hc fragment gene sequence A and T content are up to 76%, and successive A and T string often appears, in addition, spreading all over whole gene order has a large amount of rare codons to occur, make this natural gene expression in heterologous host cell have certain difficulty and expression product instability, output is extremely low.The present inventor once attempted direct pcr amplification primary BoNT/A Hc gene, again it is cloned into prokaryotic expression carrier and expresses, the expression level of Hc is very low and be inclusion body as a result, consistent (LaPenotiere HF with experimental results of predecessors, et al., Toxicon, 1995,33:1383-1386).

Another research direction of the new generation vaccine development of botulinus toxin is a research botulinus toxin nucleic acid vaccine.The major advantage that dna vaccination is better than toxoid vaccine and subunit vaccine is, convenient and flexible operation, with short production cycle, product are easy to purifying and convenient storage.Producing dna vaccination does not need to cultivate pathogenic bacteria, has higher production security than toxoid vaccine.Antigen protein produces in the cell of immune animal, does not need to carry out protein purification, uses convenient than subunit vaccine.Two pieces of bibliographical informations are arranged with after containing traditional dna vector immune mouse of botulinum toxin type A Hc gene, can produce provide protection (Jennifer Clayton, et al., Vaccine, 2000,18:1855-1862 botulinum toxin type A; Shyu RH, et al., J Biomed Sci, 2000,7:51-57).But the antibody horizontal that produces after the dna vaccination immunity is lower, and its corresponding protection effect is not high.The rf nucleic acid vaccine is a kind of new generation vaccine, it has plurality of advantages, as still having whole characteristics of replicon carrier, the DNA preparation is simple, cost is low, and vaccine is safer, has the virus pollution problem unlike recombinant virus particle vaccine, also unlike traditional dna vaccination, DNA may take place be incorporated into genome, it is that " Suicidal DNA Vaccine has good security.Up to the present, utilize SFV replicon development of Type A botulinus toxin novel nucleic acids vaccine to yet there are no report based on DNA.

Summary of the invention

But the purpose of this invention is to provide an excitating organism produces immanoprotection action to botulinum toxin type A botulinum toxin type A receptor combination region Hc.

Botulinum toxin type A receptor combination region Hc provided by the present invention, name is called HcA, is one of following nucleotide sequence:

1) dna sequence dna of SEQ ID NO:1 in the sequence table;

2) dna sequence dna of SEQ ID NO:2 in the code sequence tabulation;

3) with sequence table in the dna sequence dna that limits of SEQ ID NO:1 have 90% above homology and have the nucleotide sequence of excitating organism botulinum toxin type A generation immanoprotection action;

4) nucleotide sequence of the dna sequence dna hybridization that under the rigorous condition of height, can limit with SEQ ID NO:1 in the sequence table.

The rigorous condition of described height be 0.1 * SSPE (or 0.1 * SSC), in the solution of 0.1%SDS, hybridization and wash film under 65 ℃ of conditions.

SEQ ID NO:1 in the sequence table is by 1287 based compositions, and its encoding sequence is that coding has the protein of the amino acid residue sequence of SEQ ID NO:2 in the sequence table from 5 ' end 1-1287 base.

Described botulinum toxin type A receptor combination region Hc HcA encoded protein (HcA) is one of following amino acid residue sequences:

1) the SEQ ID NO:2 in the sequence table;

2) with the amino acid residue sequence of SEQ ID NO:2 in the sequence table through replacement, disappearance or the interpolation of one to ten amino-acid residue and have excitating organism produces immanoprotection action to botulinum toxin type A protein.

SEQ ID NO:2 in the sequence table is made up of 429 amino-acid residues.

One to ten amino-acid residue of described replacement, disappearance or interpolation can be the amino-acid residue in the non-structural domain, and its change can not exert an influence to this proteic function.

The expression vector, transgenic cell line and the host bacterium that contain gene HcA of the present invention all belong to protection scope of the present invention.

The expression vector that contains gene HcA of the present invention comprises prokaryotic expression carrier, traditional carrier for expression of eukaryon and based on the replicon carrier of DNA etc.

The upstream of botulinum toxin type A receptor combination region Hc HcA also can be connected with thioredoxin gene Trx and (derive from the Trx gene order in pET-32a (+) carrier of Novagen company in the described recombinant prokaryotic expression vector, what be positioned at this carrier holds 366-692 base place from 5 ', its nucleotides sequence is classified SEQ ID NO:8 in the sequence table as, 109 amino-acid residues of encoding).

The carrier that sets out that is used to make up the recombinant prokaryotic expression vector that contains botulinum toxin type A receptor combination region Hc HcA of the present invention is any one prokaryotic expression carrier, as pET-22b (+), pET-32a, pET-28a, pET-28b, pET-28c, pET-21a (+) or pET-30a etc.

Be the carrier that sets out with pET-22b (+), the recombinant prokaryotic expression vector that contains botulinum toxin type A receptor combination region Hc HcA and thioredoxin gene Trx of structure is pTIG-Trx-Hc.

The carrier that sets out that is used to make up the traditional carrier for expression of eukaryon that contains botulinum toxin type A receptor combination region Hc HcA of the present invention is any one carrier for expression of eukaryon, as pcDNA (pcDNA3.1 (+) etc.), pCMV5, pSilence1.0-U6 (Ambion, Austin, TX, USA), pEGFP-N1, pSV40, pCI-neo (purchasing company), pTEF1, pPICZ α, pAM82 or pAAh5 etc. in Promega.

Be the carrier that sets out with pcDNA3.1 (+), the recombinant eukaryon expression vector that contains botulinum toxin type A receptor combination region Hc HcA of structure is pcDNASHc.

For HcA is secreted into outside the born of the same parents, described 5 ' end based on botulinum toxin type A receptor combination region Hc HcA in the replicon expression vector of DNA also can be connected with secreting signal peptide (Murine Ig-chain V-J2-C signalpeptide, abbreviation S) encoding sequence (derives from pSecTag, Invitrogen company), its nucleotides sequence is classified SEQ ID NO:6 in the sequence table as, the aminoacid sequence of SEQ ID NO:7 in the code sequence tabulation.

The carrier that sets out that is used to make up the replicon expression vector that contains botulinum toxin type A receptor combination region Hc HcA of the present invention is any one replicon expression vector, as pSCAR (Yu Yunzhou etc., biological chemistry and biophysics progress, 2006,33 (1): 87-94).

Be the carrier that sets out with pSCAR, the replicon expression vector that contains botulinum toxin type A receptor combination region Hc HcA and secreting signal peptide S encoding sequence of structure is pSCARSHc.

Above-mentioned recombinant expression vector can make up according to ordinary method.

Arbitrary segmental primer is to also being that the present invention will protect among the amplification HcA.

The present invention also provides a kind of method of expressing above-mentioned botulinum toxin type A receptor combination region Hc proteins encoded HcA.

The method of the above-mentioned botulinum toxin type A receptor combination region Hc of expression provided by the present invention proteins encoded HcA, be that the above-mentioned recombinant expression vector that contains botulinum toxin type A receptor combination region Hc HcA is imported host cell, express obtaining botulinum toxin type A receptor combination region Hc proteins encoded HcA.

Described host can be intestinal bacteria, yeast, mammalian cell, insect cell or Bacillus subtilus etc., is preferably intestinal bacteria.

Described intestinal bacteria can be E.coli DH5 α, E.cili BL ₂₁(DE ₃), E.cili BL ₂₁(DE ₃) pLysS or E.coli Top10 etc.

Described yeast is preferably pichia pastoris (Pichia pastoris).Wherein, described pichia pastoris is preferably pichia pastoris GS115, KM71 (available from American I nvitrogen company) or SMD1168 (available from American I nvitrogen company).

Above-mentioned reorganization bacterium can make up according to ordinary method.

Cultivation contains the substratum and the culture condition of the host cell of botulinum toxin type A receptor combination region Hc HcA, all can be substratum and the culture condition of cultivating the host that sets out.Wherein, need add inductor when cultivating described recombination bacillus coli host, as IPTG etc., add IPTG concentration be 0.1-1.0mmol/L, be preferably 0.2mmol/L, inducing temperature is 16-37 ℃, be preferably 30 ℃, induction time is 2-4 hour, is preferably 3 hours.

Botulinum toxin type A receptor combination region Hc of the present invention can be used for preparing the botulinum toxin type A nucleic acid vaccine, and the proteins encoded of this gene can be used for preparing the botulinum toxin type A subunit vaccine.

Botulinum toxin type A receptor combination region Hc in the described dna vaccination can be present in the replicon expression vector based on DNA, wherein, be the carrier that sets out with pSCAR, the replicon expression vector that contains botulinum toxin type A receptor combination region Hc HcA and secreting signal peptide S encoding sequence of structure is pSCARSHc.

When needing, can also incorporate the gene of one or more cytokines such as granular leucocyte-macrophage colony stimulating factor (GM-CSF), interferon-(IFN-γ), interleukin-22 (IL-2), TGF-β 4 or protein in the botulinum toxin type A subunit vaccine with the preparation of botulinum toxin type A receptor combination region Hc proteins encoded as the molecular immune adjuvant.

Vaccine of the present invention can be made various ways such as injection liquid, dry powder injection or sprays.The medicine of above-mentioned various formulations all can be according to the ordinary method preparation of pharmaceutical field.

The consumption of above-mentioned nucleic acid vaccine and subunit vaccine can adopt the routine dose of pharmaceutical field amplifying nucleic acid vaccine and subunit vaccine, as 3-30 μ g (nucleic acid vaccine) and 1-10 μ g (subunit vaccine), and can be according to the practical situation adjustment.

The invention provides a botulinum toxin type A receptor combination region Hc HcA and proteins encoded thereof.This gene obtains after according to segmental gene order of botulinum toxin type A receptor binding domain Hc and amino acid residue sequence optimization, make A and T content be reduced to 57% by 76%, and substitute rare codon with intestinal bacteria codon commonly used, take into account eukaryotic cell codon commonly used simultaneously, and guarantee that coded amino acid residue sequence is constant.Above-mentioned HcA gene clone made up in the prokaryotic expression carrier obtain prokaryotic expression carrier pTIG-Trx-Hc; the reorganization bacterium is cultivated in its transformed into escherichia coli (for example BL21 (DE3) etc.) back; can make botulinum toxin type A receptor combination region Hc HcA in the host bacterium, obtain the highly-soluble expression; the solubility expression product accounts for more than 36% of bacterium solubility total amount; through a step in a small amount purifying can obtain recombinant protein HcA more than the 30mg/L; high titre ELISA antibody with its immune animal energy inducing producing specificity; neutralizing antibody and cellullar immunologic response reaction; and can be to the attack of anti-A type botulinus toxin; experiment showed, that botulinum toxin type A recombinant protein HcA is with 1 μ g dosage immunity secondary or can protect 10 three times ⁶LD ₅₀The attack of botulinum toxin type A shows that recombinant protein HcA of the present invention has good immunogenicity, can be used for preparing the botulinum toxin type A subunit vaccine.In addition; at the still strong inadequately shortcoming of the immune protective efficiency that produces after traditional dna vector immunity; the present invention also is cloned into said gene HcA based on making up in the SFV replicon carrier of DNA and has been obtained the SFV replicon carrier; compare with the constructed traditional carrier for expression of eukaryon pcDNASHc that contains HcA; replicon carrier can produce higher levels of body fluid and cellullar immunologic response; and required immunizing dose is lower; this replicon dna vector can protect immune animal to avoid the attack of higher levels of botulinum toxin type A, can be used for preparing the botulinum toxin type A nucleic acid vaccine.Botulinum toxin type A receptor combination region Hc HcA of the present invention and proteins encoded thereof will play a significant role in preparation botulinum toxin type A vaccine, have a extensive future.

Below in conjunction with specific embodiment the present invention is described in further details.

Description of drawings

Fig. 1 is the subunit vaccine of preparation anti-A type botulinus toxin and the technological line figure of nucleic acid vaccine

Fig. 2 is the SDS-PAGE detected result of HcA e. coli bl21 (DE3) expression product

Fig. 3 is the SDS-PAGE detected result through the reorganization HcA of affinitive layer purification

Fig. 4 is the part-structure synoptic diagram based on the SFV replicon carrier pSCARSHc of DNA and traditional carrier for expression of eukaryon pcDNASHc that contains HcA.

Embodiment

Method therefor is ordinary method if no special instructions among the following embodiment, concrete steps can referring to:

《Molecular?Cloning：A?Laboratory?Manual》(Sambrook，J.，Russell，David?W.，Molecular?Cloning：A?Laboratory?Manual，3 ^rd?edition，2001，NY，Cold?SpringHarbor)。The primer and dna sequence dna are synthetic by the handsome Bioisystech Co., Ltd in Shanghai.

The acquisition of embodiment 1, botulinum toxin type A receptor combination region Hc HcA

According to segmental gene order of botulinum toxin type A receptor binding domain Hc and amino acid residue sequence (BoNT/A, A62, the international standard strain, sequence number M30196) optimizes the Hc gene, make A and T content be reduced to 57% by 76%, and substitute rare codon with intestinal bacteria codon commonly used, take into account eukaryotic cell codon commonly used simultaneously, and guarantee that coded amino acid residue sequence is constant, according to optimizing back gene order design 23 to this gene fragment of (46) primer synthetic, primer sequence is as follows again:

Article 23, forward primer sequence following (5 '-3 ' end):

F1 CGGAATTCACCATGGCTGAATACATCAAG

F2 AACATCATCAATACCTCCATCCTGAACCTGCGTTACGAATCCAATCACCTGATCGACCT

F3 GTCTCGTTACGCTTCCAAAATCAACATCGGTTCTAAAGTTAACTTCGATCCAATCGACA

F4 AGAATCAGATCCAGCTGTTCAATCTGGAATCTTCCAAAATCGAAGTTATCCTGAAGAAT

F5 GCTATCGTATACAACTCTATGTACGAAAACTTCTCCACCTCCTTCTGGATTCGTATCCC

F6 AAAATACTTCAACTCCATCTCTCTGAACAATGAATACACCATCATCAACTGCATGGAAA

F7 ACAATTCTGGTTGGAAAGTATCTCTGAACTACGGTGAAATCATCTGGACTCTGCAGGAC

F8 ACTCAGGAAATCAAACAGCGTGTTGTATTCAAATACTCTCAGATGATCAACATCTCTGA

F9 CTACATCAATCGTTGGATCTTCGTTACCATCACCAACAATCGTCTGAATAACTCCAAAA

F10 TCTACATCAACGGCCGTCTGATCGACCAGAAACCAATCTCCAATCTGGGTAACATCCAC

F11 GCTTCTAATAACATCATGTTCAAACTGGACGGTTGCCGTGACACTCACCGTTACATCTG

F12 GATCAAATACTTCAATCTGTTCGACAAAGAACTGAACGAAAAAGAAATCAAAGATCTGT

F13 ACGACAACCAGTCCAATTCTGGTATCCTGAAAGACTTCTGGGGTGACTACCTGCAGTAC

F14 GACAAACCATACTACATGCTGAATCTGTACGATCCAAACAAATACGTTGACGTCAACAA

F15 TGTAGGTATCCGTGGTTACATGTACCTGAAAGGTCCACGTGGTTCTGTTATGACTACCA

F16 ACATCTACCTGAACTCTTCCCTGTACCGTGGTACCAAATTCATCATCAAGAAATACGCG

F17 TCTGGTAACAAGGACAATATCGTTCGTAACAATGATCGTGTATACATCAATGTTGTAGT

F18 TAAGAACAAAGAATACCGTCTGGCTACCAATGCTTCTCAGGCTGGTGTAGAAAAAATCT

F19 TGTCTGCTCTGGAAATCCCAGACGTTGGTAATCTGTCTCAGGTAGTTGTAATGAAATCC

F20 AAGAACGACCAGGGTATCACTAACAAATGCAAAATGAATCTGCAGGACAACAATGGTAA

F21 CGATATCGGTTTCATCGGTTTCCACCAGTTCAACAATATCGCTAAACTGGTTGCTTCCA

F22 ACTGGTACAATCGTCAGATCGAACGTTCCTCTCGTACTCTGGGTTGCTCTTGGGAGTTC

F23 ATCCCAGTTGATGACGGTTGGGGTGAACGTCCACTGCATCATCATCATCATCATTAAGC

GGCCGCAAGCTTGGG

23 reverse primers corresponding following (5 '-3 ' end) with above-mentioned 23 forward primers:

B1： CCCAAGCTTGCGGCCGCTTAATGATGATGATGATGATGCAGTGG

B2： ACGTTCACCCCAACCGTCATCAACTGGGATGAACTCCCAAGAGCAACCCAGAGTACGAG

B3： AGGAACGTTCGATCTGACGATTGTACCAGTTGGAAGCAACCAGTTTAGCGATATTGTTG

B4： AACTGGTGGAAACCGATGAAACCGATATCGTTACCATTGTTGTCCTGCAGATTCATTTT

B5： GCATTTGTTAGTGATACCCTGGTCGTTCTTGGATTTCATTACAACTACCTGAGACAGAT

B6： TACCAACGTCTGGGATTTCCAGAGCAGACAAGATTTTTTCTACACCAGCCTGAGAAGCA

B7： TTGGTAGCCAGACGGTATTCTTTGTTCTTAACTACAACATTGATGTATACACGATCATT

B8： GTTACGAACGATATTGTCCTTGTTACCAGACGCGTATTTCTTGATGATGAATTTGGTAC

B9： CACGGTACAGGGAAGAGTTCAGGTAGATGTTGGTAGTCATAACAGAACCACGTGGACCT

B10：?TTCAGGTACATGTAACCACGGATACCTACATTGTTGACGTCAACGTATTTGTTTGGATC

B11：?GTACAGATTCAGCATGTAGTATGGTTTGTCGTACTGCAGGTAGTCACCCCAGAAGTCTT

B12：?TCAGGATACCAGAATTGGACTGGTTGTCGTACAGATCTTTGATTTCTTTTTCGTTCAGT

B13：?TCTTTGTCGAACAGATTGAAGTATTTGATCCAGATGTAACGGTGAGTGTCACGGCAACC

B14：?GTCCAGTTTGAACATGATGTTATTAGAAGCGTGGATGTTACCCAGATTGGAGATTGGTT

B15：?TCTGGTCGATCAGACGGCCGTTGATGTAGATTTTGGAGTTATTCAGACGATTGTTGGTG

B16：?ATGGTAACGAAGATCCAACGATTGATGTAGTCAGAGATGTTGATCATCTGAGAGTATTT

B17：?GAATACAACACGCTGTTTGATTTCCTGAGTGTCCTGCAGAGTCCAGATGATTTCACCGT

B18：?AGTTCAGAGATACTTTCCAACCAGAATTGTTTTCCATGCAGTTGATGATGGTGTATTCA

B19：?TTGTTCAGAGAGATGGAGTTGAAGTATTTTGGGATACGAATCCAGAAGGAGGTGGAGAA

B20：?GTTTTCGTACATAGAGTTGTATACGATAGCATTCTTCAGGATAACTTCGATTTTGGAAG

B21：?ATTCCAGATTGAACAGCTGGATCTGATTCTTGTCGATTGGATCGAAGTTAACTTTAGAA

B22：?CCGATGTTGATTTTGGAAGCGTAACGAGACAGGTCGATCAGGTGATTGGATTCGTAACG

B23：?CAGGTTCAGGATGGAGGTATTGATGATGTTCTTGATGTATTCAGCCATGGTGAATTCCG。

Shown in the steps A-C among Fig. 1, at first, method (overlapping extension PCR) by artificial splicing, utilize the mutual complementation of 23 pairs of primers that full length sequence is spliced into three sections, difference called after A, B and C, after reaction finishes, to A, three kinds of pcr amplification products of B and C carry out 1% agarose gel electrophoresis and detect, use DNA recovery test kit recovery length to be about 500bp respectively available from ancient cooking vessel state company, the purpose fragment of 400bp and 400bp is also carried out purifying to it, to reclaim fragment connects among the T-A carrier pGEM-T (Promega company), to connect product transformed into escherichia coli (E.coli) DH5 α competent cell (TIANGEN) again, screening positive clone, the upgrading grain, contained the recovery Segment A respectively, B, the recombinant plasmid of C, difference called after pGEM-T-A, pGEM-T-B, pGEM-T-C, it is checked order, sequencing result shows that amplified fragments A has the nucleotide sequence of the SEQ ID NO:3 in the sequence table, by 484 based compositions, in the code sequence tabulation among the SEQ ID NO:1 from aminoterminal 1-161 amino acids residue; Amplified fragments B has the nucleotide sequence of the SEQ ID NO:4 in the sequence table, by 413 based compositions, in the code sequence tabulation among the SEQ ID NO:1 from aminoterminal 162-299 amino acids residue; Amplified fragments C has the nucleotide sequence of the SEQ ID NO:5 in the sequence table, by 390 based compositions, in the code sequence tabulation among the SEQ ID NO:1 from aminoterminal 300-429 amino acids residue, again with B and C splicing, 50 μ l PCR reaction systems are: as fragment B and each 0.5 μ l of C of template DNA, pfu Taq 0.5 μ l, 10 * PCR damping fluid (contains Mg ²⁺) 5 μ l, dNTPs (each 25mM) 4 μ l, each 0.5 μ l of primers F 10 and B23 uses ddH ₂O postreaction system to 50 μ l, the PCR reaction conditions is: 95 ℃ of 3min of elder generation; 94 ℃ of 50s then, 62 ℃ of 50s, 72 ℃ of 60s, totally 25 circulations; Last 72 ℃ of 10min, obtain fragment BC, at last with Segment A and fragment BC splicing, outside the removing template, PCR reaction system and reaction conditions are same as described above, the purpose fragment of splicing the back acquisition is carried out 1% agarose gel electrophoresis to be detected, reclaiming test kit recovery length with DNA is respectively the purpose fragment of 1287bp and it is carried out purifying, to reclaim fragment connects among the carrier pGEM-T, to connect product transformed into escherichia coli (E.coli) DH5 α competent cell again, screening positive clone, the upgrading grain obtains containing the segmental recombinant plasmid of purpose, called after pGEM-Hc, it is checked order, and sequencing result shows that the purpose fragment has the nucleotide sequence of the SEQ ID NO:1 in the sequence table, by 1287 based compositions, its encoding sequence is from 5 ' end 1-1287 bit base, coding has the protein of the amino acid residue sequence of SEQ ID NO:2 in the sequence table, is positioned between the 868aa-1296aa of botulinum toxin type A, and molecular weight of albumen is about 50KD.Sequencing result shows and has obtained the correct total length Hc gene through optimizing of sequence, is HcA with this unnamed gene, its proteins encoded called after HcA.

The structure of embodiment 2, prokaryotic expression carrier pTIG-Trx-Hc and the expression and purification of recombinant protein HcA in intestinal bacteria

Shown in step D and E among Fig. 1, make HcA in intestinal bacteria, obtain to express and purifying with following method, obtain the HcA that recombinates:

One, the structure of prokaryotic expression carrier pTIG-Trx-Hc

Trx (Trx) is to participate in the folding accessory protein of newborn protein peptide chain, as recombinant protein HcA with it during coexpression, it can promote the folding target protein in downstream to obtain correct folding by isomerization reaction, in addition, also can strengthen the formation of the disulfide linkage of intracellular protein, make expression product be difficult for forming inclusion body, can express, therefore make up the HcA Prokaryotic Expression carrier that contains the Trx gene with following method with soluble form:

1, the structure of recombinant vectors pTIG-Trx

At first, (derive from the Trx gene order in pET-32a (+) carrier of Novagen company by regular-PCR method clone (is template with carrier pET-32a (+)) thioredoxin gene sequence, what be positioned at this carrier holds 366-692 bit base place from 5 ', its nucleotides sequence is classified SEQ ID NO:8 in the sequence table as, 109 amino-acid residues of encoding), then the Trx gene order that obtains is connected between the NdeI and EcoR I restriction enzyme site of plasmid vector pET-22b (+) (Novagen company), obtain containing the recombinant vectors of Trx gene, called after pTIG-Trx, the back of its multiple clone site has the sequence label (pET-22b (+) carries) of 6 Histidines of coding, and the structure of multiple clone site is as follows:

5’-Nde?I-Trx-GCGGGATCCGG

AATTCGA…-Sac?I-Sal?I-Hind?III-Not?I-XhoI-6His-TAG-3’RBS?EcoRI。

2, the acquisition of prokaryotic expression carrier pTIG-Trx-Hc

The plasmid pGEM-Hc that obtains with embodiment 1 is a template, at primers F-HcE:

5 '-GCCG GAATTC

GAATACATCAAGAACATCATC-3 ' (being with single underscore base is restriction enzyme EcoR I recognition site, and base is a terminator codon in the square frame, and band double underline base is an initiator codon) and primer R-HcX:5 '-CTAG CTCGAGUnder the guiding of AGTGGACGTTCACCCCAAC-3 ' (band underscore base is a restriction enzyme XhoI recognition site), pcr amplification total length HcA gene order, and add EcoR I and Xho I recognition site respectively at the sequence two ends, after reaction finishes, pcr amplification product is carried out 1% agarose gel electrophoresis to be detected, reclaiming test kit with DNA reclaims the purpose fragment of the about 1300bp of length and it is carried out purifying, with reclaim fragment with EcoR I be connected with carrier pTIG-Trx after Xho I carries out double digestion through the same enzyme double digestion, to connect product transformed into escherichia coli (E.coli) DH5 α competent cell, screening positive clone, the upgrading grain, order-checking, sequencing result shows the prokaryotic expression carrier that has obtained all correct HcA of sequence and on position, called after pTIG-Trx-Hc.

Two, the expression of HcA in intestinal bacteria and the purifying of expression product

1, the expression of HcA in intestinal bacteria and the SDS-PAGE detection of expression product

Prokaryotic expression carrier pTIG-Trx-Hc transformed into escherichia coli BL21 (DE3) competent cell (TIANGEN company) of the HcA that step 1 is made up, the screening positive recombinant, the negative contrast of reorganization bacterium of pTIG-Trx empty carrier is arranged with conversion, in 1: 100 ratio the positive bacterium of recombinating is seeded in the 1000mL LB liquid nutrient medium that contains the 100mg/mL penbritin then, under 37 ℃, 250rpm, cultivate in a large number, be cultured to logarithmic phase (OD ₆₀₀Be about 0.4-0.6) time add chemical inducer IPTG to final concentration be 0.2mmol/L, continued inducing culture 5 hours down at 30 ℃, preceding respectively at inducing, induce sampling after 3 hours and 5 hours.After cultivating end, the ultrasonic cell of smashing, centrifugal collection supernatant carries out 12%SDS-PAGE and detects, (swimming lane 1 is the expression product of inducing 5 hours to the result as shown in Figure 2, swimming lane 2 is the expression product of inducing 3 hours, swimming lane 3 is the protein standard molecular weight, swimming lane 4 is not for inducing contrast, swimming lane 5 is the empty carrier contrast), result's demonstration is expressed in the solubility mode through the recombinant protein of abduction delivering, and molecular weight is about 50KD, consistent with the molecular weight of expection, and this target protein band does not appear in the contrast of inductive bacterial strain and inductive empty carrier, illustrates that expressed albumen may be exactly target protein HcA, and as seen from Figure 2,30 ℃ of following abduction deliverings after 3 hours proteic expression amount can reach higher level, by analysis, expression product can reach 53% after accounting for 36%, 5 hour of bacterium solubility total protein.

2, the purifying of expression product, Western blot and ELISA identify and Detection of Stability

1) purifying of target protein

The C of the recombinant protein HcA that step 1 is expressed end contain six histidine-tagged, therefore with Ni-NTA affinity column (available from Pharmacia Corp) and with reference to specification sheets the solubility expression product is carried out purifying, purification process is: earlier with the Ni-NTA affinity chromatography resin-bonded after ultrasonic supernatant and the balance, then with the binding buffer liquid washing that contains 10-100mM imidazoles (concentration of 10T and 100mM is all washed), again with the elution buffer wash-out that contains the 500mM imidazoles, obtain purifying protein, then purified albumen being carried out 12%SDS-PAGE detects, (swimming lane 1 is low molecular weight protein (LMWP) Marker to detected result as shown in Figure 3, molecular weight ranges 14.4-116KD, the purified product of swimming lane 2 for obtaining behind the elution buffer wash-out through containing the 500mM imidazoles, swimming lane 3 is the product behind the PBS dialysis desalting), detected result shows and has obtained highly purified target protein, through the thin layer scanning analysis, the lipidated protein that is purified to reaches 95%, and output can reach more than the 30mg/L.

2) the Western blot of expression product and ELISA identify

Respectively with mouse-anti His-tag mAb (available from MERCK) and Ma Yuankang BONT/A how anti-(available from Nat'l Pharmaceutical ﹠ Biological Products Control Institute) be one anti-, with HRP mark sheep anti-mouse igg (available from Sigma company) or the anti-horse IgG of HRP mark rabbit (available from biological company limited of China fir Golden Bridge in Beijing) is two anti-empty carrier to be contrasted, the ultrasonic supernatant of abduction delivering and the recombinant protein of purifying carry out Western blot and analyze, more abduction delivering or purified recombinant protein resist all and can specificity combine with mouse-anti His-tag mAb and Ma Yuankang BoNT/A as a result, size position and electrophoresis position consistency, molecular weight is about 50KD, shows that abduction delivering or purified recombinant protein are target protein HcA.In addition, also empty carrier contrast, the ultrasonic supernatant of abduction delivering and the recombinant protein of purifying have been carried out the ELISA detection with A type Botulinum Antitoxin, A type Botulinum Antitoxin and expression as a result and purified BoN/A HcA albumen have the specific combination activity, and with the debond of empty carrier abduction delivering product, show that recombinant expression protein has the molecular conformation of native protein, can be discerned by the specificity toxinicide.

3) Detection of Stability of recombinant protein HcA

As seen, the recombinant protein HcA of expression is more stable from above-mentioned expression and purge process, does not degrade in expression and purge process.The stability of recombinant protein HcA under preservation condition for further purification Identification, to under differing temps, preserving the certain period (4 ℃ (1 month),-20 ℃ and-80 ℃ (3 months and 6 months)) recombinant protein HcA carry out the 12%SDS-PAGE detection, the recombinant protein HcA of purifying is 4 ℃ (1 months) as a result,-20 ℃ and-80 ℃ (3 months and 6 months) all keep stablizing, even also do not degrade, show that the present invention expresses the reorganization HcA that obtains with aforesaid method and has advantages of higher stability through multigelation.

Behind embodiment 3, the reorganization HcA protein subunit vaccine immune mouse body fluid and cellular immune level detects and body in and determination of activity

To express also purified recombinant protein HcA among the embodiment 2 as the subunit vaccine immune mouse, to detect its immunogenicity, concrete grammar is: with Balb/c little (age in 6-8 week, female, the SPF level is available from Military Medical Science Institute's Experimental Animal Center) be divided into 4 groups at random, 6 every group, immune group I, II and III be immune 10 μ g, 5 μ g and 1 μ g recombinant protein HcA respectively, and the control group immunity does not contain the PBS of recombinant protein HcA.Before the immunity, recombinant protein HcA is dissolved in 200 μ lPBS, complete with the Fu Shi Freund's complete adjuvant (Sigma company) of same dose again by 1: 1 mixed, subcutaneous then multi-point injection carries out initial immunity, the freund 's incomplete adjuvant (Sigma company) that after 2 weeks the recombinant protein HcA of same dose is dissolved in behind the 200 μ l PBS with same dose carries out booster immunization by 1: 1 complete subcutaneous multi-point injection of mixed, 2 Zhou Houzai carry out booster immunization once with same dose, and subcutaneous multiple spot and abdominal injection immunity are once.Before each immunity, and last immunity the 2nd and the 4th week of back, mouse tail or eyeball blood sampling, separation of serum, (use enzyme linked immunological plate bag with the ELISA method by HcA antigen, concentration is 2 μ g/mL, is one anti-with isolating immune serum, is two anti-with HRP mark sheep anti-mouse igg (available from Sigma company)) measure serum antibody.Lymphocytic multiplication capacity is an important indicator of cellullar immunologic response, measures lymphocytic multiplication capacity with the MTS method, and method is: last immunity back the 4th all extracting spleen cells, preparation concentration is 10 ⁶The splenocyte suspension of individual/mL, at external use antigen HcA, concentration is that 10 μ g/mL stimulate, and detects the T ability of cell proliferation with the MTS method after 4 days.

ELISA detected result: after the immunity once, immune group I (10 μ g high dose group), II (dosage group among the 5 μ g) and III (1 μ g low dose group) serum antibody titer reaches 12800 respectively, 6400 and 3200, increase along with immune time, antibody titers also obtains corresponding raising, can produce the high-level antibody titre after immune 4 times, reach 409600 respectively, 409600 and 204800, and compare before contrast immune group serum and the immunity and be always negative, above-mentioned detected result can make the specific antibody that produces higher titre in its body after showing recombinant protein HcA immune mouse.

The MTS method measurement result of lymphocytic multiplication capacity shows to induce in the immune group mouse body and produced special t cell immune response, and its SI value is respectively 1.9,2.5 and 2.4, and the SI value of contrast immune group mouse is 1.1 (P＜0.05, significant differences).

Above-mentioned detected result shows that each dosage immune group all can produce specific high titre antibody and can cause cellullar immunologic response by induced animal.

In addition, also with in the classical body and measuring neutralization activity and NAT in the body of immune serum antibody, method is: can protect 10LD after immune group I, II and III serum antibody were diluted by 1: 10 ₅₀And 100LD ₅₀The attack of botulinum toxin type A; Then, after further immune group I serum antibody being diluted in 1: 10,1: 100,1: 1000 and 1: 10000 ratio respectively, use 10LD ₅₀And 100LD ₅₀Botulinum toxin type A (the international standard strain is available from Lanzhou Institute of Biological Products for BoNT/A, A62) is attacked, and can protect 10LD fully when serum antibody was by dilution in 1: 1000 as a result ₅₀The attack of botulinum toxin type A when serum antibody is pressed 1: 10000 dilution proportion, also can partly be protected 10LD ₅₀The attack of botulinum toxin type A, The above results shows the botulinum toxin type A neutralizing antibody that contains higher level in the immune serum, immune serum also can in and body in botulinum toxin type A, anti-poisoning in advance, therefore, HcA of the present invention can be used for preparing high titre immune serum, is used in the body and botulinum toxin type A (toxinicide) or be used to prepare the botulinum toxin type A subunit vaccine.

Embodiment 4, detect behind the reorganization HcA protein subunit vaccine immune mouse provide protection to botulinum toxin type A

The experimental result of embodiment 3 can produce high titer antibody level and neutralizing antibody after showing 1 μ g recombinant protein HcA immune mouse 3 times; further estimate behind the recombinant protein HcA immune mouse the botulinum toxin type A provide protection with following method: Balb/c mouse (6-8 age in week of pressing the method immunity two or three times of embodiment 3 with 1 μ g recombinant protein HcA; female; the SPF level; available from Military Medical Science Institute's Experimental Animal Center) carry out challenge test; with the PBS mice immunized is contrast; statistics survival rate and the time, at first to the mouse of 1 μ g recombinant protein HcA immunity secondary with 10 ⁴LD ₅₀Botulinum toxin type A (the international standard strain is available from Lanzhou Institute of Biological Products for BoNT/A, A62) is attacked poison, and the result is as shown in table 1, shows that it can protect botulinum toxin type A to attack, and escalated dose subsequently is with 10 ⁵Or 10 ⁶LD ₅₀Botulinum toxin type A is to other group mouse of second immunisation and with 10 ⁵With 10 ⁶LD ₅₀Botulinum toxin type A is to attacking poison through three mice immunized, and the result is as shown in table 1, shows that these immune group mouse all can protect botulinum toxin type A to attack, and the no abnormal symptom of immune group mouse, but control group mice is with 10 ²LD ₅₀Botulinum toxin type A is attacked poison, and the botulinus toxin toxicity symptom all takes place mouse, and is dead in 5 hours.Above test-results shows that HcA has good immunogenicity, can protect 10 with 1 μ g dosage immunity secondary ⁶LD ₅₀The attack of botulinum toxin type A so can be used for preparing the botulinum toxin type A subunit vaccine, is poisoned with the prevention botulinum toxin type A.

Table 1 recombinant protein HcA immune mouse protection botulinum toxin type A is attacked the test-results of poison

The SFV replicon carrier of embodiment 5, HcA and traditional Construction of eukaryotic

Contain the SFV replicon carrier of gene HcA of the present invention and traditional carrier for expression of eukaryon with following method structure:

One, the structure of the SFV replicon carrier of HcA

PSFV1 is the replicon expression vector based on RNA of Invitrogen company, the present inventor is a skeleton with semliki forest virus deutero-replicon carrier pSFV1, by being cloned into the CMV promotor in 5 ' UTR upstream, insert BGH Transcription Termination subsequence and oneself in 3 ' UTR downstream and shear ribozyme HDVr sequence, it is transformed into replicon carrier system based on DNA, called after pSCAR, the part-structure synoptic diagram of this carrier is seen the figure A among Fig. 4, this replicon carrier is the high level expression foreign gene in vivo and in vitro, its detailed construction process is seen document (Yu Yunzhou etc., biological chemistry and biophysics progress, 2006,33 (1): 87-94).At first, be template with plasmid pGEM-Hc, at primers F-HcN:5 '-GCCG CATATGGGAATACATCAAGAACATCATCAATACCTCC-3 ' (band underscore base is a restriction enzyme Nde I recognition site) and sequence R-HcC:5 '-TGAC ATCGATUnder the guiding of TTACAGTGGACGTTCACCCCAAC-3 ' (band underscore base is a restriction enzyme Cla I recognition site), pcr amplification length is about the full length sequence of 1.3kb gene HcA, after recovery and this purpose fragment of purifying, it is carried out behind the double digestion with restriction enzyme Nde I and Cla I (the secretion signal peptide-coding sequence of introducing at pSCAR (is Ig-chain leader sequence with carrier pSCARS through the same enzyme double digestion, called after S (derives from pSecTag, Invitrogen company), its nucleotides sequence is classified SEQ ID NO:6 in the sequence table as, the aminoacid sequence of SEQ ID NO:7 in the code sequence tabulation) recombinant vectors that obtains after, this sequence is between the BamH of pSCAR I and Nde I restriction enzyme site) connect, to connect product transformed into escherichia coli (E.coli) DH5 α competent cell, screening positive clone, the upgrading grain, order-checking, sequencing result shows the SFV replicon carrier that has obtained all correct HcA of sequence and on position, called after pSCARSHc, its part-structure synoptic diagram is seen the figure A among Fig. 4.

Two, traditional Construction of eukaryotic of HcA

After the SFV replicon carrier pSCARSHc that contains HcA that step 1 is made up carries out double digestion with restriction enzyme BamH I and SpeI, reclaim the also dna fragmentation that contains gene HcA of the about 2.0Kb of purifying, it is connected with pcDNA3.1 (+) (Invitrogen company) through the carrier of same enzyme double digestion, to connect product transformed into escherichia coli (E.coli) DH5 α competent cell, screening positive clone, the upgrading grain, order-checking, sequencing result shows the traditional carrier for expression of eukaryon that has obtained all correct HcA of sequence and on position, called after pcDNASHc, its part-structure synoptic diagram is seen the figure B among Fig. 4.

The detection of the SFV replicon carrier of embodiment 6, HcA and traditional carrier for expression of eukaryon vivoexpression botulinum toxin type A receptor binding domain Hc

At first, with pSCARSHc transfection BHK21 cell and Chinese hamster ovary celI (all available from ATCC company), with the pSCAR empty carrier is contrast, respectively polyvalent antibody that obtains behind the recombinant protein HcA immune mouse that obtains with embodiment 3 and botulinum toxin type A toxinicide how anti-(available from the Beijing Biological Product Inst., Ministry of Public Health) be one anti-, with HRP mark sheep anti-mouse igg (available from Sigma company) and the anti-horse IgG of HRP mark rabbit (available from biological company limited of China fir Golden Bridge in Beijing) is two anti-, detect through the BHK21 of pSCARSHc transfection cell and Chinese hamster ovary celI with immunofluorescence technique (IFA), the result all is positive, and pSCAR empty carrier transfectional cell does not have fluorescence, and detected result shows that HcA has obtained expression in transfectional cell.

Then, extraction is through the BHK21 of pSCARSHc transfection cell and Chinese hamster ovary celI, and the total protein of pSCAR empty carrier transfectional cell, again to the culture supernatant of above-mentioned total protein and above-mentioned transfectional cell, how anti-with the polyvalent antibody that obtains behind the recombinant protein HcA immune mouse and botulinum toxin type A toxinicide respectively is one anti-, with HRP mark sheep anti-mouse igg (available from Sigma company) and the anti-horse IgG of HRP mark rabbit (available from biological company limited of China fir Golden Bridge in Beijing) is that the two anti-Western blot that carry out detect, the result is through the BHK21 of pSCARSHc transfection cell and Chinese hamster ovary celI, and culture supernatant has specific band to produce in the 50kDa position, consistent with HcA recombinant protein size, then there is not this band in the control cells, show that HcA obtains to express in the pSCARSHc transfectional cell, also contain BoNT/A Hc antigen in the culture supernatant of pSCARSHc transfectional cell, The above results shows SFV replicon carrier secreting, expressing BoNT/A Hc antigen, the i.e. HcA effectively that contains secretion signal peptide sequence and HcA.

In addition, also detected respectively through pSCARSHc with the ELISA method, the specific combination activity of the polyvalent antibody that obtains behind the how anti-and recombinant protein HcA immune mouse of the BHK21 cell of pcDNASHc transfection and the lysate of Chinese hamster ovary celI and culture supernatant and A type Botulinum Antitoxin, with pSCAR empty carrier transfectional cell is contrast, the polyvalent antibody specific combination that all can be obtains behind the how anti-and recombinant protein HcA immune mouse of the cell pyrolysis liquid of pSCARSHc and pcDNASHc transfectional cell and culture supernatant as a result with A type Botulinum Antitoxin, and contrast debond with empty carrier, show that recombinant expression protein HcA has the molecular conformation of native protein, can specificity be resisted identification more by A type Botulinum Antitoxin.

The SFV replicon carrier of embodiment 7, HcA and the immunogenicity of traditional carrier for expression of eukaryon vaccine are relatively

Find that after deliberation the replicative DNA carrier just can be induced when low dosage and be produced good immune response, its consumption is well below traditional dna vector (Leitner WW, et al., Cancer research, 2000,60 (1): 51-55).The immune response of present embodiment after to SFV replicon carrier (the 3-100 μ g) immune mouse of the HcA of various dose estimated, and the traditional DNA carrier for expression of eukaryon with HcA is contrast simultaneously.Concrete grammar is: respectively with the SFV replicon carrier pSCARSHc of 3 μ g, 30 μ g and 100 μ g and traditional dna vector pcDNASHc immune Balb/c mouse (6-8 age in week respectively, female, the SPF level, available from Military Medical Science Institute's Experimental Animal Center), 6 mouse of each dosage group, immunization route are the leg muscle injection, and immunity is 4 times altogether, 2 weeks were contrast with pSCAR empty carrier immune group at interval.Immunity finishes back 28 days, detects the humoral immunity level of mouse with the ELISA method, is one anti-with immunity back mice serum, is two anti-mensuration serum antibodies in order to HRP mark sheep anti-mouse igg (available from Sigma company).Lymphocytic multiplication capacity is an important indicator of cellullar immunologic response, also measures lymphocytic multiplication capacity with the MTS method, and method is: last immunity back the 4th all extracting spleen cells, preparation concentration is 10 ⁶The splenocyte suspension of individual/mL, HcA stimulates at external use antigen, detects the T ability of cell proliferation with the MTS method after 4 days.

ELISA method detected result is: the humoral antibody level of 3 μ g and 30 μ g SFV replicon carrier pSCARSHc immune mouses is higher than antibody horizontal (P＜0.05 of 100 μ g immune group, significant difference is described), be the latter 6-7 doubly, reach 12800-25600, show that the amplicon dna vaccine can induce the stronger immune response of generation than low dosage the time, and when higher dosage (100 μ g), can not produce good immune response on the contrary, this performance is the characteristics of replicon vaccine just, and also the test-results of having reported with great majority is consistent.And compare with traditional dna vector, replicon carrier produces higher antibody horizontal (P＜0.01 illustrates that difference is extremely remarkable) when low dosage, when 3 μ g, nearly 50 times have been improved, 30 μ g have improved more than 13 times, have embodied few, the effective advantage of amplicon dna vaccine consumption.

The MTS measurement result shows that each immune group of the SFV replicon carrier pSCARSHc of HcA and traditional dna vector pcDNASHc vaccine is all induced and has produced special t cell immune response (P＜0.05, compare with the empty carrier contrast), compare with 100 μ g immune group, the replicon vaccine can be induced higher T cell proliferative response (P＜0.01) when 3 μ g and 30 μ g, each immune group of replicon vaccine is higher than traditional dna vaccination immune group (P＜0.05) significantly, and especially the former utmost point is higher than the latter (P＜0.01) significantly when low dosage.

Above-mentioned detected result shows, humoral immunoresponse(HI) that can both inducing producing specificity behind the SFV replicon carrier pSCARSHc of HcA and the traditional dna vector pcDNASHc immune mouse, through repeatedly reaching a quite high level behind the booster immunization, the same dosage report level that is higher than external Hc nucleic acid vaccine, and compare with traditional dna vector, but the SFV replicon carrier produces higher antibody horizontal and cellular immune level in the inductor when low dosage, illustrate that SFV replicon vaccine has better immune effect.

Embodiment 8, detect behind the SFV replicon carrier vaccines immune mouse of HcA the botulinum toxin type A provide protection

With the SFV replicon carrier pSCARSHc immunity Balb/c mouse of the HcA of 30 μ g (6-8 age in week, female, the SPF level is available from Military Medical Science Institute's Experimental Animal Center), immunity is 3 times altogether, and at interval two weeks, immunity finishes the back and detects humoral immunity level with the ELISA method.The immune group antibody titers is 1600-3200 before the challenge test as a result.Carry out challenge test then, method is: with pSCAR empty carrier mice immunized is contrast, statistics antibody titers and survival rate, at first to the Balb/c mouse of the SFV replicon carrier pSCARSHc immunity of above-mentioned HcA through 30 μ g 3 times with 10 ²LD ₅₀Botulinum toxin type A (the international standard strain is available from Lanzhou Institute of Biological Products for BoNT/A, A62) is attacked poison, and the result is as shown in table 2, shows that SFV replicon carrier pSCARSHc immune mouse can protect 10 3 times fully ²The attack of LD50A BOTULINUM TOXIN TYPE A A, but control group mice is with 10 ²LD ₅₀Botulinum toxin type A is attacked poison, and the botulinus toxin toxicity symptom all takes place mouse, and is dead in 5 hours; Escalated dose uses 10 respectively subsequently ³, 10 ⁶LD ₅₀Botulinum toxin type A is attacked poison to 3 mice immunized, and the result is as shown in table 2, and the immune group mouse can protect 10 ³LD ₅₀Botulinum toxin type A is attacked, and the no abnormal symptom of immune group mouse, but 10 ⁶LD ₅₀Botulinus toxin toxicity symptom (compare with control group, its poisoning is lighter, and the death time is delayed) takes place in botulinum toxin type A attack group mouse.Above test-results shows that the SFV replicon carrier vaccines of HcA of the present invention has good immunogenicity, can protect 10 3 times with the immunity of 30 μ g dosage ³LD ₅₀The attack of botulinum toxin type A so can be used for preparing the botulinum toxin type A nucleic acid vaccine, is poisoned with the prevention botulinum toxin type A.

The SFV replicon nucleic acid vaccine immunity mouse of table 2HcA is to protection botulinum toxin type A challenge test result

The SFV replicon nucleic acid vaccine of embodiment 9 detection HcA and the body fluid behind the HcA subunit vaccine combined utilization immune mouse and cellular immune level reach the provide protection to botulinum toxin type A

The SFV replicon nucleic acid vaccine that the experimental result of embodiment 7 and embodiment 8 shows HcA has produced higher antibody horizontal in the inductor after immunity repeatedly; but compare with recombinant protein HcA immune group; very big gap is still arranged; so its issuable provide protection is not high enough; in order further to improve the immunogenicity of the SFV replicon nucleic acid vaccine of HcA; HcA replicon nucleic acid vaccine and HcA subunit vaccine combined utilization immune mouse detected body fluid and cellular immune level and to the provide protection of botulinum toxin type A; concrete grammar is: with Balb/c little (age in 6-8 week; female; the SPF level; available from Military Medical Science Institute's Experimental Animal Center) be divided into 4 groups at random; every group 6 or 8; group 1; group 2 and group 3 are earlier with immune 2 times of the SFV replicon carrier pSCARSHc of the HcA of 30 μ g; two weeks of interval; again recombinant protein HcA is dissolved in 200 μ l PBS; complete with the Fu Shi Freund's complete adjuvant (Sigma company) of same dose then by 1: 1 mixed; subcutaneous multi-point injection immunity 1 time; organize 4 simultaneously and be control group, the pSCARSHc immunity of usefulness same dose 3 times.Immunity finishes 2 weeks of back, mouse tail or eyeball blood sampling, and separation of serum detects humoral immunity level with the ELISA method.The ELISA detected result shows, can improve the internal antibody level significantly behind the HcA subunit vaccine booster immunization, being on close level of antibody horizontal that the combined utilization group produces and subunit vaccine immune group, and be higher than SFV replicon nucleic acid vaccine group (P＜0.01) far away, significantly improved the antibody horizontal of SFV replicon nucleic acid vaccine, cellular immune level has also obtained enhancing in addition.Carry out challenge test then, method is: statistics antibody titers and survival rate, at first to above-mentioned 4 groups of Balb/c mouse through 3 immunity with 10 ², 10 ⁴, 10 ⁵With 10 ⁶LD ₅₀Botulinum toxin type A (BoNT/A, A62, international standard strain; available from Lanzhou Institute of Biological Products) attack poison; the result is as shown in table 3, can improve the provide protection of immune mouse to botulinum toxin type A significantly after showing HcA subunit vaccine booster immunization, and combined immunization group mouse can protect 10 ⁴LD ₅₀Botulinum toxin type A is attacked, but the mouse of control group group 4 is with 10 ²LD ₅₀Botulinum toxin type A is attacked poison, and the botulinus toxin toxicity symptom promptly takes place mouse, and is dead in 5 hours; Escalated dose uses 10 respectively subsequently ⁵, 10 ⁶LD ₅₀Botulinum toxin type A is attacked poison to the combined immunization group mouse of 3 immunity, and the result is as shown in table 3, and the immune group mouse is to 10 ⁵, 10 ⁶LD ₅₀Botulinum toxin type A is attacked and all can be protected, and the no abnormal symptom of immune mouse.Above-mentioned experimental result shows; the SFV replicon nucleic acid vaccine initial immunity of HcA and HcA subunit vaccine booster immunization strategy (DNA-primeprotein-booster) can increase substantially the specific humoral immunity level and the cellular immune level of nucleic acid vaccine; and can improve the protective capability of nucleic acid vaccine; so at the immune time that improves botulinum toxin type A protection effect and minimizing nucleic acid vaccine; and enrich immunne response by way of etc. the aspect be a kind of good immunization strategy, can be used for development of Type A botulinus toxin vaccine.

Protection botulinum toxin type A challenge test result behind the SFV replicon nucleic acid vaccine of table 3HcA and the HcA subunit vaccine combined utilization immune mouse

Sequence table

<160>8

<210>1

<211>1287

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>1

gaatacatca?agaacatcat?caatacctcc?atcctgaacc?tgcgttacga?atccaatcac 60

ctgatcgacc?tgtctcgtta?cgcttccaaa?atcaacatcg?gttctaaagt?taacttcgat 120

ccaatcgaca?agaatcagat?ccagctgttc?aatctggaat?cttccaaaat?cgaagttatc 180

ctgaagaatg?ctatcgtata?caactctatg?tacgaaaact?tctccacctc?cttctggatt 240

cgtatcccaa?aatacttcaa?ctccatctct?ctgaacaatg?aatacaccat?catcaactgc 300

atggaaaaca?attctggttg?gaaagtatct?ctgaactacg?gtgaaatcat?ctggactctg 360

caggacactc?aggaaatcaa?acagcgtgtt?gtattcaaat?actctcagat?gatcaacatc 420

tctgactaca?tcaatcgttg?gatcttcgtt?accatcacca?acaatcgtct?gaataactcc 480

aaaatctaca?tcaacggccg?tctgatcgac?cagaaaccaa?tctccaatct?gggtaacatc 540

cacgcttcta?ataacatcat?gttcaaactg?gacggttgcc?gtgacactca?ccgttacatc 600

tggatcaaat?acttcaatct?gttcgacaaa?gaactgaacg?aaaaagaaat?caaagatctg 660

tacgacaacc?agtccaattc?tggtatcctg?aaagacttct?ggggtgacta?cctgcagtac 720

gacaaaccat?actacatgct?gaatctgtac?gatccaaaca?aatacgttga?cgtcaacaat 780

gtaggtatcc?gtggttacat?gtacctgaaa?ggtccacgtg?gttctgttat?gactaccaac 840

atctacctga?actcttccct?gtaccgtggt?accaaattca?tcatcaagaa?atacgcgtct 900

ggtaacaagg?acaatatcgt?tcgtaacaat?gatcgtgtat?acatcaatgt?tgtagttaag 960

aacaaagaat?accgtctggc?taccaatgct?tctcaggctg?gtgtagaaaa?aatcttgtct 1020

gctctggaaa?tcccagacgt?tggtaatctg?tctcaggtag?ttgtaatgaa?atccaagaac 1080

gaccagggta?tcactaacaa?atgcaaaatg?aatctgcagg?acaacaatgg?taacgatatc 1140

ggtttcatcg?gtttccacca?gttcaacaat?atcgctaaac?tggttgcttc?caactggtac 1200

aatcgtcaga?tcgaacgttc?ctctcgtact?ctgggttgct?cttgggagtt?catcccagtt 1260

gatgacggtt?ggggtgaacg?tccactg 1287

<210>2

<211>429

<212>PRT

＜213〉artificial sequence

<220>

<223>

<400>2

Glu?Tyr?Ile?Lys?Asn?Ile?Ile?Asn?Thr?Ser?Ile?Leu?Asn?Leu?Arg?Tyr

1 5 10 15

Glu?Ser?Asn?His?Leu?Ile?Asp?Leu?Ser?Arg?Tyr?Ala?Ser?Lys?Ile?Asn

20 25 30

Ile?Gly?Ser?Lys?Val?Asn?Phe?Asp?Pro?Ile?Asp?Lys?Asn?Gln?Ile?Gln

35 40 45

Leu?Phe?Asn?Leu?Glu?Ser?Ser?Lys?Ile?Glu?Val?Ile?Leu?Lys?Asn?Ala

50 55 60

Ile?Val?Tyr?Asn?Ser?Met?Tyr?Glu?Asn?Phe?Ser?Thr?Ser?Phe?Trp?Ile

65 70 75 80

Arg?Ile?Pro?Lys?Tyr?Phe?Asn?Ser?Ile?Ser?Leu?Asn?Asn?Glu?Tyr?Thr

85 90 95

Ile?Ile?Asn?Cys?Met?Glu?Asn?Asn?Ser?Gly?Trp?Lys?Val?Ser?Leu?Asn

100 105 110

Tyr?Gly?Glu?Ile?Ile?Trp?Thr?Leu?Gln?Asp?Thr?Gln?Glu?Ile?Lys?Gln

115 120 125

Arg?Val?Val?Phe?Lys?Tyr?Ser?Gln?Met?Ile?Asn?Ile?Ser?Asp?Tyr?Ile

130 135 140

Asn?Arg?Trp?Ile?Phe?Val?Thr?Ile?Thr?Asn?Asn?Arg?Leu?Asn?Asn?Ser

145 150 155 160

Lys?Ile?Tyr?Ile?Asn?Gly?Arg?Leu?Ile?Asp?Gln?Lys?Pro?Ile?Ser?Asn

165 170 175

Leu?Gly?Asn?Ile?His?Ala?Ser?Asn?Asn?Ile?Met?Phe?Lys?Leu?Asp?Gly

180 185 190

Cys?Arg?Asp?Thr?His?Arg?Tyr?Ile?Trp?Ile?Lys?Tyr?Phe?Asn?Leu?Phe

195 200 205

Asp?Lys?Glu?Leu?Asn?Glu?Lys?Glu?Ile?Lys?Asp?Leu?Tyr?Asp?Asn?Gln

210 215 220

Ser?Asn?Ser?Gly?Ile?Leu?Lys?Asp?Phe?Trp?Gly?Asp?Tyr?Leu?Gln?Tyr

225 230 235 240

Asp?Lys?Pro?Tyr?Tyr?Met?Leu?Asn?Leu?Tyr?Asp?Pro?Asn?Lys?Tyr?Val

245 250 255

Asp?Val?Asn?Asn?Val?Gly?Ile?Arg?Gly?Tyr?Met?Tyr?Leu?Lys?Gly?Pro

260 265 270

Arg?Gly?Ser?Val?Met?Thr?Thr?Asn?Ile?Tyr?Leu?Asn?Ser?Ser?Leu?Tyr

275 280 285

Arg?Gly?Thr?Lys?Phe?Ile?Ile?Lys?Lys?Tyr?Ala?Ser?Gly?Asn?Lys?Asp

290 295 300

Asn?Ile?Val?Arg?Asn?Asn?Asp?Arg?Val?Tyr?Ile?Asn?Val?Val?Val?Lys

305 310 315 320

Asn?Lys?Glu?Tyr?Arg?Leu?Ala?Thr?Asn?Ala?Ser?Gln?Ala?Gly?Val?Glu

325 330 335

Lys?Ile?Leu?Ser?Ala?Leu?Glu?Ile?Pro?Asp?Val?Gly?Asn?Leu?Ser?Gln

340 345 350

Val?Val?Val?Met?Lys?Ser?Lys?Asn?Asp?Gln?Gly?Ile?Thr?Asn?Lys?Cys

355 360 365

Lys?Met?Asn?Leu?Gln?Asp?Asn?Asn?Gly?Asn?Asp?Ile?Gly?Phe?Ile?Gly

370 375 380

Phe?His?Gln?Phe?Asn?Asn?Ile?Ala?Lys?Leu?Val?Ala?Ser?Asn?Trp?Tyr

385 390 395 400

Asn?Arg?Gln?Ile?Glu?Arg?Ser?Ser?Arg?Thr?Leu?Gly?Cys?Ser?Trp?Glu

405 410 415

Phe?Ile?Pro?Val?Asp?Asp?Gly?Trp?Gly?Glu?Arg?Pro?Leu

420 425

<210>3

<211>484

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>3

gaatacatca?agaacatcat?caatacctcc?atcctgaacc?tgcgttacga?atccaatcac 60

ctgatcgacc?tgtctcgtta?cgcttccaaa?atcaacatcg?gttctaaagt?taacttcgat 120

ccaatcgaca?agaatcagat?ccagctgttc?aatctggaat?cttccaaaat?cgaagttatc 180

ctgaagaatg?ctatcgtata?caactctatg?tacgaaaact?tctccacctc?cttctggatt 240

cgtatcccaa?aatacttcaa?ctccatctct?ctgaacaatg?aatacaccat?catcaactgc 300

atggaaaaca?attctggttg?gaaagtatct?ctgaactacg?gtgaaatcat?ctggactctg 360

caggacactc?aggaaatcaa?acagcgtgtt?gtattcaaat?actctcagat?gatcaacatc 420

tctgactaca?tcaatcgttg?gatcttcgtt?accatcacca?acaatcgtct?gaataactcc 480

aaaa 484

<210>4

<211>413

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>4

tctacatcaa?cggccgtctg?atcgaccaga?aaccaatctc?caatctgggt?aacatccacg 60

cttctaataa?catcatgttc?aaactggacg?gttgccgtga?cactcaccgt?tacatctgga 120

tcaaatactt?caatctgttc?gacaaagaac?tgaacgaaaa?agaaatcaaa?gatctgtacg 180

acaaccagtc?caattctggt?atcctgaaag?acttctgggg?tgactacctg?cagtacgaca 240

aaccatacta?catgctgaat?ctgtacgatc?caaacaaata?cgttgacgtc?aacaatgtag 300

gtatccgtgg?ttacatgtac?ctgaaaggtc?cacgtggttc?tgttatgact?accaacatct 360

acctgaactc?ttccctgtac?cgtggtacca?aattcatcat?caagaaatac?gcg 413

<210>5

<211>390

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>5

tctggtaaca?aggacaatat?cgttcgtaac?aatgatcgtg?tatacatcaa?tgttgtagtt 60

aagaacaaag?aataccgtct?ggctaccaat?gcttctcagg?ctggtgtaga?aaaaatcttg 120

tctgctctgg?aaatcccaga?cgttggtaat?ctgtctcagg?tagttgtaat?gaaatccaag 180

aacgaccagg?gtatcactaa?caaatgcaaa?atgaatctgc?aggacaacaa?tggtaacgat 240

atcggtttca?tcggtttcca?ccagttcaac?aatatcgcta?aactggttgc?ttccaactgg 300

tacaatcgtc?agatcgaacg?ttcctctcgt?actctgggtt?gctcttggga?gttcatccca 360

gttgatgacg?gttggggtga?acgtccactg 390

<210>6

<211>63

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>6

atggagacag?acacactcct?gctctgggta?ctgctgctct?gggttccagg?ttccactggt 60

gac 63

<210>7

<211>21

<212>PRT

＜213〉artificial sequence

<220>

<223>

<400>7

Met?Glu?Thr?Asp?Thr?Leu?Leu?Leu?Trp?Val?Leu?Leu?Leu?Trp?Val?Pro

1 5 10 15

Gly?Ser?Thr?Gly?Asp

20

<210>8

<211>327

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>8

agcgataaaa?ttattcacct?gactgacgac?agttttgaca?cggatgtact?caaagcggac 60

ggggcgatcc?tcgtcgattt?ctgggcagag?tggtgcggtc?cgtgcaaaat?gatcgccccg 120

attctggatg?aaatcgctga?cgaatatcag?ggcaaactgg?ccgttgcaaa?actgaacatc 180

gatcaaaacc?ctggcactgc?gccgaaatat?ggcatccgtg?gtatcccgac?tctgctgctg 240

ttcaaaaacg?gtgaagtggc?ggcaaccaaa?gtgggtgcac?tgtctaaagg?tcagttgaaa 300

gagttcctcg?acgctaatct?ggcggga 327

Claims

1, botulinum toxin type A receptor combination region Hc, its nucleotide sequence is shown in SEQ ID NO:1 in the sequence table.

2, contain the described expression carrier of claim 1, transgenic cell line and host bacterium.

3, expression vector according to claim 2 is characterized in that: the upstream of containing botulinum toxin type A receptor combination region Hc described in the recombinant prokaryotic expression vector of the described botulinum toxin type A receptor combination region Hc of claim 1 also is connected with Trx Trx gene; The carrier that sets out that is used to make up the recombinant prokaryotic expression vector that contains the botulinum toxin type A receptor combination region Hc is pET-22b (+), pET-32a, pET-28a, pET-28b, pET-28c, pET-21a (+) or pET-30a.

4, expression vector according to claim 3 is characterized in that: be the carrier that sets out with pET-22b (+), the recombinant prokaryotic expression vector that contains described botulinum toxin type A receptor combination region Hc and thioredoxin gene of structure is pTIG-Trx-Hc.

5, expression vector according to claim 2 is characterized in that: the carrier that sets out that is used to make up the traditional carrier for expression of eukaryon that contains the described botulinum toxin type A receptor combination region Hc of claim 1 is pcDNA, pCMV5, pSilence1.0-U6, pEGFP-N1, pSV40, pCI-neo, pTEF1, pPICZ α, pAM82 or pAAh5.

6, expression vector according to claim 5 is characterized in that: be the carrier that sets out with pcDNA3.1 (+), the recombinant eukaryon expression vector that contains described botulinum toxin type A receptor combination region Hc of structure is pcDNASHc.

7, expression vector according to claim 2, it is characterized in that: the 5 ' end that contains botulinum toxin type A receptor combination region Hc described in the replicon expression vector of the described botulinum toxin type A receptor combination region Hc of claim 1 also is connected with secreting signal peptide S encoding sequence, its nucleotides sequence is classified SEQ ID NO:6 in the sequence table as, the aminoacid sequence of SEQ ID NO:7 in the code sequence tabulation; The carrier that sets out that is used to make up the replicon expression vector that contains described botulinum toxin type A receptor combination region Hc is pSCAR; Be the carrier that sets out with pSCAR, the replicon expression vector that contains botulinum toxin type A receptor combination region Hc and secreting signal peptide S encoding sequence of structure is pSCARSHc.

8, a kind of method of expressing botulinum toxin type A receptor combination region Hc proteins encoded, be that the recombinant expression vector that will contain the described botulinum toxin type A receptor combination region Hc of claim 1 imports host cell, express obtaining botulinum toxin type A receptor combination region Hc proteins encoded.

9, the application of the described botulinum toxin type A receptor combination region Hc of claim 1 in preparation botulinum toxin type A nucleic acid vaccine.