CN105384815A - Application of scFv antibody in preparation used for treatment or prevention of infectious bursal disease of chicken - Google Patents
Application of scFv antibody in preparation used for treatment or prevention of infectious bursal disease of chicken Download PDFInfo
- Publication number
- CN105384815A CN105384815A CN201510876063.8A CN201510876063A CN105384815A CN 105384815 A CN105384815 A CN 105384815A CN 201510876063 A CN201510876063 A CN 201510876063A CN 105384815 A CN105384815 A CN 105384815A
- Authority
- CN
- China
- Prior art keywords
- antibody
- sequence
- dna
- scfv
- variable region
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The invention discloses application of an scFv antibody in a preparation used for treatment or prevention of the infectious bursal disease of chicken. The scFv-GD antibody provided by the invention comprises a heavy-chain variable region, a light-chain variable region and a joining region between the heavy-chain variable region and the light-chain variable region. The heavy-chain variable region is (a) or (b), wherein (a) is protein composed of the first to the 128th amino acid residues in a sequence 1, and (b) is protein derived from (a) through substitution and/or deletion and/or addition of amino acid residues and having same activity. The light-chain variable region is (c) or (d), wherein (c) is protein composed of the 144th to the 249th amino acid residues in the sequence 1, and (d) is protein derived from (c) through substitution and/or deletion and/or addition of amino acid residues and having same activity. The scFv-GD antibody is obtained through screening via antigen-antibody co-expression bacterium display techniques; the neutralization activity of the scFv-GD antibody is more than 10 times of the neutralization activity of a patented scFv-A antibody; and the scFv-GD antibody has the advantages of good specificity and better treatment effect.
Description
Technical field
The present invention relates to the application of a kind of scFv antibody in treatment or prevention infectious bursal disease preparation.
Background technology
Infectious bursal disease (InfectiousBursalDisease, IBD) be by chicken infectivity bursa of Fabricius virus (InfectiousBursalDiseaseVirus, IBDV) one caused, to destroy acute, the high degree in contact sexually transmitted disease that chicken immune maincenter organ-fabricius bursa is feature, has that velocity of propagation is fast, infectivity is strong, infection rate and all high feature of mortality ratio.The current various places that spread all over the world of this disease are one of main epidemic diseases of harm poultry husbandry, and the financial loss caused because of immuning failure are huge.
IBDV can lymphocyte in the chick fabricius bursa, especially breeds rapidly in bone-marrow-derived lymphocyte, causes immunosuppression, thus can enhancing body to the susceptibility of other pathogenic agent and the reactivity reduced other vaccine.Antibody drug is effective medicine at present, and hyper-immune serum and yolk antibody all can play good effect in early days in morbidity, but is limit with there is the reasons such as horizontal transmission disease due to suitability for industrialized production poor controllability.The present invention utilizes the bacteria display technology screening of Ag-Ab coexpression to obtain the scFv antibody with higher Neutralization effect.The antiviral Neutralization effect of antibody drug is directly proportional to result for the treatment of, and Neutralization effect is higher, and its result for the treatment of is better.The Neutralization effect of scFv antibody provided by the invention significantly improves, and will have good result for the treatment of.
Summary of the invention
The object of this invention is to provide the application of a kind of scFv antibody in treatment or prevention infectious bursal disease preparation.The Neutralization effect of this scFv antibody is higher more than 10 times than the scFv-A antibody (the scFv antibody called after scFv-A antibody in this patent in patent " scFv antibody, its encoding gene and the application in preparation treatment or prevention infectious bursal disease preparation thereof ") awarding patent right, will have better effect at Prevention and Curation IBD.The homology of the Nucleotide of this scFv antibody and scFv-A antibody is 88.71%, and amino acid whose homology is 78%, illustrates that two strain scFv are diverse two kinds of antibody.
The invention provides a kind of single-chain antibody, called after scFv-GD antibody, comprise and being made up of variable region of heavy chain, variable region of light chain and the joining region between them;
Described variable region of heavy chain is following (a) or (b): the protein that (a) is made up of from N-terminal 1-128 amino acids residue sequence in sequence table 1; (b) by (a) through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have identical activity by its derivative protein;
Described variable region of light chain is following (c) or (d): the protein that (c) is made up of from N-terminal 144-249 amino acids residue sequence in sequence table 1; (d) by (c) through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have identical activity by its derivative protein.
Described single-chain antibody specifically can be following (e) or (f): (e) is by the protein shown in sequence in sequence table 1; (f) by (e) through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have identical activity by its derivative protein.
The gene of described single-chain antibody of encoding also belongs to protection scope of the present invention.
In described gene, the DNA molecular of described variable region of heavy chain of encoding is following (1) or (2) or (3): the sequence 2 of (1) sequence table is from the DNA molecular shown in 5 ' end 1-384 position Nucleotide; (2) to hybridize with the DNA sequence dna that (1) limits under strict conditions and the DNA molecular of the albumen with identical activity of encoding; (3) with the DNA sequence dna that (1) limits, at least there is more than 90% homology and the DNA molecular of the albumen with identical activity of encoding.
In described gene, the DNA molecular of described variable region of light chain of encoding is following (4) or (5) or (6): the sequence 2 of (4) sequence table is from the DNA molecular shown in 5 ' end 430-747 position Nucleotide; (5) to hybridize with the DNA sequence dna that (4) limit under strict conditions and the DNA molecular of the albumen with identical activity of encoding; (6) with the DNA sequence dna that (4) limit, at least there is more than 90% homology and the DNA molecular of the albumen with identical activity of encoding.
Described gene specifically can be (7) or (8) or (9) or (10) as follows: the sequence 2 of (7) sequence table is from the DNA molecular shown in 5 ' end 1-747 position Nucleotide; (8) DNA molecular shown in sequence 2 of sequence table; (9) DNA sequence dna limited with (7) or (8) is under strict conditions hybridized and the DNA molecular of the albumen with identical activity of encoding; (10) DNA sequence dna limited with (7) or (8) at least has more than 90% homology and the DNA molecular of the albumen with identical activity of encoding.
Above-mentioned stringent condition can be in the solution of 6 × SSC, 0.5%SDS, hybridizes under 65oC, then uses 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS respectively to wash film once.
Expression cassette containing above arbitrary described gene, recombinant vectors, transgenic cell line or recombinant bacterium all belong to protection scope of the present invention.
Antibody based on other form of described single-chain antibody also belongs to protection scope of the present invention.The antibody of other form described can be the antibody of Fab form, the antibody etc. of IgG form.
The present invention also protects the application of the antibody of described single-chain antibody or other form described in preparing product; The function of described product is following (I), (II) or (III) or (IV): (I) detects chicken infectivity bursa of Fabricius virus; (II) assistant identification chicken infectivity bursa of Fabricius virus; (III) infectious bursal disease is prevented and/or treated; (IV) disease of being brought out by chicken infectivity bursa of Fabricius virus is prevented and/or treated.
The product of the antibody containing described single-chain antibody or other form described also belongs to protection scope of the present invention; The function of described product is following (I), (II) or (III) or (IV): (I) detects chicken infectivity bursa of Fabricius virus; (II) assistant identification chicken infectivity bursa of Fabricius virus; (III) infectious bursal disease is prevented and/or treated; (IV) disease of being brought out by chicken infectivity bursa of Fabricius virus is prevented and/or treated.
The present invention also protects the application of the antibody of described single-chain antibody or other form described in assistant identification chicken infectivity bursa of Fabricius virus.Describedly be applied as non-diseases diagnostic method.
The invention provides a kind of single-chain antibody (i.e. scFv-GD antibody), scFv-GD antibody has the ability be combined with VP2 albumen and multiple IBDV strain specific, IBDV capable of blocking CPE is produced to chick embryo fibroblast and in it and specific activity to have awarded the scFv-A antibody of patent right high more than 10 times.Immune serum and yolk antibody in use exist that preparation is loaded down with trivial details, production cost is high, effect is unstable, suitability for industrialized production difficult quality controls and cause the drawbacks such as horizontal transmission disease.ScFv-GD antibody provided by the invention can overcome above-mentioned drawback, and have high specificity, result for the treatment of is good, suitability for industrialized production is quality controllable, avoids the advantages such as the horizontal transmission disease that yolk antibody causes.
Accompanying drawing explanation
Fig. 1 is the SDS-PAGE collection of illustrative plates of scFv-GD antibody-solutions.
Fig. 2 is the SEC-HPLC collection of illustrative plates of scFv-GD antibody-solutions.
Fig. 3 is that ELISA detects the specificity of scFv-GD antibody to VP2 albumen and the result of avidity.
Fig. 4 is that ELISA detects the specificity of scFv-GD antibody to different I BDV virus and the result of avidity.
Embodiment
Following embodiment is convenient to understand the present invention better, but does not limit the present invention.Experimental technique in following embodiment, if no special instructions, is ordinary method.Test materials used in following embodiment, if no special instructions, is and purchases available from routine biochemistry reagent shop.Quantitative test in following examples, all arranges and repeats experiment for three times, results averaged.
PET-27b (+) carrier: purchased from Novagen company, Cat.No.69337-3.Intestinal bacteria Rosetta: purchased from Novagen company, Cat.No.71403-4.DF1 cell (chick fibroblast): purchased from Shanghai Inst. of Life Science, CAS cellular resources center, Cat.No.3131C0001000400030.SPF chick: purchased from Harbin veterinary institute.Newcastle disease inactivated vaccine (LaSota strain), buys from biotech firm of Ha Shouyanwei section, numbering 080012008.
Infectious bursal disease live-vaccine (Gt strain): biotech firm of Ha Shouyanwei section, numbering 080012122.Infectious bursal disease mesogenic living vaccine (NF8 strain): Yangzhou VAC BIO Engineering Co., Ltd., numbering 101042056.Infectious bursal disease live-vaccine (1-65 strain): ShafitInterGumboro, numbering S20651010A.Infectious bursal disease live-vaccine (BJ836 strain): Shanghai Hai Li biologics company limited, numbering 090202026.Infectious bursal disease live-vaccine (MB strain): ABIC, numbering 20621150B.Infectious bursal disease live-vaccine (B87 strain): Zhong An Bioceuticals Inc. of Hunan Province, numbering 180022026.
Plasmid pHisSUMO: reference: Jiang Yuanyuan, Yin Chengkai, Li Jinnan, Ren Guiping, Zhang Wei, Li Deshan. utilize the research of SUMO emerging system high expression soluble recombinant protein. Northeast Agricultural University's journal, 2008,39 (10): 57-62; Li Lu, Yin Chengkai, Li Deshan. high expression soluble recombinant protein expression vector---pHisSUMO. biotechnology, 2009,19 (3): 11-14..
Coating buffer (pH9.6): get Na
2cO
30.15g, NaHCO
30.293g, water-soluble and be settled to 100mL with water.
PBS damping fluid: get NaCl8g, KCl0.2g, Na
2hPO
4.12H
2o3.58g, KH
2pO
40.24g, is dissolved in 1L water.
The discovery of embodiment 1, scFv-GD antibody (single-chain antibody) and encoding gene thereof
1, the structure of antibody library
Get the chicken spleen after IBDV immunity, after extracting RNA, reverse transcription becomes cDNA.According to the antibody sequence on GenBank, designing the gene primer of clonal antibody variable region, take cDNA as template, uses the method clonal antibody variable region of PCR.VH and VL fragment is inserted into respectively the upstream and downstream of the Linker of pTlinker carrier, constructs scFv antibody library.ScFv antibody library is carried out enzyme cut and be connected with bacterial display vector pBFD-Ab-VP2, build the bacterium surface displaying library of anti-ibd V antigen-antibody coexpression.VH is about 380bp, VL and is about 320bp, and VH-Tlinker-VL is about 740bp.
2, the screening of antibody library
Collect after transforming and all clone, through IPTG(0.25mmol/L) induce 4h, through EDTA-MgCl
2process, the goat-anti rabbit two anti-(purchased from sigma company, working concentration is that 1:500 doubly dilutes to P3838) marked with polyclonal antibody and the FITC of anti-rabbit VP2 albumen respectively hatches 1h, utilizes flow cytometer to screen it after PBS washing.
After three-wheel screening, obtain one and there is the monoclonal antibody of binding ability, by its called after scFv-GD antibody with VP2 albumen.
ScFv-GD antibody (being single-chain antibody, also known as scFv-GD albumen) is as shown in the sequence 1 of sequence table, and its encoding gene is as shown in the sequence 2 of sequence table.
The preparation of embodiment 2, scFv-GD antibody
1, the double chain DNA molecule shown in sequence 2 of composition sequence table.
2, with step 1 synthesize double chain DNA molecule for template, with F1 and R1 composition primer pair carry out pcr amplification, obtain pcr amplification product.
F1：5'–CGC
CATATGGCCGTGACGTTGGACGAG-3'；
R1：5'–CCC
AAGCTTTTAACCTAGGACGGTCAGGG-3'。
3, restriction enzyme is used
ndei and
hindthe pcr amplification product of III double digestion step 2, reclaims digestion products.
4, restriction enzyme is used
ndei and
hindiII double digestion pET-27b (+) carrier, reclaims the carrier framework of about 5367bp.
5, the digestion products of step 3 is connected with the carrier framework of step 4, obtains recombinant plasmid.According to sequencing result, structrual description carries out to recombinant plasmid as follows: at pET-27b (+) carrier
ndei and
hindthe double chain DNA molecule shown in sequence 2 of sequence table is inserted between III digestion site.
6, recombinant plasmid step 5 obtained imports intestinal bacteria Rosetta, obtains recombinant bacterium.
7, the recombinant bacterium that step 6 obtains is seeded to the LB liquid nutrient medium containing 50 μ g/ml kantlex, 37 DEG C, 100r/min shaking culture is to OD
600nm=0.4; Add IPTG and make its concentration be 0.25mmol/L, 37 DEG C, 100r/min shaking culture 4h.
8, the culture system of 20L completing steps 7 is got, 4 DEG C, the centrifugal 30min of 4000r/min collect bacterial sediment.
9, the bacterial sediment that step 8 obtains is got, resuspended with PBS damping fluid, add lysozyme soln (purchased from Amresco) and make the concentration of N,O-Diacetylmuramidase be 1mg/ml, place 1h, then carry out ultrasonication (power of 25 watts, 3min) for 4 DEG C, 4 DEG C, the centrifugal 30min of 10000g, collecting precipitation.
10, AKTAPurifier100 protein chromatography system (purchased from GE company) purifying target protein is used
Get the precipitation that step 9 obtains, damping fluid (8mol/L aqueous solution of urea is dissolved with 100 milliliters, pH8.0) fully dissolve, then HiLoad16/60Superdex75pg pillar (purchased from GE company) is splined on, then 500 milliliters of renaturation buffer (2mol/L aqueous solution of urea are used, pH8.0) wash-out elutriant after collecting post, then dialysed overnight in PBS damping fluid, obtains solution and is scFv-GD antibody-solutions.Institute is in steps all under 4 DEG C of environment.Fig. 1 is shown in by the SDS-PAGE collection of illustrative plates of scFv-GD antibody-solutions, and display is about the band of 28KD, conforms to expection.
11, get the scFv-GD antibody-solutions that step 10 obtains, carry out SEC-HPLC analysis
Silica gel filler, model is G-3000swxl; After scFv-GD antibody-solutions loading, be that (pH8.0, solvent is water, containing 50mMNa for the elutriant of 0.5ml/min with flow velocity
3pO
4and 150mMNaCl) carry out wash-out.Fig. 2 is shown in by SEC-HPLC collection of illustrative plates, and the purity of target protein can reach 90%.
The preparation of embodiment 3, VP2 albumen
One, the structure of recombinant plasmid
1, the double chain DNA molecule shown in sequence 4 of composition sequence table.
2, with step synthesis double chain DNA molecule for template, with F2 and R2 composition primer pair carry out pcr amplification, obtain pcr amplification product.
F2：5’-
GAAGACTTAGGTACAAACCTGCAAGATCAA-3’；
R2：5’-
GGATCCTTATGCTCCTGCAATCTTCAG-3’。
3, restriction enzyme is used
bbsi He
bamHthe pcr amplification product of I double digestion step 2, reclaims digestion products.
4, restriction enzyme is used
bbsi He
bamHi double digestion plasmid pHisSUMO, reclaims the carrier framework of about 5700bp.
5, the digestion products of step 3 is connected with the carrier framework of step 4, obtains recombinant plasmid.In recombinant plasmid, the encoding sequence of the His label on the encoding sequence of the molecular chaperones SUMO on the encoding gene of VP2 albumen and carrier framework and carrier framework (is positioned at the upstream of the encoding sequence of SUMO, be made up of 6 histidine residues) merge, form fusion gene, expressed fusion protein (fusion rotein is followed successively by His label, molecular chaperones SUMO and VP2 albumen from N end to C end).
Two, the preparation of VP2 albumen and purifying
1, recombinant plasmid step one obtained imports intestinal bacteria Rosetta, obtains recombinant bacterium.
2, the recombinant bacterium that step 1 obtains is seeded to the LB liquid nutrient medium containing 100 μ g/ml penbritins, 37 DEG C, 100r/min shaking culture is to OD
600nm=0.35; Add IPTG and make its final concentration be 0.4mmol/L, 25 DEG C, 65r/min shaking culture 10h.
3, get the culture system of completing steps 2,4 DEG C, the centrifugal 30min of 4000r/min, and collect bacterial sediment.
4, the bacterial sediment that step 3 obtains is got, resuspended with Bindingbuffer, add lysozyme soln (purchased from Amresco) and make the concentration of N,O-Diacetylmuramidase be 1mg/ml, place 1h, then carry out ultrasonication (power of 25 watts, 3min) for 4 DEG C, 4 DEG C, the centrifugal 30min of 10000g, collect supernatant liquor.
5, get the supernatant liquor that step 4 obtains, carry out HisTrapTMFFcrudecolum affinity chromatography.
Pillar model is: column length 0.7cm, post height 2.5cm.
Applied sample amount is 10ml.
Elution process: (solvent is water, each solute containing, for example lower concentration: 40mmol/L imidazoles, 500mmol/LNaCl and 50mmol/LNa first to use the foreign protein elutriant of 5 times of column volumes
3pO
4; PH7.4) wash-out is to remove foreign protein, and flow velocity is 1ml/min; Then (solvent is water, each solute containing, for example lower concentration: 500mmol/L imidazoles, 500mmol/LNaCl and 50mmol/LNa to use the target protein elutriant of 3 times of column volumes
3pO
4; PH7.4) wash-out, flow velocity is 1ml/min, 280nm wavelength monitoring, collects target peak (namely peak value is higher than the peak of 80mAU), is fusion rotein solution.
6, the fusion rotein solution adopting HiPrepTM26/10Desalting step 5 to be obtained carries out desalination.
7, getting the solution that step 6 obtains, is 1:50 by the mol ratio of SUMO proteolytic enzyme I(SUMO proteolytic enzyme I and fusion rotein) and final concentration be that the DTT4 DEG C of cutting of 2mmol/L is spent the night.
8, get the solution that step 7 obtains, carry out HisTrapTMFFcrudecolum affinity chromatography.
Pillar model is: column length 0.7cm, post height 2.5cm.
Applied sample amount is 15ml, 280nm wavelength monitoring, collects target peak (namely peak value is higher than the peak of 30mAU), is VP2 protein solution.VP2 protein solution is carried out polyacrylate hydrogel electrophoresis, and display molecular weight is about the single protein band of 42KDa, reclaims protein band and checks order, and N holds front 15 amino-acid residues if the sequence 3 of sequence table is from shown in N-terminal the 1 to 15 amino acids residue.
The preparation of experimental example 4, anti-rabbit VP2 polyclonal antibody and purifying
One, immunizing rabbit
1, the VP2 albumen obtained with experimental example 3 and isopyknic Freund's complete adjuvant, be placed in thermal agitation mixing on mixing tank, form " water-in-oil " shape emulsion suspension liquid, after fully emulsified, take back multiple spot subcutaneous inoculation injection, often some injection about 100 μ L, immunizing dose is 0.5mg.
2, booster immunization is carried out after mixing with isopyknic Freund's incomplete adjuvant with same dosage protein after 2 weeks.
3, booster immunization is carried out after mixing with isopyknic Freund's incomplete adjuvant with same dosage protein after one week.
4, booster immunization is carried out after mixing with isopyknic Freund's incomplete adjuvant with same dosage protein after one week.
5, after 6d, jugular vein blood collection, first puts 37 DEG C of 1h, then puts 4 DEG C and spend the night, and gets serum.
Two, the purifying of polyclonal antibody
1, get the serum that step one obtains, carry out proteinA affinity chromatography.
Pillar model is: column length 0.7cm, post height 2.5cm.
Applied sample amount is 20ml.
With the speed of per minute 0.5ml by antiserum(antisera) on post, for ensureing the combination of antiserum(antisera) and filler, need continuous upper prop 2 times also retains loading effluent liquid.With TBS buffered soln, (solvent is water, each solute containing, for example lower concentration: 50mM/LTris, 150mM/LNaCl; PH7.4) clean pillar and remove foreign protein, after add elution buffer solution (solvent be water, containing, for example the solute 50mM/L glycine of lower concentration; PH2.7), with the speed wash-out of 0.5ml/min, 280nm wavelength monitoring, collects target peak, is polyclonal antibody.Anti-TNF-α liquid solution is carried out polyacrylate hydrogel electrophoresis, and display molecular weight is about two protein bands of 50kDa and 25kDa.
Embodiment 5, ELISA detect avidity and the specificity of scFv-GD antibody
One, ELISA detects scFv-GD antibody to the specificity of VP2 albumen and avidity
1, respectively with scFv-GD antibody-solutions (the i.e. scFv-GD antibody-solutions of embodiment 2 preparation that protein concentration is 200 μ g/ml, 100 μ g/ml, 50 μ g/ml, 20 μ g/ml, 10 μ g/ml, 5 μ g/ml, 1 μ g/ml, protein concentration is adjusted with coating buffer) coated elisa plate, 4 DEG C are spent the night, then PBST buffer solution is used 3 times, each 2min.
2, every hole adds the VP2 protein solution (i.e. the VP2 protein solution of embodiment 3 preparation, with PBS damping fluid adjustment protein concentration) that 100 μ l protein concentrations are 40 μ g/ml, hatches 1h for 37 DEG C, then uses PBST buffer solution 3 times, each 2min.
3, add anti-rabbit VP2 polyclonal antibody (i.e. the Anti-TNF-α liquid solution of embodiment 4 preparation, working concentration is that 1:5000 doubly dilutes), hatch 1h for 37 DEG C, then use PBST buffer solution 3 times, each 2min.
4, add the goat anti-rabbit antibody (purchased from R & Dsystem company, working concentration is that 1:8000 doubly dilutes to HAF008) of HRP mark, hatch 1h for 37 DEG C, then use PBST buffer solution 3 times, each 2min.
5, tmb substrate nitrite ion is added, 37 DEG C of lucifuge colour developing 5min.
6, every hole adds the H of 50 μ l2mol/L
2sO
4the aqueous solution, detects OD value by microplate reader under wavelength 450nm.
The PBS group replacing scFv-GD antibody-solutions, the VP2 protein solution in step 2 and the anti-rabbit VP2 polyclonal antibody in step 3 in step 1 with isopyknic PBS damping fluid is set.When in step 1 with protein concentration being the scFv-GD antibody-solutions coated elisa plate of 400 μ g/ml: the control group 1 not adding VP2 protein solution in setting steps 2, the control group 2 of anti-rabbit VP2 polyclonal antibody is not added in step 3, do not add VP2 protein solution in step 2 and in step 3, do not add the control group 3 of anti-rabbit VP2 polyclonal antibody, waiting the BSA solution of protein concentration to replace the control group 4 of VP2 protein solution with equal-volume.
Each process arranges 3 multiple holes.
The results are shown in Figure 3.ELISA result shows, scFv-GD antibody can be combined with VP2 protein-specific.
Two, ELISA detects scFv-GD antibody to the specificity of different I BDV virus and avidity
1, with protein concentration be 400 μ g/ml scFv-GD antibody-solutions (namely embodiment 2 prepare scFv-GD antibody-solutions, adjust protein concentration with coating buffer) coated elisa plate, 4 DEG C are spent the night, and then use PBST buffer solution 3 times, each 2min.
2, every hole adds 100 μ lIBDV virus liquids (viral dosage is 10
6.2tCID
50), hatch 1h for 37 DEG C, then use PBST buffer solution 3 times, each 2min.
3, add anti-rabbit VP2 polyclonal antibody (i.e. the Anti-TNF-α liquid solution of embodiment 4 preparation, working concentration is that 1:5000 doubly dilutes), hatch 1h for 37 DEG C, then use PBST buffer solution 3 times, each 2min.
4, add the goat anti-rabbit antibody (purchased from R & Dsystem company, working concentration is that 1:8000 doubly dilutes to HAF008) of HRP mark, hatch 1h for 37 DEG C, then use PBST buffer solution 3 times, each 2min.
5, tmb substrate nitrite ion is added, 37 DEG C of lucifuge colour developing 5min.
6, every hole adds the H of 50 μ l2mol/L
2sO
4the aqueous solution, detects OD value by microplate reader under wavelength 450nm.
The strain of following IBDV is adopted to carry out above-mentioned experiment respectively: Gt strain, NF8 strain, 1-65 strain, BJ836 strain, MB strain, B87 strain.
The PBS group replacing scFv-GD antibody-solutions, the IBDV virus liquid in step 2 and the anti-rabbit VP2 polyclonal antibody in step 3 in step 1 with isopyknic PBS damping fluid is set.The control group 1 of IBDV virus liquid is not added in setting steps 2, the control group 2 of anti-rabbit VP2 polyclonal antibody is not added in step 3, do not add IBDV virus liquid in step 2 and in step 3, do not add the control group 3 of anti-rabbit VP2 polyclonal antibody, replacing the control group 4 of IBDV virus liquid with the Newcastle Disease venom of the titres such as equal-volume.
Each process arranges 3 multiple holes.
The results are shown in Figure 4.ELISA result shows, scFv-GD antibody can be combined with different I BDV strain specific, has different avidity to different IBDV strains.
The Neutralization effect of embodiment 6, scFv-GD antibody
One, the mensuration of IBDV titre
The DF1 cell being in logarithmic phase is inoculated in 96 porocyte culture plates, will with DMEM substratum 10
1to 10
14the IBDV virus liquid (B87 strain) of gradient dilution is inoculated into (every hole 100 μ l) in monolayer cell, and each extent of dilution inoculates 8 cell holes; The control group not adding IBDV virus liquid is set.Tissue Culture Plate is put in cell culture incubator, 37 DEG C, 5%CO
2cultivate, Continuous Observation 7 days, every day records cell growth state.Calculate virus titer, within the 7th day, the results are shown in Table 1.
The result of the mensuration of table 1IBDV titre
| Extent of dilution | There is the number of the cell hole of CPE | There is not the number of the cell hole of CPE | CPE per-cent |
| 10 1 | 8 | 0 | 100% |
| 10 2 | 8 | 0 | 100% |
| 10 3 | 8 | 0 | 100% |
| 10 4 | 8 | 0 | 100% |
| 10 5 | 8 | 0 | 100% |
| 10 6 | 5 | 3 | 62.5% |
| 10 7 | 0 | 8 | 0% |
| 10 8 | 0 | 8 | 0% |
| 10 9 | 0 | 8 | 0% |
| 10 10 | 0 | 8 | 0% |
| 10 11 | 0 | 8 | 0% |
| 10 12 | 0 | 8 | 0% |
TCID is calculated according to Reed-Muench Liang Shi method
50=10
-6.2/ 0.1ml.
Two, the Neutralization effect of scFv-GD antibody
The DF1 cell being in logarithmic phase is inoculated in 96 porocyte culture plates, by with the scFv-GD antibody-solutions (i.e. embodiment 2 prepare scFv-GD antibody-solutions) after DMEM substratum gradient dilution and 100TCID
50iBDV virus liquid (B87 strain) equal-volume mixing and 37 DEG C hatch 1h, be then inoculated in monolayer cell, each gradient inoculates 8 cell holes; Arrange and do not add antibody-solutions and the normal control not adding virus liquid, the virus control only not adding antibody-solutions and only add virus liquid is set.Tissue Culture Plate is put in thin incubator, 37 DEG C, 5%CO
2cultivate Continuous Observation 7 days, every day records cell growth state.Within 7th day, the results are shown in Table 2.
The result of the mensuration of the Neutralization effect of table 2scFv-GD antibody
Result shows, scFv-GD antibody has Neutralization effect, and the minimum protein concentration of blocking-up or suppression CPE is 0.146 μ g/ml.
sequence table
<110> Harbin Bo'ao Biopharmaceutical Technology Development Co., Ltd.
The application of <120> scFv antibody in treatment or prevention infectious bursal disease preparation
<130>
<160>4
<210>1
<211>249
<212>PRT
<213> artificial sequence
<220>
<223>
<400>1
AlaValThrLeuAspGluSerGlyGlyGlyLeuGlnThrProGlyGly
151015
AlaLeuSerLeuValCysLysAlaSerGlyPheSerIleSerSerTyr
202530
SerMetAlaTrpValArgGlnAlaProGlyLysGlyLeuGluTrpVal
354045
AlaGlyIleTyrSerSerGlySerSerThrTyrTyrGlySerAlaVal
505560
LysGlyArgAlaThrIleSerArgAspAsnGlyGlnSerThrValArg
65707580
LeuGlnLeuAsnAsnLeuArgAlaGluAspThrGlyThrTyrTyrCys
859095
AlaArgGlyGlyCysSerThrTyrGlyCysGlyGlyTyrAlaGlySer
100105110
IleAspAlaTrpGlyHisGlyThrGluValIleValSerSerAlaSer
115120125
GlyGlyGlyGlySerGlyGlyGlyGlySerGlyGlyGlyGlySerAla
130135140
LeuThrGlnProSerSerValSerAlaAsnProGlyGluThrValLys
145150155160
IleThrCysSerGlyGlyGlySerSerTyrGlyTyrSerTrpHisGln
165170175
GlnLysSerProGlySerAlaProValThrValIleTyrAsnAsnThr
180185190
AsnArgProSerAsnIleProSerArgPheSerGlySerLysSerGly
195200205
SerThrAlaThrLeuThrIleThrGlyValGlnAlaAspAspGluAla
210215220
IleTyrPheCysGlySerAlaAspSerSerTyrValGlyIlePheGly
225230235240
AlaGlyThrThrLeuThrValLeuGly
245
<210>2
<211>747
<212>DNA
<213> artificial sequence
<220>
<223>
<400>2
gccgtgacgttggacgagtccgggggcggcctccagacgcccggaggagcgctcagcctc60
gtctgcaaggcctccgggttctccatcagcagttacagcatggcttgggtgcgccaggcg120
cccggcaaggggctggagtgggtcgcgggtatttacagcagtggtagtagcacatactac180
gggtcggcggtgaagggccgtgccaccatctcgagggacaacgggcagagcacagtgagg240
ctgcagctgaacaacctcagggctgaggacaccggcacctactactgcgccagaggtggt300
tgtagtacttacggttgtggtggttatgctggtagcatcgacgcatggggccacgggacc360
gaagtcatcgtctcctccgctagcggtggtggtggttctggtggtggtggttctggtggt420
ggtggatccgcgctgactcagccgtcctcggtgtcagcgaacccgggagaaaccgtcaag480
atcacctgctccgggggtggcagcagctatggttacagctggcaccagcagaagtctcct540
ggcagtgcccctgtcactgtgatctataacaacaccaacagaccctcgaacatcccttca600
cgattctccggttccaaatccggctccacagccacattaaccatcactggggtccaagcc660
gacgacgaggctatctacttctgtgggagtgcagacagcagctatgttggtatatttggg720
gccgggacaaccctgaccgtcctaggt747
<210>3
<211>440
<212>PRT
<213> artificial sequence
<220>
<223>
<400>3
ThrAsnLeuGlnAspGlnThrGlnGlnIleValProPheIleArgSer
151015
LeuLeuMetProThrThrGlyProAlaSerIleProAspAspThrLeu
202530
GluLysHisThrLeuArgSerGluThrSerThrTyrAsnLeuThrVal
354045
GlyAspThrGlySerGlyLeuIleValPhePheProGlyPheProGly
505560
SerIleValGlyAlaHisTyrThrLeuGlnSerAsnGlyAsnTyrLys
65707580
PheAspGlnMetLeuLeuThrAlaGlnAsnLeuProAlaSerTyrAsn
859095
TyrCysArgLeuValSerArgSerLeuThrValArgSerSerThrLeu
100105110
ProGlyGlyValTyrAlaLeuAsnGlyThrIleAsnAlaValThrPhe
115120125
GlnGlySerLeuSerGluLeuThrAspValSerTyrAsnGlyLeuMet
130135140
SerAlaThrAlaAsnIleAsnAspLysIleGlyAsnValLeuValGly
145150155160
GluGlyValThrValLeuSerLeuProThrSerTyrAspLeuGlyTyr
165170175
ValArgLeuGlyAspProIleProAlaIleGlyLeuAspProLysMet
180185190
ValAlaThrCysAspSerSerAspArgProArgValTyrThrIleThr
195200205
AlaAlaAsnAspTyrGlnPheSerSerGlnTyrGlnAlaGlyGlyVal
210215220
ThrIleThrLeuPheSerAlaAsnIleAspAlaIleThrSerLeuSer
225230235240
IleGlyGlyGluLeuValPheGlnThrSerValGlnGlyLeuIleLeu
245250255
GlyAlaThrIleTyrLeuIleGlyPheAspGlyThrAlaValIleThr
260265270
ArgAlaValAlaAlaAspAsnGlyLeuThrAlaGlyThrAspAsnLeu
275280285
MetProPheAsnIleValIleProThrSerGluIleThrGlnProIle
290295300
ThrSerIleLysLeuGluIleValThrSerLysSerGlyGlyGlnAla
305310315320
GlyAspGlnMetSerTrpSerAlaSerGlySerLeuAlaValThrIle
325330335
HisGlyGlyAsnTyrProGlyAlaLeuArgProValThrLeuValAla
340345350
TyrGluArgValAlaThrGlySerValValThrValAlaGlyValSer
355360365
AsnPheGluLeuIleProAsnProGluLeuAlaLysAsnLeuIleThr
370375380
GluTyrGlyArgPheAspProGlyAlaMetAsnTyrThrLysLeuIle
385390395400
LeuSerGluArgAspArgLeuGlyIleLysThrValTrpProThrArg
405410415
GluTyrThrAspPheArgGluTyrPheMetGluValAlaAspLeuAsn
420425430
SerProLeuLysIleAlaGlyAla
435440
<210>4
<211>1323
<212>DNA
<213> artificial sequence
<220>
<223>
<400>4
atgacaaacctgcaagatcaaacccaacagattgttccgttcatacggagccttctgatg60
ccaacaaccggaccggcgtccattccggacgacaccctagagaagcacactctcaggtca120
gagacctcgacctacaatttgactgtgggggacacagggtcagggctaattgtctttttc180
cctggtttccctggctcaattgtgggtgctcactacacactgcagagcaatgggaactac240
aagttcgatcagatgctcctgactgcccagaacctaccggccagctacaactactgcagg300
ctagtgagtcggagtctcacagtgaggtcaagcacactccctggtggcgtttatgcatta360
aacggaaccataaacgccgtgaccttccaaggaagcctgagtgaactgacagatgttagc420
tacaatgggttgatgtctgcgacggccaacatcaacgacaaaatcgggaacgtcctagta480
ggggaaggggtaactgtcctcagcttacccacatcatatgatctggggtatgtgagactc540
ggtgaccccattcccgctatagggcttgacccaaagatggtagcaacatgtgacagcagt600
gataggcccagagtctacaccataactgcagccaatgactaccaattctcatcacagtac660
caagcaggtggagtgacaatcacactgttctcagcaaacatcgatgccatcacaagcctc720
agcatcgggggagaacttgtgtttcaaacaagcgtccaaggccttatactgggcgctacc780
atctaccttataggcttcgatgggactgcggtaatcaccagagctgtggccgcagacaat840
gggctaacggccggcactgacaaccttatgccattcaatattgtgattccaaccagcgag900
ataacccagccaatcacatccatcaaactggagatagttacctccaaaagtggtggtcag960
gcgggggatcagatgtcatggtcagcaagtgggagcctagcagtgacgatccacggtggc1020
aactatccaggggccctccgtcccgtcacactagtagcctacgaaagagtggctacagga1080
tctgtcgttacggtcgccggggtgagcaacttcgagctgatcccaaatcctgaactagca1140
aagaacctgatcacagaatacggccgatttgacccaggggccatgaactacacaaaactg1200
atactgagtgagagggaccgtcttggcatcaagaccgtgtggccaacaagggagtacacc1260
gactttcgcgagtactttatggaggtggccgacctcaactctcccctgaagattgcagga1320
gca1323
Claims (10)
1. a single-chain antibody, comprises and being made up of variable region of heavy chain, variable region of light chain and the joining region between them;
Described variable region of heavy chain is following (a) or (b): the protein that (a) is made up of from N-terminal 1-128 amino acids residue sequence in sequence table 1; (b) by (a) through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have identical activity by its derivative protein;
Described variable region of light chain is following (c) or (d): the protein that (c) is made up of from N-terminal 144-249 amino acids residue sequence in sequence table 1; (d) by (c) through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have identical activity by its derivative protein.
2. single-chain antibody as claimed in claim 1, is characterized in that: described single-chain antibody is following (e) or (f): (e) is by the protein shown in sequence in sequence table 1; (f) by (e) through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have identical activity by its derivative protein.
3. the gene of single-chain antibody described in coding claim 1 or 2.
4. gene as claimed in claim 3, is characterized in that:
In described gene, the DNA molecular of described variable region of heavy chain of encoding is following (1) or (2) or (3): the sequence 2 of (1) sequence table is from the DNA molecular shown in 5 ' end 1-384 position Nucleotide; (2) to hybridize with the DNA sequence dna that (1) limits under strict conditions and the DNA molecular of the albumen with identical activity of encoding; (3) with the DNA sequence dna that (1) limits, at least there is more than 90% homology and the DNA molecular of the albumen with identical activity of encoding;
In described gene, the DNA molecular of described variable region of light chain of encoding is following (4) or (5) or (6): the sequence 2 of (4) sequence table is from the DNA molecular shown in 5 ' end 430-747 position Nucleotide; (5) to hybridize with the DNA sequence dna that (4) limit under strict conditions and the DNA molecular of the albumen with identical activity of encoding; (6) with the DNA sequence dna that (4) limit, at least there is more than 90% homology and the DNA molecular of the albumen with identical activity of encoding.
5. gene as claimed in claim 4, is characterized in that:
Described gene is following (7) or (8) or (9) or (10): the sequence 2 of (7) sequence table is from the DNA molecular shown in 5 ' end 1-747 position Nucleotide; (8) DNA molecular shown in sequence 2 of sequence table; (9) DNA sequence dna limited with (7) or (8) is under strict conditions hybridized and the DNA molecular of the albumen with identical activity of encoding; (10) DNA sequence dna limited with (7) or (8) at least has more than 90% homology and the DNA molecular of the albumen with identical activity of encoding.
6. the expression cassette containing arbitrary described gene in claim 3 to 5, recombinant vectors, transgenic cell line or recombinant bacterium.
7. based on the antibody of other form of single-chain antibody described in claim 1 or 2.
8. the application of antibody in preparing product described in single-chain antibody described in single-chain antibody, claim 2 described in claim 1 or claim 7; The function of described product is following (I), (II) or (III) or (IV): (I) detects chicken infectivity bursa of Fabricius virus; (II) assistant identification chicken infectivity bursa of Fabricius virus; (III) infectious bursal disease is prevented and/or treated; (IV) disease of being brought out by chicken infectivity bursa of Fabricius virus is prevented and/or treated.
9. the product containing antibody described in single-chain antibody described in single-chain antibody, claim 2 described in claim 1 or claim 7; The function of described product is following (I), (II) or (III) or (IV): (I) detects chicken infectivity bursa of Fabricius virus; (II) assistant identification chicken infectivity bursa of Fabricius virus; (III) infectious bursal disease is prevented and/or treated; (IV) disease of being brought out by chicken infectivity bursa of Fabricius virus is prevented and/or treated.
10. the application of antibody in assistant identification chicken infectivity bursa of Fabricius virus described in single-chain antibody described in single-chain antibody, claim 2 described in claim 1 or claim 7.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510876063.8A CN105384815B (en) | 2015-12-03 | 2015-12-03 | A kind of scFv antibody is treating or preventing the application in Bursal Disease preparation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510876063.8A CN105384815B (en) | 2015-12-03 | 2015-12-03 | A kind of scFv antibody is treating or preventing the application in Bursal Disease preparation |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105384815A true CN105384815A (en) | 2016-03-09 |
| CN105384815B CN105384815B (en) | 2019-03-01 |
Family
ID=55417634
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510876063.8A Active CN105384815B (en) | 2015-12-03 | 2015-12-03 | A kind of scFv antibody is treating or preventing the application in Bursal Disease preparation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105384815B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108484759A (en) * | 2018-03-01 | 2018-09-04 | 东北农业大学 | Two kinds of scFv antibody, its encoding gene and its application in preparing treatment or prevention Bursal Disease preparation |
| US20210189010A1 (en) * | 2018-09-05 | 2021-06-24 | Sino-Swed Tongkang Bio-Tech (Shenzhen) Limited | Development of recombinant chicken igy scfv antibody raised against human tymidine kinase 1 expressed in prokaryotic cells and use thereof |
| CN113493509A (en) * | 2021-07-23 | 2021-10-12 | 东北农业大学 | Tetravalent high-affinity antibody for resisting chicken infectious bursal disease virus and preparation and application thereof |
| CN114213532A (en) * | 2021-12-13 | 2022-03-22 | 东北农业大学 | Preparation and application of high-affinity scFv antibody for resisting chicken infectious bursal disease virus |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103333242A (en) * | 2013-07-23 | 2013-10-02 | 哈尔滨博翱生物医药技术开发有限公司 | scFv antibody, encoding gene thereof and application thereof to preparation of preparation for treating or preventing infectious bursal disease |
| CN103483449A (en) * | 2013-08-20 | 2014-01-01 | 东北农业大学 | Two ScFv (Single Chain Variable Fragment ) antibodies, encoding genes and application thereof for preparing preparation for treating or preventing infectious bursal disease of chicken |
-
2015
- 2015-12-03 CN CN201510876063.8A patent/CN105384815B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103333242A (en) * | 2013-07-23 | 2013-10-02 | 哈尔滨博翱生物医药技术开发有限公司 | scFv antibody, encoding gene thereof and application thereof to preparation of preparation for treating or preventing infectious bursal disease |
| CN103483449A (en) * | 2013-08-20 | 2014-01-01 | 东北农业大学 | Two ScFv (Single Chain Variable Fragment ) antibodies, encoding genes and application thereof for preparing preparation for treating or preventing infectious bursal disease of chicken |
Non-Patent Citations (1)
| Title |
|---|
| S.I. SAPATS等: "Generation of chiken single chain antibody variable fragments（scFv） that differentiate and neutralize infectious bursal disease virus（IBDV）", 《ARCH VIROL》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108484759A (en) * | 2018-03-01 | 2018-09-04 | 东北农业大学 | Two kinds of scFv antibody, its encoding gene and its application in preparing treatment or prevention Bursal Disease preparation |
| US20210189010A1 (en) * | 2018-09-05 | 2021-06-24 | Sino-Swed Tongkang Bio-Tech (Shenzhen) Limited | Development of recombinant chicken igy scfv antibody raised against human tymidine kinase 1 expressed in prokaryotic cells and use thereof |
| CN113493509A (en) * | 2021-07-23 | 2021-10-12 | 东北农业大学 | Tetravalent high-affinity antibody for resisting chicken infectious bursal disease virus and preparation and application thereof |
| CN114213532A (en) * | 2021-12-13 | 2022-03-22 | 东北农业大学 | Preparation and application of high-affinity scFv antibody for resisting chicken infectious bursal disease virus |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105384815B (en) | 2019-03-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103483449A (en) | Two ScFv (Single Chain Variable Fragment ) antibodies, encoding genes and application thereof for preparing preparation for treating or preventing infectious bursal disease of chicken | |
| CN103333242B (en) | scFv antibody, encoding gene thereof and application thereof to preparation of preparation for treating or preventing infectious bursal disease | |
| CN103554235B (en) | RBD (receptor binding domain) segment in MERS-CoV (Middle East respiratory syndrome coronavirus) membrane protein and coding gene and application thereof | |
| CN105384815A (en) | Application of scFv antibody in preparation used for treatment or prevention of infectious bursal disease of chicken | |
| CN104099310A (en) | Recombinant nuclease and preparation method thereof | |
| Wang et al. | Development of a multi-mimotope peptide as a vaccine immunogen for infectious bursal disease virus | |
| CN115998856A (en) | Novel influenza virus immunogenic composition and preparation method and application thereof | |
| CN104211784B (en) | It is used to prepare the protein and method of Hepatitis E virus sample particle | |
| CN107586335A (en) | A kind of Humanized monoclonal antibodies and application | |
| CN109111518B (en) | Specific egg yolk antibody for preventing and treating feline distemper and preparation method thereof | |
| CN107488217A (en) | A kind of polypeptide, immunogenic conjugate and influenza vaccines | |
| CN104877968B (en) | Efficient secretion anti-dog parvovirus monoclonal antibody hybridoma cell A135 strains | |
| CN102397559B (en) | Broad spectrum type influenza vaccine and preparation method thereof | |
| CN101879312B (en) | Broad spectrum type influenza vaccine and preparation method thereof | |
| CN102816246A (en) | Human cytomegalo virus immunogen fusion protein as well as preparation method and usage thereof | |
| CN105504052A (en) | Application of scFv (single-chain fragment variable) antibody for resisting infectious bursal disease viruses to preparation for treating or preventing infectious bursal disease | |
| CN104710529B (en) | A kind of single-chain antibody of anti-fishes virus haemorrhagic septicaemia virus | |
| CN108348596A (en) | With the recombinant virus sample particle of bovine immunodeficiency virus Gag albumen | |
| CN101497909A (en) | Method for preparing anti-A type botulinus toxin immunoglobulin antibody | |
| CN101152570B (en) | Epitope vaccine of hog cholera virus and its preparing process | |
| CN108484759A (en) | Two kinds of scFv antibody, its encoding gene and its application in preparing treatment or prevention Bursal Disease preparation | |
| CN101676726B (en) | Preparation method of E hepatitis rabbit-human chimeric antibody quality control substance | |
| CN114213532B (en) | Preparation and application of high-affinity anti-chicken infectious bursal disease virus scFv antibody | |
| CN103755804B (en) | Nano antibody for type A H3N2 influenza virus and application thereof | |
| CN103570832A (en) | Anti-Haemophilus parasuis porcine chimeric antibody, and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20181226 Address after: 222001 No. 58 Haichang South Road, Haizhou District, Lianyungang City, Jiangsu Province Applicant after: Jiangsu Kangyuan Ruiao Biomedical Technology Co., Ltd. Address before: Room 314, Science Park, Northeast Agricultural University, 59 Wood Street, Xiangfang District, Harbin, Heilongjiang Province, 150030 Applicant before: Harbin Boao Bio-Medical Technology Development Company |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |