JP2003503005A - Expression of functional eukaryotic proteins - Google Patents

Abstract

SUMMARY OF THE INVENTION The present invention relates to improved expression of evolved polynucleotide and polypeptide sequences encoding eukaryotic enzymes, particularly peroxidase enzymes, in conventional or simplified expression systems. . Various methods for directed evolution of polynucleotide sequences can be used to obtain improved sequences. The improved characteristics of a polypeptide or protein produced in this manner include improved folding, non-formation of inclusion bodies, and maintained functional activity. In certain embodiments, the present invention relates to horseradish peroxidase gene and improved expression of horseradish peroxidase enzyme.

Description

Detailed Description of the Invention

The US Government has a grant number N0014-96-1-0 awarded by the US Navy.
340 and N00014-98-1-0657 have certain rights to the invention.

This application claims priority from US Patent Application No. 60 / 094,403 (filed July 28, 1998) and No. 60 / 106,840 (filed November 3, 1998). To do.

BACKGROUND OF THE INVENTION Field of the Invention The present invention relates to the selection (particularly in simple host cell expression systems) of polynucleotides encoding functional polypeptides or proteins, particularly eukaryotic proteins. Relates to a method for production. Simple expression systems include robust prokaryotic cells (eg bacteria) and eukaryotic systems (eg yeast). In particular, the invention relates to recombinant production of expression resistant functional eukaryotic proteins by host cells in high yield and without inactivation, denaturation, inclusion bodies or other loss of structure or function. In a preferred embodiment, the expressed protein is secreted by the host cell. Preferred proteins of the present invention include peroxidase and heme-containing proteins such as horseradish peroxidase (HRP) and cytochrome c peroxidase (CCP). Polynucleotides encoding and expressing these proteins in recombinant host cell expression systems are also included in the invention.

Description of Related Art The publications and references mentioned herein and listed in the attached bibliography are each each incorporated by reference in their entirety. These are referenced numerically in the text and bibliography below.

Many proteins of interest are produced by organisms having “eukaryotic” cells. These are DNA surrounded by a nuclear envelope and on a structure called a chromosome.
Is a cell having a nucleus containing. All multicellular organisms (eg humans and animals)
And many unicellular animals have eukaryotic cells. Other unicellular organisms (eg, bacteria) have “prokaryotic” cells. These cells have a defined structure
It has a primitive nucleus with A but without the chromosomes and nuclear membranes characteristic of eukaryotes. Prokaryotic organisms are generally much easier and cheaper to grow, maintain, and manipulate than eukaryotic cells.

[0006] Genetic engineering and recombinant DNA and RNA technologies are based on the use of proteins, hormones and enzymes native to one organism, cells of different organisms as "factories", ie host cell expression systems. Have made it possible to produce. In particular, expression of proteins of eukaryotic origin in prokaryotic host cells is often desired. This is because prokaryotes can be grown in large numbers on the same cells to produce large amounts of the desired foreign protein. For example, certain human proteins can be useful as drugs if those proteins can be supplied in sufficient quantity to patients with protein deficiencies. Such proteins are
It may not be readily or ethically obtainable by isolating them from human cells, or they may be obtained by direct chemical synthesis or by growing them in isolated tissue culture. , Cannot be easily manufactured. Other proteins and enzymes are industrially useful. For example, certain enzymes can degrade food products and are useful in laundry detergents. However, the commercial application is
Requires large amounts of protein and a high degree of quality control.

To solve some of these problems, recombinant genetic engineering techniques have used the genetic machinery of other cells (eg, bacteria and yeast) to produce humans or other proteins. It has developed. The selected genetic material (eg, the polynucleotide that encodes the desired protein) is "recombined" with the genetic material in the host cell.
So that the host cell expresses the introduced native genetic material and produces the desired polypeptide or protein. Bacteria and yeast can be suitable host cells. Because they are easy and economical to grow and maintain in large quantities, and they can be used to reliably and repeatedly produce foreign proteins.

However, many proteins cannot be easily expressed in foreign host cells, including bacteria and yeast. Such expression-resistant polypeptides or proteins may not be expressed at all or may be expressed inefficiently (eg, in low yield). This protein may be expressed but may lose some or all of its function. In some cases, the expressed protein may lose some or all of its active folded structure and may become denatured or even completely inactive. The expressed protein may also be encapsulated within inclusion bodies within the host cell. These are separate particles or globules inside the cell and separated from the rest of the cell, and they probably contain the aggregated or inactive form of the expressed protein. This makes it difficult to collect the produced protein from the host cell, which makes isolation and purification techniques difficult, inefficient, time consuming, and expensive. obtain. Efforts to produce expression-resistant polypeptides in active or functional form and in relatively high yield have been made for many years and have been largely unsuccessful. In particular, expression-resistant enzymes of commercial importance (eg, peroxidase enzymes such as horseradish peroxidase) have not been functionally expressed in reasonably high yields, or may be a convenient host cell, economical. Not functionally expressed in host cells or simple host cells. Instead, these enzymes are produced in non-functional or inactive forms (eg inclusion bodies) and are empirically engineered and reconstituted to obtain active enzymes in relatively low yields.

Some proteins made by cells are secreted or delivered outside the cell, which can improve yield and efficiency of subsequent isolation and purification steps. However, many proteins are not naturally secreted and are difficult to artificially secrete, for example because they contain chemical groups that do not readily cross cell membranes. In particular, it is difficult to engineer compatible proteins and host cell lines to secrete proteins that have a tendency to form inclusion bodies. Therefore,
Improved techniques for expressing foreign proteins, especially proteins of eukaryotic origin, and especially recombinant proteins that can be secreted by host cells in high yield and without loss of activity or function. Is required.

As discussed, the particular challenge of producing foreign proteins in host cell expression systems is that many foreign proteins are present when using conventional recombinant hosts (eg, E. coli and yeast). Cannot be properly folded into functional proteins (1-4). As a result, polypeptide chains produced in recombinant host cell lines are often degraded during synthesis or accumulation in inclusion bodies. This is especially true for eukaryotic proteins that contain disulfide bonds in their native form or are glycosylated. The underlying reason for this, which is not clearly understood and is probably multifactorial, is the "non-natural" recombinant environment in which the protein accumulates (35), and E. coli. E. coli hosts may be deficient in proper cofactors (eg molecular chaperones) (3). Furthermore, glycosylation is involved in protein folding in eukaryotic organisms (36) and its function is absent in bacteria.

The problem of folding presents a difficult barrier to large-scale production of proteins for pharmaceutical or industrial applications. The lack of highly efficient functional expression systems is also one of the bottleneck in the application of directed evolution techniques to optimize proteins and reaction conditions for desired applications. Using random mutagenesis and genetic recombination, followed by screening or selection, directed evolution is where a variety of enzymatic properties that are often important for industrial applications (eg, substrate specificity, activity in organic solvents, and It has been successfully applied (5) to improve stability at high temperature). Although eukaryotic enzymes have a variety of existing and potential applications, the improvement of these proteins by directional evolution makes it impossible to functionally express these proteins in facile recombinant hosts. Limited by being there.

For example, the difficulty of expressing peroxidase enzymes in simple expression hosts has raised at least two technical challenges in order to realize the potential of peroxidase as a biocatalyst. First, attempts to modify these enzymes for industrial applications by protein engineering methods have been hampered. Directional evolution is described, for example, in E. coli or S. Utilizing expression in a host such as cerevisiae, an organism in which a large library of mutants or variants can be made. Second, the lack of efficient expression in a suitable foreign (heterologous) host prevents the large scale production of some of these proteins on an economic scale.

One way to obtain active forms of recombinantly expressed proteins is by refolding these proteins from inclusion bodies in vitro, but these processes are often difficult and inefficient. Target (1-3). Moreover, this is not a viable option for directed evolution, which requires screening of tens of thousands of variants. A more advantageous way of solving this problem could be to identify mutations in the target gene that could facilitate folding in the host environment.
Evidence from many studies increasingly suggests that certain residues in the amino acid sequence have profound effects on the protein folding itself. Therefore, it would be a great advantage if scientists could identify mutations in target genes that promote folding in the host environment. While this may avoid inclusion body damage, such techniques require the discovery, identification and use of certain beneficial variants.

For example, a series of studies by King and coworkers showed that several single amino acid substitutions interfere with the productive folding of the phage p22 tailspike protein at limited temperatures in vivo. And second-site suppressor mutation (second-site suppressor mutation)
Mutation) has shown that folding defective mutants can be rescued (6). In another study, substitution of tyrosine 35 with leucine in bovine pancreatic trypsin inhibitor (BPTI) eliminated a kinetic trap in the folding pathway in vitro (7). Moreover, several mutants of human interleukin 1β, produced by cassette mutagenesis of several selected residues, were found in soluble form in E. coli. Although expressed in E. coli, wild type was reported to be almost insoluble and to form inclusion bodies (8). In another study, a single site-directed mutation was found to improve the folding efficiency of recombinant antibodies (9
).

It is difficult to predict which residues are important for function or stability as well as protein folding. Therefore, it would be advantageous if there were methods for systematically searching for beneficial mutations that affect protein folding and expression without compromising biological activity. Directional evolution techniques may prove useful in achieving this goal. This evolutionary approach uses DNA shuffling for simultaneous random mutagenesis and recombination to generate variants with improved desired properties over existing wild-type proteins. Point mutations are generated due to the intrinsic infidelity of Taq-based polymerase chain reaction (PCR), which is associated with the reassembly of nucleic acid sequences. In one example, St
Emmer and coworkers applied this technique to the gene encoding green fluorescent protein (GFP), which is described in E. It produced a protein that folds better in E. coli than the wild type (10).

One group of proteins of particular interest are heme proteins (ie, they have an iron-containing heme family). These proteins have many biological and biochemical applications, including specific enzymes called peroxidases. Peroxidase is an enzyme that promotes oxidation or reduction reactions, where peroxide (eg, hydrogen peroxide) is one of the reactants. Peroxide is
It is a compound in which oxygen atoms other than molecular oxygen are bonded to each other. For example, the heme enzyme horseradish peroxidase (HRP) is widely used as a reporter in diagnostic assays. In HRP, the starting material or starting substrate is a peroxide (
For example, chemically bound in the presence of hydrogen peroxide (H ₂ O ₂ ), water as a by-product (
H ₂ O) is produced. This reaction can be used to indicate whether another reaction of interest has occurred or whether a particular substance (eg, HRP starting material) is present in the mixture or sample. It would be beneficial to provide a method for producing large amounts of HRP and other heme or peroxidase enzymes using efficient and cost effective systems such as prokaryotic expression systems. But the native HRP
Although containing four disulfides and highly glycosylated (about 21%), the carbohydrate moiety has no apparent effect on its activity or stability (
11). As a result, previous attempts to express HRP in bacteria resulted in inclusion bodies, with no functional expression (12-14). Successful expression in yeast has also not been achieved before the present invention.

Therefore, in order to eliminate the need for difficult in vitro folding protocols, there is a need to develop new and improved methods for expressing proteins that are normally difficult to express. Exists. In particular, there is a need for protein expression methods that are well suited for use in combination with directed evolution techniques.

In particular, the present invention relates to error-prone PCR and D
A library of HRP variants generated by NA shuffling was screened for bacterial (E. coli, B. subtilis) and yeast (S. c.
Described are methods for identifying mutations that facilitate functional expression in E. cerevisiae). In one exemplary embodiment, the variant of the invention is a functional and active horse radish peroxidase (HRP), which is an E. It is expressed in E. coli without inclusion bodies at a level of about 110 μg / L. This is comparable to the amounts previously obtained from the more costly, time-consuming and difficult in vitro refolding techniques used to recover other HRP enzymes from inclusion bodies.

SUMMARY OF THE INVENTION The observed constraints on the use of native proteins are believed to be the result of evolution. Proteins evolve in the context and environment of living organisms and perform specific biological functions under conditions that favor survival (rather than laboratory or industrial conditions). In some cases evolution may not favor sub-optimal efficient enzymes,
Or you may not even need it. The yield, efficiency, operating conditions, stability and other properties of known expression systems are not considered to be invariant and they are considered endogenous to the nature of the cellular expression system. It is not a limitation that should be done. The proteins used in these systems can be evolved in vitro, or similar proteins have been developed separately, for example to obtain even more efficient expression, folding and secretion while maintaining the activity of the protein. In particular, it is possible to modify or enhance the properties of proteins. The improved protein also
It can be obtained by screening cultures of native organisms or expressed gene libraries (3).

Many proteins are inactive when expressed using simple expression systems (eg, E. coli) resulting in inclusion bodies or inability to fold properly. is there. The present invention utilizes directed evolution techniques to generate novel polynucleotides that encode mutated functional proteins, which are produced in expression systems without inactivation or inclusion bodies. Have an increased ability to be. In a preferred embodiment, this protein is secreted extracellularly.

There are several advantages of secreting proteins from bacteria into the culture medium. Often, the desired substrate is E. This is because it cannot easily pass through the E. coli membrane. Secretion may facilitate screening in directed evolution studies. Because by catalyzing the secreted enzyme for the reaction in the culture medium, a substrate that cannot enter cells can be used. This can also significantly simplify the production of recombinant proteins, if the secretion levels are high enough, because the culture supernatant is almost free of contaminants. Nevertheless, the secretion of proteins from bacteria into the culture medium remains a daunting task, especially for enzymes containing bulky prosthetic groups (eg heme).

This problem is addressed by the appropriate signal peptides (eg Erwinia carot
The signal from ovora pectate lyase B (PelB) (27)) can be used to solve by efficiently directing the secretion of peroxidases such as HRP or CCP into the culture medium. This signal peptide is also commonly associated with other proteins containing the heme prosthetic group (eg, cytochrome P450).
Enzymes and other peroxidases).

According to one embodiment of the invention, directed evolution or random mutagenesis is used to produce in vitro proteins. The protein is readily folded after expression even in yeast and prokaryotic expression systems (eg, E. coli), and outside the host cell in the amount expected for proteins produced in such expression systems. Easily secreted by. Moreover, the activity of these proteins is not impaired by the mutagenesis step after proper selection has been made.

Accordingly, the present invention provides a method for improving the expression of a polynucleotide encoding a peroxidase enzyme by using directed evolution, and a modified horseradish peroxidase having improved expression in conventional expression systems. An encoding polynucleotide is provided.

The above features and many other attendant advantages of the present invention will be better understood with reference to the following detailed description in combination with the accompanying drawings.

DETAILED DESCRIPTION OF THE INVENTION The present invention provides for the synthesis during synthesis due to the fact that the protein either originally gives rise to inclusion bodies or is unable to fold properly in the environment of the expression system. Disassembled,
It relates to methods for improving the expression of proteins using conventional expression systems.

Definitions As used herein, “about” or “approximately” means within 20 percent, preferably within 10 percent, and more preferably within 5 percent of a given value or range. means.

The term “substrate” means any substrate or compound that is or tends to be converted to another compound by the action of an enzyme catalyst. The term includes aromatic compounds and aliphatic compounds, and includes not only single compounds, but also combinations of compounds (eg, solutions), mixtures and other materials including at least one substrate.

As used herein, an “oxidation reaction” or “oxygenation reaction” refers to a chemical reaction involving oxygenation of a substrate to form an oxygenated or oxidized substrate or product. Or it is a biochemical reaction. Oxidation reactions are typically accompanied by reduction reactions (hence the term "redox" reaction refers to oxidation and reduction). When a compound receives oxygen or loses an electron, the compound is "oxidized". The compound is "reduced" (when it loses oxygen or gains electrons).

The term “enzyme” means any substance composed wholly or in large part of a protein or polypeptide that more or less specifically catalyzes or promotes one or more chemical or biochemical reactions. .

A “polypeptide” (one or more peptides) is a chain of chemical building blocks called amino acids that are linked together by chemical bonds called peptide bonds. A protein or polypeptide (including an enzyme) can be "native" or "wild-type", meaning that it occurs naturally; or it is made from a native protein or another variant, It may be "variant", "variant" or "modified" which means altered, derived or somewhere different or altered. A "parental" polypeptide or enzyme is any method, tool, or any other polypeptide or enzyme from which any parent, whether its parent is itself a native or variant polynucleotide or enzyme. Any polypeptide or enzyme that is derived or produced using techniques. The parental polynucleotide is a polynucleotide that encodes a tail or polypeptide. A "test enzyme" is a protein-containing substance that is tested to determine if it has the properties of an enzyme. The term "enzyme" can also refer to a catalytic polynucleotide (eg, RNA or DNA).

The "activity" of an enzyme is a measure of its ability to catalyze a reaction and can be expressed as the rate at which the reaction product is produced. For example, enzyme activity can be expressed as the amount of product produced per unit time, per unit enzyme (eg, concentration or weight). The "stability" of an enzyme means its ability to function over time in a particular environment or under certain circumstances. One method of assessing stability is:
To assess its ability to withstand loss of activity over time. The stability of an enzyme can also be assessed in other ways, for example by determining the relative degree to which the enzyme is in the folded or unfolded state. Thus, if one enzyme is more resistant to loss of activity under the same conditions, more resistant to denaturation, or more resistant by any suitable measure, than another enzyme, the enzyme is It is more stable than the other enzyme or has improved stability. For example, a more “thermally stable” or “thermostable” enzyme is an enzyme that is more resistant to loss of structure (denaturation) or loss of function (enzymatic activity) when exposed to heat or elevated temperatures. . One way to evaluate this is. It is to determine the "melting temperature" or T _m for proteins. Melting temperature (also called midpoint)
Is the temperature at which half of the protein is denatured from its fully folded state. This midpoint is typically determined by calculating the midpoint of the titration curve, which plots protein denaturation as a function of temperature. Thus, a protein with a higher T _m requires more heat to cause denaturation and is more stable or more thermostable. In other words, a protein with a higher T _m shows that less of its protein molecule is denatured and more resistant to denaturation than a protein with a lower T _m at the same temperature. It means that the protein is more stable (the protein has less denaturation at the same temperature). Another measure of stability is T _1/2 , which is the transition midpoint of the protein inactivation curve as a function of temperature. T _1/2 is the temperature at which a protein _loses half its activity. Thus, a protein with a higher T _1/2 requires more heat to inactivate it and is more stable or more thermostable. Stated another way, a protein with a higher T _1/2 shows less of its protein molecule is inactivated and loses more than a protein with a lower T _1/2 at the same temperature. It means that the protein that is more resistant to activity is more stable (that protein has higher activity at the same temperature). These assays are also called "heat shift" assays. This is because the inactivation or denaturation curve, plotted against temperature, "shifts" to higher or lower temperatures as the stability increases or decreases. Thermal stability can also be measured in other ways. For example, the longer half-life (t _1/2 ) for enzyme activity at elevated temperatures is an indicator of thermostability.

An “oxidizing enzyme” is an enzyme that typically catalyzes one or more oxidative reactions by adding, inserting, imparting or transferring oxygen from a source or donor to a substrate. Such enzymes are also called oxidoreductases or redox enzymes,
And includes oxygenases, hydrogenases or reductases, oxidases and peroxidases.

The terms “oxygen donor”, “oxidant” and “oxidant” mean a substrate, molecule or compound that donates oxygen to a substrate in an oxidation reaction. Typically, oxygen donors are reduced (accept electrons). Without limitation, exemplary oxygen donors, molecular oxygen or dioxygen (O ₂₎ and peroxide (alkyl peroxides (e.g., t- butyl peroxide), and most preferably hydrogen peroxide (H ₂
Including O ₂ ). A peroxide is any compound that has two oxygen atoms bound to each other.

A “luminescent” substrate is any detectable electromagnetic radiation, or a change in electromagnetic radiation (most commonly visible light), by any mechanism, including color change, UV absorption, fluorescence and phosphorescence. It means any substrate that is produced. Preferably, the luminescent substrate according to the invention produces a detectable color, fluorescence or UV absorption.

The term “chemiluminescent agent” means any substrate that enhances the ability to detect a luminescent (eg, fluorescent) signal, eg, by increasing the intensity or half-life of the signal. One exemplary and preferred chemiluminescent agent is 5-amino-2,3-dihydro-1,4-phthalazinedione (luminol) and analogs. Other chemiluminescent agents include 1,2-dioxetanes (eg, tetramethyl-1,2-dioxetane (TMD), 1,2-dioxetanone, and 1,2-dioxetanedione).

The term “polymer” means any substrate or compound consisting of two or more building blocks “mers” that are repeatedly linked to each other. For example, a "dimer" is a compound in which two constitutional units are linked together.

The term “cofactor” means any non-protein substance essential or beneficial for the activity of the enzyme. By "coenzyme" is meant a cofactor that directly interacts and acts to promote the reaction catalyzed by the enzyme. Many coenzymes act as carriers. For example, NAD ⁺ and NADP ⁺ carry hydrogen atoms from one enzyme to another. By "auxiliary protein" is meant any protein substance that is essential or beneficial for the activity of the enzyme.

The term “host cell” refers to the production (eg, expression of a gene, DNA or RNA sequence, protein or enzyme by a cell) of a substance by a cell in any way, selecting, modifying, transforming, propagating, Alternatively, it means any cell of any organism used or manipulated.

“DNA” (deoxyribonucleic acid) is a chemical constitutional unit called a nucleotide base, adenine (A) and guanine (which are linked together on the deoxyribose sugar skeleton).
G), any chain or sequence of cytosine (C) and thymine (T). D
NA can have a single-stranded nucleotide base or can have two complementary strands that can form a double helix structure. “RNA” (ribonucleic acid) is a chemical structural unit called a nucleotide base, adenine (A), which is linked together on the ribose sugar backbone.
By any chain or sequence of guanine (G), cytosine (C) and uracil (U). RNA typically has single-stranded nucleotide bases.

“Polynucleotide” or “nucleotide sequence” is a series of nucleotide bases (also called “nucleotides”) in DNA and RNA, and 2
It means any chain of the above nucleotides. Nucleotide sequences typically carry genetic information, including the information used by cellular machinery to make proteins and enzymes. These terms refer to double-stranded or single-stranded genomic and cDNA, RNA, any synthetically and genetically engineered polynucleotide,
And both sense and antisense polynucleotides (although only the sense strand is shown herein). It includes single- and double-stranded molecules (ie, DNA-DNA, DNA-RNA and RNA-RNA hybrids, as well as "protein nucleic acids" (PNA), which bind bases to the amino acid backbone. Formed)). It also includes nucleic acids containing modified bases such as thiouracil, thioguanine and fluorouracil.

The polynucleotides herein may be flanked by naturally-occurring regulatory sequences, or may be heterologous sequences (promoter, enhancer, response element, signal sequence, polyadenylation sequence, intron, 5'-noncoding region and 3 '). '-(Including non-coding regions, etc.). Nucleic acids can also be modified by many means known in the art. Non-limiting examples of such modifications include methylation, "capping", replacement of one or more naturally occurring nucleotides with analogs, and internucleotide modifications (eg, uncharged bonds (eg, methylphosphonate). , Phosphotriesters, phosphoramidites, carbamates, etc.) and charge bonds (eg,
Phosphorothionate, phosphorodithionate, etc.)). Polynucleotides include one or more additional covalent moieties (eg, proteins (eg, nucleases, toxins, antibodies, signal peptides, poly-L-lysines, etc.), intercalators (eg, acridine, psoralens, etc.), chelating agents (eg. , Metals, radioactive metals, iron, metal oxides, etc.), and alkylating agents). Polynucleotides can be derivatized by formation of methylphosphotriesters or ethylphosphotriesters, or alkylphosphoramidite linkages. In addition, the polynucleotides herein can also be modified, either directly or indirectly, with a label that can provide a detectable signal. Exemplary labels include radioisotopes, fluorescent molecules, biotin and the like.

Proteins and enzymes are produced in host cells using the instructions in DNA and RNA according to the genetic code. Generally, a DNA sequence bearing the instructions for a particular protein or enzyme is "transcribed" into the sequence of the corresponding RNA.
The RNA sequence is then “translated” into a sequence of amino acids that form a protein or enzyme. An "amino acid sequence" is any chain of 2 or more amino acids. Each amino acid is represented in DNA or RNA by one or more nucleotide triplets. Each triplet forms a codon, which corresponds to an amino acid. For example, the amino acid lysine (Lys) is a nucleotide triplet or codon AA.
It may be encoded by A or the codon AAG (the genetic code has some degeneracy (also called degeneracy), meaning that most amino acids have more than one corresponding codon). Since nucleotides in DNA and RNA sequences are read in three groups for protein production, it is important to start reading the sequence at the correct amino acid, so that the correct triplet is read. The manner in which nucleotide sequences are grouped into codons is called a "reading frame."

The term “gene” (also referred to as “structural gene”) means a DNA sequence that encodes or corresponds to a specific sequence of amino acids that includes all or part of one or more proteins or enzymes. , And may or may not include, for example, a regulatory DNA sequence (eg, a promoter sequence) that determines the conditions under which the gene is expressed. Some genes that are not structural genes are DNA to RNA
But is not translated into an amino acid sequence. Other genes may function as regulators of structural genes or as regulators of DNA transcription.

“Coding sequence” or “encoding” a polypeptide, protein or enzyme
A sequence is a nucleotide sequence that results in the production of that polypeptide, protein or enzyme when it is expressed, ie, this nucleotide sequence encodes the amino acid sequence for that polypeptide, protein or enzyme. R
NA polymerase transcribes its coding sequence into mRNA, which is then
Is trans-RNA spliced and, when translated into a protein encoded by its coding sequence, the coding sequence is "under the control" of transcriptional and translational control sequences in the cell. Preferably, the coding sequence is a double-stranded DNA sequence, which is transcribed and translated into a polypeptide in cells in vitro or in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the code array are
It is determined by a start codon at the 5 '(amino) terminus and a translation stop codon at the 3' (carboxyl) terminus. The coding sequence includes a prokaryotic sequence and a eukaryotic mRN.
It can include, but is not limited to, cDNA from A, genomic DNA sequences from eukaryotic (eg, mammalian) DNA, and even synthetic DNA sequences. If the coding sequence is intended for expression in eukaryotic cells, a polyadenylation signal and transcription termination sequence will usually be located 3'to the coding sequence.

Transcriptional and translational control sequences are DNA regulatory sequences (eg, promoters, enhancers, terminators, etc.) that provide expression of the coding sequences in a host cell. In eukaryotic cells, polyadenylation signals are regulatory sequences.

A “promoter sequence” is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a coding sequence downstream (3 ′ direction). To define the present invention, a promoter sequence is joined at its 3'end by a transcription start site and has the minimum number of bases or elements necessary to initiate transcription at a level where the background is detectable. Upstream to include (5 'direction)
Stretch. Within the promoter sequence, a transcription initiation site (eg, nuclease S1
By means of mapping), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. As mentioned above, promoter DNA is a DNA sequence that initiates, regulates, or otherwise mediates or controls the expression of coding DNA. A promoter can be "inducible", meaning that it is influenced by the presence or amount of another compound ("inducer"). For example, inducible promoters include promoters that initiate or increase expression of downstream coding sequences in the presence of the particular inducer compound. A "leaky" inducible promoter provides high expression levels in the presence of inducer compounds, and in the absence of inducer, relatively very low expression levels, and minimal detectable expression levels. Is a promoter that provides

A "signal sequence" is included at the beginning of the coding sequence for proteins expressed in the periplasmic space or outside the cell. This sequence encodes a signal peptide N-terminal to the mature polypeptide, which directs the host cell to translocate the polypeptide. The term "translocation signal sequence" is also used to refer to signal sequences. Translocation signal sequences can be found associated with a variety of proteins native to eukaryotes and prokaryotes, and are often functional in both types of organisms. The proteins of the invention may be further modified and improved by adding sequences that direct the secretion of the protein outside the host cell. The addition of the signal sequence does not affect the folding of the secreted protein, and the evidence is readily tested using techniques known in the art and depending on the protein (eg, after modification Test for activity of a given protein).

Preferred signal sequences of the present invention include the pelB signal sequence, which normally directs the protein to the periplasmic space between the bacterial inner and outer membranes. Other signal sequences include, for example, ompA and ompT (52).
This signal sequence is linked upstream of the nucleotide sequence encoding the protein so that the sequence is present at the N-terminus of the protein after expression.
Conventional cloning techniques can be used as described. Some routine experimentation within the skill of the art may be necessary to optimize the addition of the signal sequence to any given protein.

The terms “express” and “expression” allow or allow information in a gene or DNA sequence to be manifested (eg, into transcription and translation of the corresponding gene or DNA sequence). Producing a protein by activating the cell functions involved). A DNA sequence is expressed intracellularly or by a cell to form an "expression product" (eg, protein). The expression product itself (eg, the resulting protein) may also be said to be "expressed" by the cell. A polynucleotide or polypeptide is recombinant, eg, in a foreign host cell under the control of a foreign or native promoter, or when expressed or produced in a native host cell under the control of the foreign promoter. Is expressed.

A polynucleotide or polypeptide is "overexpressed" when it is expressed or produced in an amount or yield that is substantially higher than a given baseline yield (eg, a naturally occurring yield). Will be done. For example, a polypeptide may be produced at a yield higher than the normal, average or baseline yield of native polypeptide in the native host cell under certain conditions (eg, conditions appropriate for the life cycle of the native host cell). Is also substantially abundant, it is overexpressed. Overexpression of a polypeptide can be, for example,
It may be obtained by modifying one or more of the following: (a) conditions for growth or survival of the host cell; (b) a polynucleotide encoding the overexpressed polypeptide; (c) expression of that polynucleotide. A promoter used to control; and (d) the host cell itself. This is relative and therefore
"Overexpression" also refers to the level of expression of one polypeptide, whether that polypeptide is the native polypeptide or is encoded by the native polynucleotide. Can be used to compare or identify against. Typically, overexpression means a yield that is at least about twice the normal, average, or given baseline yield. Thus, a polypeptide is overexpressed when it is produced in an amount or yield of the parent polypeptide or substantially higher amount or yield than under parental conditions. Similarly, the polypeptide is produced in an amount or yield that is substantially lower than the parent polypeptide amount or parent conditions (eg, at least half the baseline yield). "Underexpressed", In this situation,
The expression level or expression yield refers to the amount or concentration of the expressed polynucleotide or the produced polypeptide (ie, expression product) regardless of whether it is in the active form or the functional form. As an example, a polynucleotide or polypeptide may be said to be expressed in a detectable amount under the control of an inducible promoter, but underexpressed in the absence of induction (ie, in the absence of an inducing compound). .

The expression product may be characterized as intracellular, extracellular or secretory. The term "intracellular" means something that is inside a cell. The term "extracellular" means something that is outside a cell. The substance, from somewhere on the cell or from the inside,
It is “secreted” by a cell when delivered to the periplasm or outside the cell.

As used herein, the terms “expression resistant polypeptide” and “resistant to functional expression” are synonyms and polys that are difficult to express functionally in the host cell of choice. Refers to peptides. For example, expression resistant polypeptides are not produced or have very low yields when a polynucleotide encoding the polypeptide is transformed or introduced into a host cell (eg, a simple host cell expression system). Or in a non-functional form.

These polypeptides include, for example, polypeptides having disulfide bridges,
Includes polypeptides that are composed of multiple subunits or that require glycosylation. Expression-resistant polypeptides may also be directed against folding and unfolding conditions, particularly intracellular conditions (inside the cell) (eg, temperature, pH, protein concentration, and the presence or presence of certain cofactors, coenzymes, coproteins, etc.). Polypeptides that are sensitive to (eg, absent). Expression resistant polypeptides also include polypeptides encoded by polynucleotides that are sensitive to a particular promoter or signal sequence in a particular expression system. Furthermore, expression-resistant polypeptides include polypeptides that tend to aggregate, polypeptides that tend to form inclusion bodies, or polypeptides produced in an inactive or unfolded form.

Particularly suitable for use as expression resistant parent polypeptides in the present invention are inactive, but very low yield (eg, overexpressed) when produced in high yield (eg, overexpressed). , Is under-expressed, and is active (eg, the polypeptide does not aggregate). These include, for example, the following polypeptides: (a) aggregate or form inclusion bodies when expressed by a polynucleotide under the control of an inducible promoter in the presence of an inducer. Or, tend to be inactive or unfolded; and (b) if expressed by a polynucleotide under the control of an inducible promoter, without an inducer, tend not to aggregate, and so on. is there. Such promoters are known and may be referred to as "leaky" promoters.

Polypeptides that include, incorporate, or associate with a heme group are also examples of expression resistant polypeptides. Specific expression resistant polypeptides of the present invention include plexidase enzymes (eg, horseradish peroxidase enzyme). An "expression resistant polynucleotide" is a polynucleotide that encodes an expression resistant polypeptide.

The gene encoding the protein of the present invention for use in the expression system can be isolated from any source, especially genomic DNA or cDNA, in particular a human cDNA library or a genomic library. Methods of obtaining genes are well known in the art (eg, Sambrook et al., (19)).

Thus, any animal cell can potentially serve as a nucleic acid source for molecular cloning of a gene of interest. DNA is also cloned DN
CDNA from a cDNA library prepared from tissue having high level expression of the protein from A (eg, a DNA “library”) by chemical synthesis.
It can be obtained by standard procedures known in the art, such as purified from the desired cells by A cloning or by cloning genomic DNA or fragments thereof (19,51). Clones derived from genomic DNA may contain regulatory and intron DNA regions in addition to the coding region; cD
Clones derived from NA do not contain intron sequences.

In molecular cloning of genes from genomic DNA, DNA fragments are generated, some of which encode the desired gene. This DNA can be cleaved at specific sites using various restriction enzymes. Alternatively, the DNA may be fragmented using the DNA in the presence of manganese or the DNA may be physically sheared, eg, by sonication. The linear DNA fragments can then be separated according to size by standard techniques including, but not limited to, agarose gel electrophoresis and polyacrylamide gel electrophoresis and column chromatography.

The term “transformation” refers to the introduction of an “exogenous” (ie, foreign or extracellular) gene, DNA or RNA sequence into a host cell, so that the host cell is introduced. It means to express a desired gene or sequence to produce a desired substance (typically, a protein or enzyme encoded by the introduced gene or sequence). The introduced gene or sequence may also be referred to as a "cloned" or "foreign" gene or sequence and may contain regulatory or control sequences (eg, start sequences, termination sequences, promoter sequences, signal sequences, secretory sequences or Other sequences used by the genetic machinery of the cell). The gene or sequence may include non-functional sequences with unknown function. Introduced DN
A host cell that receives and expresses A or RNA is "transformed" and it is a "transformant" or a "clone." D introduced into the host cell
NA or RNA can be from any source, including cells of the same genus or species as the host cell, or a different genus or species.

The terms “vector”, “cloning vector” and “expression vector” refer to
A vehicle capable of introducing DNA or RNA sequences (eg, foreign genes) into a host cell, thereby transforming the host and promoting expression (eg, transcription and translation) of the introduced sequences. means.

The vector typically contains the DNA of the infectious agent, and the foreign DNA is inserted into the infectious agent. A common method for inserting one segment of DNA into another segment of DNA is the use of enzymes called restriction enzymes that cut the DNA at specific sites (specific groups of nucleotides) called restriction sites. Include. Generally, foreign DNA is inserted at one or more restriction sites in the vector DNA and then carried by the vector into the host along with the transmissible vector DNA. A segment or sequence of DNA that has inserted or added DNA (eg, an expression vector) may also be referred to as a "DNA construct."

A common type of vector is a “plasmid”. A plasmid is generally a molecule contained within the self of double-stranded DNA that readily accepts additional (foreign) DNA and can be readily introduced into a suitable host cell. Plasmid vectors often contain the coding DNA and promoter DNA and contain one or more restriction sites suitable for inserting foreign DNA. The promoter DNA and the coding DNA may be from the same gene or different genes, and may be from the same or different organisms. A large number of vectors, including plasmids and fungal vectors, have been described for replication and / or expression in various eukaryotic and prokaryotic hosts. Non-limiting examples include pKK plasmid (Clonetech), pUC plasmid, pET plasmid (Novagen, Inc., Madison, WI), p
RSET or pREP plasmid (Invitrogen, San Die
go, CA) or pMAL plasmid (New England Biol)
Abs, Beverly, MA), and many suitable host cells, using the methods disclosed or cited herein or other methods known to those of skill in the relevant art. Recombinant cloning vectors often may contain one or more replication systems for cloning or expression, one or more markers for selection in the host (eg, antibiotic resistance) and one or more expression cassettes. Preferred vectors are described in the examples and include, without limitation, the following: pcWori, pET-26 (b), pXTD1.
4, pYEX-S1, pMAL and pET22-b (+). Other vectors are
It can be used if desired by a person skilled in the art. Routine experimentation in biotechnology may be used to determine which vectors are most suitable for use in the present invention, when different from those described in the examples. In general, the choice of vector will depend on the size of the polynucleotide sequences used in the methods of the invention and the host cell.

“Cassette” refers to a segment of DNA that can be inserted into a vector at specific restriction sites. The segment of DNA encodes the polypeptide of interest, and its cassette and restriction sites are designed to ensure insertion of the cassette in proper reading frame for transcription and translation.

The term “expression system” refers to suitable conditions (eg, carried by the vector,
And the host cell and a suitable vector (for expression of the protein encoded by the foreign DNA, introduced into the host cell). Common expression systems include bacterial (eg, E. coli and B. subtilities) or yeast (eg, S. cervisiae) host cells and plasmid vectors, and insect host cells and Baculovirus vectors. As used herein, a "simple expression system" refers to a foreign or heterologous to a selected polynucleotide or polypeptide and native to the selected polynucleotide or polypeptide. Or any expression system that uses host cells that can be grown or maintained more favorably than cells that are heterologous, or that can produce the polypeptide more efficiently or in higher yields. For example, expressing proteins of eukaryotic origin using potent prokaryotic cells can be a convenient expression system. A preferred simple expression system is E.
E. coli host cells, B. subtilis cells and S. cerevisiae
Host cells and any suitable vector are included.

The terms “variant” and “mutation” refer to a detectable change in genetic material (eg, DNA) or any process, mechanism or result of such a change. This includes gene mutations, where the structure of the gene (eg, DNA sequence)
, Any gene or DNA resulting from any mutation process,
And any expression product (eg, protein or enzyme) expressed by the modified gene or DNA sequence. The term “variant” can also be used to indicate a modified or altered gene, DNA sequence, enzyme, cell, etc. (ie, any type of variant).

A “sequence conservative variant” of a polynucleotide sequence is a variant in which one ≧ nucleotide change at a given codon position does not result in a change in the amino acid encoded at that position.

A “function conservative variant” is a variant in which a given amino acid residue in a protein or enzyme is altered without altering the overall conformation and function of the polypeptide. , Including but not limited to: Substituting an amino acid with an amino acid that has similar properties (eg, acidic, basic, hydrophobic, etc.). Amino acids with similar properties are well known in the art. For example, arginine, histidine and lysine are hydrophilic basic amino acids and may be interchangeable. Similarly, the hydrophobic amino acid isoleucine can be replaced with leucine, methionine or valine. Amino acids other than the amino acids referred to as conserved may differ in the protein or enzyme so that the% sequence similarity of a protein or amino acid between any two proteins of similar function may vary, and, for example, , Cluster Meth
It may be 70-99% when determined according to the alignment scheme according to od (where the similarity is based on the MEGALIGN algorithm). A "conservative variant" also has an amino acid identity of at least 60%, preferably at least 75%, most preferably at least 85%, and more preferably 90% as determined by the BLAST or FASTA algorithm. Have,
And a polypeptide or enzyme having the same or substantially similar properties or functions as the native or parental protein or enzyme being compared.

The term “DNA reassembly” is used when recombination occurs between identical sequences. The term "DNA shuffling" refers to recombination between substantially homologous but non-identical sequences.

“Isolation” or “purification” of a polypeptide or enzyme refers to its environment of origin (eg, the natural environment if the polypeptide or enzyme is naturally occurring, or the polypeptide or enzyme). Is produced by recombinant DNA methods, it means obtaining the polypeptide by removing the polypeptide or enzyme (from the host cell). Methods for purifying polypeptides are well known in the art and include, but are not limited to, preparative disc gel electrophoresis, isoelectric focusing, HPLC, reverse phase HPL.
C, gel filtration, ion exchange and fractionation chromatography, and countercurrent partitioning. For some purposes it is preferred to produce the polypeptide in a recombinant system. In this recombinant system, the protein includes additional sequence tags that facilitate purification, such as, but not limited to, polyhistidine sequences. The polypeptide can then be purified from the host cell crude lysate by chromatography on a suitable solid phase matrix. Alternatively, antibodies raised against other or peptides derived therefrom may be used as purification reagents. Other purification methods are possible. The purified polynucleotide or polypeptide is
It may comprise less than 50%, preferably less than about 75%, and most preferably less than about 90% of the cellular components originally associated with the polynucleotide. A "substantially pure" enzyme exhibits the highest degree of purity, which can be achieved using conventional purification techniques known in the art.

Polynucleotides are “hybridizable” to each other if at least one strand of one polynucleotide is capable of annealing to another polynucleotide under defined stringency conditions. Hybridization stringency is determined, for example, by: a) hybridization and / or
Or the temperature at which the wash is performed, and b) the ionic strength and polarity (formamide) of the hybridization and wash solutions and other parameters. Hybridization requires that the two polynucleotides contain substantially complementary sequences. However, depending on the stringency of hybridization, mismatches can be tolerated. Typically, hybridization of two sequences at high stringency (eg, 0.5 × SSC in water at 65 ° C.) shows that the sequence has a somewhat higher degree of complementarity to the entire sequence. Need that. Moderate stringency conditions (eg, 2 x SS at 65 ° C)
Aqueous solutions of C) and low stringency conditions (eg, 2 × SSC in water at 55 ° C.) correspondingly require less total complementarity between the hybridizing sequences. (1 × SSC is 0.15M NaCl, 0.015M sodium citrate). A polynucleotide that "hybridizes" to a polynucleotide herein can be of any length. In one embodiment, such a polynucleotide is at least 10 nucleotides in length, preferably at least 15 nucleotides in length, and most preferably at least 20 nucleotides in length. In another embodiment, the hybridizing polynucleotides are about the same length. In another embodiment, the hybridizing polynucleotide comprises a polynucleotide that anneals under appropriate stringency conditions and the same function (
For example, those that encode polypeptides or enzymes having the ability to catalyze the oxidation, oxygenase, or coupling reactions of the invention.

The use of the general genetic engineering tools and techniques (including transformation and expression), host cells, vectors, expression systems, etc., discussed herein are well known in the art.

Protein Mutagenesis and Directed Evolution In order to improve expression of proteins using conventional expression systems, the present invention may use directed evolution to generate a mutant library of polynucleotides. Make an unexpected invention. This results in a functional protein with even higher activity than the normal or native protein when expressed using conventional expression systems or simple expression systems. Inclusion bodies, which are commonly formed when expressing proteins with disulfide bonds, and labor-intensive in vitro refolding procedures can also be avoided by directed evolution.

According to the present invention, a protein that is more easily expressed in a simple gene expression system is obtained by using directed evolution to produce a mutant polynucleotide that is incubated in a library format for selection. obtain. General methods for generating libraries and isolating and identifying proteins (also referred to as "variants") that have been improved according to the invention using directed evolution are briefly described below, It is extensively described, for example, by US Pat. Nos. 5,741,691 and 5,811,238. It can be appreciated that any method for generating a mutation in a polynucleotide sequence to provide an evolved polynucleotide for use in an expression system can be used. The protein produced by the directed evolution method is then labeled according to conventional methods.
It can be screened for improved expression, folding, secretion and function.

Any source of nucleic acid in purified form can be utilized as the starting nucleic acid. Thus, the process may use DNA or RNA, including messenger RNA, which DNA or RNA may be single-stranded or double-stranded. In addition, DNA-RNA hybrids containing one strand of each can be utilized. The nucleic acid sequence can be of variable length depending on the size of the nucleic acid sequence to be mutated. Preferably the specific nucleic acid sequence is 50 to 50,000 base pairs. It is contemplated that the entire vector containing the nucleic acid encoding the protein of interest can be used in the methods of the invention.

Any particular nucleic acid sequence can be used to produce a population of variants by the process of the invention. The initial population of particular nucleic acid sequences with mutations can be generated by a number of different known methods, some of which are described below.

Error-prone polymerase chain reaction (20,45,46) and cassette mutagenesis (38-44), where specific regions of optimization are replaced by synthetically mutagenized oligonucleotides It can be used in the present invention. Error-prone PCR can be used to mutagenize a mixture of fragments of unknown sequence. These techniques can also be used under low fidelity polymerization conditions to randomly induce low levels of point mutations over long sequences or to mutagenize a mixture of fragments of unknown sequence.

Oligonucleotide-directed mutagenesis, which replaces short sequences with synthetically mutagenized oligonucleotides, can be used to produce evolved polynucleotides with improved expression.

Alternatively, nucleic acid or DNA shuffling, which uses in vitro or in vivo homologous recombination methods of pools of nucleic acid fragments or polynucleotides, is used to carry polynucleotides having variant sequences of the invention. Molecules can be generated.

Parallel PCR is another method that can be used to evolve polynucleotides to improve expression in conventional expression systems. This method uses a number of different PCR reactions that occur in parallel in the same vessel, so that the products of one reaction prime the production of another reaction. Sequences can be randomly mutagenized at various levels by random fragmentation and reassembly of fragments by mutation priming. Site-directed mutagenesis can be introduced into long sequences by random fragmentation of the template, followed by reassembly of that fragment in the presence of the mutagenic oligonucleotide.

Certain useful applications of parallel PCR that can be used in the present invention have been described in
exual) PCR. In sex PCR, also known as DNA shuffling (shuffling), parallel PCR is used to perform in vitro recombination on a pool of DNA sequences. Sex PCR can also be used to construct chimeric libraries of genes from different species.

Polynucleotide sequences for use in the invention can also be altered by chemical mutagenesis. Chemical mutagenesis includes, for example, sodium disulfide, nitrous acid, hydroxylamine, hydrazine or formic acid. Other agents that are analogs of nucleotide precursors include nitrosoguanidine, 5-bromouracil, 2-aminopurine or acridine. Generally, these agents are added to the PCR reaction instead of the nucleotide precursor, thereby
Mutate the sequence. Intercalating agents such as proflavin, acriflavine, quinacrine and the like may also be used. Random mutagenesis of polynucleotide sequences is also accomplished by irradiation with X-rays or UV light, or by subjecting the polynucleotides to growth in a host lacking normal DNA damage repair function (eg, E. coli). Can be done. In general, the DNA or DNA fragment of the plasmid so mutagenized is described in E. E. coli and amplified as a pool or library of mutant plasmids.

Alternatively, a mixed population of particular nucleic acids can be found in nature, where these nucleic acids are different alleles of the same gene, or the same gene from different related species (ie, a cognate gene). ). Alternatively, these nucleic acids are related DNA sequences found within a species (eg, the peroxidase class of genes).
Can be. Once a mixed population of specific nucleic acid sequences has been generated, the polynucleotide can be used directly or inserted into an appropriate cloning vector using techniques well known in the art.

Once the evolved polynucleotide molecules are produced, they can be cloned into a suitable vector selected by one of skill in the art according to methods well known in the art. When a mixed population of specific nucleic acid sequences is cloned into a vector, the mixed population of nucleic acid sequences is clonally cloned by inserting each vector into a host cell and allowing the host cell to amplify the vector. Can be amplified to. The mixed population can be tested to identify the desired recombinant nucleic acid fragment. The selection method depends on the desired DNA fragment. For example, in the present invention, a DNA fragment encoding a protein with improved folding properties can be determined by testing for the functional activity of the protein and the absence of inclusion body formation. Such tests are well known in the art.

Using the method of directed evolution, the present invention produces properly folded, functional, and soluble proteins in conventional or facile expression systems (eg, E. coli or yeast). Provide a new means to do so. Conventional tests can be used to determine if the protein of interest produced from the expression system has improved expression, folding and / or functional properties. For example, to determine whether a polynucleotide that has been subjected to directed evolution and expressed in a foreign host cell produces a protein with improved folding, one skilled in the art will appreciate the functional activity of that protein. Experiments designed to test can be performed. Briefly, evolved proteins can be rapidly screened and, if readily isolated and secreted, purified from expression systems or media. The protein can then be subjected to an assay designed to test the functional activity of the particular protein in its native form. Such experiments for various proteins are
Well known in the art and described in the examples below.

In one embodiment, the present invention contemplates using a polynucleotide that encodes a variant of the heme-containing protein. Thus, the present invention uses directed evolution to generate novel peroxidase enzymes (eg, HRP). This enzyme folds properly in the host cell used in the expression system (eg, E. coli), maintains functional activity, and avoids problems associated with inclusion body formation.

The present invention can also be applied to select or optimize expression systems. These include selection of host cells, promoters and signal sequences. Expression conditions can also be optimized according to the present invention.

The following examples further describe the methods of the present invention, and in particular, H that does not form inclusion bodies and retains functional activity when expressed using conventional expression systems.
Teaching the use of directional evolution to generate variants of RP. Usually, the corresponding native proteins form inclusion bodies after expression in conventional expression systems and show little retained functional activity.

Examples of practicing the present invention are provided, and are understood to be illustrative only and not limiting of the scope of the invention or the scope of the appended claims. Those of skill in the art will understand that the invention can be implemented in numerous forms, in accordance with the appended claims and the disclosure herein.

Example 1 Functional Expression of Horseradish Peroxidase in E. coli and Yeast There is increasing interest in developing eukaryotic peroxidases for use as industrial biocatalysts. However, protein engineering and directed evolution to improve certain properties is complicated by the lack of facile recombinant expression systems. In an attempt to develop a functional bacterial expression system suitable for large-scale screening of horseradish peroxidase (HRP) mutants, this example demonstrates that by inserting the corresponding gene as a fusion with the signal peptide PelB. The development of a bacterial expression system for heme-related proteins, such as horseradish peroxidase (HRP), is described. Furthermore, by subjecting these genes to directed evolution, heme-related proteins have been identified in E. coli. It folds more efficiently in E. coli and is more resistant to heat (thermostable), and more resistant to inactivation by H ₂ O ₂ . Although this example is a promising industrial biocatalyst, there are currently no suitable bacterial or yeast expression systems because the protein either forms inclusion bodies or is not efficiently secreted by cells. It provides an approach to greatly facilitate the attempt to "fine tune" the enzyme.

(HRP Cloning) The HRP gene (with an extra methionine residue at the N-terminus) was cloned into the plasmid pBB.
G10 (British Biotechnologies, Ltd., Oxford.
ord, UK) and cloned by PCR technology to create an AatII site
A start codon was introduced and a HindIII site was introduced immediately downstream from the stop codon. This plasmid contains the synthetic horseradish peroxidase (HRP) gene described in Smith et al. (13). This DNA sequence is based on the amino acid sequence published for the HRP protein (49). pBBG10 is HRP
The sequence was created by inserting between the HindIII and EcoRI sites of the polylinker in the well known plasmid pUC19. The PCR product obtained from this plasmid was first digested with AatII, blunt-ended with t4 DNA polymerase, and then further restricted with HindIII. Digest pE
T-22b (+) (purchased from Novagen, McsI and HindIII
Treated with) to obtain the vector pETpelBHRP. A map of this expression vector is shown in FIG. In this construct, the HRP gene is placed under the control of the T7 promoter and fused in frame to the pelB signal sequence (see SEQ ID NO: 1 and SEQ ID NO: 2 and FIG. 2). They theoretically direct the transport of proteins into the periplasmic space (ie, delivery outside the cytoplasm of cells) (27). The ligation product was treated with 1 mM isopropyl-b.
For expression of that protein in cells, both with and without induction by D-thiogalactopyranoside (IPTG), E. coli strain BL21 (DE
3).

In cells induced with IPTG, peroxidase activity above background was pET-due in BL221 (DE3) cells, even considering that the level of HRP polypeptide exceeds 20% of the total cellular protein. 22b
It was also not detected in BL21 (DE3) cells with (+). This is consistent with previous observations (12-14).

Clones were discovered that showed weak but measurable activity against azino-di- (ethylbenzthiazoline sulfate) (ABTS) in cells that were not induced with IPTG.

The T7 promoter in the pET-22b (+) vector is known to be prone to leakage (31), and therefore, theoretically, the H produced at this basal level.
It is possible that some of the RP polypeptide chains may fold into their native form. Conversely, the addition of IPTG results in high levels of HRP synthesis, which in turn favors chain aggregation and prevents its proper folding. Subsequently, random mutagenesis and screening were used to identify mutations that resulted in higher expression of HRP activity.

Thus, in one aspect of the invention, a small amount of polypeptide under some conditions,
And the use of promoters that can regulate the production of larger amounts of the polypeptide under other conditions. For example, a "leaky" inducible promoter can be used.
This type of promoter produces high levels of specific proteins in the presence of inducer compounds, and much lesser amounts of that protein in the absence of inducer. In some embodiments, polypeptides can be overexpressed under certain conditions (eg, in the presence of an inducer) and underexpressed under other conditions (eg, no inducer). Polypeptides that are inactive when expressed at normal levels or overexpressed but active when underexpressed are particularly suitable for use as the parent polypeptide of the invention. Such expression-resistant polypeptides may be modified using the methods of the invention to provide functional, active expression, with reasonably high yields and levels of activity.

Random Library Generation and Screening One of the HRP clones that showed detectable peroxidase activity was used in the first generation of error-prone PCR mutagenesis. Random library,
It was generated by a modification of the error-prone PCR protocol described above (20, 21 and 22). Here, 0.15 mM MnCl ₂ was used instead of 0.5 mM McCl ₂ . This protocol has been shown to incorporate both manganese ions and non-equilibrium nucleotides and produce both transitions and transversions, and thus amino acid changes produce a broader spectrum (50).

Briefly, this PCR reaction solution consisted of 20 femtomolar template, 30 picomoles of each two primers, 7 mM MgCl ₂ , 50 mM KCl, 1
0 mM Tris-HCl (pH 8.3), 0.01% gelatin, 0.2 mM
DGTP, 0.2 mM dATP, 1 mM dCTP, 1 mM dTTP, 0
． 15 mM MnCl ₂ and 5 units of Taq polymerase were included in 100 μl. The PCR reaction was carried out using the MJ PTC-200 cycler (MJ Research).
The following parameters were performed for 30 cycles in rch, MA): 94 ° C for 1 minute, 50 ° C for 1 minute, and 72 ° C for 1 minute. The primers used are as follows: 5'-TTATTTGCTCAGCCGGTGGCAGCAGC (SEQ ID NO: 15),
And 5'-AAGCGCTCATGAGCCCGAAGTGGG (SEQ ID NO: 16).

The PCR product was purified using the Promega Wizard PCR kit and digested with NdeI and HindIII. Digestion product, QIAEX
Subjected to gel purification using the II Gel Extraction Kit, and the HRP fragment was similarly digested and ligated back into the gel purified pET-22b (+) vector. The ligation mixture was transformed into BL21 (DE3) cells by electroporation with a Gene Pulser II (Bio-Rad). Cell growth and expression was performed at 30 ° C. in LB medium in either 96-well or 384-well microplates. Peroxidase activity tests were performed with H ₂ O ₂ and ABTS (26).

For each generation, typically 12,000 to 15,000 colonies were picked and screened in 96 well plates. This number means an exhaustive search of all accessible single variants, where 9 for any variant.
At least once with a probability of 5% (25). Colonies were either manually or automated with a colony picker (Caltech, Q-bot (Ge
(Netic, UK). 12 screened
Among the 1,000 colonies (without addition of IPTG), the variant designated HRP1A6 showed 10-14 fold higher peroxidase activity than the parental clone. Figure 5A
And 5B. This mutant clone also showed significantly reduced activity when as little as 5 μM IPTG was added. Figure 6. Sigma reports that 1 mg of HPR highly purified from horseradish has a total activity of 1,000 units as determined by the ABTS assay. Other investigators reported similar results (13
). Based on this data, the concentration of active HRP was estimated to be approximately 100 μg / L. HRP1A6 shows total activity greater than 100 units / L. This compares favorably with the yields obtained from the refolding of aggregated HRP chains in vitro (13). This expression level for the HRP variant was also found in E. c
Similar to the levels for bovine pancreatic trypsin inhibitor (BPTI) in oli, which is an unglycosylated protein with three disulfide bonds. Greater than 95% activity of HRP was found in LB culture medium as judged by ABTS activity.

The mutant HRP remained stable at 4 ° C. for up to 1 week. IPTG was omitted in all HRP expression experiments unless otherwise noted. A peroxidase activity test for HRP was performed using a classical peroxidase assay, ABTS
And hydrogen peroxide (26). 15 μl of cell suspension was added to 140 μl
1 ABTS / H ₂ O ₂ (2.9 mM, ABTS, 0.5 mM H ₂ O ₂ , pH 4.
5) in a microplate. And this activity is called SpectraM
ax plate reader (Molecular Devices, Sunnyv)
ale, CA) at 25 ° C. One unit of HRP is defined as the amount of enzyme that oxidizes 1 μmol ABTS per minute under assay conditions.

By sequencing the mutant gene, a mutation was found at position 255. here,
The codon AAC for the amino acids asparagine (Asn or N) was changed to the codon GAC for the amino acids aspartic acid (Asp or D). This residue is a putative glycosylation site and is located on the surface of the protein. The sequence of this mutant (HRP1A6) is shown in FIG. 3 (SEQ ID NO: 3).
A map of plasmid pETpelBHRP1A6 containing this mutant is shown in FIG.

[0102]   A representative structure of this HRP mutant showing the Asp255Asp mutation is shown in FIG.

Functional Expression of HRP in Yeast The native HRP protein contains 4 disulfide bonds and is expressed in E. coli.
E. coli has only a limited ability to support disulfide formation. Theoretically, these well-conserved disulfides in HRP (and other plant peroxidases) appear to be important for the structural integrity of this protein and may not be replaced by mutations elsewhere. .
Yeast has a greater ability to support disulfide bond formation. Therefore,
Yeast, in particular, is If it is desired to relax the apparent restriction on the folding of HRP, which imposes any constraints on disulfide formation in E. coli, E. coli. Instead of E. coli, it can be used as a suitable expression host.
For example, S. cerevisiae can be used as a host for expression of mutant HRP genes and proteins.

The HRP variant (HRP1A6) was cloned into Clontech (Palo Alto,
CA) (35) and cloned into the secretion vector pYEX-S1,
pYEXS1-HRP was obtained (FIG. 8). This vector is Kluveromyc
Utilizes the constitutive phosphoglycerate kinase promoter and secretory signal peptide from es lactis. This plasmid was first transformed into E. coli
Amplification in S. cerevisiae and then using the LiAc method as described (36). ce
revisiae strain BJ5465 (Yeast Genetic Stock
Center (YGSC), University of California
a, obtained from Berkeley). BJ5465 is prosthesis deficient and has been found to be generally suitable for secretion.

The first generation of HRP error-prone PCR was performed in yeast. Of the first 7,400 mutants screened, four were HRP1A in yeast.
The activity was 400% higher than that of No. 6. Further details and results are shown in FIG.

Example 2: Functional expression of HRP in yeast by directed evolution This example describes the use of directed evolution to further improve the functional expression of HRP. A variant of horseradish peroxidase (HRP1A6) was isolated as described in Example 1. HRP contains four well-conserved disulfides, and E. Since E. coli only has a limited ability to support disulfide bond formation, further improvements in bacterial expression of HRP in E. coli could be constrained by the exact pairing of disulfide-containing cysteines. Yeast cells, such as S. cerevisiae, have a much greater ability to support disulfide bond formation and can better adapt disulfide bonds in peroxidase enzymes. Theoretically, these well-conserved disulfides in HRP (and other plant peroxidases) are:
It appears to be important for the structural integrity of this protein, and may not be replaced by mutations elsewhere. Therefore, yeast is
． If it was desired to relax the apparent restriction on the folding of HRP, which imposes any constraints on disulfide formation in E. coli. co
can be used as a suitable expression host instead of li.

Therefore, S. cerevisiae was selected as an alternative host for expression of HRP. S. cerevisiae is a microbial and eukaryotic, and eukaryotic protein post-translational and secretory machinery (eg, ER and Golgi,
They catalyze the formation of disulfide bonds and glycosylate polypeptides). Genetic engineering techniques, especially genetic transformation, are also readily available. The disadvantage is that yeast naturally secretes little protein. Moreover, yeast glycosylation is significantly different from that of higher eukaryotes. This may present problems with glycoprotein secretion (4). Nevertheless, some proteins were efficiently secreted from yeast (4). Strategically, the experiments in this example exploit the ability of yeast to catalyze the formation of disulfide bonds while fine-tuning glycosylation factors through the process of directional evolution.

Construction of Yeast Expression System for HRP The HRP variant HRP1A6 from Example 1 was transformed into the yeast secretion vector pYEX-S1.
Cloning (35) in (obtained from Clontech, Palo Alto, Calif.) Yielded pYEXS1-HRP (FIG. 8). This vector is based on K. lac
Utilizes the constitutive phosphoglycerate kinase promoter and secretory signal peptide from tis. pYEX-S1 was digested with SacI, then T4 D
Blunt-ended with NA polymerase. The mature HRP1A6 gene is generated by proofreading polymerase pfu (Stratagen), which produces blunt-ended products.
e, CA) and was cloned by PCR technology from pETpelBHRP1A6. The forward primer and reverse primer used were
It was as follows: 5'-CAGTTAACCCCCTACATTC-3 '(
SEQ ID NO: 25) and 5'-TCATTAAGAGTTGCTGTTGAC-3
'(SEQ ID NO: 26). This PCR fragment was then ligated into restriction digested and blunt ended pYEX-S1 and E. E. coli DH5α cells were transformed. Multiple colonies were picked, and for the presence of the HRP gene, these two primers: 5 '"CGTAGTTTTTTCAAGTTCTT.
AG 3 '(SEQ ID NO: 27) and 5'TCCTTACCTTCCAATAATT
Screened by colony PCR reaction 18 with C-3 '(SEQ ID NO: 28). The correct orientation of this HEP gene was further confirmed by sequencing. This yeast expression vector is referred to hereafter generally as pYEXS1-
It is called HRP (FIG. 8). In this construct, the HRP gene was cloned into K. lact
It is located immediately downstream of the secretory signal peptide from is and expression is under the control of the constitutive phosphoglycerate kinase promoter. This vector also
E. It has the E. coli Amp resistance gene and the yeast selectable markers leu2-d and URA3 (47).

For expression experiments, this plasmid was first transformed into E. coli. E. coli strain DH5α followed by L utilizing single stranded DNA as described by Gietz et al. (48).
Using the iAc method, S. cerevisiae strain BJ5465 (Yeast
Genetic Stock Center (YGSC; Universit)
Y of California (obtained from Berkeley)). After transformation, cells were plated in YNB selection medium supplemented with 20 μg / ml leucine, 20 μg / ml histidine, 20 μg / ml adenine and 20 μg / ml tryptophan. Colonies were picked and in YEPD medium at 30 ° C. in a circulating air incubator for 2 days and 16 hours, 9
Grow in 6-well microplates. The HRP activity test was performed using the classical peroxidase assay, ABTS and hydrogen peroxide (26). The activity obtained for HRP1A6 from yeast was determined by E. about 1/1 of that from E. coli
It was only 0. And this was actually slightly lower than that obtained for the wild type in this construct.

Generation and Screening of HRP Variants A library of HRP variants as described in (53) except that the following two primers flanking the HRP gene were used in a mutagenic PCR reaction. (20): 5'-CAGTTAAC constructed by error-prone PCR in
CCCTACATTC-3 '(SEQ ID NO: 25) and 5'-TGATGCTGT
CGCCGAAGAAG-3 '(SEQ ID NO: 29). The thermal cycle parameters were 95 ° C. for 2 minutes (94 ° C. for 1 minute, 50 ° C. for 1 minute, and 72 ° C. for 1 minute for 30 cycles).

The PCR product was transferred to the Promega Wizard PCR kit (Madiso).
n, WI) and digested with SacI and BamHI (HR
The first 27 amino acid residues of P were left unmodified). The digested product is then
Subjected to gel purification using the QIAEX II gel extraction kit (QIAGEN, Valencia, CA), and the HRP fragment was similarly digested and ligated back into gel purified pYEXS1-HRP1A6. The ligation mixture was added to Gen
E. coli by electroporation with a Pulser II (Bio-Rad). E. coli HB101 cells and 100 mg / ml
Were selected on LB medium supplemented with ampicillin. Colonies were picked directly from LB plates. This plasmid DNA was then added to yeast BJ54 as described above.
Used for transformation into 65.

Single colonies were picked from yeast nitrogen base (YNB) plates, and YEP
The cells were grown in a 96-well microplate containing D medium (1% yeast extract, 1% peptone, 2% glucose) for 64 hours at 30 ° C. in an incubator. The microplate was then centrifuged at 1,500 g for 10 minutes and 10 μl of supernatant in each well was added to the Beckman 96 channel pipette station (
(Maltimek, Beckman, Fullerton, CA) were transferred to new microplates and assayed for total HRP activity. The overall standard deviation of this measurement (including pipetting error, which was about 2%) was
It did not exceed 10%. The improved mutant, which shows the highest total HRP activity, was removed directly from the microplate, washed 3 times with sterile H ₂ O ₂ and regrown in YNB selective medium. The plasmid containing the HRP mutant was designated as Zy
mo yeast plasmid miniprep kit (Zymo Research, Ora
n., CA) and first extracted from yeast, and then E. coli x 10-
Returned to Gold for further growth and isolation of preparation.

Where mentioned, preliminary screening of HRP-expressing yeast clones was performed as follows. Colonies on YNB plates were plated on MSI-supported pure nitrocellulose membrane (Micron Separations Inc. W.
estboro, MA), which was grown on fresh YEPD agar at 30 ° C. for 34 hours. Then, the membrane was immersed in 100 ml of TMB membrane substrate (0.8 mM TMB, 2.9 mM H ₂ O ₂ , and 0.12% (W / V) dextran sulfate (as an enhancer)) for 5 minutes to develop the product. I was allowed to. Those yeast clones that showed a bright green color were traced back to the master YNB selection plate, picked up and grown in YEPD for further screening as follows.

Primary HRP Mutagenesis in Yeast to Improve Expression The first error-prone of HRP1A6 in yeast.
) PCR was performed to improve expression levels. The error-prone PCR protocol used incorporated both non-equilibrium nucleotide concentrations and manganese ions as previously described (20, 21). This protocol was shown to generate approximately random variants, which allowed for a broader spectrum of amino acid residue changes to be sampled. The manganese ion concentration used is
100 μM, which resulted in an error rate of about 1-2 mutations per gene on average (22). The PCR product was purified with the Promega Wizard PCR kit and digested with SacI and BamHI (hence the first 27 of the HRP.
Amino acid residues remain unchanged). This digestion product is then QIAE
Subjected to gel purification using the XII gel extraction kit, and the HRP fragment was ligated back into similarly digested and gel purified PEXS1-HRP1A6. The ligated mixture was transformed into HB101 cells by electroporation with Gene Pluser II (Bio-Rad). The colony was transformed into E. col
The plasmids were prepared from scratched plates from i and resuspended in LB medium. This plasmid was then transformed into yeast and yeast colonies were obtained and propagated (as above).

A total of approximately 14,000 colonies were picked and screened for this generation. This showed an exhaustive search for all single accessible variants, and a 95% probability for any variant sampled at least once (2
5). Many mutants of these colonies were found in yeast to have the parent (HRP1A
The activity was significantly higher than that of 6). Two examples of improved mutants, HRP1
-117G4 [SEQ ID NO: 12 and SEQ ID NO: 13] and HRP1-77E2
It is named [SEQ ID NO: 5 and SEQ ID NO: 6]. HRP1-117G4 obtained a 16-fold higher activity than the parent, ie about 220 units / L total activity (FIG. 9). H
RP1-77E2 showed a total activity of about 147 units / L. Both of these are described in E. It was higher than the highest level obtained in E. coli. Figure 12 (HRP1-77
See E2) and FIG. 16 (HRP1-117G4).

[0116]   (Second generation HRP mutagenesis in yeast to improve expression)   HRP1-117G4 was used as a parent in the second generation of error-prone PCR.
For this generation, higher concentrations of manganese ions were used to increase the mutation rate.
It was This change was made based on the following considerations. Screening is currently about 10 ^Four -10^FiveSince only the mutant library of
Were traditionally limited to preferentially making single mutations (15). this
In the example, the fraction of clones that were more active than the parent for a given generation was relatively constant.
The error rate per gene was up to 6 mutations. Higher error rate
The advantage of using is that at higher error rates, neutral mutants
It is possible to exist with the advantageous variant that is isolated.
These generated neutral mutants provide cross-links that generate new types of mutants
Possibly or not to provide synergy with the newly created variant
Depending on the offset, it can be useful in subsequent generations. Ma used in this generation
The gangan ion concentration is 350 μM, which averages about 4-5 per gene.
Variant error rates were generated.

In addition, a preliminary screening of colonies was performed using a nitrocellulose membrane. This was possible because the higher error rate significantly reduces the number of colonies that show equivalent or higher activity than the parent. This procedure was as follows. Colonies are first replicated from the master plate to a nitrocellulose membrane,
Grow on YEPD plates at 30 ° C. for 1 day and 6 hours. Then removed the film from the plate and immersed in a mixture of TMB (tetramethylbenzidine) and H ₂ O _2. The brightest colored colonies were identified and the corresponding mother colonies were picked from the master plate and grown. Approximately 120,000 colonies were screened for this generation (approximately 5,000 picked and grown) and mutant HRP2-28D6 was obtained. It has 85% higher activity than its parent HRP1-117G4, ie 410 units / L
The total activity was shown (Fig. 9).

Third Generation HRP Mutagenesis in Yeast to Improve Expression A third round of random mutagenesis was performed under similar conditions using HRP2-28D6 as the parent. For this generation, a total colony count of 90,000 was prescreened and 3,000 picked and grown. The best variant, HRP3-17E12, gave a 160% increase over the parental HRP2-28D6, an expression level of 1080 units / L that was 85-fold greater than the starting variant HRP1A6.

[0119]   (Primary HRP mutagenesis in yeast to improve stability)   Thermal stability and H₂O₂Mutagenesis of HRP for improved resistance to
The first generation of expulsion was performed with HRP1-77E2 as the parent. Random mutation
Evolving (using 100 μM manganese) and cell proliferation were performed essentially as described above.
Performed (without prior screening). Thermal stability test is performed on PTC-200
Incubation at 73 ° C for 10 minutes using Cler (MJ Research, MA)
It was carried out at the option time. H₂O₂Resistance tests were performed separately with 25 mM H₂O₂To
At room temperature and a pre-incubation time of 30 minutes, followed by 25 mMH ₂ O₂Was performed by ABTS screening in. More heat stable bite than parents
Or chemically stable (H₂O₂Mutants that are resistant to heat (thermal stability)
About) or H₂O₂At concentration (H₂O₂Further stability was characterized).

Of the 3,000 colonies screened, one thermostable mutant (H
RP-14B6) showed a T _1/2 higher than 6 ° C. over the parent T _1/2 (T _1/2
Is the transition midpoint of the HRP inactivation curve as a function of temperature) (FIG. 10). Another variant, HRP1-28B11, also showed some improvement in thermostability. Mutant HRP1-24D11 was significantly less thermostable than its parent, HRP1-77E2, but more resistant to H ₂ O ₂ degradation. (HR
A common feedback mechanism for P enzymes is that they are degraded by H ₂ O ₂ (which is a reactant in HRP-promoted enzymatic reactions). HR
P1-24D11 variants after incubation for 30 minutes with 25 mM H ₂ O _2, holds about 60% of the activity, whereas the parent showed 42% residual activity under the same conditions (Fig. 11).

(Construction of Vector for HRP Expression in Pichia pastoris) The improved HRP mutant was further transformed into Pichia expression vector pPIZaB (
Invitrogen Corp. , Carlsbad, CA) to facilitate the generation of variants for biochemical characterization (54). This vector contains a factor peptide (4 residues Glu-A at the C-terminus of the secretory signal).
la-GLu-Ala spacer sequence), and methanol-induced PA
Contains the OX1 promoter. pPIZaB is first restricted with PstI, then T4 D
Blunt-ended with NA polymerase and then further digested with EcoRI. This sample was purified with the Promega DNA Purification Kit. The coding sequence for the HRP variant was obtained from the corresponding pYEXS1-HRP plasmid by PCR technology using the proofreading polymerase Pfu. The following two primers were used in the PCR reaction: 5'-TCAGTTAACCCCCTACATTC-3 '.
(Forward direction) [SEQ ID NO: 30] and 5'CCACCACCACAGTAGAGACA
TGG-3 '(reverse direction) [SEQ ID NO: 31]. The PCR product was restricted with EcoRI and ligated into digested and purified pPIZaB, pPIZaB-HR.
Generate P (FIG. 1). Here, the HRP gene was placed immediately downstream of the factor a signal. The ligation product was first transformed into E. E. coli strain XL10-Gold,
And 25 mg / ml Zeocin (Cayla, Toulouse ced
ex, France) supplemented low salt LB medium (1% tryptophan, 0.5%
Yeast extract, 0.5% NaCl, adjusted to pH 7.5). Clones were screened for the presence of the HRP gene by a colony PCR reaction (55) with the following two primers: 5'-GAGAAAAGAGAGGC.
TGAA GCTC -3 '(forward) [SEQ ID NO: 32] and 5'-TCCTTA
CCTCTCAAATAATTC-3 (reverse direction) [SEQ ID NO: 33]. The forward primer contained the last 3 nucleotides of the signal sequence and the first nucleotide of the HRP sequence (underlined). This confirmed that the positive colonies carried the full length HRP gene in the correct orientation. Plasmids were isolated from liquid cultures of positive transformants using the QIAgen miniprep kit and used for further transformation into Pichia for expression of HRP.

Transformation of Pichia was performed by electroporation according to the manufacturer's instructions (Invitrogen). Prior to transformation, the plasmid was
linearized with eI, purified with the Promega DNA Purification Kit, and further
d. d. Was treated with H ₂ O Te Bu equilibrated Princeton Centri-Sep column, to remove any residual impurities. The linearized vector was transformed with D
Upon transformation through homologous recombination between NA and Pichia genome, Pi
It was integrated into the chia genome. Transformed cells with 100 mg / ml Zeo
It was plated on YPDS medium (1% yeast extract, 2% peptone, 2% glucose, 1M sorbitol) supplemented with cin. For each construct containing different HRP variants, typically 4-6 transformants were picked and purified on fresh YPDS plates (supplemented with 100 mg / ml Zeocin) to isolate single colonies. This was then screened to identify the clones that were conferred the highest expression levels. Pichia strain X-33 was used in all expression experiments. In the first test, X-33 (Mut +) was replaced by KM17 (M
utS) was determined to yield significantly better HRP expression.

[0123]   (HRP expression in Pichia pastoris)   Cell growth of Pichia was performed at 30 ° C. on a shaker. pPIZaB-HR
First, P-bearing cells were supplemented with BMGY supplemented with 1% casamino acid (1% yeast extract, 2%
Peptone, 100 mM potassium phosphate, pH 6.0, 1.34% YNB, 4x1
0-5% biotin, 1% glycerol) overnight growth with an OD of 1.2-1.6_{60 0} I chose The cells were then pelleted and resuspended and supplemented with 1% casamino acid.
Filled BMMY medium (B except for 0.5% methanol instead of 1% glycerol)
OD of 1.0 in the same as MGY)₆₀₀I chose Propagation for an additional 54-72 hours
Continued. Sterile methanol was added every 24 hours to maintain induction conditions. Supernatant
HRP levels peaked around 54-60 hours after induction (where O
D₆₀₀Reached about 8.0-10.0). 1 if applicable, at the time of induction
． 0 mM vitamin B1, 1.0 mM d-ALA, and a trace amount of 0.5 ml / L
Element mixture (0.5g / L MgCl₂, 30 g / L FeCl₂・ 6H₂O, 1g
/ L ZnCl₂・ 4H₂O, 0.2g / L CoCl₂・ 6H₂O, 1g / L N
a₂MoO_Four・ 2H₂O, 0.5g / L CaCl₂・ 2H₂O, 1g / L CuC
l₂, And 0.2 g / L H₂BO₃) Was added to the growth medium.

Peroxidase Activity Assay The peroxidase test for HRP was performed with the classical peroxidase assay, ABTS and hydrogen peroxide (26). 10 μl (or 15 μl)
Of the cell suspension of 140 μl (or 150 μl) of A
BTS / H ₂ O ₂ (ABTS and H ₂ O ₂ concentrations of 0.5 mM and 2 respectively)
． 9 mM (pH 4.5)). Then, the increase in absorbance at 405 nm (the e of oxidized ABTS was 34.700 cm ^-1 M ^-1 ) was changed to SpectraMa.
x Plate Reader (Molecular Devices, Sunnyvale)
e, CA) at 25 ° C. The unit of HRP is defined as the amount of enzyme that oxidizes 1 μmol ABTS per minute under assay conditions.

Guaiacol Assay This assay is performed with 1 mM H ₂ O ₂ and 5 mM Guajacol (Guayacol) in 50 mM phosphate buffer pH 7.0. And 470
The increase in absorbance at nm was followed after the addition of yeast supernatant (ε of the oxidized product is 26.000 cm ⁻¹ M ⁻¹ at 470 nm).

The stability of the variants was evaluated using an assay for initial activity (A _i ) and residual activity (A _resid ) (implemented as above with ABTS as substrate). The A _resid, NaOA containing of H ₂ contain no O ₂ or 1mM of H ₂ O ₂
After incubation of the HRP variant in c buffer pH 4.5 and at 50 ° C
Measure after 10 minutes of incubation.

Assays for stability in organic solvent / buffer (NaOAc buffer 50 mM pH 4.5) mixtures were performed using supernatants (10 μl) of HRP variants expressed in yeast in dioxane / buffer (20/80). ) Was used at 1 mM H ₂ O ₂ and 2 mM ABTS.

Production of HRP Variants in Pichia To obtain sufficient amounts of purified enzyme, Pichia was used in a further attempt to increase production of HRP variants. HRP-C (wild type), HRP 2-1
3A10 (FIG. 19, [SEQ ID NO: 21 and SEQ ID NO: 22]) and HRP 3
-17E12 (FIG. 20, [SEQ ID NO: 23 and SEQ ID NO: 24]) was added to Pichi
It was cloned into the a secretion vector pPICZaB. This construct (pPICZa
In B-HRP, FIG. 1b), HRP was fused to a factor a signal peptide,
And the expression was induced using methanol. A representative expression curve is shown in FIG. Regarding HRP3-17E12, after culturing for 55 hours, about 6,500 units / L of HRP activity (that is, 6.5 times the activity obtained from yeast) was detected in the supernatant (FIG. 25, open square). ). Not only our laboratory, but also research from other laboratories, trace metal elements to the growth medium, heme synthesis intermediate aminolevulinic acid,
And the addition of vitamin supplements (e.g. thiamine) has been described by E. It was found that there was a substantial improvement in the yield of the heme-containing protein holoenzyme in E. coli (59-62). Addition of these additives to Pichia growth medium in our experiments resulted in 32% in HRP3-17E12 activity detected in the supernatant.
(Fig. 25, black square).

(Sequencing Data) The parent HRP1-77E2 used in thermostability and H ₂ O ₂ stability studies was revertants D255-N255 (GAC-AAC), and the second variant. Sequencing has been shown to carry L371 (TTA-ATA). This residue is part of helix 2 and is adjacent to the heme pocket (34). See, eg, FIG. 2 [SEQ ID NO: 5] and [SEQ ID NO: 6].

Mutant HRP1-4B6, in addition to L371, K232M (AAG-ATG
) Own. This residue is part of helix 14 and is solvent exposed on its surface. See, eg, FIG. 13 [SEQ ID NO: 7] and [SEQ ID NO: 8].

HRP1-28B11, a thermostable mutant between HRP1-77E2 and HRP1-4B6, contains mutants F221L (TTT-T) in addition to L371.
TA). This residue is in a loop structure and is part of the substrate access channel (34). See Figure 14 [SEQ ID NO: 9] and [SEQ ID NO: 10].

Mutant HRP1-24D11 includes mutant L131P (CTA in addition to L371.
~ CCA). This residue is at the tip of helix 7 and is on its surface. See Figure 15 [SEQ ID NO: 11] and [SEQ ID NO: 12].

Mutant HRP1-117G4, which is a preferred mutant of primary origin for total activity
Contains 5 variants for its parent: (1) D255-N255 reversion (GAC-AAC) (wild-type sequence); (2) L131.
P (CTA-CCA); (3) L223Q (CTG-CAG); (4) N135 (AAC-AAT) with silent mutations, and (5) T257 (ACT-.
ACA). For mutant L223Q, this amino acid residue is in the loop and is solvent exposed. See Figure 16 [SEQ ID NO: 13] and [SEQ ID NO: 14].

Remarkably, the improved HRP variant, HRP1-80C12 (FIG. 17).
[SEQ ID NO: 17] and [SEQ ID NO: 18]), as well as HRP1-77E2 (FIG. 20, [SEQ ID NO: 23] and [SEQ ID NO: 24]) are also revertants D255.
Possesses N255 (GAC to AAC). Furthermore, HRP1-80C12 is
Includes L131P (CTA-> CCA) found in HRP1-77G4. On the other hand, HRP-77E2 has the second mutant L371 (TTA-> ATA). It is part of helix B and is in the heme pocket and is probably solvent accessible as well.

HRP2-28D6 (FIG. 18 [SEQ ID NO: 19] and [SEQ ID NO: 20])
Two additional variants for HRP1-117G4: T102A (ACT ---
> GCT) and P226Q (CCA-> CAA). T102A is part of helix D and is the only variant found to be embedded inside the structure. P226Q is located in the same loop as L223Q. On the other hand, HRP2-13A10 has four further variants for HRP1-117G4: R93L (CGA->CTA); T102A (ACT->GCT);
K241T (AAA->ACA); and V303E (GTG-> GAG)
including. R93L (solvent accessible) has helix C and helix D
It is in a loop structure that connects K241T is a helix G and a helix H
It is in a loop structure that connects This residue is exposed to solvent as before. Finally, V303E is part of a long chain extending from helix J at the C-terminus of the protein. These three variants appear to contribute to the increased stability of this variant compared to the other variants.

HRP3-17E12 is an additional three variants for the parent HRP2-28D6: N47S (AAT->AGT); K241T (AAA-> ACA) and one of the silent variants at G121 (GGT ---). > GGC). K241
It should be noted that T was also found in HRP2-13A10. N47
S is located in a loop structure connecting helix B and one 3-helix, and is also solvent accessible.

Variant Analysis All three of the first improved variant forms of evolution carry the revertant D255N for the parent HRP1A6. This seems to suggest that the glycosylation site on HRP favors folding and expression. Although the function of glycosylation in proteins has been an interesting issue, its role in protein folding, processing and secretion has been gradually recognized (56-58).
).

The three synonymous variants cannot be easily explained by changes in codon usage (63). Two of them, N135 (AAC-> AAT) and T257 (ACT-> ACA), produced only slight changes in frequency of use,
On the other hand, for G121 (GGT-> GGC), the more frequently used codon (GCT, 61%) was replaced by the slightly less frequent codon (GGC, 16%). However, it is not clear how significantly this substitution affects the translation of HRP mRNA.

Characterization of Variants for Reactivity and Stability In addition to the ABTS assay, the guaiacol system is also used as a second independent activity assay for HRP variants (FIG. 21). Both assays are
It shows a good correlation with the activity of the mutants.

22a and 22b show the correlation between reactivity and stability after incubation at 50 ° C. without H ₂ O ₂ (a) and 1 mM H ₂ O ₂ (b). In both cases the mutant HRP 2-13A10 shows the highest stability combined with good reactivity. Three amino acid changes appear to be responsible for this stability, as demonstrated by sequencing.

A similar pattern of stability is observed with the organic solvent system (Figure 23). Here, the mutant HRP2-13A10 shows the best activity ratio in the dioxane / buffer system relative to the activity ratio in the buffer alone.

(Example 3) (Expression and secretion of CCP in E. coli) (Construction of expression vector for CCP) Dr. Dave Goodin (The Scripps Research)
PT7CC, donated by Institute, La Jolla, CA)
S. p. From P (16, 17). The C. cerevisiae cytochrome C peroxidase (CCP) gene was recloned by PCR technology and the Ms
A HindIII site was introduced immediately downstream of the cI site and the stop codon. This PCR product was restricted with MsCI and HindIII and then ligated into similarly digested pET-22b (+), generating pETCCP (Figure 26). This pT
7CCP carries the gene for CCP. The N-terminal sequence of this gene is Good
It has been modified to encode the amino acids Met-Lys-Thr as described in in et al. (17) and Fitzgerald et al. (16). in this way,
In this construct, the CCP gene was placed under the control of the T7 promoter and fused in frame to the pelB signal sequence for periplasmic localization.

(Expression of CCP) The expression experiment of CCP in E. coli BL21 (DE3) was performed at 100 μg.
/ LB ampicillin in LB medium. Cells were grown at 37 ° C. to an A ₆₀₀ of 0.7-0.8. At this time, IPTG was added to a final concentration of 1 mM to induce the synthesis of CCP from the T7 promoter. Growth was continued at 30 ° C. for a further 20 hours and cells and supernatant were collected by centrifugation.

CCP is an E. It is known to fold correctly in E. coli. Surprisingly, over 95% of CCP protein was found at high levels (approximately 100 mg / liter as assessed by SDS-PAGE) in the LB culture medium. This protein was active against ABTS, indicating that the secreted CCP folds and contains the required heme ferric iron.

Thus, while exemplary embodiments of the present invention have been described, the present disclosure is exemplary only and various other alternatives, adaptations and modifications may be made within the scope of the present invention. It should be noted to those skilled in the art. For example, although any method step of the invention generally requires a particular order, or is necessarily inherent or absolute, for the practice of the invention, Any order (simultaneous or contemporaneously
It will be understood by the practitioner. Therefore, the present invention is not limited to any particular embodiment or illustration herein. The invention is defined according to the appended claims and is limited only by the claims.

[0146]   (References)

[0147]

[Chemical 1]

[Brief description of drawings]

FIG. 1A shows that E. 1 is a schematic map of the plasmid pETpelBHRP, which is the E. coli HRP expression vector pETHRP. The HRP gene (containing an extra methionine residue at the N-terminus) was introduced into pET-22b (+) and Erwinia carotovora pectate lyase B (PelB) for periplasmic localization.
Was inserted immediately downstream of the signal sequence of. Expression is under the control of the T7 promoter. FIG. 1 is a schematic map of the pastoris expression vector pPICZαB-HRP. The HRP gene was inserted immediately downstream of the alpha factor signal in this plasmid. Expression is under the control of the methanol-inducible _PAOX1 promoter.

FIG. 2 shows the nucleic acid and amino acid sequences of the pelB signal peptide (SEQ ID NO: 1 and SEQ ID NO: 2).

FIG. 3 shows the nucleotide and amino acid sequences encoding the HRP enzyme variant designated HRP1A6 (SEQ ID NO: 3 and SEQ ID NO: 4).

[Figure 4]   FIG. 4 is a map of the expression vector pETpelBHRP1A6.

FIG. 5A shows wild type and E. HRP mutants evolved in E. coli (1A
The relative activity of 6) is shown. FIG. 5B shows a representative landscape of first generation HRP variants sorted by activity in descending order. Activity is normalized to wild-type activity.

[Figure 6]   FIG. 6 shows the activity level of mutant HRP1A6 at various ITPG concentrations.

FIG. 7 shows the structure of HRP. This indicates the position of the Asn255 to Asp mutation in the surface loop of HRP variant 1A6. This figure is based on the published HRP conformation (34) from Insight II software (Molecular B).
iosystems).

FIG. 8 is a map of the expression vector pYEXS1-HRP containing the coding sequence of HRP cloned into the secretion plasmid pYEX-S1.

FIG. 9 shows HRP1A6 as well as S. Three other variants obtained by directed evolution in S. cerevisiae: HRP1-77E2, HRP1-117G
4 and the level of activity of HRP2-28D6. In this embodiment, HR
P1A6 was the parent of HRP1-77E2 and HRP1-117G4,
HRP1-117G4 was the parent of HRP2-28D6.

FIG. 10 shows residual activity of some HRP variants as a function of temperature as a heat inactivation curve. This heat inactivation curve shows the relative thermostability of the mutants.

FIG. 11 shows residual activity of some HRP variants as a function of hydrogen peroxide concentration in a titration curve. This titration curve shows the relative ability of the mutants to withstand degradation in the presence of hydrogen peroxide.

FIG. 12 shows the nucleotide and amino acid sequences encoding the HRP enzyme variant designated HRP1-77E2 (SEQ ID NO: 5 and SEQ ID NO: 6).

FIG. 13 shows the nucleotide and amino acid sequences encoding the HRP enzyme variant designated HRP1-4B6 (SEQ ID NO: 7 and SEQ ID NO: 8).

FIG. 14 shows the nucleotide and amino acid sequences encoding the HRP enzyme variant designated HRP1-28B11 (SEQ ID NO: 9 and SEQ ID NO: 10).
.

FIG. 15 shows the nucleotide and amino acid sequences encoding the HRP enzyme variant designated HRP1-24D11 (SEQ ID NO: 11 and SEQ ID NO: 12).
).

FIG. 16 shows the nucleotide and amino acid sequences encoding the HRP enzyme variant designated HRP1-117G4 (SEQ ID NO: 12 and SEQ ID NO: 13).
).

FIG. 17 shows the nucleotide and amino acid sequences encoding the HRP enzyme variant designated HRP1-80C12 (SEQ ID NO: 17 and SEQ ID NO: 18).
).

FIG. 18 shows the nucleotide sequence and amino acid sequence encoding the HRP enzyme variant designated HRP2-28D6 (SEQ ID NO: 19 and SEQ ID NO: 20).
.

FIG. 19 shows the nucleotide sequence and amino acid sequence encoding the HRP enzyme variant designated HRP2-13A10 (SEQ ID NO: 21 and SEQ ID NO: 22).
).

FIG. 20 shows the nucleotide sequence and amino acid sequence encoding the HRP enzyme variant designated HRP3-17E12 (SEQ ID NO: 23 and SEQ ID NO: 24).
).

FIG. 21 is a schematic diagram of S.M. cerevisiae strain BJ5465 in wild type, parent (
HRP1A6) and the activity of evolved HRP variants. Values were obtained using the ABTS assay. Cells were grown in shake flasks at 30 ° C. for 64 hours.

FIG. 22 shows the correlation between reactivity and stability (A _resid / A _i ) of HRP variants.

FIG. 23   FIG. 23 shows the reactivity of HRP variants in an organic solvent / water system.

FIG. 24 shows mutant strains. Nucleotide substitutions are shown in parentheses after the corresponding amino acid substitutions and synonymous mutations are italicized. For each generation,
Give " ^* " to the new mutation.

Figure 25: H secreted from Pichia for variant HRP3-17E2
Shows the accumulation of RP activity.

FIG. 26 is a schematic map of the yeast cytochrome c peroxidase expression vector pETCCP.

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) C12R 1: 865) C12N 15/00 ZNAA (C12N 1/21 C12R 1:19) (C12N 9/08 C12R 1 : 865) (C12N 9/08 C12R 1:19) (81) Designated countries EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC , NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, SD, SL, SZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AL, AM, AT, AU, A Z, BA, BB, BG, BR, BY, CA, CH, CN, CU, CZ, DE, DK, EE, ES, FI, GB, GD, GE, HR, HU, ID, IL, IN, IS , JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, UA, UG, US, UZ, VN, YU, ZA, ZW (72) Inventor Lin, Chan Lin United States California 91106, Pasadena , S. Chester Avenue 101, Apartment Number F Term (reference) 4B024 AA20 BA08 CA02 DA06 DA12 EA04 HA03 4B050 CC04 DD13 4B065 AA26 AA80 AB01 BA02 CA28

Claims (35)

[Claims] 1. A method of obtaining and improving the production of an expression resistant polypeptide, the method comprising the steps of: at least one encoding a parent polypeptide that is resistant to functional expression in a selected host cell. Providing a parent polynucleotide, altering the nucleotide sequence of the parent polynucleotide to produce a population of variant polypeptides, transforming the host cell to express the variant polypeptide , And screening for a functional variant produced by said host cell and having at least one of improved expression without folding or inclusion bodies. 2. The method of claim 1, wherein the parent polypeptide forms an inclusion body when overexpressed in the host cell. 3. The method of claim 1, wherein the parent polypeptide has at least one of a disulfide bridge structure and a glycosylation structure. 4. The method of claim 1, wherein the parent polypeptide has or binds to at least one heme family. 5. The parent polypeptide is produced in a non-functional form when overexpressed in the host cell and in a functional form when underexpressed in the host cell. The method according to 1. 6. The parent polypeptide is overexpressed under the control of an inducible promoter in the presence of an inducer and underexpressed under the control of an inducible promoter in the absence of the inducer. The method according to 5. 7. The method of claim 1, comprising repeating the method for multiple cycles, wherein the parent polynucleotide in each cycle is
The method, which is a variant polynucleotide from the previous cycle. 8. The method of claim 1, wherein the step of altering the nucleotide sequence is performed by at least one of random mutagenesis, site-directed mutagenesis and DNA shuffling. 9. The method of claim 7, wherein the step of altering the nucleotide sequence is performed by at least one of random mutagenesis, site-directed mutagenesis and DNA shuffling. 10. A polynucleotide evolved according to the method of claim 1. 11. A polynucleotide evolved according to the method of claim 7. 12. A polynucleotide evolved according to the method of claim 9. 13. The method of claim 1, wherein the host cell is transformed with a vector having a signal sequence that directs secretion of the polypeptide encoded by the variant polynucleotide. 14. The method of claim 13, wherein the signal sequence is the PelB signal sequence. 15. The method of claim 1, wherein the host cell is a simple host cell. 16. The method of claim 1, wherein the host cell is selected from yeast and bacteria. 17. The method of claim 7, wherein the host cell is selected from yeast and bacteria. 18. The method of claim 9, wherein the host cell is selected from yeast and bacteria. 19. The host cell is E. The method according to claim 1, which is an E. coli cell. 20. The host cell is S. cerevisiae cells,
The method of claim 1. 21. The host cell is a P. The method according to claim 1, which is a pastoris cell. 22. The host cell is E. 10. The method according to claim 9, which is an E. coli cell. 23. The host cell is S. cerevisiae cells,
The method according to claim 9. 24. The host cell is a P. The method according to claim 9, which is a pastoris cell. 25. The polypeptide of claim 7, wherein the polypeptide is a heme-containing protein.
The method described in. 26. The polypeptide of claim 9, wherein the polypeptide is a heme-containing protein.
The method described in. 27. The polypeptide of claim 1, wherein the polypeptide is a heme-containing protein.
The method according to 8. 28. The method of claim 7, wherein the polypeptide is a peroxidase enzyme. 29. The method of claim 9, wherein the polypeptide is a peroxidase enzyme. 30. The method of claim 18, wherein the polypeptide is a peroxidase enzyme. 31. The method of claim 26, wherein the polypeptide is a horseradish peroxidase enzyme. 32. The method of claim 27, wherein the polypeptide is a horseradish peroxidase enzyme. 33. The method of claim 28, wherein the polypeptide is a horseradish peroxidase enzyme. 34. A polynucleotide encoding horseradish peroxidase having one or more mutations at amino acid positions selected from positions 255, 371, 131 and 223, wherein the initiation methionine residue is 0th place,
Polynucleotide. 35. A polynucleotide encoding a horseradish peroxidase having at least one mutation selected from N255D, L371I and L131P.