CN116555235A

CN116555235A - HRV3C protease mutants with altered P1' site specificity for substrates

Info

Publication number: CN116555235A
Application number: CN202310613615.0A
Authority: CN
Inventors: 易犁; 梅萌; 张桂敏; 周瑜; 范贤; 张发英
Original assignee: Hubei University
Current assignee: Hubei University
Priority date: 2023-05-29
Filing date: 2023-05-29
Publication date: 2023-08-08

Abstract

The invention discloses a group of HRV3C protease mutants aiming at the change of the P1' locus specificity of a substrate, belonging to the technical fields of genetic engineering and enzyme engineering. The invention utilizes saturation mutation and random mutation technology to carry out molecular transformation on wild type HRV3C protease, so that the wild type HRV3C protease is changed from recognizing the original polypeptide sequence LEVLFQ ∈G to recognizing the polypeptide sequence LEVLFQ ∈M, and a series of HRV3C protease mutants are obtained. Compared with wtHRV3C-P, the mutant provided by the invention has better specificity and cutting activity for a substrate LEVLFQ ∈M, and can achieve the effect of traceless excision of protein fusion tags, thereby widening the practical application range of HRV3C protease.

Description

HRV3C protease mutants with altered P1' site specificity for substrates

Technical Field

The invention relates to a group of HRV3C protease mutants with specific change of a P1' locus of a substrate, belonging to the technical fields of genetic engineering and enzyme engineering.

Background

Human rhinovirus 3C (HRV 3C) protease belongs to the family of cysteine proteases, has His40-Glu71-Cys146 catalytic triplets, can recognize LEVLFQ ∈G polypeptide sequences, and cuts between Gln and Gly, and has high specificity and activity. HRV3C protease has high activity in the temperature range of 4 to 30 ℃ and is therefore widely used for removal of fusion protein tags. In particular, the HRV3C protease has obvious high activity advantage in low temperature protein purification [ Raran-Kurussi, S.,J.,Cherry,S.,et al.,Differential temperature dependence oftobacco etch virus and rhinovirus 3C proteases.Anal Biochem.2013,436(2),142-4.]。

however, wild-type HRV3C protease (wt HRV 3C-P) has strict substrate specificity as a tool enzyme, and after the fusion protein tag is removed, the N-terminal end of the target protein may remain with 1 amino acid Gly, so that the target protein may be immunogenic, thus greatly limiting the application range thereof.

Disclosure of Invention

In view of the deficiencies of the prior art, a first object of the present invention is to provide a set of HRV3C protease mutants with altered P1' site-specificity for a substrate.

In order to achieve the above technical object, the present inventors considered that since Met is an amino acid for translation initiation of most proteins, the present inventors have realized the object of traceless excision protein fusion tag by modifying wild-type HRV3C protease to be molecule-modified for substrate P1' site specificity from recognizing the original polypeptide sequence LEVLFQ ∈g to recognizing the polypeptide sequence LEVLFQ ∈m.

In order to change the substrate P1' site specificity of the HRV3C protease so as to widen the practical application range, the inventor adopts a combined strategy of combining structure simulation, saturation mutation and random mutation library design and ERS optimized YESS (eYESS) system, and expands the molecular modification of the HRV3C protease. Wherein the eYESS system is based on a previously published Saccharomyces cerevisiae endoplasmic reticulum retention screening (yeast ER sequestration screening, YESS) system [ Yi, L., gebhard, M.C., li, Q., et al, engineering ofTEVprotease variants by Yeast ER Sequestration Screening (YESS) of composite materials, proc Natl Acad Sci U S A2013, 110 (18), 7229-7234]An improved protein molecular modification system capable of effectively carrying out single-cell high-throughput screening on an exogenous protease mutant library by utilizing endoplasmic reticulum retention signal peptide (ER retention sequence, ERS) in an optimized mode. In the eYESS system (FIG. 1), the HRV3C protease was molecularly engineered using a three-step screening strategy. Firstly, ERS (FEHDEL) is used at the carboxyl end of the protease mutant library and the substrate end thereof to increase the concentration and hydrolysis reaction time of protease and the substrate thereof in an endoplasmic reticulum, improve the probability of protease hydrolysis reaction, amplify weak protease hydrolysis reaction signals and further preliminarily enrich enough protease mutants. Secondly, ERS at the carboxyl end of the substrate is removed and ERS at the protease end is reserved to increase the screening pressure of the system, so that the protease mutant with improved enzyme activity is obtained through screening. Finally, the protease mutants with further improved activity are screened out by removing ERS at the carboxyl end of the protease to further improve the screening pressure of the system. In addition, to increase the effectiveness of mutant pool screening, the eYESS system employed Kex2 knock-out Saccharomyces cerevisiae strain EBY100 ^Kex2- Construction of the mutant library effectively prevents cleavage of the protease and its substrate by the primary endogenous protease Kex2 in the yeast secretory pathway [ Li, Q, yi, L, hoi, K.H., et al Profiling Protease Specificity: combining Yeast ER Sequestration Screening (YESS) with Next Generation Sequencing ].ACS Chem Biol 2017,12(2),510-518.]。

The invention provides a group of HRV3C protease mutants with modified site specificity aiming at a substrate P1', which mutate 22 th lysine, 25 th phenylalanine, 106 th asparagine, 129 th threonine, 140 th alanine, 143 th threonine or 145 th glutamine of wt HRV 3C-P. Specifically, the HRV3C protease mutant is obtained by carrying out at least one mutation on the basis of the amino acid sequence of wild type HRV3C protease:

(1) Mutating lysine 22 to any one of alanine, cysteine, glycine, leucine, methionine, proline, glutamine, arginine, valine and tryptophan;

(2) Mutating phenylalanine at position 25 to valine;

(3) Mutating asparagine at position 106 into any one amino acid of cysteine, glutamic acid, phenylalanine, glycine, lysine, arginine, threonine, valine, tryptophan and tyrosine;

(4) Mutating threonine at position 129 to isoleucine;

(5) Mutating alanine at position 140 to serine;

(6) Mutating threonine at position 143 to any one of alanine, phenylalanine, methionine, proline, tryptophan and tyrosine;

(7) Glutamine at position 145 is mutated to any one of cysteine, aspartic acid, phenylalanine, histidine, methionine, threonine, tryptophan and tyrosine.

The amino acid sequence of the wild type HRV3C protease (wt HRV 3C-P) is shown in SEQ ID NO. 1.

In one embodiment of the invention, the HRV3C protease mutant is obtained by mutating lysine 22 of wt HRV3C-P to methionine, mutating asparagine 106 to threonine, mutating threonine 143 to proline and mutating glutamine 145 to threonine, and obtaining an optimal mutant A3 in the first step of screening, wherein the amino acid sequence is shown as SEQ ID NO.2, and the mutation sites of the rest mutants are shown in Table 1.

In another embodiment of the present invention, the HRV3C protease mutant is obtained by mutating lysine 22 to leucine, phenylalanine 25 to valine, asparagine 106 to tyrosine, threonine 143 to methionine, glutamine 145 to methionine in wt HRV3C-P, and obtaining the optimal mutant B22 in the second step, wherein the amino acid sequence is shown in SEQ ID No.3, and the mutation sites of the remaining mutants are shown in table 1.

In another embodiment of the present invention, the HRV3C protease mutant is obtained by mutating lysine 22 to leucine, phenylalanine 25 to valine, asparagine 106 to tyrosine, threonine 129 to isoleucine, threonine 143 to methionine, glutamine 145 to methionine of wt HRV3C-P, and obtaining the optimal mutant C3 in the third step, wherein the amino acid sequence is shown in SEQ ID No.4, and the rest mutant mutation sites are shown in table 1.

The invention further provides genes for encoding the mutants A3, B22 and C3, and the nucleotide sequences of the genes are shown in SEQ ID NO. 5-7.

Third, the invention also provides a recombinant plasmid containing the gene. In one embodiment of the invention, the recombinant plasmid is constructed on the basis of pRK792 or pYSD vectors.

Fourth, the invention also provides a genetically engineered bacterium expressing the HRV3C protease mutant. In one embodiment of the invention, the genetically engineered bacterium is escherichia coli or saccharomyces cerevisiae.

Fifth, the present invention also provides a method for screening HRV3C protease mutants having altered P1' site specificity for a substrate, which comprises constructing a mutant having a library size of 2.7X10 which covers 6 sites ⁸ The HRV3C protease saturated mutant library of (2) was subjected to three-step high-throughput screening for substrate LEVLFQ +.m using the eYESS system. The method specifically comprises the following steps:

1) Base groupIn the reported structure of HRV3C protease (PDB: 2B 0F) [ Bjorandahl, T.C., andrew, L.C., sementhenko, V., et al, NMR solution structures ofthe apo and peptide-inhibited human rhinovirus C protease (Serotype 14): structural and dynamic comparator.biochemistry 2007,46 (45), 12945-12958.]The ZDOCK program analysis in DS is utilized to find that the distance and substrate (LEVLFQ ≡G) P1 'site in the S1' substrate binding region on HRV3C protease isIncluding Lys22, phe25, asn106, thr143, gly144, and Gln145 (fig. 2). Finally, a size of 2.7X10 is constructed for the 6 bits ⁸ HRV3C protease saturated mutant pool of (b);

2) Designing a mutation primer containing a degenerate codon NNS, NDT, VMA, ATG, TGG combination by taking a wt HRV3C-P gene as a template, and performing PCR;

3) Recovering the PCR product obtained in the step 2) by using 0.8% agarose gel, and then carrying out double digestion on the PCR product and pYSD-GAL1-Aga2-FLAG-LEVLFQ ∈M-HA-FEHDEL vector by using restriction endonucleases PstI and EcoRI according to a molar ratio of 3:1, and then electroconverting to Saccharomyces cerevisiae EBY100 ^Kex2- Obtaining a saturated mutant library of HRV3C protease containing 6 site mutations in competent cells;

4) Culturing and inducing the constructed HRV3C protease mutant library, marking fluorescent antibodies by utilizing Anti-HA-FITC and Anti-FLAG-iFluor647, and finally carrying out 3 rounds of high-throughput screening on yeast cells with high iFluor647 and low FITC fluorescent signals by using a flow cytometer. The yeast obtained in the last round of screening is coated on YNB-CAA-Glucose plates, 50 single colonies are respectively selected for activity and sequence analysis after single colonies grow out, and the result shows that most mutants can cut new substrates, the activity of the A3 mutant is highest, and the cutting efficiency for the substrate LEVLFQ ∈M is 84.2% (figure 3);

5) The final round of screening yeast cell plasmids was extracted and used as templates to amplify the protease gene, which was then digested with PstI and EcoRI to obtain pYSD-GAL1-Aga2-FLAG-LEVLFQ ∈ M-HA vector according to a molar ratio 3:1, and then electroconverting to Saccharomyces cerevisiae EBY100 ^Kex2- In competent cells, a pool of protease mutants was obtained from the second screening step. In this library, the screening pressure of the second screening step was reduced by removing ERS at the substrate end. The yeast cells with high iFluor647 and low FITC fluorescence signals are obtained through three rounds of flow cytometry screening. The activity and sequence of 50 protease mutants in the last round of screening cells are analyzed, and a protease mutant B22 with the strongest cleavage activity for a substrate LEVLFQ ∈M is obtained through identification. To verify whether the B22 mutant could maintain this cleavage efficiency in ERS-free conditions. Then, the B22 protease gene is constructed on a vector pYSD-GAL1-Aga2-FLAG-LEVLFQ ∈M-HA, and the activity is detected by using a YESS system, so that the cleavage efficiency of the substrate LEVLFQ ∈M is reduced from 95% to 50% in the prior art (figure 3). It follows that the activity of the B22 mutant is to be further improved;

6) In order to further increase the screening pressure of the system, ERS at the carboxyl end of protease is removed in the third screening step. The B22 gene is used as a template, a protease mutant DNA fragment is obtained through error-prone PCR amplification, and then the protease mutant DNA fragment is subjected to double digestion with pYSD-GAL1-Aga 2-FLAG-LEVLFQ: 1, and then electroconverting to Saccharomyces cerevisiae EBY100 ^Kex2- In competent cells, a library of protease mutants screened in the third step was obtained. Then, three rounds of sorting were performed on yeast cells with high iFluor647 and low FITC fluorescence signals, and the activity and sequence of 50 mutants in the last round of screening cells were analyzed, and a mutant C3 with highest activity on a substrate LEVLFQ.

Sixth, the invention also provides a method for detecting the dynamic parameters of the HRV3C protease and the mutant thereof, which specifically comprises the following steps:

1) The LEVLFQ ∈X-6His-GFP (X is any one of 20 amino acids) and LEVLFQ ∈G-6His-wt HRV3C-P, LEVLFQ ∈M-6His-C3 gene fragments are obtained by a PCR cloning method respectively, and then are respectively connected with pRK792 vectors subjected to restriction endonuclease NcoI and XhoI double digestion. The enzyme linked products are respectively transformed into competent cells of escherichia coli XL-GOLD (Invitrogen company), and recombinant plasmids pRK792-MBP-LEVLFQ ∈X-6His-GFP (X is any one of 20 amino acids), pRK792-MBP-LEVLFQ ∈G-6His-wt HRV3C-P and pRK792-MBP-LEVLFQ ∈M-6His-C3 are respectively obtained after colony PCR verification and sequencing confirmation;

2) Respectively transforming the plasmids into BL21 (DE 3) competent cells to obtain escherichia coli expression strains containing wt HRV3C-P and mutants thereof or MBP-LEVLFQ;

3) Culturing the different escherichia coli expression strains with LB (containing Amp antibiotics) culture medium, and then inducing the expression of HRV3C protease, mutants and fusion protein substrates thereof by using IPTG;

4) Purifying the HRV3C protease, mutant and fusion protein substrate by using Ni-NTAHis resin;

5) The purified protease and the substrate are reacted according to different concentration ratios, reaction solutions at 0, 5, 10, 15, 25 and 45min are taken, and fluorescent intensity of GFP fusion proteins contained on a protein gel diagram is analyzed by utilizing SDS-PAGE and a multifunctional laser analyzer, so that the cleavage efficiency and kinetic parameters of the HRV3C protease mutant aiming at different fusion protein substrates are calculated (table 2).

Seventh, the invention also provides a method for detecting the specificity of the HRV3C protease mutant C3 to the P1' site of the substrate, which specifically comprises the following steps:

1) PCR cloning to obtain C3, C3-FEHDEL, aga2-FLAG-LEVLFQ ∈X-HA and Aga2-FLAG-LEVLFQ ∈X-HA-FEHDEL (X is any one of 20 amino acids) gene fragments;

2) The C3 and C3-FEHDELPCR products obtained in the step 1) are subjected to double digestion by restriction enzymes BamHI and XhoI and agarose gel recovery, and then are respectively subjected to enzyme ligation with pYSD carrier subjected to double digestion by restriction enzymes BamHI and XhoI. The enzyme linked product is transformed into competent cells of escherichia coli XL-GOLD (Invitrogen company), and recombinant plasmids pYSD-GAL10-C3 and pESD-GAL10-C3-FEHDEL are respectively obtained after colony PCR verification and sequencing confirmation;

3) And (2) carrying out double digestion and agarose gel recovery on the Aga2-FLAG-LEVLFQ ∈X-HA and the Aga2-FLAG-LEVLFQ ∈X-HA-FEHDEL PCR products obtained in the step (1) by using restriction endonucleases PstI and EcoRI, and then respectively carrying out enzyme ligation with pYSD-GAL10-C3 and pYSD-GAL10-C3-FEHDEL vectors subjected to double digestion by using the restriction endonucleases PstI and EcoRI. The enzyme linked product is transformed into competent cells of escherichia coli XL-GOLD (Invitrogen company), and recombinant plasmids pYSD-C3-GAL10-GAL1-Aga 2-FLAG-LEVLFQ;

4) The plasmids were transformed into Saccharomyces cerevisiae EBY100, respectively ^Kex2- Obtaining a saccharomyces cerevisiae expression strain simultaneously containing an HRV3C protease mutant C3 and a substrate thereof in competent cells;

5) The different Saccharomyces cerevisiae expression strains are respectively cultured by YNB-CAA-Glucose culture medium, and then the YNB-CAA-Galactose culture medium is changed to induce the expression of HRV3C protease mutant C3 and substrates thereof.

6) The induced yeast cells were labeled with Anti-HA-FITC and Anti-FLAG-iFlor647 fluorescent antibodies. And detecting fluorescence of the yeast cells by using a flow cytometer, and finally calculating the cutting efficiency of the C3 mutant aiming at different substrates.

The analysis results show that: when both protease and substrate ends carry FEHDEL, the C3 mutant was able to cleave 20 substrates and the cleavage efficiency reached 80% -99% (FIG. 4). Whereas the C3 mutant was also able to cleave 20 substrates when the protease and the end of the substrate ERS were removed, but exhibited different cleavage efficiencies. Analysis found that the C3 mutant has weaker substrate cleavage efficiency against charged or aromatic ring amino acids such as Asp, glu, phe, his, lys, pro, arg, val, trp and Tyr at the P1' site, and only 10% -40% (FIG. 5). Compared with the result that the wild type HRV3C protease can only cut the substrate LEVLFQ ∈G when no ERS is contained, the result shows that the C3 mutant screened by the invention has wider substrate specificity aiming at the substrate P1' locus, and the practical application range of the HRV3C protease as tool enzyme is widened.

Compared with the prior art, the invention has the following beneficial effects:

(1) The invention utilizes a combination strategy of combination structure simulation, saturation mutation, random mutation technology and eYESS system to carry out molecular modification on wt HRV3C-P, so that the original polypeptide sequence LEVLFQ ∈G is identified to be changed into the polypeptide sequence LEVLFQ ∈M, and a series of HRV3C protease mutants are obtained.

(2) Compared with wt HRV3C-P, the HRV3C protease mutation for the specific change of the substrate P1' has better specificity and cutting activity for the substrate LEVLFQ ∈M, and can achieve the effect of traceless excision of protein fusion tags.

Drawings

Fig. 1: an eYESS system for the molecular engineering of proteases.

Fig. 2: molecular docking diagram of wild type HRV3C protease and substrate LEVLFQ ∈g.

The yellow region shows the substrate binding pocket for HRV3C protease (grey). The substrate LEVLFQ ∈ G is shown in blue, and Gln at the P1 site and Gly at the P1' site are shown as blue spheres. The catalytic triad His40-Glu71-Cys146 is shown in green. In the S1 substrate binding pocket, gln at the P1 site forms an H bond with Thr141 and His160, respectively (red, left). Gly from P1 'site of substrate in S1' substrate binding pocket isAmino acids of (a) are Lys22, phe25, asn106, thr143, gly144 and Gln145, represented by pink spheres (right).

Fig. 3: schematic of high throughput screening of HRV3C protease mutant libraries.

In the first screening step, both the HRV3C protease mutant library and its substrate have ERS at their carboxyl terminus. In the second step, the ERS at the carboxyl terminus of the substrate is removed, while the ERS at the protease terminus remains. In the third step, ERS at the end of protease and its substrate is removed. In the whole yeast cell screening process, three rounds of separation and enrichment are carried out on cells with high iFluor647 fluorescence and low FITC fluorescence signals, and ERS is FEHDEL.

Fig. 4: substrate P1' site-specific analysis of C3 mutants under double ERS conditions.

Fig. 5: substrate P1' site-specific analysis of C3 mutants in the absence of ERS.

Detailed Description

The following description of the technical solution and the principle of the present invention is provided by way of illustration only and not by way of limitation of the scope of the present invention. The experimental methods used in the following examples are conventional methods unless otherwise specified. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

Example 1: construction method of HRV3C protease mutant library

26 primers are designed, 4 short fragments are amplified by taking the gene of HRV3C protease as a template, and then the HRV3C protease gene, the ERS (FEHDEL) gene and a homologous sequence (40 bp) with a vector are assembled through overlapping PCR. The primer sequences were as follows:

F1：ATATACCTCTATACTTTAACGTCAAGGAGAAAAAACCCCGGATCCATGCAGTTACTTCG

R1：GATGTGGTAATAGTCATGATATTC

F2-1：GAATATCATGACTATTACCACATCTNNKGGTGAANDTACTGGCTTGGGTATTCATGAC

F2-2：GAATATCATGACTATTACCACATCTNNKGGTGAAVMAACTGGCTTGGGTATTCATGAC

F2-3：GAATATCATGACTATTACCACATCTNNKGGTGAAATGACTGGCTTGGGTATTCATGAC

F2-4：GAATATCATGACTATTACCACATCTNNKGGTGAATGGACTGGCTTGGGTATTCATGAC

R2：GAATGAACAACCAAAGTAGCATCAAC

F3：GTTGATGCTACTTTGGTTGTTCATTCTNNKAATTTTACTAATACTATTTTAG

R3：TTTAGTAGCGTAATCGTAACG

F4-1：CGTTACGATTACGCTACTAAANDTNNKNDTTGTGGTGGTGTTTTGTGTGC

F4-2：CGTTACGATTACGCTACTAAANDTNNKVMATGTGGTGGTGTTTTGTGTGC

F4-3：CGTTACGATTACGCTACTAAANDTNNKATGTGTGGTGGTGTTTTGTGTGC

F4-4：CGTTACGATTACGCTACTAAANDTNNKTGGTGTGGTGGTGTTTTGTGTGC

F4-5：CGTTACGATTACGCTACTAAAVMANNKNDTTGTGGTGGTGTTTTGTGTGC

F4-6：CGTTACGATTACGCTACTAAAVMANNKVMATGTGGTGGTGTTTTGTGTGC

F4-7：CGTTACGATTACGCTACTAAAVMANNKATGTGTGGTGGTGTTTTGTGTGC

F4-8：CGTTACGATTACGCTACTAAAVMANNKTGGTGTGGTGGTGTTTTGTGTGC

F4-9：CGTTACGATTACGCTACTAAAATGNNKNDTTGTGGTGGTGTTTTGTGTGC

F4-10：CGTTACGATTACGCTACTAAAATGNNKVMATGTGGTGGTGTTTTGTGTGC

F4-11：CGTTACGATTACGCTACTAAAATGNNKATGTGTGGTGGTGTTTTGTGTGC

F4-12：CGTTACGATTACGCTACTAAAATGNNKTGGTGTGGTGGTGTTTTGTGTGC

F4-13：CGTTACGATTACGCTACTAAATGGNNKNDTTGTGGTGGTGTTTTGTGTGC

F4-14：CGTTACGATTACGCTACTAAATGGNNKVMATGTGGTGGTGTTTTGTGTGC

F4-15：CGTTACGATTACGCTACTAAATGGNNKATGTGTGGTGGTGTTTTGTGTGC

F4-16：CGTTACGATTACGCTACTAAATGGNNKTGGTGTGGTGGTGTTTTGTGTGC

R4：TCGATTTTGTTACATCTACACTGTTGTTATCAGATCTCGAGTCACAATTCGTCGTGTTC

the 21 degenerate primers described above used NNS and NDT, VMA, ATG, TGG degenerate codons (N is any nucleotide, s=g/C, d=a/G/T, v=a/C/G, m=a/C, NDT/VMA/ATG/TGG 4 degenerate codon combinations covered 20 amino acids, which effectively reduced the codon redundancy of the library), lys22, asn106, gly144 three sites used NNK degenerate codons, phe25, thr143 and gin 145 three sites used NDT/VMA/ATG/TGG 4 degenerate codon combinations).

For the first screening of eYESS, the HRV3C protease mutant DNA fragment obtained by amplification and pYSD-GAL1-Aga2-FLAG-LEVLFQ ∈M-HA-FEHDEL vector subjected to double enzyme digestion by restriction endonucleases BamHI and XhoI are subjected to the following steps of: 1, and then electroconverting to Saccharomyces cerevisiae EBY100 ^Kex2- In competent cells, thereby obtaining an HR containing 6 sitesV3C protease saturated mutant libraries.

In the second screening of eYESS, the plasmid of the last round of yeast cells screened in the first step is extracted, and is used as a template, the primers F1 and R4 are used for amplification to obtain an ERS-containing HRV3C protease mutant DNA fragment, and then the ERS-containing HRV3C protease mutant DNA fragment is subjected to double digestion with restriction endonucleases BamHI and XhoI to form a pYSD-GAL1-Aga2-FLAG-LEVLFQ ∈M-HA vector according to a molar ratio of 3:1, mixing, and electroconverting to Saccharomyces cerevisiae EBY100 ^Kex2- In competent cells, a pool of HRV3C protease mutants was thus obtained for the second screening step.

The gene of the mutant B22 with the best activity obtained by the second step is used as a template, error-prone PCR (the mismatch rate is 1.0-1.5%) is carried out by using primers F1 and R5, the ERS-free HRV3C protease mutant DNA fragment is obtained by amplification, and then the DNA fragment is subjected to double digestion with restriction endonucleases BamHI and XhoI to obtain a pYSD-GAL1-Aga2-FLAG-LEVLFQ ∈m-HA vector, wherein the molar ratio is 3:1, mixing, and electroconverting to Saccharomyces cerevisiae EBY100 ^Kex2- In competent cells, a pool of HRV3C protease mutants was obtained for the third screening step. Wherein the R5 primer sequence is as follows:

R5：TCGATTTTGTTACATCTACACTGTTGTTATCAGATCTCGAGTCATTGCTTTTCAACGAA

example 2: high throughput screening of HRV3C protease mutant libraries

The HRV3C protease mutant library constructed in example 1 was cultured to OD using YNB-CAA-Glucose medium ₆₀₀ 3.0-4.0, then induced in YNB-CAA-Galactose medium, initial OD ₆₀₀ 0.5. After 12 hours of induction at 30℃2X 10 was collected ⁹ The yeast cells of (2) were washed once with solution A and then once with solution B, and centrifuged at 4℃and 3000rpm for 2min. Then labeled with 0.1. Mu. MAnti-HA-FITC and 0.1. Mu. MAnti-FLAG-iFluor647 fluorescent antibodies.

The labeled yeast cells were centrifuged at 3000rpm for 2min, and the supernatant was removed. The cells were resuspended in 1 XPBS after one more wash with solution B. Cells were sorted using MoFloTM XDP 4 laser overspeed sorting flow cytometry from Beckman, usa. The detection channels are FITC channel (525/40 nm band pass) and APC channel (660/20 nm)Bandpass). In each round of sorting, 10 were collected ⁷ -10 ⁸ Cells with high iFluor647 and low FITC fluorescence signal were identified. The enriched cells were further cultured with YNB-CAA-Glucose and induced by YNB-CAA-Galactose, labeled with fluorescent antibody, and then subjected to the next round of sorting. After 3 rounds of sorting, the collected cells were plated on YNB-CAA-Glucose solid medium.

Picking single colony from the solid plate, inoculating into 3mLYNB-CAA-Glucose culture solution, shake culturing at 30deg.C to OD ₆₀₀ After 3.0 min at 3000rpm, the cells were collected and the supernatant was discarded. Then the yeast cells are lysed by lysozyme to extract yeast plasmids. The extracted yeast plasmid was then transformed into E.coli XL-Gold competent cells, the plasmid was amplified and finally sequenced to obtain the sequence information of the selected HRV3C protease mutants (Table 1).

Table 1HRV 3C protease mutant mutation site information

Example 3: construction of Saccharomyces cerevisiae expression strain containing HRV3C protease mutant C3 and substrate plasmid thereof

PCR cloning to obtain C3, C3-FEHDEL, aga2-FLAG-LEVLFQ ∈X-HA and Aga2-FLAG-LEVLFQ ∈X-HA-FEHDEL (X is any one of 20 amino acids) gene fragments;

the C3 and C3-FEHDELPCR products obtained above were recovered by 0.8% agarose gel, and then digested with restriction enzymes BamHI and XhoI in the following system: bamHI, 1. Mu.L; xhoI, 1. Mu.L; 10×Cutsmartbuffer,5 μl; PCR recovery of the product, 30. Mu.L, adding ddH ₂ O to 50. Mu.L. After 5h of digestion at 37 ℃, 0.8% agarose gel is used for recovery;

then the plasmid was digested with BamHI and XhoI, and digested with restriction enzymes, and ligated with pYSD vector. The enzyme linked system is as follows: an enzyme section, 1.2. Mu.L; cutting the carrier with 0.3 mu L; t4 DNA ligase buffer (NEB Co.) 1. Mu.L; t4 DNA ligase (NEB Co.), 0.3. Mu.L; adding ddH ₂ O to 10. Mu.L, and enzymatically linked at 22℃for 1h. EnzymesDirectly converting the ligature product into competent cells of the escherichia coli XL-GOLD, and respectively obtaining recombinant plasmids pYSD-GAL10-C3 and pYSD-GAL10-C3-FEHDEL after colony PCR verification and sequencing confirmation;

the PCR products of Aga2-FLAG-LEVLFQ ∈X-HA and Aga2-FLAG-LEVLFQ ∈X-HA-FEHDEL (X is any one of 20 amino acids) obtained above were recovered, and after being recovered by PstI and EcoRI double digestion and agarose gel, they were then enzymatically linked to pYSD-GAL10-C3 and pYSD-GAL10-C3-FEHDEL vectors recovered by PstI and EcoRI double digestion and agarose gel. The enzyme linked product is transformed into competent cells of escherichia coli XL-GOLD, and recombinant plasmids pYSD-C3-GAL10-GAL1-Aga 2-FLAG-LEVLFQ;

the constructed recombinant plasmids are respectively transferred into saccharomyces cerevisiae EBY100 by a chemical conversion method ^Kex2- Then spread on YNB-CAA-Glucose plates and incubated at 30℃for 3-4 days.

Example 4: detection of HRV3C protease mutant Activity Using YESS System

The yeast transformant of example 3, which had been transformed with the HRV3C protease mutant C3 and its substrate plasmid, was inoculated into 1mLYNB-CAA-Glucose broth and shake-cultured overnight at 30℃until its OD was reached ₆₀₀ When the OD reaches 3.0-4.0, the culture solution is changed into YNB-CAA-Galactose culture solution for induction, and the OD is started ₆₀₀ Is 0.5, and is induced for 12h at 30 ℃. Take 10 ⁶ Each cell was labeled with 0.1. Mu.M Anti-HA-FITC and 0.1. Mu.M MAnti-FLAG-iFluor647 fluorescent antibody. And then using a CytoFLEX analysis type flow cytometer of Beckman company in the U.S.A. The detection channels were FITC channel (525/40 nm bandpass) and APC channel (660/20 nm bandpass). The calculation formula of the cleavage efficiency of the C3 mutant aiming at different substrates is as follows: [ substrate cleavage efficiency ]]Percent of cells with iFluor647 fluorescent signal only = []/(percent of cells with iFluor647 fluorescent Signal alone)]Percentage of cells with both iFluor647 and FITC fluorescent signals])。

The culture medium and cell wash solution described in examples 2 and 4 were composed as follows:

YNB-CAA-Glucose:20g/L glucose, 6.7g/L YNB,5.4g/L Na ₂ HPO ₄ ,8.6g/LNaH ₂ PO ₄ ·H ₂ O,5g/L casamino acids,pH7.4；

YNB-CAA-Galactose:20g/L galactose, 6.7g/L YNB,5.4g/L Na ₂ HPO ₄ ,8.6g/LNaH ₂ PO ₄ ·H ₂ O,5g/L casamino acids,pH7.4；

Solution a:1X PBS,0.5%BSA,1mM EDTA,pH7.4;

solution B:1X PBS,0.5%BSA,pH7.4.

Example 5: construction of colibacillus expression strain containing HRV3C proteinase and its substrate plasmid

The PCR cloning method is adopted to respectively obtain LEVLFQ ∈X-6His-GFP (X is any one of 20 amino acids), LEVLFQ ∈G-6His-wt HRV3C-P, LEVLFQ ∈M-6His-C3 gene fragments;

the PCR products obtained above were recovered by 0.8% agarose gel, and then digested with restriction enzymes NcoI and XhoI, in the following manner: ncoI, 1. Mu.L; xhoI, 1. Mu.L; 10×Cutsmart buffer,5 μl; PCR recovery of the product, 30. Mu.L, adding ddH ₂ O to 50. Mu.L. After 5h of digestion at 37 ℃, 0.8% agarose gel is used for recovery;

then, the vector was digested with restriction endonucleases NcoI and XhoI, and pRK792 was digested simultaneously. The enzyme linked system is as follows: an enzyme section, 1.2. Mu.L; cutting the carrier with 0.3 mu L; t4 DNA ligase buffer (NEB Co.) 1. Mu.L; t4 DNA ligase (NEB Co.), 0.3. Mu.L; adding ddH ₂ O to 10. Mu.L, and enzymatically linked at 22℃for 1h. The enzyme linked product is directly transformed into competent cells of escherichia coli XL-GOLD, and recombinant plasmids pRK792-MBP-LEVLFQ ∈X-6His-GFP (X is any one of 20 amino acids), pRK792-MBP-LEVLFQ ∈G-6His-wt HRV3C-P and pRK792-MBP-LEVLFQ ∈M-6His-C3 are respectively obtained after colony PCR verification and sequencing confirmation;

the recombinant plasmids constructed above were transferred to BL21 (DE 3) by chemical transformation, respectively, and then plated on LB plates (containing ampicillin) and cultured overnight at 37 ℃.

The PCR reaction systems described in examples 1, 3 and 5 are: 10 xKOD buffer, 5. Mu.L; dNTP (2.5 mM), 4. Mu.L; primer F (10. Mu.M), 3. Mu.L; primer(s)R (10. Mu.M), 3. Mu.L; pfu polymerase, 2 μl; template, 1 μl; adding ddH ₂ O to 50. Mu.L. PCR amplification system: 95 ℃ for 5min;95 ℃,30s,55 ℃,30s,72 ℃,30s,25 cycles; 72 ℃ for 5min;12℃for 10min.

Example 6: dynamics experiments of HRV3C protease and mutant thereof

E.coli transformants transformed with HRV3C protease and mutants and fusion protein substrate plasmids of example 5 were inoculated into 2mL of LB medium, respectively, and shake-cultured overnight at 37 ℃; transferring into 200mL LB liquid medium (with ampicillin antibiotics added), shaking at 37deg.C for 2-3h to OD ₆₀₀ 0.6-0.8, and adding 0.5mM IPTG to induce protein expression, and shake culturing at 18deg.C for 20-24 hr. The cells were collected by centrifugation at 4000rpm for 10min at 4℃and the supernatant was discarded and the cells were washed twice with sterile water. After resuspension of cells with 20mL of Lysis Buffer, stirring for 1h at 4 ℃; ultrasonic bacteria breaking is carried out in an ice bath state, ultrasonic waves are stopped for 4s, and 35% power bacteria breaking is carried out for 15min; centrifuging the bacterial liquid at 17000rpm at 4deg.C for 30min to completely separate cell debris from the supernatant; adding 1mLNi-NTAHis resin into the protein purification column, and washing the resin 2 times by using a Wash Buffer, wherein each time is 2mL; adding 2mL of the broken bacteria supernatant into a protein purification column, standing for 5min, releasing the impurity protein, and washing the resin by using 2mL of a LWAsh Buffer to remove the unbound impurity protein. The resin was washed with an equal amount of Wash Buffer for each addition of the sterile supernatant until the target protein was fully bound to the protein purification column. Finally, desalting the eluted target protein by using an AKATA protein purifier, storing in a Storage Buffer, removing high-concentration imidazole, and avoiding influencing the later-stage protein experiment.

The purified wt HRV3C-P and its mutant (100 nM) were mixed with fusion protein substrate MBP-LEVLFQ ∈X-6His-GFP (5. Mu.M, 15. Mu.M, 30. Mu.M, 60. Mu.M, 120. Mu.M, and 320. Mu.M; X is any one of the amino acids of A, C, G, I, L, M, N, Q, S, T) at various concentrations, and 20. Mu. L Cleavage buffer was added thereto for reaction at 4℃in a total volume of 200. Mu.L.

At 0, 5, 10, 15, 25 and 45min, respectively, the reaction samples were mixed with SDS-PAGE loading buffer and boiled at 100deg.C for 10min to terminateThe protease hydrolysis reaction was stopped, then SDS-PAGE analysis was performed at 4℃and using a multifunctional laser imager Amersham ^TM The Typhoon detects the fluorescence intensity of GFP fusion protein contained in the protein gel graph to calculate the hydrolysis efficiency of protease, and the calculation formula is as follows: [ protease hydrolysis efficiency ]]= ([ cleavage protein substrate MBP-LEVLFQ ∈X-6His-GFP gray scale ]]Gray level of/(control protein substrate MBP-LEVLFQ ∈M/G-6 His-GFP)]) 100% and finally the data were fitted to the Michaelis-Menten enzyme kinetic model to calculate kinetic parameters (Table 2).

The protein purification reagent comprises the following components:

Lysis Buffer：50mM Tris-HCl(pH 8.0),200mM NaCl,50mM NaH ₂ PO ₄ ,25mM Imidazole,10％Glycerol；

Wash Buffer：50mM Tris-HCl(pH 8.0),200mM NaCl,50mM NaH ₂ PO ₄ ,40mM Imidazole；

Elution Buffer：50mM Tris-HCl(pH 8.0),200mM NaCl,50mM NaH ₂ PO ₄ ,200mM Imidazole；

Storage Buffer：50mM Tris-HCl(pH 7.5),1mM EDTA；

Cleavage buffer：150mM NaCl,50mM Tris-HCl(pH 7.5)。

TABLE 2 kinetics parameters of HRV3C protease and mutant C3 thereof against fusion protein substrates

From the above examples, a series of HRV3C protease mutants with altered P1' site specificity are obtained, wherein the C3 mutants have the strongest activity against the substrate LEVLFQ ∈M, have wider substrate specificity against the P1' site, and can recognize any 20 amino acids at the P1' site. In addition, the C3 mutant was directed against 10 fusion protein substrates MBP-LEVLFQ ∈X-6His-GFP (X is A, C, G),I. L, M, N, Q, S, T) k of any one of the amino acids) _cat /K _M The value is 0.37+ -0.01 to 3.72+ -0.04 mM ^-1 ·s ^-1 In between, the wild type HRV3C protease can only recognize and cut 4 fusion protein substrates MBP-LEVLFQ ∈X-6His-GFP (X is any amino acid in A, C, G, S), k _cat /K _M The value ranges from 0.39.+ -. 0.03 to 4.73.+ -. 0.01mM ^-1 ·s ^-1 Between them.

Claims

1. A mutant HRV3C protease having a modified P1' site-specific activity on a substrate, wherein the amino acid sequence of the mutant HRV3C protease is obtained by mutating at least one of the following amino acid sequences of a wild-type HRV3C protease:

(2) Mutating phenylalanine at position 25 to valine;

(4) Mutating threonine at position 129 to isoleucine;

(5) Mutating alanine at position 140 to serine;

2. The HRV3C protease variant with altered site-specific activity against a substrate P1' according to claim 1, wherein the amino acid sequence of the wild-type HRV3C protease is shown in SEQ ID No. 1.

3. The HRV3C protease mutant with altered site-specific properties for substrate P1' according to claim 1, wherein the amino acid sequence of the HRV3C protease mutant is shown in SEQ ID No.2, SEQ ID No.3 or SEQ ID No. 4.

4. A gene encoding the HRV3C protease mutant of claim 1.

5. The gene according to claim 4, wherein the nucleotide sequence of the gene is shown in SEQ ID NO.5, SEQ ID NO.6 or SEQ ID NO. 7.

6. A recombinant plasmid comprising the gene of claim 4.

7. The recombinant plasmid according to claim 6, wherein the recombinant plasmid is constructed on the basis of pRK792 or pYSD plasmid.

8. A genetically engineered bacterium expressing the HRV3C protease mutant of claim 1.

9. The genetically engineered bacterium of claim 8, wherein the genetically engineered bacterium is saccharomyces cerevisiae or escherichia coli.

10. A method for screening HRV3C protease mutants with altered P1' site specificity for a substrate, comprising constructing a mutant with a library size of 2.7X10 which covers 6 sites ⁸ The HRV3C protease saturated mutant library of (C) is subjected to three-step high-throughput screening aiming at a substrate LEVLFQ ∈m by utilizing an optimized saccharomyces cerevisiae endoplasmic reticulum retention screening system.