JP2003334083A - New apelin receptor and its dna - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide an apelin receptor originated from a cattle and having adrenocorticotropic hormone secretion regulating action, oxytocin secretion regulating action, etc. <P>SOLUTION: The present invention provides the apelin receptor containing same or substantially same amino acid sequence as a specific amino acid sequence, a DAN encoding the receptor, a medicine thereof, use of the receptor to diagnostics, use of the receptor to screening, etc., of a adrenocorticotropic hormone secretion regulator or an oxytocin secretion regulator thereof. <P>COPYRIGHT: (C)2004,JPO

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD [0001] The present invention relates to a novel apelin receptor for apelin having adrenocorticotropic hormone secretion regulating action, oxytocin secretion regulating action, etc., a DNA encoding the same, and uses thereof.

[0002]

2. Description of the Related Art Many hormones and neurotransmitters regulate biological functions through specific receptors present on cell membranes. Many of these receptors are coupled guanine nucleotide-binding proteins.
binding protein, sometimes abbreviated as G protein below)
Signal transduction in cells through activation of Recently,
Among such G protein-coupled receptors, the so-called orphan G protein-coupled receptor APJ (human receptor protein encoded by a gene [Gene, 136, 355]
Page (1993)]) was found in bovine stomach extracts [Biochem. Biophys. Res. Com.
mun., 251, p. 472 (1998)]. This peptide was named Apelin because it is an endogenous ligand of APJ. Apelin suppresses cytokine production from mouse spleen cells [Biochemica Biophysica Actor,
1452, p. 25 (1999)], and decrease of blood pressure and increase of drinking behavior [Journal of Neurochemistry, vol. 74, p. 34 (2000)]. WO99 / 33976 discloses apelin which is a ligand for APJ, and this apelin has a central nervous function regulating action, a circulatory function regulating action, a cardiac function regulating action, an immune function regulating action, a digestive function regulating action, It is described that it is involved in the metabolic function regulating action or the reproductive organ function regulating action. Also, WO00
/ 18793 and WO01 / 70769 disclose modified apelin.

[0003]

SUMMARY OF THE INVENTION It is an object of the present invention to provide a novel apelin receptor, DNA encoding the same, and uses thereof.

[0004]

Means for Solving the Problems As a result of extensive studies to solve the above problems, the present inventors succeeded in isolating a novel apelin receptor derived from bovine lung. The present inventors have succeeded in completing the present invention as a result of further studies based on these findings.

That is, the present invention provides (1) SEQ ID NO: 1.
An apelin receptor protein or a salt thereof, which contains the same or substantially the same amino acid sequence as the amino acid sequence represented by (2) the amino acid sequence represented by SEQ ID NO: 1 above ( 1) The apelin receptor protein described in (3), the partial peptide of the apelin receptor protein described in (1) above or a salt thereof, (4) the polypeptide encoding the apelin receptor protein described in (1) above or a partial peptide thereof. A polynucleotide containing a nucleotide, (5) the polynucleotide according to (4) above, which is DNA, (6) the polynucleotide according to (5) above, which contains a base sequence represented by SEQ ID NO: 2.
(7) A recombinant vector containing the polynucleotide according to (4) above, (8) a transformant transformed with the recombinant vector according to (7) above, (9) a transformant according to (8) above. A method for producing an apelin receptor protein, a partial peptide thereof or a salt thereof according to (1) above, which comprises culturing a body to produce the apelin receptor protein or a partial peptide thereof according to (1) above, )
(11) A medicament comprising the apelin receptor protein according to (1) or the partial peptide according to (3) or a salt thereof, (11) a medicament comprising the polynucleotide according to (4), (12). The pharmaceutical according to (10) or (11) above, which is a corticotropin secretion regulator.
(13) The medicament according to (10) or (11) above, which is a prophylactic / therapeutic agent for hypoaldosteronism, hypocortisolemia, secondary and chronic hypoadrenocortical function, Addison's disease, adrenal insufficiency, pain or obesity. , (14) The drug according to (10) or (11) above, which is an oxytocin secretion regulator, (15) labor induction, weak labor, relaxation bleeding, placental delivery, uterine retrograde failure, cesarean section, miscarriage, artificial pregnancy The above-mentioned (10) or (1) which is a prophylactic / therapeutic agent for abortion, lactation deficiency, post-traumatic stress syndrome or milk stasis.
1) the medicament, (16) the diagnostic agent comprising the polynucleotide according to (4), (17) hypoaldosteronism, hypocortisolemia, secondary and chronic hypoadrenocorticism, Addison's disease, Adrenal insufficiency, pain, obesity,
Induction of labor, weak labor, laxative hemorrhage, placental delivery, uterine retrograde failure, cesarean section, abortion, abortion, lactation failure, posttraumatic stress syndrome, lactation stasis, Cushing's disease, Cushing's syndrome, adrenocorticotropic hormone Producing pituitary tumor, CRH producing tumor, aldosterone producing tumor, aldosteronism, primary cortisol resistance, congenital adrenal deficiency, anti-stress, depression, anorexia nervosa, insomnia, gastroduodenal ulcer, irritable bowel (16) The diagnostic agent according to the above (16), which is a diagnostic agent for syndrome, excessive labor pain, infertility, tonic contraction, fetal distress, uterine rupture, cervical laceration, dysmenorrhea, preterm birth or Prader-Willi syndrome. ) An antibody against the apelin receptor protein according to (1) above or the partial peptide according to (3) above or a salt thereof,
(19) The above-mentioned (1) which is a neutralizing antibody which inactivates signal transduction of the apelin receptor protein according to (1) above.
8) The antibody, (20) the medicament comprising the antibody of (18) above, (21) the medicament of the above (20) which is a corticotropin secretion regulator, (22) Cushing's disease, Cushing Syndrome, adrenocorticotropic hormone-producing pituitary tumor, CRH-producing tumor, aldosterone-producing tumor,
The above-mentioned (20), which is a prophylactic / therapeutic agent for aldosteronism, primary cortisol resistance, congenital adrenal deficiency, anti-stress, depression, anorexia nervosa, insomnia, gastroduodenal ulcer or irritable bowel syndrome. (23) The drug according to (20) above, which is an oxytocin secretion regulator.
(24) Overwork labor, infertility, tonic contraction, fetal distress, uterine rupture, cervical laceration, dysmenorrhea, premature birth or Prad
(20) The medicament according to (20), which is a preventive / therapeutic agent for er-Willi syndrome, (25) a diagnostic agent comprising the antibody according to (18), (26) hypoaldosteronism, hypocortisolemia, secondary And chronic hypoadrenocorticism, Addison's disease, adrenal insufficiency, pain, obesity, labor induction, weak labor, laxative hemorrhage, placental delivery, uterine retrograde failure, cesarean section, abortion, abortion, lactation failure , Post-traumatic stress syndrome, lactation, Cushing's disease, Cushing's syndrome, adrenocorticotropic hormone-producing pituitary tumor, CRH-producing tumor, aldosterone-producing tumor, aldosteronism, primary cortisol resistance, congenital adrenal enzyme deficiency, anti-stress , Depression, anorexia nervosa, insomnia, gastric and duodenal ulcer, irritable bowel syndrome, excessive labor pain, infertility, tonic contraction, fetal distress, child Rupture, cervical laceration, dysmenorrhea,
The above (2) which is a diagnostic drug for preterm birth or Prader-Willi syndrome
5) a diagnostic agent, (27) a polynucleotide comprising a nucleotide sequence complementary to the polynucleotide of (4) above or a part thereof, (28) a polynucleotide of (27) above (29) The drug according to (28) above, which is a corticotropin secretion regulator, (30) Cushing's disease, Cushing's syndrome, adrenocorticotropic hormone-producing pituitary tumor, CRH-producing tumor, aldosterone-producing tumor, The above-mentioned (28), which is a prophylactic / therapeutic agent for aldosteronism, primary cortisol resistance, congenital adrenal deficiency, anti-stress, depression, anorexia nervosa, insomnia, gastroduodenal ulcer or irritable bowel syndrome. (31) The drug according to (28) above, which is an oxytocin secretion regulator, (32) Overwork labor, infertility, ankylosing uterine contraction, fetal provisional , A uterine rupture, cervical laceration, dysmenorrhea, preterm birth, or a drug containing the polynucleotide according to (28) above, which is a prophylactic / therapeutic agent for Prader-Willi syndrome, (33) comprising the polynucleotide according to (27) above Drugs, (34) Hypoaldosteronism, Hypocortisolemia, Secondary and chronic hypoadrenocorticism, Addison's disease, Adrenal insufficiency,
Pain, obesity, induction of labor, weak labor, loose bleeding, placental delivery, uterine restoration, cesarean section, miscarriage, abortion, lactation deficiency, posttraumatic stress syndrome, milk stasis, Cushing's disease, Cushing's syndrome, Corticotropin-producing pituitary tumor, CRH-producing tumor, aldosterone-producing tumor, aldosteronism, primary cortisol resistance, congenital adrenal deficiency, anti-stress, depression, anorexia nervosa, insomnia, gastroduodenal ulcer , Irritable bowel syndrome, excessive labor pain, infertility, ankylosing uterine contraction, fetal distress,
Uterine rupture, cervical laceration, dysmenorrhea, preterm birth or Prader-W
The diagnostic agent according to (33) above, which is a diagnostic agent for illi syndrome,
(35) Apelin receptor, its modified form, its amide, its ester, or its salt, and the apelin receptor containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, its partial peptide, or its salt Apelin receptor containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 with apelin, its modified form or its amide or its ester or its salt, or a part thereof Method for screening compound or salt thereof that changes binding property to peptide or salt thereof, (36) Apelin, modified form thereof or amide or ester thereof or salt thereof and the same as or substantially the amino acid sequence represented by SEQ ID NO: 1 Contain identical amino acid sequences The same or substantially the same as the amino acid sequence represented by SEQ ID NO: 1 with apelin, its modified peptide or its amide or its ester or its salt, which contains a perine receptor, its partial peptide or its salt An apelin receptor containing an amino acid sequence, a kit for screening a compound or its salt that changes the binding property to a partial peptide or a salt thereof, (37) the screening method according to (35) above or the screening according to (36) above Apelin receptor containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 with apelin, its modified form or its amide or its ester or its salt, which can be obtained using the kit for Change the binding with the partial peptide or its salt Compound or salt thereof, (38) Compound or salt thereof according to (37) which is an agonist, (39) Compound or salt thereof according to (37) which is antagonist, (40) Compound according to (37) or (41) a medicament comprising the salt thereof, (41) an adrenocorticotropic hormone secretagogue, (42) a oxytocin secretion regulator, (40) a drug, (4)
3) A prophylactic / therapeutic agent for hypoaldosteronism, hypocortisolemia, secondary and chronic hypoadrenocorticism, Addison's disease, adrenal insufficiency, pain or obesity, which comprises the agonist according to (38) above, 44) Labor induction, weak labor, relaxation bleeding, placental delivery before and after delivery, uterine reconstruction failure, cesarean section, miscarriage, artificial abortion, lactation deficiency, posttraumatic stress syndrome, which comprises the agonist according to (38) above. Preventive / therapeutic agent for milk stasis, (45) above (3
9) Cushing's disease, Cushing's syndrome, adrenocorticotropic hormone-producing pituitary tumor, CRH-producing tumor, aldosterone-producing tumor, aldosteronism, primary cortisol resistance, congenital adrenal enzyme deficiency, antistress, which comprises the antagonist according to 9) , A prophylactic / therapeutic agent for depression, anorexia nervosa, insomnia, gastric / duodenal ulcer or irritable bowel syndrome, (46) excessive labor pain, infertility, ankylosis containing the antagonist according to (39) above Uterine contractions,
Preventive / therapeutic agent for fetal distress, uterine rupture, cervical laceration, dysmenorrhea, preterm birth or Prader-Willi syndrome (47) Contains the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1. Using the DNA encoding the apelin receptor or its partial peptide, wherein the expression of the apelin receptor or its partial peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 Method for screening compound or salt thereof with varying amount, (48) containing DNA encoding apelin receptor or its partial peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 Which is the same as or substantially the same as the amino acid sequence represented by SEQ ID NO: 1. Same apelin receptor comprising the amino acid sequence or compound alters the expression level of its partial peptide or the screening kit of a salt thereof,
(49) It contains the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, which can be obtained using the screening method described in (47) above or the screening kit described in (48) above. A compound or a salt thereof that regulates the expression level of an apelin receptor or a partial peptide thereof, (50) a compound or a salt thereof, which is a compound or a salt thereof that promotes the expression level, and (51) inhibits the expression level. (52) The compound or salt thereof according to the above (49), which is a compound or salt thereof,
(53) A pharmaceutical comprising the compound or salt thereof according to (49), (53) an adrenocorticotropic hormone secretory regulator according to (52), and (54) an oxytocin secretory regulator (52). The pharmaceutical as described above, (55) above (5
0) Prevention of hypoaldosteronism, hypocortisolemia, secondary and chronic adrenal insufficiency, Addison's disease, adrenal insufficiency, pain or obesity, which comprises a compound or a salt thereof that promotes the expression level Therapeutic agent, (56) Induction of labor, weak labor, relaxation bleeding, placental delivery, uterine retrograde failure, cesarean section, miscarriage, artificial, containing the compound or salt thereof that promotes the expression level according to (50) above. A preventive / therapeutic agent for abortion, lactation deficiency, post-traumatic stress syndrome or milk stasis, (57) Cushing's disease, Cushing's syndrome, which comprises the compound or its salt inhibiting the expression level according to (51). Adrenocorticotropic hormone producing pituitary tumor, CRH producing tumor, aldosterone producing tumor, aldosteronism, primary cortisol resistance, congenital adrenal enzyme deficiency An anti-stress, depression, anorexia nervosa, insomnia, a preventive / therapeutic agent for gastric / duodenal ulcer or irritable bowel syndrome, (58) containing a compound that inhibits the expression level according to (51) or a salt thereof Overwork labor,
A preventive / therapeutic agent for infertility, ankylosing uterine contraction, fetal distress, uterine rupture, cervical laceration, dysmenorrhea, preterm birth or Prader-Willi syndrome, (59) Apelin is represented by SEQ ID NO: 3 and The screening method according to (35) above, which is a peptide containing the same or substantially the same amino acid sequence, (60) Apelin is represented by SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9 or SEQ ID NO: 11. The screening method according to the above (35), which is a peptide containing a partial sequence of the amino acid sequence described above, (61) the sixth amino acid sequence of the amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11 in which apelin is (a). To the 77th amino acid sequence from (b) SEQ ID NO: 5, 7, 9 or 1
A peptide having the 40th to 77th amino acid sequences of the amino acid sequence represented by 1, (c) SEQ ID NO:
The 42nd of the amino acid sequence represented by 5, 7, 9 or 11
A peptide having the amino acid sequence from the 77th to the 77th,
(D) a peptide having the 47th to 77th amino acid sequence of the amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11, (e) SEQ ID NO: 5, 7, 9 or 1
A peptide having the 61st to 77th amino acid sequences of the amino acid sequence represented by 1, (f) SEQ ID NO:
The 65th of the amino acid sequence represented by 5, 7, 9 or 11
A peptide having the amino acid sequence from the 77th to 77th or a peptide having an amino acid sequence in which the N-terminal amino acid (Gln) thereof is pyroglutamine-oxidized, (g) the amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11 A peptide having the 1st to 25th amino acid sequence of (h) a peptide having the 6th to 25th amino acid sequence of the amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11; i) a peptide having the 42nd to 64th amino acid sequences of the amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11, (j) SEQ ID NO:
The 61st of the amino acid sequence represented by 5, 7, 9 or 11
A peptide having an amino acid sequence from the 64th amino acid to the 64th amino acid,
(K) a peptide having an amino acid sequence from the 43rd position to the 77th position in the amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11, (l) SEQ ID NO: 5, 7, 9 or 1
A peptide having the 41st to 77th amino acid sequences of the amino acid sequence represented by 1, (m) SEQ ID NO:
66th of the amino acid sequence represented by 5, 7, 9 or 11
A peptide having the amino acid sequence from the 77th to the 77th,
(N) a peptide having an amino acid sequence from the 67th position to the 77th position in the amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11, (o) SEQ ID NO: 5, 7, 9 or 1
A peptide having the 64th to 77th amino acid sequences of the amino acid sequence represented by 1, (p) SEQ ID NO:
63rd of the amino acid sequence represented by 5, 7, 9 or 11
A peptide having the amino acid sequence from the 77th to the 77th,
(Q) a peptide having the 65th to 76th amino acid sequence of the amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11, or (r) represented by SEQ ID NO: 5, 7, 9 or 11 65th to 75th amino acid sequence
The peptide having the amino acid sequence at position (3)
The screening method according to 5), wherein (62) the apelin is represented by SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9 or SEQ ID NO: 11 from the 65th position to the 7th position.
The screening method according to (35) above, which is a peptide containing the 7th amino acid sequence, and (63) apelin is pGlu Arg Pro Arg Leu Ser His Lys Gly Pro Met Pro.
The screening method according to (35) above, which is a peptide containing the amino acid sequence represented by Phe, and (64) apelin is represented by SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9 or SEQ ID NO: 11. The screening method according to (35) above, which is a peptide containing the 42nd to 77th amino acid sequences in the amino acid sequence, and (65) the modified apelin has the formula X ¹ -Arg-Pro-Arg-X ² -Ser. ^{-His-X 3 -Gly-Pro -X} 4 -X 5 (I) [ wherein, to ^{X 1} is 1 may be the side chain is substituted the same or different hydrogen atom or each consisting of 25 amino acids Represents an amino acid residue or peptide chain, X
² represents a neutral amino acid residue whose side chain may be substituted, X ³ represents a neutral amino acid residue whose side chain may be substituted, and an aromatic amino acid residue whose side chain may be substituted. A basic amino acid residue whose group or side chain may be substituted, X ⁴ represents a neutral or aromatic amino acid residue whose bond or side chain may be substituted, and X ⁵ represents a side chain An amino acid residue which may be substituted or an amino acid derivative in which the C-terminal carboxyl group thereof is reduced to a hydroxymethyl group or a formyl group, an amino acid residue which may be substituted a hydroxyl group or a side chain and a side chain are substituted A dipeptide chain having an optionally attached amino acid residue or a C-terminal carboxyl group thereof is reduced to a hydroxymethyl group or a formyl group to represent a peptide derivative represented by the formula -Arg-Pro- Arg-, -Ser-His-
Alternatively, the side chain of each amino acid residue in -Gly-Pro- may be substituted, provided that X ² represents Leu, X ³ represents Lys, X ⁴ represents Met, and X ⁵ represents Pro or Pro-Phe is shown and -Arg-Pro in a formula is shown.
-Arg- is an unsubstituted -Arg-Pro-Arg-,
-Ser-His- is an unsubstituted -Ser-His-
And -Gly-Pro- is an unsubstituted -Gly-Pro-
Except when ] The screening method according to the above (35), which is a peptide represented by the formula (66), wherein the modified form of apelin is the formula P1-Arg-Pro-Arg-Leu-Phe-P2-P3-Gly-Pro-P4-P5 ( II) [In the formula, P1 represents a hydrogen atom or an amino acid residue or a peptide chain consisting of 1 to 25 amino acids which may be the same or different and whose side chains may be substituted;
2 represents a neutral amino acid residue whose side chain may be substituted or a basic amino acid residue whose side chain may be substituted, and P3 is a neutral amino acid residue whose side chain may be substituted. , A side chain may be substituted with an aromatic amino acid residue or a side chain may be substituted with a basic amino acid residue, P4 is a bond or a neutral side chain may be substituted or An aromatic amino acid residue is shown. P5 is an amino acid residue whose side chain may be substituted or an amino acid derivative in which its C-terminal carboxyl group is reduced to a hydroxymethyl group or a formyl group, or a hydroxyl group or side chain is substituted. A dipeptide chain consisting of an amino acid residue which may be substituted with an amino acid residue whose side chain may be substituted or its C-terminal carboxyl group is reduced to a hydroxymethyl group or a formyl group. Shows the peptide derivative, the side chain of -Arg-Pro-Arg-Leu-Phe- or -Gly-Pro- each amino acid residue in the middle in the formula may be substituted. ] Which is a peptide represented by the above (3
5) The screening method described in (6), wherein the modified form of apelin has the formula Q1-Arg-Pro-Arg-Leu-Ser-Ala-Q2-Gly-Q5-Q3-Q4 (III) [wherein Q1 is a hydrogen atom] Or an amino acid residue or a peptide chain consisting of 1 to 25 amino acids, each of which may be the same or different and whose side chains may be substituted,
2 represents a neutral amino acid residue whose side chain may be substituted, an aromatic amino acid residue whose side chain may be substituted, or a basic amino acid residue whose side chain may be substituted,
Q3 represents a neutral or aromatic amino acid residue whose bond or side chain may be substituted, Q4 represents an amino acid residue whose side chain may be substituted or its C-terminal carboxyl group is a hydroxymethyl group or A formyl group-reduced amino acid derivative, a dipeptide chain formed by binding an amino acid residue which may be substituted with a hydroxyl group or a side chain and an amino acid residue which may be substituted with a side chain, or its C-terminal carboxyl group is Shows a peptide derivative reduced to a hydroxymethyl group or a formyl group, Q5 represents a neutral amino acid residue whose side chain may be substituted, and is -Arg-Pro-Arg-Leu-Ser-Ala in the formula.
The side chain of each amino acid residue in-may be substituted. ] The screening method of said (35) which is the peptide represented by this, its ester, its amide, or its salt, (68) The modified form of apelin is a formula R1-Arg-Pro-Arg-Leu-Ser-His-Lys. -Gly-Pro-R2-Pro-R3 (IV) [In the formula, R1 is a hydrogen atom or an amino acid residue or a peptide consisting of 1 to 25 amino acids which may be the same or different and whose side chains may be substituted. Shows a chain, R
2 represents Cha which may be substituted, Met which may be substituted or Nle which may be substituted, and R
3 is optionally substituted Phe (Cl), optionally substituted Phe, optionally substituted Nal
(2) represents an optionally substituted Cha or an optionally substituted Tyr, and represents -Arg-Pro-A in the formula.
rg-Leu-Ser-His-Lys-Gly-Pr
The side chain of each amino acid residue in o or -Pro- may be substituted. ] The peptide represented by the above, its ester, its amide, or its salt, as defined in the above (3)
5) The screening method described above, (69) The non-human mammal having the exogenous DNA described in (5) above or a mutant DNA thereof, (70) The non-human mammal described in (69) above, which is a rodent. (71) The animal according to (70) above, wherein the rodent is a mouse or rat.
2) Exogenous DNA described in (5) or its mutation D
A recombinant vector containing NA and capable of being expressed in mammals, (73) a non-human mammalian embryonic stem cell in which the DNA according to (5) above is inactivated, (74) said DNA introducing a reporter gene The embryonic stem cell according to (73) above, which has been inactivated by: (75) the embryonic stem cell according to (73), which is resistant to neomycin, (76) the above-mentioned (73), wherein the non-human mammal is a rodent. Embryonic stem cells,
(77) The embryonic stem cell according to the above (76), wherein the rodent is a mouse, (78) the non-human mammal deficient in expression of the DNA according to the above (5), (79) the D
NA is inactivated by introducing a reporter gene, and the reporter gene can be expressed under the control of a promoter for the DNA described in (5) above (78).
(80) The non-human mammal according to (78), wherein the non-human mammal is a rodent.
1) The test compound is administered to the non-human mammal described in (80) above, wherein the rodent is a mouse, (82) the animal described in (79) above, and the expression of the reporter gene is detected. (5) a method for screening a compound or a salt thereof that promotes or inhibits the promoter activity for DNA, (83) the apelin receptor protein according to (1) above, the partial peptide or a salt thereof for mammals, A method for regulating adrenocorticotropic hormone secretion, which comprises administering an effective amount of the polynucleotide according to (4) above, the compound according to (37) or a salt thereof, or the compound according to (49) or a salt thereof. (84) For mammals, the apelin receptor protein described in (1) above, a partial peptide thereof or a salt thereof, and the poline described in (4) above. Nucleotides, the (37) or a salt thereof described or above, (4
9) A method for regulating oxytocin secretion, which comprises administering an effective amount of the compound or the salt thereof, (85) the apelin receptor protein, the partial peptide thereof or the salt thereof according to the above (1), to a mammal , Above (4)
Hypoaldosteronism, hypocortisolemia, sequelae, which comprises administering an effective amount of the polynucleotide described above, the agonist described in (38) above, or the compound or its salt that promotes the expression level described in (50) above. And chronic adrenocortical hypofunction, Addison's disease, adrenal insufficiency, pain or obesity prevention / treatment method, (86) for mammals, the apelin receptor protein, its partial peptide, or its Labor induction, which is characterized by administering an effective amount of a salt, the polynucleotide described in (4) above, the agonist described in (38) above, or the compound promoting the expression level described in (50) above or a salt thereof. Labor, flaccid bleeding, placenta pre- and post-partum delivery, uterine restoration failure, cesarean section, abortion, artificial abortion, lactation deficiency, post-traumatic stress syndrome or milk Method for preventing / treating stasis, (87) An antibody against the apelin receptor protein according to (1) above, a partial peptide thereof or a salt thereof against a mammal, the polynucleotide according to (27) above, (39) above Cushing's disease, Cushing's syndrome, adrenocorticotropic hormone-producing pituitary tumor, CRH-producing tumor, which comprises administering an effective amount of the antagonist or the compound or a salt thereof that inhibits the expression level according to (51). Prevention and treatment of aldosterone-producing tumor, aldosteronism, primary cortisol resistance, congenital adrenal deficiency, anti-stress, depression, anorexia nervosa, insomnia, gastroduodenal ulcer or irritable bowel syndrome, (88 ) For mammals, the apelin receptor protein described in (1) above, a partial peptide thereof or a salt thereof. Against the antibody, the polynucleotide described in (27) above, the antagonist described in (39) above, or the compound that inhibits the expression level described in (51) or a salt thereof is administered in an effective amount. , Infertility, ankylosing uterine contraction, fetal distress, uterine rupture, cervical laceration, dysmenorrhea, premature birth or Prader-Willi syndrome prevention and treatment method, (89) for producing adrenocorticotropic hormone secretion regulator The apelin receptor protein according to (1) above, a partial peptide thereof or a salt thereof,
The polynucleotide according to (4) above, or (37) above.
Use of the compound or salt thereof described in the above, or compound or salt thereof described in the above (49), (90) Apelin receptor protein, partial peptide thereof or salt thereof described in the above (1) for producing an oxytocin secretion regulator. ,
Use of the polynucleotide according to (4) above, the compound according to (37) or a salt thereof, or the compound according to (49) or a salt thereof, (91) hypoaldosteronism, hypocortisolemia, secondary and chronic. The apelin receptor protein according to (1) above, a partial peptide or salt thereof according to (4) above for producing a prophylactic / therapeutic agent for hypoadrenocorticalism, Addison's disease, adrenal insufficiency, pain or obesity. Polynucleotide, above (3
8) Use of an agonist, or a compound or a salt thereof that promotes the expression level according to (50) above, (92) labor induction, weak labor, laxative bleeding, placental delivery, uterine retrograde failure, cesarean section, miscarriage. , An apelin receptor protein according to the above (1), a partial peptide thereof or a salt thereof for producing a prophylactic / therapeutic agent for artificial abortion, lactation deficiency, post-traumatic stress syndrome, or milk retention, the above (4) Polynucleotide, the agonist according to (38) above, or a compound or a salt thereof that promotes the expression level according to (50), (93) Cushing's disease, Cushing's syndrome, adrenocorticotropic hormone-producing pituitary tumor, CRH. Producing tumor, aldosterone producing tumor, aldosteronism, primary cortisol resistance, congenital adrenal enzyme deficiency, antistress, depression , An antibody against the apelin receptor protein, a partial peptide thereof or a salt thereof according to the above (1) for producing a prophylactic / therapeutic agent for anorexia nervosa, insomnia, gastric / duodenal ulcer or irritable bowel syndrome, the above ( 27) The polynucleotide according to
Use of the antagonist according to (39) above, or a compound or a salt thereof that inhibits the expression level according to (51), (94) overwork labor, infertility, ankylosing uterine contraction, fetal distress, uterine rupture, cervical canal Laceration, dysmenorrhea, premature birth or
An antibody against the apelin receptor protein according to (1) above, a partial peptide thereof or a salt thereof, for producing a prophylactic / therapeutic agent for Prader-Willi syndrome, a polynucleotide according to (27) above, and an antagonist according to (39) above. Or a compound or salt thereof which inhibits the expression level according to (51) above.

Further, the present invention provides (95) X¹Has side chains
(65) which is an amino acid residue which may be substituted
The screening method described, (96) X¹Has been replaced
Optionally pGlu or side chains may be substituted
The screening method according to (65) above, which is Gln,
(97) X¹Is the formula Y¹-Y^Two(In the formula, Y¹Are each
The side chains may be the same or different and may be substituted 1 Not
Amino acid residue consisting of 17 amino acids or pepti
Showing a chain, Y^TwoHave the same or different side chains
Consists of 1 to 8 optionally substituted amino acids
The amino acid residue or the peptide chain)
(65) The screening method described in (98) Y^TwoBut
 Formula B¹-B^Two-B^Three-B^Four-B⁵-B⁶-B⁷-B
⁸(In the formula, B¹Through B⁸Are the same or different
Represents an amino acid residue whose side chain may be substituted),
 Formula B^Two-B^Three-B^Four-B⁵-B⁶-B⁷-B⁸(formula
Where each symbol has the same meaning as above), Formula B^Three-B^Four
-B⁵-B⁶-B⁷-B ⁸(In the formula, each symbol agrees with the above.
Meaning), formula B^Four-B⁵-B⁶-B⁷-B ⁸(formula
Where each symbol has the same meaning as above), Formula B⁵-B⁶
-B⁷-B⁸(In the formula, each symbol has the same meaning as above),
 Formula B⁶-B⁷-B⁸(In the formula, each symbol has the same meaning as above.
), The formula B⁷-B⁸(In the formula, each symbol is the same as above.
Meaning) or formula B⁸(In the formula, B⁸Is the same as above
(97) which is a peptide chain represented by
The screening method described, (99) B¹Replaces the side chain
(9) which is a neutral amino acid residue which may be
8) The screening method described in (100) B¹Is replaced
The mask according to (98) above, which is Gly which may be
Learning method, (101) B^Two, B^ThreeAnd B^FourGazo
Each may have the same or different side chain.
The screen described in (98) above, which is a basic amino acid residue.
Method (102) B⁵Has an aromatic side chain
Screening according to the above (98), which is an amino acid residue
Method, (103) B⁶And B⁷Are the same or
Basic amino acid residue that may have different side chains
The screening method according to the above (98), which is a group (1
04) B⁸Is Gln in which the side chain may be substituted
The screening method described in (98) above, (105) Y
¹Is the expression (a) A¹-A^Two-A^Three-A^Four-A⁵-A⁶-A
⁷-A⁸-A⁹-A¹⁰-A¹¹-A¹²-A^Thirteen-A
¹⁴-A¹⁵-A¹⁶-A¹⁷(In the formula, A¹Through A
¹⁷Have the same or different side chains
An amino acid residue which may be present), (b) Formula A^Two-A^Three−
A^Four-A⁵-A⁶-A⁷-A⁸-A⁹-A¹⁰-A¹¹
-A¹²-A^Thirteen-A¹⁴-A¹⁵-A¹⁶-A
¹⁷(Wherein each symbol has the same meaning as described above), (c) formula
A^Three-A^Four-A⁵-A⁶-A⁷-A⁸-A⁹-A¹⁰−
A¹¹-A¹²-A^Thirteen-A¹⁴-A¹⁵-A¹⁶-A
¹⁷(Wherein each symbol has the same meaning as described above), (d) formula
A^Four-A⁵-A⁶-A⁷-A⁸-A⁹-A¹⁰-A¹¹
-A¹²-A^Thirteen-A¹⁴-A¹⁵-A¹⁶-A
¹⁷(Wherein each symbol has the same meaning as described above), (e) formula
A⁵-A⁶-A⁷-A⁸-A⁹-A¹⁰-A¹¹-A
¹²-A^Thirteen-A¹⁴-A¹⁵-A¹⁶-A¹⁷(formula
Where each symbol has the same meaning as above), (f) Formula A⁶-A
⁷-A⁸-A⁹-A^{1 0}-A¹¹-A¹²-A^Thirteen-A
¹⁴-A¹⁵-A¹⁶-A¹⁷(In the formula, each symbol is as described above.
Have the same meaning), (g) Formula A⁷-A⁸-A⁹-A¹⁰−
A¹¹-A¹²-A^Thirteen-A¹⁴-A¹⁵-A¹⁶-A
¹⁷(In the formula, each symbol has the same meaning as described above), (h) formula
A⁸-A⁹-A¹⁰-A¹¹-A¹²-A^Thirteen-A¹⁴
-A¹⁵-A¹⁶-A¹⁷(In the formula, each symbol is the same as above.
Meaning)), (i) Formula A⁹-A^{1 0}-A¹¹-A¹²−
A^Thirteen-A¹⁴-A¹⁵-A¹⁶-A¹⁷(In the formula, each note
No. has the same meaning as above), (j) Formula A¹⁰-A¹¹−
A¹²-A^Thirteen-A¹⁴-A¹⁵-A¹⁶-A¹⁷(formula
Where each symbol has the same meaning as above), (k) Formula A^{1 1}−
A¹²-A^Thirteen-A¹⁴-A¹⁵-A¹⁶-A¹⁷(formula
Where each symbol has the same meaning as above), (l) Formula A¹²−
A^Thirteen-A¹⁴-A¹⁵-A¹⁶-A¹⁷(In the formula, each note
No. has the same meaning as above), (m) Formula A^Thirteen-A¹⁴−
A¹⁵-A^{1 6}-A¹⁷(In the formula, each symbol has the same meaning as above.
), (N) Formula A¹⁴-A¹⁵-A¹⁶-A
¹⁷(Wherein each symbol has the same meaning as above), (o) formula
A¹⁵-A^{1 6}-A¹⁷(In the formula, each symbol has the same meaning as above.
), (P) Formula A¹⁶-A¹⁷(In the formula, each symbol is
And (q) A¹⁷(A¹⁷Is as above
Amino acid residue or peptide represented by
The screening method according to (97) above, which is a chain, (1
06) A¹Is an amino acid residue having an aromatic side chain
The screening method described in (105) above, (107)
A^TwoAnd A^ThreeIs a neutral amino group in which the side chain may be substituted.
The screening method according to (105) above, which is a non-acid residue.
Law, (108) A^FourIs neutral in which the side chain may be substituted
Or a basic-L-amino acid residue (105)
The screening method described, (109) A⁵Is the side chain
The above (105), which is a Pro that may be replaced
Screening method, (110) A⁶And A⁹Is that
Each of them may be the same or different and the side chain may be substituted.
The screen according to (105) above, which is a basic amino acid residue.
Learning method, (111) A⁷And A¹⁰Respectively
Identical or different, with a hydroxyl group in the side chain
Nono acid residue or a neutral amino group whose side chain may be substituted
The screening method according to (105) above, which is an acid residue
Law, (112) A⁸Has a hydroxy group in the side chain
The screening method according to (105) above, which is a non-acid residue.
Law, (113) A⁸Is Ser, Pro or Hyp
The screening method according to (105) above,
4) A¹⁰Is an amino acid residue having a hydroxy group in the side chain
The screening method according to the above (105), which is
15) A¹¹Through A¹⁴Are the same or different
Is a neutral amino acid residue whose side chain may be substituted.
The screening method described in (105) above, (116)
A¹⁵Is an amino acid residue having an aromatic side chain
The screening method according to (105), (117) A
¹⁵The screenin according to (105) above, wherein is Trp.
Method, (118) A¹⁶And A¹⁷Are the same
Or a neutral amino optionally substituted on the side chain
The screening method according to (105) above, which is an acid residue
Law,

(119) The screening method according to (66) above, wherein P1 is a hydrogen atom, pGlu or Arg-Arg-Gln, and (120) P2 is an optionally substituted His or an optionally substituted Ala. A certain screening method according to the above (66), (121) P3
Is Arg which may be substituted or Lys which may be substituted, The screening method according to (66), wherein (122) -P4-P5 is -Cha-Pro-Ph.
e (Cl), -Cha-Pro-Phe, -Met-P
ro-Phe, -Met-Pro-Phe (Cl),-
The above (6) which is Cha-Phe or -Met-Phe.
6) The screening method described above, wherein the modified form of (123) apelin is Arg-Pro-Arg-Leu-Phe-Ala-Arg-Gly-Pro-Cha.
-Pro-Phe (Cl), Arg-Pro-Arg-Leu-Phe-His-Lys-Gly-Pro-Cha-Pro-Phe
(Cl), Arg-Pro-Arg-Leu-Phe-His-Lys-Gly-Pro-Cha-Pro-Ph
e, Arg-Pro-Arg-Leu-Phe-His-Lys-Gly-Pro-Met-Pro-Phe
(Cl), Arg-Pro-Arg-Leu-Phe-Ala-Arg-Gly-Pro-Met-Pro-Ph
e, Arg-Pro-Arg-Leu-Phe-His-Lys-Gly-Pro-Cha-Phe (C
l), pGlu-Arg-Pro-Arg-Leu-Phe-Arg-Arg-Gly-Pro-Met-Pro
-Phe, pGlu-Arg-Pro-Arg-Leu-Phe-His-Lys-Gly-Pro-Met-Pro
-Phe or Arg-Pro-Arg-Leu-Phe-Ala-Arg-Gly-Pro-Met-Phe, the screening method according to the above (66),

(124) The screening method according to (67) above, wherein Q1 is a hydrogen atom, pGlu or Arg-Arg-Gln, and (125) Q2 is an optionally substituted Arg or an optionally substituted Lys. A certain screening method according to the above (67), (126) -Q
3-Q4 is -OH, -Met, -Met-Pro-Ph
e, -Met-Pro-Phe (Cl), -Cha-P
ro-Phe, -Cha-Pro-Phe (Cl),-
Ala-Pro-Phe (Cl), -Cha-Phe
The screening method according to (67) above, which is (Cl) or -Cha, (127) Q5 is an optionally substituted Pro, optionally substituted Gly, or optionally substituted Ala (67). ) The screening method described above, wherein the modified form of (128) apelin is (i) Arg-Ar
g-Gln-Arg-Pro-Arg-Leu-Ser-Ala-Arg-Gly-Pro-Met-Pro-
Phe (Cl), (ii) Arg-Pro-Arg-Leu-Ser-Ala-Arg-Gly-Pro-
Met-Pro-Phe (Cl), (iii) Arg-Pro-Arg-Leu-Ser-Ala-Arg
-Gly-Pro-Cha-Phe (Cl), (iv) Arg-Pro-Arg-Leu-Ser-Ala
-Arg-Gly-Pro-Cha-Pro-Phe (Cl), (v) Arg-Arg-Gln-Arg-
Pro-Arg-Leu-Ser-Ala-Arg-Gly-Pro-Cha, (vi) Arg-Pro-
Arg-Leu-Ser-Ala-Arg-Gly-Pro-Cha-Pro-Phe, (vii) Arg
-Arg-Gln-Arg-Pro-Arg-Leu-Ser-Ala-Arg-Gly-Pro-Met-P
ro-Phe, (viii) Arg-Arg-Gln-Arg-Pro-Arg-Leu-Ser-Ala
-Arg-Gly-Pro-Met, (ix) Arg-Arg-Gln-Arg-Pro-Arg-Leu
-Ser-Ala-Arg-Gly-Pro, (x) Arg-Pro-Arg-Leu-Ser-Ala-
Arg-Gly-Pro-Met-Pro-Phe, (xi) pGlu-Arg-Pro-Arg-Leu
-Ser-Ala-Arg-Gly-Pro-Met-Pro-Phe, (xii) Arg-Pro-Ar
g-Leu-Ser-Ala-Arg-Gly-Pro-Met, (xiii) pGlu-Arg-Pro
-Arg-Leu-Ser-Ala-Lys-Gly-Pro-Met-Pro-Phe, (xiv) Ar
g-Pro-Arg-Leu-Ser-Ala-Arg-Gly-Pro-Ala-Pro-Phe (C
l), (xv) Arg-Pro-Arg-Leu-Ser-Ala-Arg-Gly-Gly-Met-P
ro-Phe (Cl), (xvi) Arg-Pro-Arg-Leu-Ser-Ala-Arg-Gly-
NMe-Ala-Met-Pro-Phe (Cl), (xvii) Arg-Pro-Arg-Leu-Se
r-Ala-Arg-Gly-Pro-Cha-Pyn, (xviii) Arg-Pro-Arg-Leu
-Ser-Ala-Arg-Gly-Pro-Cha-Pro-Pyn, (xix) Arg-Arg-Gl
n-Arg-Pro-Arg-Leu-Ser-Ala-Arg-Gly-Gly-Cha, or
(xx) Arg-Pro-Arg-Leu-Ser-Ala-Lys (Me) ₂ -Gly-Pro-Met-
Pro-Phe, the screening method according to the above (67), which is a peptide represented by:

(129) The screening method described in (68) above, wherein R1 is a hydrogen atom, pGlu or Arg-Arg-Gln, and (130) the modified apelin is Arg-Arg-Gln-Arg-Pro-Arg-Leu. -Ser-His-Lys-Gly-Pro-
Cha-Pro-Phe (Cl), Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Cha-Pro-Phe
(Cl), Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Met-Pro-Phe
(Cl), pGlu-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Cha-Pro
-Phe, pGlu-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Met-Pro
-Phe (Cl), Arg-Arg-Gln-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-
Nle-Pro-Tyr, Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Met-Pro-Nal
(2), pGlu-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Met-Pro
-Nal (2), or Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Met-Pro-Ch
The screening method according to the above (68), which is a peptide represented by a, or an ester thereof, an amide thereof, or a salt thereof;
Arg-Gln-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Met
(O), (ii) Arg-Arg-Lys (Arg-Arg) -Arg-Pro-Arg-Leu-Ser
-His-Lys-Gly-Pro-Met-Pro-Phe, (iii) Arg-Arg-Arg-Ar
g-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Met-Pro-Phe, (i
v) Arg-Arg-Lys-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro
-Met-Pro-Phe, (v) Arg-Arg-Ala-Arg-Pro-Arg-Leu-Ser-
His-Lys-Gly-Pro-Met-Pro-Phe, (vi) Arg-Pro-Arg-Leu-
Ser-His-Lys-Gly-Pro-Met-Phe (Cl), (vii) pGlu-Arg-Pr
o-Arg-Leu-Ser-Arg-Lys-Gly-Pro-Met-Pro-Phe, (viii)
Arg-Arg-Phe-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Me
t-Pro-Phe, (ix) pGlu-Arg-Pro-Arg-Leu-Ser-His-Arg-G
ly-Pro-Met-Pro-Phe, (x) pGlu-Arg-Pro-Arg-Leu-Ser-H
is-Lys-Gly-Pro-Met-Phe (Cl), (xi) Arg-Pro-Arg-Leu-S
er-His-Lys-Gly-Pro-Met-Cha, (xii) pGlu-Arg-Pro-Arg
-Leu-Ser-Leu-Lys-Gly-Pro-Met-Pro-Phe, (xiii) Arg-P
ro-Arg-Leu-Ser-His-Lys-Gly-Pro-Met-Nal (2), (xiv) p
Glu-Arg-Pro-Arg-Leu-Ser-Arg-Arg-Gly-Pro-Met-Pro-Ph
e, (xv) pGlu-Arg-Pro-Arg-Leu-Ser-Phe-Lys-Gly-Pro-M
et-Pro-Phe, (xvi) pGlu-Arg-Pro-Arg-Leu-Ser-His-Lys
-Gly-Pro-Met-Cha, (xvii) pGlu-Arg-Pro-Arg-Leu-Ser-
His-Lys-Gly-Pro-Met-Nal (2), (xviii) pGlu-Arg-Pro-A
rg-Leu-Ser-His-Phe-Gly-Pro-Met-Pro-Phe, (xix) pGlu
-Arg-Pro-Arg-Leu-Ser-His-Leu-Gly-Pro-Met-Pro-Phe,
(xx) Arg-Arg-Gln-Arg-Pro-Arg-Leu-Ser-Ala-Arg-Gly-N
Me2, (xxi) Arg-Arg-Gln-Arg-Pro-Arg-Leu-Ser-Ala-Arg
-Gly-Mor, (xxii) Arg-Pro-Arg-Leu-Ser-His-Ala-Gly-P
ro-Cha-Pro-Phe (Cl), (xxiii) Arg-Pro-Arg-Ala-Ser-Hi
s-Lys-Gly-Pro-Cha-Pro-Phe (Cl), (xxiv) Arg-Pro-Lys
(Me) ₂ -Leu-Ser-Ala-Arg-Gly-Pro-Met-Pro-Phe, (xxv) A
rg-Pro-Arg-Leu-Ser-Dap-Arg-Gly-Pro-Cha-Pro-Phe (C
l), (xxvi) Arg-Pro-Arg-Leu-Ser-Dap (Ac) c-Arg-Gly-Pr
o-Cha-Pro-Phe (Cl), (xxvii) Arg-Pro-Arg-Leu-Ser-Dap
(C6) -Arg-Gly-Pro-Cha-Pro-Phe (Cl), (xxviii) Arg-Pro
-Arg-Leu-Ser-Dap (Adi) -Arg-Gly-Pro-Cha-Pro-Phe (C
l), or (xxix) Arg-Pro-Ala-Leu-Ser-His-Lys-Gly-P
The screening method according to (68) above, which is a peptide represented by ro-Cha-Pro-Phe (Cl), an ester thereof, an amide thereof, or a salt thereof. As used herein, “substantially the same” means the activity of a protein,
For example, the binding activity of a ligand and a receptor, physiological properties (eg, adrenocorticotropic hormone secretory regulatory action, oxytocin secretory regulatory action) and the like are substantially the same. Amino acid substitutions, deletions, additions or insertions often do not result in a significant change in the physiological or chemical properties of the polypeptide, in which case the substitutions, deletions,
Polypeptides with additions or insertions will be substantially identical to those without such substitutions, deletions, additions or insertions. Substantially identical substitutions of amino acids in the amino acid sequence can be selected, for example, from other amino acids in the class to which the amino acid belongs. Examples of non-polar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine. Examples of polar (neutral) amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, glutamine and the like. Examples of positively charged (basic) amino acids include arginine, lysine, and histidine. Examples of negatively charged (acidic) amino acids include aspartic acid and glutamic acid.

[0010]

BEST MODE FOR CARRYING OUT THE INVENTION The apelin receptor protein of the present invention (hereinafter sometimes abbreviated as apelin receptor) is
It is a receptor protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1. Apelin receptors are, for example, all cells of humans and mammals (eg, guinea pig, rat, mouse, rabbit, pig, sheep, cow, monkey, etc.) (for example, splenocytes, nerve cells, glial cells, pancreatic β cells, Bone marrow cells, mesangial cells, Langerhans cells, epidermal cells, epithelial cells, endothelial cells, fibroblasts, fiber cells, muscle cells, adipocytes, immune cells (eg, macrophages, T cells, B cells, natural killer cells, mast cells) , Neutrophils, basophils, eosinophils, monocytes), megakaryocytes, synovial cells, chondrocytes, osteocytes, osteoblasts, osteoclasts, mammary gland cells, hepatocytes or stromal cells, or these Cell progenitors, stem cells or cancer cells) or cells of blood cell lineage, or any tissue in which these cells are present, such as the brain, parts of the brain (eg, olfactory bulb, squamous nucleus, basal cerebrum) , Hippocampus, thalamus,
Hypothalamus, subthalamic nucleus, cerebral cortex, medulla oblongata, cerebellum, occipital lobe,
Frontal lobe, temporal lobe, putamen, caudate, brain stain, substantia nigra), spinal cord,
Pituitary, stomach, pancreas, kidney, liver, gonad, thyroid, gallbladder, bone marrow, adrenal gland, skin, muscle, lung, digestive tract (eg, large intestine,
Small intestine), blood vessel, heart, thymus, spleen, submandibular gland, peripheral blood, peripheral blood cells, prostate, testis, testis, ovary, placenta, uterus, bone,
It may be a protein derived from a joint, skeletal muscle, or the like, or may be a synthetic protein.

The amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 1 is, for example, about 76% or more, preferably 80% or more, more preferably about the amino acid sequence represented by SEQ ID NO: 1. Examples include amino acid sequences having a homology of 90% or more, more preferably about 95% or more. The protein containing an amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 1 of the present invention has, for example, an amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 1, A protein having substantially the same activity as the amino acid sequence represented by SEQ ID NO: 1 is preferable. Examples of substantially the same activity include ligand binding activity and signal transduction activity. "Substantially the same quality" means that their activities are qualitatively the same. Therefore,
Equivalent activities such as ligand binding activity and signal transduction activity (eg, about 0.01 to 100 times, preferably about 0.5
It is preferably about 20 to 20 times, more preferably about 0.5 to 2 times), but these quantitative factors such as the degree of activity and the molecular weight of the protein may be different. The activity such as ligand binding activity and signal transduction activity can be measured according to a method known per se, for example, it can be measured according to a screening method described later.

As the apelin receptor, a) 1 or 2 or more in the amino acid sequence represented by SEQ ID NO: 1 (preferably about 1 to 30 and more preferably 1 to 30)
About 10 amino acid sequences, more preferably several (1 to 5) amino acid deletions, b) 1 or 2 or more (preferably 1 to 30) amino acid sequences represented by SEQ ID NO: 1. Degree, more preferably about 1 to 10,
More preferably, an amino acid sequence in which several (1 to 5) amino acids are added, c) 1 or 2 or more (preferably 1 to 30) in the amino acid sequence represented by SEQ ID NO: 1.
A protein having an amino acid sequence in which about one, more preferably about 1 to 10, more preferably several (1 to 5) amino acids are substituted with other amino acids, or d) an amino acid sequence combining them. Also used.

The apelin receptor in the present specification means pep
According to the convention of Cido, the left end is the N-terminal (amino end).
The end) and the right end are the C-terminal (carboxyl terminal). Array
Apelin containing the amino acid sequence represented by No. 1
Apelin receptors such as receptors have a C-terminal cal
Boxyl group (-COOH), carboxylate (-CO
O ⁻), Amide (-CONH_Two) Or ester (-C
OOR). Here at Esther
Examples of R include, for example, methyl, ethyl, n-propy
C such as toluene, isopropyl or n-butyl_1-6A
Alkyl group such as cyclopentyl, cyclohexyl
Which C_3-8A cycloalkyl group, for example phenyl, α
-C such as naphthyl_6-12Aryl groups, such as benzene
Phenyl-C such as zir and phenethyl_1-2Alkyl group
Or α-naphthyl-C such as α-naphthylmethyl
_1-2C such as alkyl group_7-14Aralkyl group
Or pivaloyloxy commonly used as an oral ester
A methyl group or the like is used. Apelin receptor is C-terminal or lower
Has a carboxyl group (or carboxylate) outside
The carboxyl group is amidated or esterified
Those which have been modified are also included in the apelin receptor of the present invention.
It Examples of the ester in this case include the above-mentioned C powder.
Edge esters and the like are used. In addition, apelin acceptance
In the body, in the above-mentioned protein, N-terminal methionine
The amino group of the residue is a protecting group (eg, formyl group, acetyl group).
C such as le_2-6C such as alkanoyl group_1-6Acyl
That is protected by a base, etc., the N-end side is cut in vivo
The generated glutamyl group was oxidized by pyroglutamine.
A substituent on the side chain of an amino acid in the molecule (for example, -O
H, -SH, amino group, imidazole group, indole
Groups, guanidino groups, etc.) are suitable protecting groups (eg,
Mill group, C such as acetyl_2-6Such as alkanoyl groups
C_1-6Protected by an acyl group, etc., or
Is a complex protein such as a so-called glycoprotein in which sugar chains are bound.
Including both. Specific examples of the apelin receptor of the present invention
Is, for example, the amino acid sequence represented by SEQ ID NO: 1.
The bovine-derived apelin receptor or the like contained therein is used.

The partial peptide of the apelin receptor (hereinafter sometimes abbreviated as a partial peptide) may be any of the above-mentioned partial peptides of the apelin receptor. For example, the apelin receptor Among these protein molecules, those exposed to the outside of the cell membrane and having substantially the same receptor binding activity are used. Specifically, the partial peptide of the apelin receptor having the amino acid sequence represented by SEQ ID NO: 1 is:
Extracellular region (hydrophilic (Hydr
A peptide containing a portion analyzed to be (ophilic) site). Further, a peptide partially containing a hydrophobic (Hydrophobic) site can also be used. A peptide containing each domain individually may be used, but a peptide of a part containing a plurality of domains at the same time may be used. The number of amino acids in the partial peptide of the present invention is preferably a peptide having an amino acid sequence of at least 20 amino acids, preferably 50 amino acids or more, and more preferably 100 amino acids or more among the constituent amino acid sequences of the receptor protein of the present invention described above. . The substantially identical amino acid sequence means an amino acid sequence having a homology of about 76% or more, preferably about 80% or more, more preferably about 90% or more, further preferably about 95% or more with these amino acid sequences. . Here, the “substantially the same receptor activity” has the same meaning as described above. The “substantially the same quality of receptor activity” can be measured in the same manner as above.

The partial peptide of the present invention has one or more (preferably 1 to 10) amino acids in the above amino acid sequence.
About one, more preferably several (1 to 5) amino acids are deleted, or 1 or 2 or more (preferably about 1 to 20, more preferably 1) in the amino acid sequence.
-10, more preferably several (1-5) amino acids are added, or 1 or 2 or more (preferably 1-10, more preferably several) in the amino acid sequence. , And more preferably about 1 to 5 amino acids) may be substituted with other amino acids. Further, the partial peptide of the present invention has a carboxyl group (-COO at the C-terminal).
H), carboxylate (-COO ^-), amide (-C
ONH ₂₎ or may be any of the ester (-COOR). When the partial peptide of the present invention has a carboxyl group (or carboxylate) in addition to the C-terminal, those in which the carboxyl group is amidated or esterified are also included in the partial peptide of the present invention. As the ester in this case, for example, the above-mentioned C-terminal ester or the like is used. Further, in the partial peptide of the present invention, the amino group of the N-terminal methionine residue is protected by a protecting group, as in the apelin receptor described above, N
Gln produced by cleavage at the end in vivo is oxidized by pyroglutamine, a substituent on the side chain of an amino acid in the molecule is protected by an appropriate protecting group, or a so-called glycopeptide to which a sugar chain is bound. The complex peptides and the like are also included. Examples of the salt of the apelin receptor of the present invention or a partial peptide thereof include physiologically acceptable salts with acids or bases, and physiologically acceptable acid addition salts are particularly preferable. Examples of such salts include salts with inorganic acids (for example, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid),
Alternatively, organic acids (eg, acetic acid, formic acid, propionic acid,
Fumaric acid, maleic acid, succinic acid, tartaric acid, citric acid,
Malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like salts are used.

The apelin receptor of the present invention or a salt thereof comprises
It can be produced from the above-mentioned human or mammalian cells or tissues by a known method for purifying a receptor protein, or by culturing a transformant containing a DNA encoding the apelin receptor of the present invention described later. Can also be manufactured by. In addition, it can also be produced by a protein synthesis method described later or a method similar thereto. When producing from human or mammalian tissues or cells, the human or mammalian tissues or cells are homogenized and then extracted with an acid or the like, and the extract is subjected to chromatography such as reverse phase chromatography or ion exchange chromatography. Can be purified and isolated by combining

For the synthesis of the apelin receptor of the present invention, its partial peptide, its salt or its amide,
Usually, a commercially available resin for protein synthesis can be used. Examples of such a resin include chloromethyl resin, hydroxymethyl resin, benzhydrylamine resin, aminomethyl resin, 4-benzyloxybenzyl alcohol resin, 4-methylbenzhydrylamine resin, PAM resin, 4-hydroxymethylmethyl resin. Phenylacetamide methyl resin, polyacrylamide resin, 4- (2 ',
4'-dimethoxyphenyl-hydroxymethyl) phenoxy resin, 4- (2 ', 4'-dimethoxyphenyl-F
moc aminoethyl) phenoxy resin and the like. Using such a resin, an amino acid having an α-amino group and a side chain functional group appropriately protected is condensed on the resin according to the sequence of the desired protein according to various condensation methods known per se. At the end of the reaction, the protein is cleaved from the resin and at the same time various protective groups are removed, and then an intramolecular disulfide bond forming reaction is carried out in a highly diluted solution to obtain the target protein or its amide. Regarding the condensation of the protected amino acid described above, various activating reagents that can be used for protein synthesis can be used, but carbodiimides are particularly preferable. Carbodiimides include DCC, N, N'-
Diisopropylcarbodiimide, N-ethyl-N'-
(3-Dimethylaminoprolyl) carbodiimide or the like is used. For activation by these, a protected amino acid is added directly to the resin together with a racemization-inhibiting additive (eg, HOBt, HOOBt), or activation of the protected amino acid is carried out in advance as a symmetrical acid anhydride or HOBt ester or HOOBt ester. After that, it can be added to the resin.

The solvent used for activation of the protected amino acid and condensation with the resin can be appropriately selected from solvents known to be usable for protein condensation reaction. For example,
Acid amides such as N, N-dimethylformamide, N, N-dimethylacetamide, N-methylpyrrolidone, halogenated hydrocarbons such as methylene chloride and chloroform, alcohols such as trifluoroethanol, sulfoxides such as dimethyl sulfoxide. , Ethers such as pyridine, dioxane and tetrahydrofuran, nitriles such as acetonitrile and propionitrile, esters such as methyl acetate and ethyl acetate, or an appropriate mixture thereof. The reaction temperature is appropriately selected from the range known to be applicable to protein bond-forming reactions, and is usually appropriately selected from the range of about -20 ° C to 50 ° C. Activated amino acid derivatives are usually 1.5-
Used in 4-fold excess. As a result of the test using the ninhydrin reaction, when the condensation is insufficient, sufficient condensation can be performed by repeating the condensation reaction without removing the protecting group. When sufficient condensation cannot be obtained even after repeating the reaction, unreacted amino acid can be acetylated using acetic anhydride or acetylimidazole.

Examples of the protective group for the amino group of the raw material include Z, Boc, tertiary pentyloxycarbonyl, isobornyloxycarbonyl, 4-methoxybenzyloxycarbonyl, Cl-Z, Br-Z, adamantyloxycarbonyl, Trifluoroacetyl, phthaloyl, formyl, 2-nitrophenylsulfenyl, diphenylphosphinothioyl oil, Fmoc and the like are used. The carboxyl group is, for example, an alkyl esterified (for example, linear, branched or cyclic alkyl ester such as methyl, ethyl, propyl, butyl, tert-butyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, 2-adamantyl and the like. ), Aralkyl esterification (eg benzyl ester, 4-
Nitrobenzyl ester, 4-methoxybenzyl ester, 4-chlorobenzyl ester, benzhydryl esterification), phenacyl esterification, benzyloxycarbonyl hydrazide formation, tertiary butoxycarbonyl hydrazide formation, trityl hydrazide formation, etc. . The hydroxyl group of serine can be protected by, for example, esterification or etherification.
Examples of groups suitable for this esterification include lower alkanoyl groups such as acetyl group, aroyl groups such as benzoyl group, groups derived from carbonic acid such as benzyloxycarbonyl group and ethoxycarbonyl group.
Moreover, examples of a group suitable for etherification include a benzyl group, a tetrahydropyranyl group, and a t-butyl group. As a protective group for the phenolic hydroxyl group of tyrosine,
For example, Bzl, Cl2-Bzl, ₂ -nitrobenzyl, Br-Z, tertiary butyl, etc. are used.
Examples of the protecting group for imidazole of histidine include:
Tos, 4-methoxy-2,3,6-trimethylbenzenesulfonyl, DNP, benzyloxymethyl, Bu
m, Boc, Trt, Fmoc, etc. are used.

The activated carboxyl group of the raw material includes, for example, corresponding acid anhydrides, azides, active esters [alcohols (for example, pentachlorophenol, 2,4,5-trichlorophenol, 2,4- Dinitrophenol, cyanomethyl alcohol, paranitrophenol, HONB, N-hydroxysuccinide, N
-Hydroxyphthalimide, ester with HOBt)]
Are used. As the activated amino group of the raw material, for example, the corresponding phosphoric acid amide is used. Examples of the method for removing (eliminating) the protecting group include Pd
-Catalytic reduction in a hydrogen stream in the presence of a catalyst such as black or Pd-carbon, or acid with anhydrous hydrogen fluoride, methanesulfonic acid, trifluoromethanesulfonic acid, trifluoroacetic acid, or a mixture thereof. Treatment, base treatment with diisopropylethylamine, triethylamine, piperidine, piperazine, etc., and reduction with sodium in liquid ammonia are also used. The elimination reaction by the acid treatment is generally carried out at a temperature of about -20 ° C to 40 ° C. In the acid treatment, for example, anisole, phenol, thioanisole, metacresol,
The addition of cation trapping agents such as para-cresol, dimethyl sulfide, 1,4-butanedithiol, 1,2-ethanedithiol is effective. Further, the 2,4-dinitrophenyl group used as the imidazole protecting group of histidine is removed by thiophenol treatment, and the formyl group used as the indole protecting group of tryptophan is the above 1,2-ethanedithiol, 1,4-butane group. In addition to deprotection by acid treatment in the presence of dithiol or the like, it is also removed by alkali treatment with dilute sodium hydroxide solution, dilute ammonia or the like.

The protection of a functional group which should not be involved in the reaction of the starting material, the removal of the protective group and the protective group, the activation of the functional group involved in the reaction and the like can be appropriately selected from known groups or known means. . As another method for obtaining an amide form of a protein, for example, first, the carboxy terminal amino acid α
-Amidation of a carboxyl group for protection, extension of the peptide (protein) chain to the amino group side to a desired chain length, and then a protein obtained by removing only the protective group for the α-amino group at the N-terminal of the peptide chain. A protein from which only the protecting group of the C-terminal carboxyl group has been removed is produced, and both proteins are condensed in the mixed solvent as described above. The details of the condensation reaction are the same as above. After purifying the protected protein obtained by condensation, all the protecting groups can be removed by the above method to obtain the desired crude protein. This crude protein can be purified by making full use of various known purification means, and the main fraction can be lyophilized to obtain the amide form of the desired protein. To obtain an ester form of a protein, for example, the α-carboxyl group of a carboxy-terminal amino acid is condensed with a desired alcohol to form an amino acid ester, and then an ester form of the desired protein is obtained in the same manner as the amide form of the protein. be able to.

The partial peptide of the apelin receptor of the present invention or a salt thereof can be prepared by publicly known methods for peptide synthesis.
Alternatively, it can be produced by cleaving the apelin receptor of the present invention with an appropriate peptidase. The peptide synthesis method may be, for example, either a solid phase synthesis method or a liquid phase synthesis method. That is, the target peptide can be produced by condensing a partial peptide or amino acid capable of constituting the apelin receptor of the present invention with the remaining portion and removing the protecting group when the product has a protecting group. . For the known condensation method and removal of the protecting group,
Examples include the methods described in a) to e) below. a) M. Bodanszky and MA Ondetti, Peptide Synthesis, Interscience Publisher
s, New York (1966) b) Schroeder and Luebke, The Peptid
e), Academic Press, New York (1965) c) Nobuo Izumiya et al., Fundamentals and experiments of peptide synthesis, Maruzen Co., Ltd.
(1975) d) Haruaki Yajima and Shunpei Sakakibara, Biochemistry Laboratory 1, Protein Chemistry IV, 205, (1977) e) Supervised by Haruaki Yajima, Development of Pharmaceuticals Volume 14 Peptide Synthesis Hirokawa Shoten After the reaction, the partial peptide of the present invention can be purified and isolated by combining usual purification methods such as solvent extraction, distillation, column chromatography, liquid chromatography, and recrystallization. When the partial peptide obtained by the above method is a free form, it can be converted into an appropriate salt by a known method, and conversely, when it is obtained as a salt, it can be converted into a free form by a known method. You can

Any polynucleotide can be used as the polynucleotide encoding the apelin receptor of the present invention, so long as it contains the nucleotide sequence (DNA or RNA, preferably DNA) encoding the apelin receptor of the present invention. May be. Examples of the polynucleotide include RNA such as DNA and mRNA encoding the apelin receptor of the present invention.
And may be double-stranded or single-stranded. When double-stranded, double-stranded DNA, double-stranded RNA or DN
A: RNA hybrid may be used. In case of single strand,
It may be the sense strand (ie the coding strand) or the antisense strand (ie the non-coding strand). By using the polynucleotide encoding the apelin receptor of the present invention, for example, by the method described in the publicly known special edition of Experimental Medicine, “New PCR and its Applications,” 15 (7), 1997, or a method analogous thereto, the apelin receptor of the present invention can be used. Body mRNA can be quantified. DN encoding the apelin receptor of the present invention
A may be any of genomic DNA, genomic DNA library, cDNA derived from the cells and tissues described above, cDNA library derived from the cells and tissues described above, and synthetic DNA. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. In addition, reverse Transcriptase Polymerase Chain R can be directly used by preparing total RNA or mRNA fraction from the above-mentioned cells / tissues.
It can also be amplified by eaction (hereinafter, abbreviated as RT-PCR method). Specifically, the DNA encoding the apelin receptor of the present invention includes, for example, a DNA containing the base sequence represented by SEQ ID NO: 2, or a base sequence represented by SEQ ID NO: 2 and highly stringent conditions. Any DNA that has a nucleotide sequence that hybridizes below and that encodes a receptor protein that has substantially the same activity as the apelin receptor of the present invention (eg, ligand binding activity, signal transduction activity, etc.) It may be one. As the DNA capable of hybridizing with the nucleotide sequence represented by SEQ ID NO: 2, for example, SEQ ID NO: 2
About 85% or more, preferably about 9 with the nucleotide sequence represented by
A DNA containing a base sequence having a homology of 0% or more, more preferably about 95% or more is used.

Hybridization can be carried out by a method known per se or a method analogous thereto, for example, molecular
Cloning (Molecular Cloning) 2nd (J. Sambrook
et al., Cold Spring Harbor Lab. Press, 1989). When a commercially available library is used, it can be performed according to the method described in the attached instruction manual. More preferably, it can be carried out under high stringent conditions. The high stringent condition is, for example,
The sodium concentration is about 19-40 mM, preferably about 19
~ 20 mM, temperature about 50-70 ° C, preferably about 6
The conditions of 0 to 65 ° C. are shown. Especially, the sodium concentration is about 1
Most preferred is 9 mM and a temperature of about 65 ° C. More specifically, the DNA encoding the bovine apelin receptor containing the amino acid sequence represented by SEQ ID NO: 1 includes D containing the base sequence represented by SEQ ID NO: 2.
NA or the like is used. The polynucleotide comprising a part of the base sequence of the DNA encoding the apelin receptor of the present invention or a part of the base sequence complementary to the DNA is a DNA encoding the following partial peptide of the present invention. Is used to mean not only RNA but also RNA. According to the present invention, an antisense polynucleotide (nucleic acid) capable of inhibiting the replication or expression of the GPR gene is designed based on the cloned or determined nucleotide sequence information of the DNA encoding the apelin receptor. And can be synthesized. Such a polynucleotide (nucleic acid) can hybridize with RNA of the apelin receptor gene, inhibit the synthesis or function of the RNA, or bind to the apelin receptor-related R
The expression of the apelin receptor gene can be regulated / controlled via the interaction with NA. A polynucleotide complementary to a selected sequence of GPR-related RNA, and GP
A polynucleotide capable of specifically hybridizing with R-related RNA is useful for regulating and controlling the expression of the apelin receptor gene in vivo and in vitro,
It is also useful for treatment or diagnosis of diseases. The term "corresponding" means having homology or being complementary to a specific sequence of nucleotides, base sequences or nucleic acids including genes. “Corresponding” between a nucleotide (base sequence or nucleic acid) and a peptide (protein) usually refers to an amino acid of a peptide (protein) in a command derived from the nucleotide (nucleic acid) sequence or its complement. . 5'end hairpin loop of apelin receptor gene, 5'end 6-base pair repeat, 5'end untranslated region, polypeptide translation initiation codon, protein coding region, ORF translation initiation codon, 3'end untranslated region, 3 '
The end palindromic region and the 3'end hairpin loop can be selected as the preferred target region, but any region within the apelin receptor gene can be selected as the target.

The relationship between the target nucleic acid and the polynucleotide complementary to at least a part of the target region, and the relationship between the polynucleotide capable of hybridizing with the target region can be said to be "antisense". . Antisense polynucleotides are polydeoxynucleotides containing 2-deoxy-D-ribose, D-
Ribose-containing polydeoxynucleotides, other types of polynucleotides that are N-glycosides of purine or pyrimidine bases, or other polymers with non-nucleotide backbones (eg, commercially available protein nucleic acids and synthetic sequence-specific nucleic acids). Polymer) or other polymer containing a special bond, provided that the polymer contains nucleotides having a configuration that allows base pairing and base attachment as found in DNA and RNA. . They are double-stranded DN
A, single-stranded DNA, double-stranded RNA, single-stranded RNA, DNA: RNA hybrid, and unmodified polynucleotide (or unmodified oligonucleotide) as well as addition of known modifications , For example, with a label known in the art, with a cap, methylated, one or more natural nucleotides substituted with an analogue, one with an intramolecular nucleotide modification, For example, those having an uncharged bond (eg, methylphosphonate, phosphotriester, phosphoramidate, carbamate, etc.), those having a charged bond or a sulfur-containing bond (eg, phosphorothioate, phosphorodithioate, etc.), eg Proteins (nucleases, nuclease inhibitors, toxins, antibodies, signal peptides Plastid, poly -L- lysine, etc.)
Having side chain groups such as sugars and sugars (eg, monosaccharides), those having intercurrent compounds (eg, acridine, psoralen, etc.), chelate compounds (eg, metals, radioactive metals, boron) , An oxidative metal, etc.), an alkylating agent, or a modified bond (for example, α-anomer type nucleic acid). Here, the term “nucleoside”, “nucleotide” and “nucleic acid” may include those having not only purine and pyrimidine bases but also other modified heterocyclic bases. Such modifications may include methylated purines and pyrimidines, acylated purines and pyrimidines, or other heterocycles. The modified nucleotide and the modified nucleotide may also have a modified sugar moiety, for example, one or more hydroxyl groups are substituted with halogen, an aliphatic group, or the like,
Alternatively, it may be converted into a functional group such as ether or amine.

The antisense polynucleotide (nucleic acid) of the present invention is RNA, DNA, or a modified nucleic acid (RNA, DNA). Specific examples of the modified nucleic acid include, but are not limited to, sulfur derivatives and thiophosphate derivatives of nucleic acids, and those resistant to degradation of polynucleoside amides and oligonucleoside amides. The antisense nucleic acid of the present invention can be preferably designed according to the following policy. That is, it makes the antisense nucleic acid more stable in the cell, increases the cell permeability of the antisense nucleic acid, has a greater affinity for the target sense strand, and if it is toxic, Make sense nucleic acid less toxic. Thus many modifications are known in the art, for example J. Kawakami et al., Pharm Tech Japan, Vo.
l. 8, pp. 247, 1992; Vol. 8, pp. 395, 1992; ST Cr
ooke et al. ed., Antisense Research and Applicatio
ns, CRC Press, 1993 etc. The antisense nucleic acid of the present invention has an altered or modified sugar,
It may contain a base, a bond, and can be provided in a special form such as liposome, microsphere, applied by gene therapy, or provided in an added form. Thus, as an additive form, a polycationic substance such as polylysine that acts to neutralize the charge of the phosphate skeleton, a lipid that enhances the interaction with the cell membrane or the uptake of nucleic acid ( Examples thereof include hydrophobic ones such as phospholipids and cholesterol). Preferred lipids to add include cholesterol and its derivatives (eg cholesteryl chloroformate, cholic acid, etc.). These can be attached to the 3'-end or 5'-end of the nucleic acid, and can be attached via a base, a sugar, or an intramolecular nucleoside bond. Other groups include
A capping group specifically arranged at the 3'-end or the 5'-end of a nucleic acid, which includes a group for preventing decomposition by nucleases such as exonuclease and RNase. Examples of such a capping group include, but are not limited to, hydroxyl group-protecting groups known in the art including glycols such as polyethylene glycol and tetraethylene glycol. The inhibitory activity of the antisense nucleic acid can be examined using the transformant of the present invention, the in vivo or in vitro gene expression system of the present invention, or the in vivo or in vitro translation system of G protein-coupled receptor protein. it can. The nucleic acid can be applied to cells by various methods known per se.

DNA encoding the partial peptide of the present invention
Any may be used as long as it contains the nucleotide sequence encoding the partial peptide of the present invention. Further, any of genomic DNA, genomic DNA library, cDNA derived from the cells / tissues described above, cDNA library derived from the cells / tissues described above, and synthetic DNA may be used. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. In addition, using the mRNA fraction prepared from the cells / tissues described above, the reverse
Transcriptase Polymerase Chain Reaction (hereinafter RT
-Abbreviated as PCR method). Specifically, D encoding the partial peptide of the present invention
Examples of NA include (1) DN having a partial base sequence of DNA having the base sequence represented by SEQ ID NO: 2.
A, or (2) having a nucleotide sequence that hybridizes with the nucleotide sequence represented by SEQ ID NO: 2 under high stringent conditions, and has substantially the same activity (eg, ligand binding) as the apelin receptor of the present invention. A DNA having a partial base sequence of a DNA encoding a receptor protein having an activity, a signal transduction action, etc.) is used. DN capable of hybridizing with the nucleotide sequence represented by SEQ ID NO: 2
A is, for example, a base sequence having homology of about 76% or more, preferably about 80% or more, more preferably about 90% or more, further preferably about 95% or more with the base sequence represented by SEQ ID NO: 2. And the like containing DNA are used.

As a means for cloning DNA that completely encodes the apelin receptor of the present invention or a partial peptide thereof (hereinafter sometimes abbreviated as the apelin receptor of the present invention), a part of the apelin receptor of the present invention can be used. DNA amplified by the PCR method using a synthetic DNA primer having a nucleotide sequence or incorporated into an appropriate vector
Can be selected by hybridization with a DNA fragment encoding a part or the entire region of the apelin receptor of the present invention or one labeled with a synthetic DNA. The method of hybridization is, for example,
Molecular Cloning 2n
d (J. Sambrook et al., Cold Spring Harbor Lab. Pre
ss, 1989) and the like. When a commercially available library is used, it can be performed according to the method described in the attached instruction manual.
The conversion of the nucleotide sequence of DNA can be performed by PCR or a known kit such as Mutan ^™ -super Express K.
m (Takara Shuzo Co., Ltd.), Mutan ^™ -K (Takara Shuzo Co., Ltd.), etc., and ODA-LA PCR method, Ga
It can be carried out according to a method known per se such as the pped duplex method, the Kunkel method or a method similar thereto. The cloned DNA encoding the apelin receptor can be used as it is, or if desired after digestion with a restriction enzyme or addition of a linker, depending on the purpose. The DNA may have ATG as a translation initiation codon at the 5'-terminal side and TAA, TGA or TAG as a translation termination codon at the 3'-terminal side. These translation initiation codon and translation termination codon can be added using an appropriate synthetic DNA adaptor. The expression vector of the apelin receptor of the present invention is, for example,
(A) A DNA fragment of interest can be excised from the DNA encoding the apelin receptor of the present invention, and (b) the DNA fragment can be ligated downstream of the promoter in an appropriate expression vector.

As a vector, a plasmid derived from E. coli (eg, pBR322, pBR325, pUC12, pBR322)
UC13), a Bacillus subtilis-derived plasmid (eg, pUB11)
0, pTP5, pC194), yeast-derived plasmid (eg, pSH19, pSH15), bacteriophage such as λ phage, retrovirus, vaccinia virus, baculovirus and other animal viruses, and p
A1-11, pXT1, pRc / CMV, pRc / RS
V, pcDNAI / Neo, etc. are used. The promoter used in the present invention may be any promoter as long as it is suitable for the host used for gene expression. For example, when an animal cell is used as a host, SRα promoter, SV40 promoter, L promoter
TR promoter, CMV promoter, HSV-TK
Examples include promoters. Of these, CMV
It is preferable to use a promoter, SRα promoter, or the like. When the host is Escherichia, trp
Promoter, lac promoter, recA promoter, λP _L promoter, lpp promoter, etc., when the host is Bacillus, SPO1 promoter, SPO2 promoter, penP promoter, etc. When the host is yeast, PHO5 promoter, PGK promoter , GAP promoter, ADH
A promoter and the like are preferable. When the host is an insect cell, polyhedrin promoter, P10 promoter and the like are preferable.

In addition to the above, the expression vector may optionally contain an enhancer, a splicing signal, a poly A addition signal, a selection marker, an SV40 replication origin (hereinafter sometimes abbreviated as SV40 ori) and the like. Can be used. Examples of selection markers include dihydrofolate reductase (hereinafter, dhfr).
The gene [methotrexate (M
TX) resistance], ampicillin resistance gene (hereinafter referred to as Amp
^r ), neomycin resistance gene (hereinafter sometimes abbreviated as Neo ^r , G418 resistance), and the like. In particular, when the dhfr gene is used as a selection marker using CHO (dhfr ⁻ ) cells, the target gene can be selected by a thymidine-free medium. If necessary, a signal sequence suitable for the host is added to the N-terminal side of the receptor protein of the present invention. If the host is Escherichia, PhoA
When the host is a genus Bacillus, the signal sequence, OmpA, signal sequence and the like are α-amylase signal sequence and subtilisin signal sequence, and when the host is yeast, MFα, signal sequence and SUC2. When the host is an animal cell such as a signal sequence, an insulin signal sequence, an α-interferon signal sequence, an antibody molecule / signal sequence, etc. can be used, respectively. Using the vector containing the DNA encoding the apelin receptor of the present invention thus constructed,
A transformant can be produced.

As the host, for example, Escherichia, Bacillus, yeast, insect cells, insects, animal cells and the like are used. Specific examples of Escherichia bacteria include:
Escherichia coli K12 ・ DH
1 [Proc. Natl. Acad. Sci. USA], Volume 60, 160
(1968)], JM103 [Nukuirek Acids.
Research (Nucleic Acids Research), Volume 9, 309
(1981)], JA221 [Journal of Molecular Biolog (Journal of Molecular Biolog
y), 120, 517 (1978)], HB101 [Journal of Molecular Biology, 41.
, 459 (1969)], C600 [Genetics, 39, 440 (1954)] and the like. Examples of the bacterium of the genus Bacillus include Bacillus subtilis MI114 [gene,
24, 255 (1983)], 207-21 [Journal of Biochemis
try), Vol. 95, 87 (1984)] and the like are used.
Examples of the yeast include Saccharomyces cerevisiae AH22 and AH22.
^{R -, NA87-11A, DKD-5D} , 20B-1
2. Schizosaccharomys pombe
ces pombe) NCYC1913, NCYC2036, Pichia pastoris and the like are used.

Examples of insect cells include virus A
In the case of cNPV, larvae of the night-thief moth (Spodop
tera frugiperda cell; Sf cell), Trichoplusia ni
MG1 cells from the midgut of the mouse, H from the eggs of Trichoplusia ni
igh Five ^™ cells, cells derived from Mamestra brassicae or cells derived from Estigmena acrea are used. When the virus is BmNPV, the silkworm-derived cell line (Bombyx
mori N; BmN cells) and the like are used. Examples of the Sf cells include Sf9 cells (ATCC CRL1711), Sf
21 cells (above Vaughn, JL et al., In Vivo
ivo), 13, 213-217, (1977)) is used. Examples of insects include silkworm larvae [Maeda et al., Nature, 315, 592 (198).
5)]. Animal cells include, for example, monkey cells COS-
7, Vero, Chinese hamster cell CHO (hereinafter, abbreviated as CHO cell), dhfr gene-deficient Chinese hamster cell CHO (hereinafter, CHO (dhf
r ⁻ ) cell), mouse L cell, mouse AtT-2
0, mouse myeloma cells, rat GH3, human FL cells and the like are used.

To transform Escherichia, for example, Proc. Natl. Acad. Sci. USA, Vol. 69. , 2110
(1972) and Gene, Volume 17, 107 (19).
82) and the like.
Transformations of Bacillus include, for example, Molecular and General Genetics (Molecula).
r & General Genetics), 168, 111 (197)
It can be performed according to the method described in 9). For transforming yeast, for example, Methods in Enzymology, 194,
182-187 (1991), Procedures of the National Academy of Sciences of the USA (Proc. Natl. Acad.
SA), Vol. 75, 1929 (1978) and the like. For transforming insect cells or insects, for example, bio / technology (Bio /
Technology), 6, 47-55 (1988) and the like. To transform animal cells,
For example, Cell Engineering Separate Volume 8 New Cell Engineering Experimental Protocol.
263-267 (1995) (published by Shujunsha), Virology, 52, 456 (1973). Thus, a transformant transformed with the expression vector containing the DNA encoding the apelin receptor is obtained. When the host is culturing a transformant which is a bacterium of the genus Escherichia, a bacterium of the genus Bacillus, a liquid medium is suitable as a medium used for the culture, and among them, a carbon source necessary for the growth of the transformant,
A nitrogen source, an inorganic substance, etc. are contained. As the carbon source, for example, glucose, dextrin, soluble starch, sucrose, etc., as the nitrogen source, for example, ammonium salts, nitrates, corn steep liquor, peptone, casein, meat extract, soybean meal, potato extract, etc. Examples of the inorganic or organic substance and the inorganic substance include calcium chloride, sodium dihydrogen phosphate, magnesium chloride and the like. In addition, yeast extract, vitamins, growth promoting factor and the like may be added. The pH of the medium is preferably about 5-8.

As a medium for culturing Escherichia, for example, M9 medium containing glucose and casamino acid [Miller, Journal of Experiments in Molecular Genetics (Journa
l of Experiments in Molecular Genetics), 431-
433, Cold Spring Harbor Laboratory, New York1
972] is preferable. In order to make the promoter work efficiently if necessary, for example, 3β-indolyl is used.
A drug such as acrylic acid can be added. When the host is a bacterium belonging to the genus Escherichia, the culture is usually carried out at about 15 to 43 ° C. for about 3 to 24 hours, and if necessary, aeration and stirring can be added. When the host is a bacterium of the genus Bacillus, the culture is usually carried out at about 30 to 40 ° C. for about 6 to 24 hours, and aeration and stirring can be added if necessary. When culturing a transformant whose host is yeast, examples of the medium include Burkholder's minimum medium [Bostian, KL
Et al., Proc. Natl. Acad. Sci. USA, 77, 4505. Proc. Of the National Academy of Sciences of the USA.
(1980)] and SD medium containing 0.5% casamino acid [Bitter, GA et al., Procedures of the National Academy of Sciences of
The USA (Proc. Natl. Acad. Sci. USA), 8
1, 5330 (1984)]. P of medium
H is preferably adjusted to about 5-8. Culture is usually about 2
It is carried out at 0 ° C to 35 ° C for about 24 to 72 hours, and aeration and stirring are added if necessary.

When culturing a transformant whose host is an insect cell or an insect, the medium is Grace's Insect Mediu.
m (Grace, TCC, Nature, 195, 788 (1
962)) to which an additive such as immobilized 10% bovine serum is appropriately added is used. The pH of the medium is about 6.2
It is preferably adjusted to 6.4. Culturing is usually performed at about 27 ° C. for about 3 to 5 days, and aeration and agitation are added if necessary. When culturing a transformant whose host is an animal cell, the medium is, for example, MEM medium containing about 5 to 20% fetal bovine serum [Science, Volume 122, 50].
1 (1952)], DMEM medium [Virolo
gy), Volume 8, 396 (1959)], RPMI 1640
Medium (The Journal of the American Me
dical Association) Volume 199, 519 (1967)],
199 medium [Proceedi of the Society for the Biological Medicine (Proceedi
ng of the Society for the Biological Medicine), 7
3 volume, 1 (1950)] and the like are used. pH is about 6
It is preferably 8. Culturing is usually performed at about 30 ° C to 40 ° C for about 15 to 60 hours, and aeration and agitation are added if necessary. As described above, the apelin receptor of the present invention can be produced inside the transformant cell, on the cell membrane or outside the cell.

Separation and purification of the apelin receptor of the present invention from the above culture can be performed, for example, by the following method. When the apelin receptor of the present invention is extracted from cultured bacterial cells or cells, after the culture, the bacterial cells or cells are collected by a known method, suspended in an appropriate buffer solution, and then subjected to ultrasonic wave, lysozyme and / or freezing. A method of obtaining a crude extract of apelin receptor by disrupting cells or cells by thawing and then centrifuging or filtering is appropriately used. The buffer solution may contain a protein denaturing agent such as urea or guanidine hydrochloride, or a surfactant such as Triton X-100 ^™ . When the apelin receptor is secreted into the culture medium, after the completion of the culture, the cells or cells are separated from the supernatant by a method known per se, and the supernatant is collected. Purification of the apelin receptor contained in the thus obtained culture supernatant or the extract can be carried out by appropriately combining separation / purification methods known per se. As the known separation and purification methods thereof, a method utilizing solubility such as salting out or solvent precipitation method, a dialysis method, an ultrafiltration method, a gel filtration method, and an SDS-polyacrylamide gel electrophoresis method are mainly used. Difference, charge difference such as ion exchange chromatography, specific relevance such as affinity chromatography, hydrophobicity difference such as reversed-phase high performance liquid chromatography And a method of utilizing a difference in isoelectric points such as an isoelectric focusing method.

When the apelin receptor thus obtained is obtained as a free form, it can be converted into a salt by a method known per se or a method analogous thereto, and conversely when it is obtained as a salt, it is known per se. The free form or other salt can be converted by a method or a method analogous thereto. The recombinantly produced apelin receptor may be optionally modified or partially removed by reacting it with an appropriate protein-modifying enzyme before or after purification. Examples of the protein-modifying enzyme include trypsin, chymotrypsin, arginyl endopeptidase, protein kinase, glycosidase and the like. The activity of the thus-produced apelin receptor of the present invention can be measured by a binding experiment with a labeled ligand, an enzyme immunoassay using a specific antibody, or the like.

The apelin used in the present invention is specifically a peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 3 or a partial peptide thereof, SEQ ID NO: 5. Partial peptide of the precursor containing the same or substantially the same amino acid sequence as the amino acid sequence represented, of the precursor containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 7 Partial peptide, precursor partial peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 9,
Alternatively, a peptide containing a partial peptide of a precursor containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 11 and the like can be mentioned.

As apelin, any tissue (eg, pituitary, pancreas, brain, kidney, liver, gonad, thyroid gland) of human or warm-blooded animal (eg, guinea pig, rat, mouse, pig, sheep, cow, monkey, etc.) is used. , Gallbladder, bone marrow,
Peptide derived from adrenal gland, skin, muscle, lung, gastrointestinal tract, blood vessel, heart, etc., or SEQ ID NO: 3
Any peptide may be used as long as it contains the same or substantially the same amino acid sequence as the amino acid sequence represented by, and specifically, the same or substantially the same amino acid sequence as represented by SEQ ID NO: 3. A peptide containing the same amino acid sequence or a partial peptide thereof, a partial peptide of a precursor containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 5, represented by SEQ ID NO: 7 A partial peptide of a precursor containing the same or substantially the same amino acid sequence as the amino acid sequence, a partial peptide of the precursor containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 9. Or SEQ ID NO: 31
Any one may be used as long as it contains a precursor partial peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by. For example, as the apelin of the present invention, in addition to a peptide containing the amino acid sequence represented by SEQ ID NO: 3, the amino acid sequence represented by SEQ ID NO: 3 is about 50 to 99.9% (preferably 70 to 99.9%).
A peptide containing an amino acid sequence having a homology of 99.9%, more preferably 80 to 99.9%, further preferably 90 to 99.9%, and containing the amino acid sequence represented by SEQ ID NO: 3. Peptide having substantially the same activity, peptide having substantially the same activity as the partial peptide of the precursor represented by SEQ ID NO: 5, the same as or substantially the same as the amino acid sequence represented by SEQ ID NO: 7 Peptide having substantially the same activity as the partial peptide of the precursor containing the same amino acid sequence, SEQ ID NO: 9
Or a peptide having substantially the same activity as the partial peptide of the precursor containing the same or substantially the same amino acid sequence as that of SEQ ID NO: 11
And a peptide having substantially the same activity as the precursor partial peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by. Examples of substantially the same activity include receptor binding activity and signal transduction activity. "Substantially the same quality" means that the receptor binding activity and the like are qualitatively the same. Therefore, strength and weakness such as strength of receptor binding activity and quantitative factors such as molecular weight of peptide may be different.

Specifically as the apelin, SEQ ID NO:
The amino acid sequence represented by 3 or a partial sequence thereof,
Partial sequence of amino acid sequence represented by SEQ ID NO: 5, Partial sequence of amino acid sequence represented by SEQ ID NO: 7, Partial sequence of amino acid sequence represented by SEQ ID NO: 9, represented by SEQ ID NO: 11 Mouse brain, rat brain, which contains an amino acid sequence represented by a partial sequence of the amino acid sequence, etc.
Examples include peptides derived from pig brain, pig small intestine, bovine hypothalamus, bovine stomach, human hypothalamus or human lung. Furthermore, in the amino acid sequence represented by SEQ ID NO: 3 or a partial sequence thereof, the partial sequence of the amino acid sequence represented by SEQ ID NO: 5, the partial sequence of the amino acid sequence represented by SEQ ID NO: 7, and the SEQ ID NO: 9. A partial sequence of the amino acid sequence represented, or a peptide containing the same or substantially the same amino acid sequence as the partial sequence of the amino acid sequence represented by SEQ ID NO: 11, or one or more of the partial peptides Peptides containing an amino acid sequence in which amino acids are substituted, deleted, added or inserted are included as peptides containing substantially the same amino acid sequence. For example, with the amino acid sequence represented by SEQ ID NO: 3 or a partial sequence thereof, the partial sequence of the amino acid sequence represented by SEQ ID NO: 5, the partial sequence of the amino acid sequence represented by SEQ ID NO: 7, and the SEQ ID NO: 9. Partial sequence of the amino acid sequence represented, or 1 to 7 in the partial sequence of the amino acid sequence represented by SEQ ID NO: 11,
An amino acid sequence in which 1 or more and 5 or less, more preferably 1 or more and 3 or less amino acids are deleted, the amino acid sequence represented by SEQ ID NO: 3 or a partial sequence thereof,
A partial sequence of the amino acid sequence represented by SEQ ID NO: 5,
1 to 20 in the partial sequence of the amino acid sequence represented by SEQ ID NO: 7, the partial sequence of the amino acid sequence represented by SEQ ID NO: 9, or the partial sequence of the amino acid sequence represented by SEQ ID NO: 11. Preferably 1 or more and 15 or less,
More preferably, an amino acid sequence in which 1 or more and 10 or less amino acids are added (or inserted), SEQ ID NO: 3
Of the amino acid sequence represented by or a partial sequence thereof, the partial sequence of the amino acid sequence represented by SEQ ID NO: 5, the partial sequence of the amino acid sequence represented by SEQ ID NO: 7, the amino acid sequence represented by SEQ ID NO: 9. Partial sequence or 1 in the partial sequence of the amino acid sequence represented by SEQ ID NO: 11
Peptides containing an amino acid sequence in which 1 or more and 7 or less, preferably 1 or more and 5 or less, more preferably 1 or more and 3 or less amino acids are substituted with other amino acids, and the like.

Further, apelin or its partial peptide also includes those in which the N-terminal side of Gln is cleaved in vivo and the Gln is oxidized with pyroglutamine. The precursor of apelin may be any protein as long as it is a protein containing apelin as its partial sequence, and specifically, it contains the amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11. And the like (hereinafter, the apelin and the precursor may be collectively referred to as apelin). The molecular weight of apelin is about 1000 to 1000.
It is 0 dalton, preferably about 1000 to about 5000 daltons, more preferably about 1000 to about 3000 daltons. In the peptide in the present specification, the left end is the N-terminal (amino terminal) and the right end is the C-terminal (carboxyl terminal) according to the convention of peptide notation. The amino acid sequence represented by SEQ ID NO: 3 or a partial sequence thereof, SEQ ID NO: 5
The partial sequence of the amino acid sequence represented by, the partial sequence of the amino acid sequence represented by SEQ ID NO: 7, the partial sequence of the amino acid sequence represented by SEQ ID NO: 9, or SEQ ID NO: 1.
Peptide C-terminal containing such partial sequence of the amino acid sequence represented by the normal carboxyl group (-COOH) or carboxylate (-COO ^-) is a, C-terminal, an amide (-CONH ₂₎ or an ester ( -COOR). Examples of R of the ester include C _1-6 such as methyl, ethyl, n-propyl, isopropyl or n-butyl.
C such as alkyl group, cyclopentyl and cyclohexyl
_3-8 cycloalkyl group, C _6-12 aryl group such as phenyl and α-naphthyl, phenyl-C _1-2 alkyl such as benzyl, phenethyl and benzhydryl, or α-naphthyl-C ₁ -such as α-naphthylmethyl. _In addition to C _7-14 aralkyl groups such as _2- alkyl, pivaloyloxymethyl ester widely used as an oral ester can be mentioned. Amino acid sequence represented by SEQ ID NO: 3 or a partial sequence thereof, partial sequence of amino acid sequence represented by SEQ ID NO: 5, partial sequence of amino acid sequence represented by SEQ ID NO: 7, represented by SEQ ID NO: 9 When a peptide containing a partial sequence of the amino acid sequence represented by SEQ ID NO: 11, or a partial sequence of the amino acid sequence represented by SEQ ID NO: 11 has a carboxyl group or a carboxylate other than at the C-terminal, those groups are amidated or Those which are esterified are also included in the peptides of the present invention. As the ester at this time, for example, the above-mentioned C-terminal ester or the like is used. As the salt of apelin, salts with physiologically acceptable bases (for example, alkali metals etc.) and acids (organic acids, inorganic acids) are used, and physiologically acceptable acid addition salts are particularly preferable. Examples of such salts include salts with inorganic acids (for example, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid), or organic acids (for example, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid,
Salts such as tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) are used.

Apelin can be produced by a method of purifying peptides from tissues or cells of humans or warm-blooded animals, or can be produced according to the peptide synthesis method described below. In addition, DN coding for apelin described below
It can also be produced by culturing a transformant containing A. When producing from tissues or cells of humans or warm-blooded animals, after homogenizing tissues or cells of humans or warm-blooded animals, extraction with acid etc. is performed, and the extract is
Purification and isolation can be performed by combining chromatography such as salting out, dialysis, gel filtration, reverse phase chromatography, ion exchange chromatography, affinity chromatography and the like.

As described above, apelin can be produced according to a method known per se for peptide synthesis, or by cleaving a precursor containing apelin with an appropriate peptidase. The peptide synthesis method may be either a solid phase synthesis method or a liquid phase synthesis method. That is, the target peptide can be produced by condensing a partial peptide or amino acid capable of forming apelin with the remaining portion and removing the protecting group when the product has a protecting group. Examples of known condensation methods and elimination of protective groups include the methods described in the following (1) to (3). M. Bodanszky and MA Ondetti, Peptide Synthesis, Interscience Publisher
s, New York (1966) Schroeder and Luebke, The Peptide,
Academic Press, New York (1965) Nobuo Izumiya et al., Fundamentals and experiments of peptide synthesis, Maruzen Co., Ltd.
(1975) Haruaki Yajima and Shunpei Sakakibara, Laboratory of Biochemistry 1, Protein Chemistry IV, 205, (1977) Supervised by Haruaki Yajima, Development of Pharmaceuticals Volume 14 Peptide Synthesis Hirokawa Shoten The peptide of the present invention can be purified and isolated by a combination of purification methods such as solvent extraction, distillation, column chromatography, liquid chromatography, recrystallization and the like. When the apelin obtained by the above method is a free form, it can be converted into a suitable salt by a known method, and conversely, when it is obtained with a salt, it can be converted into a free form by a known method. it can.

As the amide form of apelin, a commercially available resin for peptide synthesis suitable for amide formation can be used. Examples of such resin include chloromethyl resin, hydroxymethyl resin, benzhydrylamine resin, aminomethyl resin, 4-benzyloxybenzyl alcohol resin, 4-methylbenzhydrylamine resin, PAM resin,
4-hydroxymethylmethylphenylacetamidomethyl resin, polyacrylamide resin, 4- (2 ′, 4′-dimethoxyphenyl-hydroxymethyl) phenoxy resin,
4- (2 ', 4'-dimethoxyphenyl-Fmoc aminoethyl) phenoxy resin etc. can be mentioned. Using such a resin, an amino acid having an α-amino group and a side chain functional group appropriately protected, according to the sequence of the target peptide,
The condensation is performed on the resin according to various condensation methods known per se.
At the end of the reaction, the peptide is cleaved from the resin and at the same time various protective groups are removed, and if necessary, an intramolecular disulfide bond forming reaction is carried out in a highly diluted solution to obtain the target peptide. Regarding the above-mentioned condensation of protected amino acids, various activating reagents that can be used for peptide synthesis can be used, but carbodiimides are particularly preferable. Carbodiimides include DCC, N, N'-diisopropylcarbodiimide, N-ethyl-N '-(3-dimethylaminopropyl)
Carbodiimide etc. are mentioned. For activation by these, the protected amino acid is added directly to the resin with a racemization inhibitor additive (e.g., HOBt, HOOBt, etc.) or the amino acid previously protected as a symmetrical acid anhydride or HOBt ester or HOOBt ester is It can be added to the resin after activation. The solvent used for activation of the protected amino acid or condensation with the resin can be appropriately selected from solvents known to be usable for peptide condensation reaction. For example, N, N-dimethylformamide, N, N-dimethylacetamide, N-
Acid amides such as methylpyrrolidone, halogenated hydrocarbons such as methylene chloride and chloroform, alcohols such as trifluoroethanol, sulfoxides such as dimethyl sulfoxide, tertiary amines such as pyridine,
Ethers such as dioxane and tetrahydrofuran, nitriles such as acetonitrile and propionitrile, esters such as methyl acetate and ethyl acetate, and appropriate mixtures thereof are used. The reaction temperature is appropriately selected from the range known to be applicable to peptide bond-forming reactions, and is usually selected in the range of approximately -20 ° C to 50 ° C. The activated amino acid derivative is usually 1.
Used in 5- to 4-fold excess. As a result of the test using the ninhydrin reaction, when the condensation is insufficient, sufficient condensation can be performed by repeating the condensation reaction without removing the protecting group. When sufficient condensation cannot be obtained even after repeating the reaction, the unreacted amino acid can be acetylated with acetic anhydride or acetylimidazole so as not to affect the subsequent reaction.

Examples of the protecting group for the amino group of the starting amino acid include Z, Boc, tertiary pentyloxycarbonyl, isobornyloxycarbonyl, 4-methoxybenzyloxycarbonyl, Cl-Z, Br-Z, adamantyloxycarbonyl. , Trifluoroacetyl, phthaloyl, formyl, 2-nitrophenylsulfenyl, diphenylphosphinothioyl oil, Fmoc and the like.
Examples of the protective group for the carboxyl group include 2-adamantyl, as well as C _1-6 alkyl group, C _3-8 cycloalkyl group, C _7-14 aralkyl group described above as R,
4-nitrobenzyl, 4-methoxybenzyl, 4-chlorobenzyl, phenacyl group and benzyloxycarbonyl hydrazide, tertiary butoxycarbonyl hydrazide, trityl hydrazide and the like can be mentioned. The hydroxyl groups of serine and threonine can be protected by, for example, esterification or etherification. Examples of groups suitable for this esterification include lower alkanoyl groups such as acetyl group, aroyl groups such as benzoyl group, groups derived from carbon such as benzyloxycarbonyl group and ethoxycarbonyl group. Examples of the group suitable for etherification include a benzyl group, a tetrahydropyranyl group and a tert-butyl group.
Examples of the protective group for the phenolic hydroxyl group of tyrosine include Bzl, Cl ₂ -Bzl, 2-nitrobenzyl, Br-Z, tertiary butyl and the like. Examples of the protecting group for imidazole of histidine include Tos, 4-methoxy-2,3,6-trimethylbenzenesulfonyl, DNP, benzyloxymethyl, Bum, Boc, Trt, Fmoc and the like. Examples of the activated carboxyl group of the raw material include corresponding acid anhydrides, azides, active esters [alcohols (for example, pentachlorophenol, 2,4,5-trichlorophenol, 2,4-dinitrophenol, cyano Methyl alcohol, para-nitrophenol, HONB, N-hydroxysuccinimide, N-hydroxyphthalimide, ester with HOBt)] and the like. The activated amino group of the raw material includes, for example, the corresponding phosphoric acid amide.

As the method for removing (eliminating) the protecting group, for example, catalytic reduction in a hydrogen stream in the presence of a catalyst such as Pd black or Pd carbon, or anhydrous hydrogen fluoride, methanesulfonic acid or trifluoride is used. Acid treatment with methanesulfonic acid, trifluoroacetic acid, or a mixture thereof, base treatment with diisopropylethylamine, triethylamine, piperidine, piperazine, etc., reduction with sodium in liquid ammonia, and the like are also included. The elimination reaction by the acid treatment is generally carried out at a temperature of -20 ° C to 40 ° C, but in the acid treatment, anisole, phenol, thioanisole, metacresol, paracresol, dimethyl sulfide, 1,4-butanedithiol, 1 , 2-
It is effective to add a cation trapping agent such as ethanedithiol. Also, the 2,4-dinitrophenyl group used as the imidazole protecting group of histidine is removed by thiophenol treatment, and the formyl group used as the indole protecting group of tryptophan is the above 1,2-ethanedithiol, 1,4-butane group. In addition to deprotection by acid treatment in the presence of dithiol or the like, it is also removed by alkali treatment with dilute sodium hydroxide or dilute ammonia. Protection of a functional group which should not be involved in the reaction of the raw material, protection of the protective group, elimination of the protective group, activation of the functional group involved in the reaction and the like can be appropriately selected from known groups or known means. As another method for obtaining the amide form of apelin, first, after amidating the α-carboxyl group of the carboxyl terminal amino acid, the peptide chain is extended to the amino group side to the desired chain length, and then the N-terminal of the peptide chain And a peptide (or amino acid) from which only the protecting group for the C-terminal carboxyl group has been removed, and both peptides are condensed in the mixed solvent as described above. . The details of the condensation reaction are the same as above. After purifying the protected peptide obtained by condensation,
All the protecting groups can be removed by the above method to obtain the desired crude peptide. This crude peptide can be purified by making full use of various known purification means, and the main fraction can be lyophilized to obtain the amide form of the desired peptide. In order to obtain an ester form of apelin, the α-carboxyl group of a carboxy terminal amino acid is condensed with a desired alcohol to form an amino acid ester, and then the desired ester form of apelin can be obtained in the same manner as the amide form of the peptide.

As apelin, the above-mentioned SEQ ID NO:
3. The amino acid sequence represented by 3, or a partial sequence thereof, the partial sequence of the amino acid sequence represented by SEQ ID NO: 5, the partial sequence of the amino acid sequence represented by SEQ ID NO: 7, the amino acid sequence represented by SEQ ID NO: 9. Or a partial sequence of the amino acid sequence represented by SEQ ID NO: 11 and the like (eg, adrenocorticotropic hormone secretory regulatory action, oxytocin secretion) Any peptide may be used as long as it has a regulatory action). Examples of such a peptide include the amino acid sequence represented by SEQ ID NO: 3 or a partial sequence thereof,
A partial sequence of the amino acid sequence represented by SEQ ID NO: 5,
One or more from a peptide having a partial sequence of the amino acid sequence represented by SEQ ID NO: 7, a partial sequence of the amino acid sequence represented by SEQ ID NO: 9, or a partial sequence of the amino acid sequence represented by SEQ ID NO: 11 A peptide having an amino acid sequence in which the amino acid of is deleted.
Specifically, (1) a peptide having the 1st to 12th amino acid sequences of the amino acid sequence represented by SEQ ID NO: 3, (2) the first of the amino acid sequences represented by SEQ ID NO: 3
A peptide having the thirteenth to thirteenth amino acid sequence,
(3) A peptide having the 1st to 14th amino acid sequence of the amino acid sequence represented by SEQ ID NO: 3, (4) 1st to 1st of the amino acid sequence represented by SEQ ID NO: 3
A peptide having the 5th amino acid sequence, (5) a peptide having the 1st to 16th amino acid sequences of the amino acid sequence represented by SEQ ID NO: 3, (6) SEQ ID NO:
Peptides having a partial sequence of the amino acid sequence represented by 5, 7, 9 or 11 are preferable. Of these, peptides having a partial sequence of the amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11 are preferable.

Further, as a peptide having a partial sequence of the amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11, (a) SEQ ID NO: 5, 7, 9 or 11
A peptide having the 6th to 77th amino acid sequences of the amino acid sequence represented by: (b) SEQ ID NO: 5,
A peptide having the 40th to 77th amino acid sequences of the amino acid sequence represented by 7, 9 or 11;
(C) a peptide having an amino acid sequence from the 42nd position to the 77th position in the amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11, (d) SEQ ID NO: 5, 7, 9 or 1
A peptide having the 47th to 77th amino acid sequence of the amino acid sequence represented by 1, (e) SEQ ID NO:
The 61st of the amino acid sequence represented by 5, 7, 9 or 11
A peptide having the amino acid sequence from the 77th to the 77th,
(F) A peptide having the 65th to 77th amino acid sequence of the amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11 or its N-terminal amino acid (Gln)
Which was oxidized with pyroglutamine, (g) SEQ ID NO: 5,
A peptide having the 1st to 25th amino acid sequences of the amino acid sequence represented by 7, 9 or 11 (h)
A peptide having the 6th to 25th amino acid sequences of the amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11, (i) the amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11 A peptide having the 42nd to 64th amino acid sequence of (b), (j) SEQ ID NO: 5, 7, 9
Or a peptide having the 61st to 64th amino acid sequence of the amino acid sequence represented by 11, and (k) the 43rd to 77th amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11. A peptide having the amino acid sequence of (1), a peptide having the 41st to 77th amino acid sequence of the amino acid sequence represented by SEQ ID NOs: 5, 7, 9 or 11, (m) the SEQ ID NOs: 5, 7 66th to 7th of the amino acid sequence represented by 9 or 11
Peptide having the 7th amino acid sequence, (n) Peptide having the 67th to 77th amino acid sequence of the amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11, (o) SEQ ID NO: 5 , A peptide having the 64th to 77th amino acid sequence of the amino acid sequence represented by 7, 9 or 11, (p) the 63rd amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11 From 77th
A peptide having the amino acid sequence of the third position, (q) a peptide having the amino acid sequence of the 65th to the 76th position in the amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11, (r) the SEQ ID NO: 5, Peptides having the 65th to 75th amino acid sequences of the amino acid sequence represented by 7, 9 or 11 are mentioned, among which the amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11 A peptide having the 65th to 77th amino acid sequence, or an amino acid (Gln) at the N-terminal thereof that has been pyroglutamine-oxidized or SEQ ID NO: 5, 7, 9 or 1
A peptide having the 42nd to 77th amino acid sequences of the amino acid sequence represented by 1 is preferably used. In particular, the peptide represented by the 65th to 77th amino acid sequence of the amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11 or the N-terminal amino acid (Gln) thereof is pyroglutamine-oxidized (pGlu Arg P
ro Arg Leu Ser His Lys Gly Pro Met Pro Phe) is preferred. In addition pGlu Arg Pro Arg Leu Ser His Lys Gly P
A peptide having a partial amino acid sequence of the amino acid sequence represented by ro Met Pro Phe is also preferably used as apelin.

The partial peptide of apelin can be further used as an antigen for preparing an anti-apelin antibody.
In addition to the above-mentioned apelin, partial peptides such as N-terminal peptide, C-terminal peptide and central peptide of the above-mentioned apelin are used as the peptide as such an antigen. As the partial peptide, a peptide containing individual domains may be used, but a partial peptide containing a plurality of domains at the same time may be used. The partial peptide in the present specification also has an amide (-CONH ₂ ) or ester (-CO at the C-terminal).
OR). Here, examples of the ester group are the same as those in the above-mentioned peptide. When the partial peptide has a carboxyl group or a carboxylate in addition to the C-terminal, those having an amidated or esterified group are also included in the partial peptide of the present invention.
As the ester at this time, for example, the above-mentioned C-terminal ester is used. Apelin or its partial peptide may be a fusion protein with a protein whose function or property is well known. As the salt of the partial peptide of apelin, the same salts as the above-mentioned salts of apelin are used. The partial peptide of apelin or its amide, ester or salt thereof can be produced according to the same synthetic method as in the case of the above-mentioned apelin or by cleaving apelin with an appropriate peptidase.

As the DNA encoding apelin, specifically, the amino acid sequence represented by SEQ ID NO: 3 or a partial sequence thereof, the partial sequence of the amino acid sequence represented by SEQ ID NO: 5, and SEQ ID NO: The same as or substantially the same as the partial sequence of the amino acid sequence represented by 7, the partial sequence of the amino acid sequence represented by SEQ ID NO: 9, or the partial sequence of the amino acid sequence represented by SEQ ID NO: 11. Any DNA can be used as long as it contains a DNA encoding an apelin containing the same amino acid sequence. Also, genomic DNA, genome D
NA library, tissue- or cell-derived cDNA described above
A, the above-mentioned tissue / cell-derived cDNA library,
Any of synthetic DNA may be used. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. In addition, reverse Transcriptase Polymerase Chain React was directly performed using the RNA fraction prepared from the tissues and cells described above.
It can also be amplified by ion (hereinafter, abbreviated as RT-PCR method).

More specifically, the amino acid sequence represented by SEQ ID NO: 3 or a partial sequence thereof, SEQ ID NO: 5
The partial sequence of the amino acid sequence represented by, the partial sequence of the amino acid sequence represented by SEQ ID NO: 7, the partial sequence of the amino acid sequence represented by SEQ ID NO: 9, or SEQ ID NO: 1.
D encoding a polypeptide derived from mouse whole brain, rat whole brain, bovine hypothalamus, bovine stomach, human hypothalamus or human lung containing a partial sequence of the amino acid sequence represented by 1
As NA, (1) the base sequence represented by SEQ ID NO: 4 or a partial sequence thereof, the partial sequence of the base sequence represented by SEQ ID NO: 6, the partial sequence of the base sequence represented by SEQ ID NO: 8, the sequence DNA containing a partial sequence of the nucleotide sequence represented by No. 10 or a partial sequence of the nucleotide sequence represented by SEQ ID NO: 12, (2) defined under (1) under stringent conditions Derived from a mammal, which hybridizes with the above sequence, (3) due to the degeneracy of the genetic code, does not hybridize with the sequence defined in (1) and (2), but encodes a polypeptide having the same amino acid sequence. DNA or the like is used. Hybridization can be performed according to a method known per se or a method analogous thereto. The stringent conditions are, for example, 42 ° C., 50% formamide, 4
× SSPE (1 × SSPE = 150 mM NaCl, 10 mM NaH ₂ PO
_{4 · H 2 O, 1mM EDTA} pH7.4), 5 × Denhardt's solution, zero.
It is 1% SDS. In the base sequence represented by SEQ ID NO: 4, Y is T or C, N is T, C, A or G, R is A or G, M is C or A, W is T or A And S represents C or G. Also, SEQ ID NO:
3. The amino acid sequence represented by 3, or a partial sequence thereof, the partial sequence of the amino acid sequence represented by SEQ ID NO: 5, the partial sequence of the amino acid sequence represented by SEQ ID NO: 7, the amino acid sequence represented by SEQ ID NO: 9. Of the DNA encoding a polypeptide containing the partial sequence of SEQ ID NO: 11 or the partial sequence of the amino acid sequence represented by SEQ ID NO: 11,
A DNA fragment containing a partial base sequence of not less than 51 and not more than 51 (preferably not less than 9 and not more than 30, more preferably not less than 12 and not more than 30) is also preferably used as a DNA detection probe.

The DNA encoding apelin can also be produced by the following genetic engineering method. As a means for cloning a DNA that completely encodes apelin, the above DNA can be prepared by a PCR method known per se using a synthetic DNA primer having a partial base sequence of apelin.
The target DNA is amplified from a library or the like, or the DNA inserted into an appropriate vector is labeled with, for example, a DNA fragment having a partial or entire region of the polypeptide of the present invention or a synthetic DNA. It can be selected by hybridization. Hybridization methods include, for example, Molecular Cloni
ng (2nd ed .; J. Sambrook et al., Cold Spring Harbo
r Lab. Press, 1989). When a commercially available library is used, the method described in the attached instruction manual is used. Depending on the purpose, the cloned DNA encoding apelin is
Alternatively, it can be used after digestion with a restriction enzyme or addition of a linker, if desired. The DNA has ATG as a translation initiation codon at the 5'terminal side, and TAA and TG as translation termination codons at the 3'terminal side.
It may have A or TAG. These translation initiation codon and translation termination codon can be added using an appropriate synthetic DNA adaptor. An apelin expression vector can be produced, for example, by (a) cutting out a target DNA fragment from apelin-encoding DNA, and (b) ligating the DNA fragment downstream of a promoter in a suitable expression vector. it can. As the vector, a plasmid derived from E. coli (eg, pBR322, pB
R325, pUC12, pUC13), a Bacillus subtilis-derived plasmid (eg, pUB110, pTP5, pC19)
4), yeast-derived plasmid (eg, pSH19, pSH1
5), bacteriophage such as λ phage, animal virus such as retrovirus, vaccinia virus, baculovirus and the like are used. The promoter used in the present invention may be any promoter as long as it is suitable for the host used for gene expression.

When the host used for transformation is an animal cell, SV40-derived promoter, retrovirus promoter, metallothionein promoter, heat shock promoter, cytomegalovirus promoter, SRα promoter and the like can be used. When the host is Escherichia, the trp promoter,
T7 promoter, lac promoter, recA promoter, .lambda.P _L promoter, lpp promoter, etc. When the host is Bacillus, SPO1 promoter, SPO2 promoter, etc. When the host is yeast penP promoter, PHO5 promoter, PGK Promoter, GAP promoter, ADH
1 promoter, GAL promoter and the like are preferable.
When the host is an insect cell, polyhedrin promoter, P10 promoter and the like are preferable. In addition to the above, the expression vector may optionally include an enhancer, a splicing signal, a poly A addition signal, a selection marker,
Those containing an SV40 origin of replication (hereinafter sometimes abbreviated as SV40ori) and the like can be used. Examples of the selection marker include dihydrofolate reductase (hereinafter sometimes abbreviated as dhfr) gene [methotrexate (MTX) resistance], ampicillin resistance gene (hereinafter sometimes referred to as Amp ^r ),
Neomycin resistance gene (hereinafter sometimes referred to as Neo, G418 resistance) and the like can be mentioned. Especially CHO
When the DHFR gene is used as a selection marker using (dhfr ⁻ ) cells, selection can also be performed using a thymidine-free medium. If necessary, a signal sequence suitable for the host is added to the N-terminal side of the polypeptide or its partial peptide. When the host is Escherichia, the phoA signal sequence, OmpA signal sequence and the like, when the host is Bacillus α-amylase signal sequence, subtilisin signal sequence, etc., the host is yeast In some cases, the mating factor α (MFα) signal sequence, invertase signal sequence, etc. When the host is an animal cell, for example, insulin signal sequence, α-interferon signal sequence, antibody molecule, signal sequence, etc. Can be used respectively. A transformant can be produced using the vector containing the DNA encoding the polypeptide thus constructed.

As the host, for example, Escherichia, Bacillus, yeast, insects or insect cells, animal cells, etc. are used. Examples of Escherichia bacteria include Escherichia coli K12 and DH1.
[Proc. Natl. Acad. Sci. USA], Volume 60, 160
(1968)], JM103 [Nukuirek Acids.
Research (Nucleic Acids Research), Volume 9, 309
(1981)], JA221 [Journal of Molecular Biolog (Journal of Molecular Biolog
y)], Volume 120, 517 (1978)], HB101
[Journal of Molecular Biology, 4
1 volume, 459 (1969)], C600 [Genetics, 39 volume, 440 (1954)] and the like. Examples of Bacillus include Bacillus
Bacillus subtilis MI114 [Gene,
24, 255 (1983)], 207-21 [Journal of Biochemis
try), Vol. 95, 87 (1984)] and the like are used.

Examples of yeast include Saccaromyces cerevisiae AH22,
^{AH22R -, NA87-11A, DKD-5D} , 20
B-12 or the like is used. Examples of insects include silkworm larvae [Maeda et al., Nature (Natu
re), 315, 592 (1985)]. Examples of insect cells include Spodoptera frugiperda cell (Sf) when the virus is AcNPV.
Cells), MG1 cells derived from the midgut of Trichoplusia ni, Tri
High Five ^TM cells derived from choplusia ni eggs, Mamestra br
Cells derived from assicae or cells derived from Estigmena acrea are used. When the virus is BmNPV, silkworm-derived cell lines (Bombyx mori N; BmN cells) and the like are used. Examples of the Sf cells include Sf9 cells (AT
CC CRL1711), Sf21 cells [above, Vaughn, JL et al.,
In Vitro, Volume 13, 213-217
Page (1977)] and the like. Examples of animal cells include monkey COS-7 cells, Vero cells, Chinese hamster cells CHO, DHFR gene-deficient Chinese hamster cells CHO (dhfr ^- CHO cells), mouse L cells, mouse 3T3 cells, mouse myeloma cells, human HEK293 cells, Human FL cells, 29
3 cells, C127 cells, BALB3T3 cells, Sp-2
/ O cells and the like are used. To transform Escherichia, for example, the Procedures of the National Academy of Sciences of
The USA (Proc. Natl. Acad. Sci. US
A), Volume 69, 2110 (1972) and Gene,
Vol. 17, 107 (1982) and the like. To transform Bacillus, for example, Molecular & General Genetics, 168, 11
1 (1979) and the like. To transform yeast, for example, Procedures of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. U.
SA), Vol. 75, 1929 (1978).

To transform insect cells or insects,
For example, Bio / Technology, 6
Vol., Pp. 47-55 (1988) and the like. For transforming animal cells, for example, Virology, 52, 456 (197).
It is performed according to the method described in 3). Examples of the method for introducing an expression vector into cells include, for example, the lipofection method [Felgner, PL et al.
The National Academy of Sciences
Proceedings of the Natinal
Academy of Sciences of the United States of Americ
a), 84, 7413 (1987)], calcium phosphate method [Graham, FL and van der Eb, AJ Virology, 52, 456-467 (1).
973)], electroporation [Nuemann, E. et al. EMBO J., Vol. 1, pp. 841-845 (1982)] and the like. Thus, a transformant transformed with the expression vector containing the DNA encoding the polypeptide of the present invention can be obtained. As a method of stably expressing the polypeptide of the present invention using animal cells, there is a method of clonally selecting cells in which the expression vector introduced into the above-mentioned animal cells is integrated into the chromosome. Specifically, transformants are selected using the above selection marker as an index. Furthermore, by repeatedly performing clonal selection on the animal cells thus obtained using the selection marker, a stable animal cell line having a high expression ability of the polypeptide of the present invention or the like can be obtained. When the dhfr gene is used as a selection marker, the MTX concentration is gradually increased and the cells are cultured to select a resistant strain, so that the DNA encoding the polypeptide of the present invention or a partial peptide thereof can be introduced into cells together with the dhfr gene. It is also possible to obtain a highly expressed animal cell line by amplifying in-house. To produce the polypeptide or the like of the present invention by culturing the above transformant under conditions capable of expressing the DNA encoding the polypeptide or the like of the present invention, and producing and accumulating the polypeptide or the like of the present invention You can Host is Escherichia,
When culturing a transformant that is a bacterium of the genus Bacillus, a liquid medium is suitable as a medium used for the culture, and among them, a carbon source, a nitrogen source, an inorganic substance and the like necessary for the growth of the transformant are contained. It is included. Examples of carbon sources include glucose, dextrin, soluble starch, sucrose, etc.
As the nitrogen source, for example, ammonium salts, nitrates, corn steep liquor, peptone, casein, meat extract, soybean meal, potato extract and other inorganic or organic substances, as inorganic substances such as calcium chloride, sodium dihydrogen phosphate, Magnesium chloride etc. are mentioned. In addition, yeast, vitamins, growth promoting factors and the like may be added. The pH of the medium is preferably about 5-8.

As a medium for culturing Escherichia, for example, M9 medium containing glucose and casamino acid [Miller, Journal of Experiments in Molecular Genetics (Journa
l of Experiments in Molecular Genetics), 431-
433, Cold Spring Harbor Laboratory, New York 1
972] is preferable. If necessary, a drug such as 3β-indolylacrylic acid can be added to the promoter in order to work it efficiently. When the host is a bacterium of the genus Escherichia, the culture is usually performed at about 15 to 43 ° C. for about 3 to 24 hours, and if necessary, aeration and stirring can be added. When the host is a bacterium of the genus Bacillus, the culture is usually carried out at about 30 to 40 ° C. for about 6 to 24 hours, and aeration and stirring can be added if necessary. When culturing a transformant whose host is yeast, examples of the medium include Burkholder's minimum medium [Bostian, KL et al.
Procedures of the National Academy of Sciences of the USA (Pr
oc. Natl. Acad. Sci. USA), 77, 4505 (1)
980)] or an SD medium containing 0.5% casamino acid [Bi
tter, GA et al., The Procedures of the National Academy of Sciences of the
USA (Proc. Natl. Acad. Sci. USA), 8
1, 5330 (1984)]. P of medium
H is preferably adjusted to about 5-8. Culture is usually about 2
It is carried out at 0 ° C to 35 ° C for about 24 to 72 hours, and aeration and stirring are added if necessary.

When culturing a transformant whose host is an insect cell, Grace's Insect Medium (Grace,
TCC, Nature, 195, 788 (1962)) to which an additive such as immobilized 10% bovine serum is appropriately added may be used. The pH of the medium is preferably adjusted to about 6.2 to 6.4. Culturing is usually performed at about 27 ° C. for about 3 to 5 days, and aeration and agitation are added if necessary. When culturing a transformant whose host is an animal cell, the medium is, for example, MEM medium containing about 5 to 20% fetal bovine serum [Seience, Volume 122, 501 (1952)], D.
MEM medium [Virology, Volume 8, 396
(1959)], RPMI 1640 medium [Journal
The Jounal of the American Medical Association
199, 519 (1967)], 199 medium [Proceeding of the Society fo (Proceeding of the Society fo)
r the Biological Medicine), 73, 1 (195
0)] is used. The pH is preferably about 6-8. Culturing is usually carried out at about 30 ° C to 40 ° C for about 15 to 60 hours, and aeration and agitation are added if necessary. Especially CHO
When (dhfr ⁻ ) cells and the dhfr gene are used as selection markers, it is preferable to use DMEM medium containing dialyzed fetal bovine serum containing almost no thymidine.

The polypeptide of the present invention can be separated and purified from the above-mentioned culture, for example, by the following method. When the polypeptide of the present invention is extracted from cultured bacterial cells or cells, after the culture, the bacterial cells or cells are collected by a known method, suspended in an appropriate buffer, and then subjected to ultrasonic waves, lysozyme and / or freeze-thawing. After destroying the bacterial cells or cells by, for example, a method of obtaining a crude polypeptide extract by centrifugation or filtration can be appropriately used. A protein denaturing agent such as urea or guanidine hydrochloride or Triton X-100 (registered trademark; hereinafter TM
May be omitted. ) Or the like may be included. When the polypeptide is secreted into the culture medium, after the culture is completed, the bacterial cells or cells are separated from the supernatant by a method known per se, and the supernatant is collected. Purification of the polypeptide of the present invention contained in the thus obtained culture supernatant or the extract can be carried out by appropriately combining separation / purification methods known per se. As the known separation and purification methods thereof, a method utilizing solubility such as salting out or solvent precipitation method, a dialysis method, an ultrafiltration method, a gel filtration method, and an SDS-polyacrylamide gel electrophoresis method are mainly used. The difference in charge, the difference in charge such as ion exchange chromatography, the method using specific affinity such as affinity chromatography, and the difference in hydrophobicity such as reversed-phase high performance liquid chromatography Methods such as isoelectric focusing, chromatofocusing, and other methods that utilize differences in isoelectric points are used. When the polypeptide of the present invention thus obtained is obtained in a free form, it can be converted into a salt by a method known per se or a method analogous thereto, and conversely, when it is obtained as a salt, a method known per se. Alternatively, it can be converted into a free form or another salt by a method similar thereto. In addition, the polypeptide of the present invention produced by the recombinant can be optionally modified or partially removed by acting an appropriate protein-modifying enzyme before or after purification. Examples of the protein-modifying enzyme include trypsin, chymotrypsin, arginyl endopeptidase, protein kinase, glycosidase and the like. The presence of the thus-generated polypeptide of the present invention can be measured by an enzyme immunoassay using a specific antibody.

Next, the modified form of apelin will be described.
It In the present specification, an amino acid residue means an amino acid
It loses water molecules and forms peptide bonds, which allow proteins and peptides to
Other than N-terminal or C-terminal when incorporated into peptide
The structure of a part. For example, α-amino acid residue is α-
Amino acid (H_TwoNC (R⁰) (R¹) COOH: R⁰And R¹Are each
The same or different, representing any substituent)
Lost to form peptide bonds in proteins and peptides
-N at the part other than N-terminal or C-terminal when incorporated into
HC (R⁰) (R¹) Refers to the structure of CO-. On the other hand, the N-terminal amino acid
Residue is H_TwoNC (R⁰) (R¹) CO-, C-terminal amino acid residue is -NHC
(R⁰) (R ¹) COOH. In addition, β-amino acid (H_TwoNC
(R⁰) (R¹) C (R²) (R³) COOH: R⁰, R¹, R²And R³Haso
Each is the same or different and represents an arbitrary substituent) is water
Losing molecules to form peptide bonds,
Portion other than N-terminal or C-terminal when incorporated into
-NHC (R⁰) (R¹) C (R²) (R³) Refers to the structure of CO-. On the other hand, N end
The amino acid residue at the end is H_TwoNC (R⁰) (R¹) C (R²) (R³) CO-, C end
The terminal amino acid residue is -NHC (R⁰) (R¹) C (R²) (R³) Indicated by COOH
Be done. In addition, γ-amino acid (H_TwoNC (R⁰) (R¹) C (R²) (R³) C
(R^Four) (R^Five) COOH: R⁰, R¹, R², R³, R^FourAnd R⁵Haso
Each is the same or different and represents an arbitrary substituent) is water
Losing molecules to form peptide bonds,
Portion other than N-terminal or C-terminal when incorporated into
-NHC (R⁰) (R¹) C (R²) (R³) C (R^Four) (R^Five) Refers to the structure of CO-.
On the other hand, the N-terminal amino acid residue is H _TwoNC (R⁰) (R¹) C (R²) (R³)
C (R^Four) (R^Five) CO-, C-terminal amino acid residue is -NHC (R⁰) (R¹) C
(R ²) (R³) C (R^Four) (R^Five) COOH. Furthermore, ε-ami
No acid (H_TwoNC (R⁰) (R¹) C (R²) (R³) C (R^Four) (R^Five) C (R⁶) (R⁷) C
(R⁸) (R⁹) COOH: R⁰, R¹, R², R³, R^Four, R^Five, R⁶, R⁷, R
⁸And R⁹Are the same or different and are any substitutions
Group (which represents a group) loses a water molecule to form a peptide bond.
N-terminal when incorporated into protein or peptide or
-NHC (R⁰) (R¹) C (R²) (R³) C (R^Four) (R^Five) C (R
⁶) (R⁷) C (R⁸) (R⁹) Refers to the structure of CO-. On the other hand, the N-terminal amino acid
No acid residue is H_TwoNC (R⁰) (R¹) C (R²) (R³) C (R^Four) (R^Five) C (R⁶)
(R⁷) C (R⁸) (R⁹) CO-, C-terminal amino acid residue is -NHC (R⁰) (R
¹) C (R²) (R ³) C (R^Four) (R^Five) C (R⁶) (R⁷) C (R⁸) (R⁹) Indicated by COOH
Be done.

In the present specification, an amino acid is a natural or unnatural amino acid, which is D-form or L-form.
The body may be any one of α-, β-, γ-, and ε-types. α-amino acid, β-amino acid, γ-
Examples of the group forming the side chain of amino acid and ε-amino acid include:
For example, (1) C _1-6 alkyl group (eg, methyl, ethyl,
n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl etc., preferably C _1-3 alkyl etc.), (2) cyano group, (3) halogen (eg fluorine, Chlorine, bromine, iodine, etc.), (4) hydroxy-C _1-6 alkyl group (eg, hydroxymethyl, hydroxyethyl, etc.), (5) C _1-6
Alkoxy group (eg, methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, tert-butoxy and the like, preferably C _1-3 alkoxy and the like), (6) C
_1-6 alkoxy-carbonyl group (eg, methoxycarbonyl, ethoxycarbonyl, isopropoxycarbonyl, tert-butoxycarbonyl, etc., preferably C
_1-3 alkoxy-carbonyl, etc.), (7) C _1-4 acyl group (eg, formyl such as formyl, acetyl, propionyl, butyryl and C _2-4 alkanoyl),
(8) Hydroxy group, (9) Formula: —S (O) a—R ²¹ (wherein
a is an integer of 0 to 2 and R ²¹ is a group (eg, methylthio, methanesulfinyl, methanesulfonyl, ethylthio) represented by C _1-6 alkyl (specific examples thereof are the same as those mentioned above). , Ethanesulfinyl, ethanesulfonyl, etc.), (10) benzyloxycarbonyl,
(11) tosyl group, (12) carbamoyl group, (13) mercapto group, (14) amino group, (15) sulfo group, (16) phosphono group, (1
7) phospho group, (18) carboxyl group, (19) tetrazolyl group, (20) amino-C _1-6 alkyl group (eg, aminomethyl, aminoethyl, etc.), (21) aminoallyl group, (22)
Thiazolyl group, (23) thienyl group, (24) oxazolyl group,
(25) Furyl group, (26) pyranyl group, (27) pyridyl group, (28)
Pyrazyl group, (29) pyrazinyl group, (30) pyrimidinyl group,
(31) pyridazinyl group, (32) indolyl group, (33) indodinyl group, (34) isoindolyl group, (35) pyrrolyl group, (3
6) imidazolyl group, (37) isothiazolyl group, (38) pyrazolyl group, (39) chromenyl group, (40) purinyl group, (41) quinolidinyl group, (42) quinolyl group, (43) isoquinolyl group,
(44) quinazolinyl group, (45) quinoxalinyl group, (46) cinnolinyl group, (47) morpholinyl group, (48) benzothienyl group, (49) benzofuranyl group, (50) benzimidazolyl, (51) benzimidazolyl group Group, (52) C _3-8 cycloalkyl group, (53) C substituted with the substituent described in the above (2), (3), (5) to (17), (20) to (52) _1-4 alkyl group, (54) above (2), (3), (5) to (17), (20) to (52)
Formyl substituted with the substituent described in 1., a C _1-4 acyl group such as C _2-4 alkanoyl, (55) above (1) to (52)
C _6-10 such as phenyl substituted with the substituents described in
Aryl group (mesityl, tolyl, xylyl, styrenyl, etc.), (56) C _7-15 aralkyl group such as benzyl substituted with the substituent described in the above (1) to (52) (methylbenzyl, methoxybenzyl, etc.) , (57) C _7-15 aralkyl group (benzyl, phenethyl, benzhydryl, naphthylmethyl, _etc.), (58) _{C 6- 10} aryl group (phenyl,
Naphthyl, indenyl, etc.), and (59) hydrogen atom.

A side chain forming an amino acid residue and a nitrogen atom may be bound to each other to form a ring (eg, proline, etc.), and two side chains may be bound to each other to form a ring (eg, proline). Three
-Aminonorbornanecarboxylic acid, etc.). Examples of α-amino acids include glycine, alanine, valine,
Leucine, isoleucine, serine, threonine, cysteine, methionine, aspartic acid, glutamic acid, lysine, arginine, phenylalanine, tyrosine, histidine, tryptophan, asparagine, glutamine,
Proline, pipecolic acid, norleucine, γ-methylleucine, tert-leucine, norvaline, homoarginine, homoserine, α-aminoisobutyric acid, α-aminobutyric acid, ornithine, α-aminoadipic acid, phenylglycine, thienylglycine, cyclohexylglycine, Cyclohexylalanine, thienylalanine, naphthylalanine, biphenylalanine, p-phosphonomethylphenylalanine, octahydroindole-2-carboxylic acid, O-phosphotyrosine, adamantylalanine, benzothienylalanine, pyridylalanine, piperidylalanine, pyrazylalanine, quino Lylalanine, thiazolylalanine, homocysteine, homophenylalanine, citrulline, homocitrulline, oxyproline (hydroxyproline), α, β Diaminopropionic acid,
α, γ-diaminobutyric acid, aminomalonic acid, 1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, penicillamine,
Examples thereof include cycloleucine and 2-amino-4-pentenoic acid. Examples of β-amino acids include, for example, β-alanine, β-aminobutyric acid, isoasparagine, 3-aminoadipic acid, 3-aminophenylpropionic acid, 3-amino-2-
Examples thereof include hydroxy-4-phenylbutyric acid, 3-aminonorbornanecarboxylic acid, and 3-aminobicycloheptanecarboxylic acid. Examples of γ-amino acids include, for example, γ-
Aminobutyric acid, isoglutamine, statin, 4-amino-3-
Hydroxy-5-cyclohexylpentanoic acid, 4-amino-3-
Examples thereof include hydroxy-5-phenylpentanoic acid, 6-aminopenicillanic acid and 3-aminoadamantane-1-carboxylic acid. Examples of ε-amino acids include ε-aminocaproic acid, 4-aminomethyl-cyclohexanecarboxylic acid and the like.

Examples of the natural amino acids include glycine and a
Lanine, valine, leucine, isoleucine, serine, su
Leonine, cysteine, cystine, methionine, aspa
Laginic acid, Glutamic acid, Lysine, Arginine, Pheny
Lualanine, tyrosine, histidine, tryptophan,
Asparagine, glutamine, proline, ornithine, shi
Examples include toluline. As a non-natural amino acid
Is norleucine, γ-methylleucine, tert-leucine
N, norvaline, homoarginine, homoserine, amino
Isobutyric acid, aminoadipic acid (eg, α-aminoadipic acid
Acid), phenylglycine, thienylglycine, cyclo
Hexylglycine, aminobutyric acid, β-alanine, cyclo
Hexylalanine, thienylalanine, naphthylalani
, Adamantylalanine, benzothienylalanine,
Pyridyl alanine, piperidyl alanine, pyrazyl alan
Nin, quinolyl alanine, thiazolyl alanine, isoa
Sparagine, isoglutamine, homocysteine, homov
Phenylalanine, homocitrulline, oxyproline (hi
Droxyproline), diaminopropionic acid, diamino
Butyric acid, aminobenzoic acid, the aforementioned natural amino acids, non-natural amino acids
Examples thereof include N-methylated no acids. These nets
Examples of the substituent that may be substituted on the side chain of the acid residue
Is (1) C_1-6Alkyl group (eg, methyl, ethyl, n
-Propyl, isopropyl, n-butyl, isobutyl,
sec-butyl, tert-butyl, n-pentyl
But preferably C_1-3Alkyl, etc.), (2) cyano
Group, (3) halogen (eg, fluorine, chlorine, bromine, iodine, etc.
DO), (4) Hydroxy-C_1-6Alkyl group (eg, hydr
Roxymethyl, hydroxyethyl, etc.), (5) C_1-6
Alkoxy group (eg, methoxy, ethoxy, n-propoxy)
Ci, isopropoxy, n-butoxy, tert-butoxy
C, etc., preferably C_1-3(Alkoxy etc.), (6) C
_1-6Alkoxy-carbonyl group (eg, methoxycarbo group
Nyl, ethoxycarbonyl, isopropoxy carbonyl
And tert-butoxycarbonyl, etc., preferably C
_1-3(Alkoxy-carbonyl, etc.), (7) C_1-4A
Silyl groups (eg formyl, acetyl, propionyl, buty
Formyl such as ril and C_2-4Alkanoyl, etc.),
(8) Hydroxy group, (9) Formula: —S (O) a—R²¹(In the formula,
a is an integer of 0 to 2, R²¹Is C_1-6Alkyl (specific
Examples include the same as above)))
Groups (eg, methylthio, methanesulfinyl, meta
Sulfonyl, ethylthio, ethanesulfinyl, ethane
Sulfonyl, etc.), (10) benzyloxycarbonyl,
(11) Tosyl group, (12) carbamoyl group, (13) mercapto
Group, (14) amino group, (15) sulfo group, (16) phosphono group, (1
7) phospho group, (18) carboxyl group, (19) tetrazoli
Group, (20) amino-C_1-6Alkyl group (eg, amino
Tyl, aminoethyl, etc.), (21) aminoallyl group, (22)
Thiazolyl group, (23) thienyl group, (24) oxazolyl group,
(25) Furyl group, (26) pyranyl group, (27) pyridyl group, (28)
Pyrazyl group, (29) pyrazinyl group, (30) pyrimidinyl group,
(31) pyridazinyl group, (32) indolyl group, (33) indodi
Nyl group, (34) isoindolyl group, (35) pyrrolyl group, (3
6) imidazolyl group, (37) isothiazolyl group, (38) pyra
Zolyl group, (39) chromenyl group, (40) purinyl group, (41) key
Noridinyl group, (42) quinolyl group, (43) isoquinolyl group,
(44) quinazolinyl group, (45) quinoxalinyl group, (46) syn
Norinyl group, (47) morpholinyl group, (48) benzothienyl
Group, (49) benzofuranyl group, (50) benzimidazole
(51) benzimidazolyl group, (52) C_3-8Cycloa
Rualkyl group, (53) oxo group, (54) from the above (2), (3), (5)
(19), C substituted with the substituent described in (22) to (52)
_1-4Alkyl group, (55) (2), (3), (5) to (1
9), holmi substituted with the substituent described in (22) to (52)
Le, C_2-4C such as alkanoyl_1-4Acyl group, (5
6) Phenyl substituted with the substituent described in the above (1) to (52)
C such as le _6-10Aryl groups (mesityl, tolyl, chi
Silyl, styrenyl, etc.), (57) above (1) to (52)
C such as benzyl substituted with the above substituents_7-15Aralchi
Group (methylbenzyl, methoxybenzyl, etc.), (58)
C_7-15Aralkyl groups (benzyl, phenethyl, benzhi
Drill, naphthylmethyl, etc.), (59) C_6-10Ally
Group (phenyl, naphthyl, indenyl, etc.)
You can

Examples of the neutral substituent include (1) C_1-6Al
Kill group (eg, methyl, ethyl, n-propyl, isopro
Pill, n-butyl, isobutyl, sec-butyl, te
rt-butyl, n-pentyl and the like, preferably C_1-3
Alkyl, etc.), (2) cyano group, (3) halogen (eg, fluorine
Element, chlorine, bromine, iodine, etc.), (4) hydroxy-C
_1-6Alkyl group (eg hydroxymethyl, hydroxy
Ethyl, etc.), (5) hydroxy group, (6) carbamoyl group,
(7) Mercapto group, (8) Formula: —S (O) a—R²¹(Each in the formula
The symbol has the same meaning as defined above, (9) C_6-10Ally
Group (eg phenyl, naphthyl, indenyl, chromenyl)
Etc.), (10) thienyl group, (11) oxazolyl group, (12) phenyl group
Ryl group, (13) indolyl group, (14) indolizinyl group, (1
5) Isoindolyl group, (16) C_3-8Cycloalkyl group,
(17) an oxo group, (18) the above (2), (3), (5) to (16)
C substituted with a substituent_1-6Alkyl, (19) Above (1)
Phenyl and naphthyl substituted with the substituents described in (16)
Such as C_6-10Aryl group (mesityl, tolyl, xy
Ril, styrenyl, etc.), (20) As described in (1) to (16) above
C such as benzyl substituted with the substituents of_7-15Aral
Kill group (methylbenzyl, methoxybenzyl, etc.)
Can be given. The acidic substituents are carbon
C substituted with a xyl group, a sulfo group, a tetrazolyl group, etc.
_1-4C such as alkyl group, phenyl and naphthyl
_6-10C such as aryl group or benzyl_7-15
Examples thereof include aralkyl group and carboxyl group. base
Examples of the volatile substituent include (1) amino-C_1-6Alkyl group
(Aminomethyl, aminoethyl, etc.), (2) aminoant
Group, (3) pyridyl group, (4) pyrazyl group, (5) pyrazinyl
Group, (6) pyridazinyl group, (7) imidazolyl group, (8) pyridine group
Razolyl group, (9) pyrazolyl group, (10) morpholinyl group,
(11) an amino group, (12) a substituent according to the above (3) to (10)
The replaced C_1-4Alkyl group, (13) As described in (1) to (11) above.
C such as benzyl substituted with the above substituents_7-15Ara
A rutile group, (14) substituted with the substituent described in (1) to (11) above
C such as phenyl and naphthyl_6-10Aryl group
And so on. In the present specification, an acidic amino acid and
Then, specifically, for example, in the side chain carboxyl
Having acidic groups such as groups, sulfo groups, tetrazolyl groups
Amino acids are included. As a specific example, glutami
Acid, pyroglutamic acid, aspartic acid, cysteine
Acid, homocysteic acid, 3- (5-tetrazolyl) ara
Nin, 2-amino-4- (5-tetrazolyl) butyric acid, etc.
Can be given. In the present specification, a basic amino acid
For example, histidine, arginine, ortini
, Lysine, diaminopropionic acid, diaminobutyric acid,
Examples include homoarginine. Side chain substituted salt
Specific examples of the basic amino acid include N,^α−
Acetyl Arginine, N^ε-Tosylarginine, N^ε
-Acetyllysine, N^ε-Methyllysine, N^ε-Tosyl
Examples include lysine. As used herein, neutral ami
Specific examples of the acid include, for example, alanine and varieties.
, Norvaline, leucine, isoleucine, alloisoro
Isine, norleucine, tertiary leucine, gamma
Methylleucine, proline, phenylglycine, phenyl
Rualanine, glutamine, asparagine, serine, thread
Onine, glycine, cysteine, methionine, trypto
Fan, oxyproline (hydroxyproline), shiku
Examples include amino acids such as lohexylalanine. ~ side
As the neutral amino acid whose chain has been replaced, specifically,
Examples include biphenylalanine.

In the present specification, examples of the amino acid residue having an aromatic side chain include, for example, tryptophan, phenylalanine, tyrosine, 1-naphthylalanine, 2-naphthylalanine, 2-thienylalanine, Examples thereof include histidine, pyridylalanine (2-pyridylalanine), O-methyltyrosine and the like. Specific examples of the amino acid residue having an aromatic side chain in which the side chain is substituted include, for example, 3-iodotyrosine and p-
Examples thereof include phosphonomethylphenylalanine and O-phosphotyrosine. In the present specification, examples of the amino acid residue having a hydroxy group in the side chain include serine, threonine, tyrosine, oxyproline (hydroxyproline) and the like. In the present specification, peptides and peptide chains have N at the left end according to the convention of peptide notation.
The terminal (amino terminal) and the right terminal are C terminals (carboxyl terminal). Peptides and peptide chains of the invention C-terminal is normally a carboxyl group (-COOH) or carboxylate (-COO ^-) is a, C-terminal, may be an amide (-CONH ₂₎ or ester (-COOR) . Examples of the R of the ester include C _1-6 alkyl groups such as methyl, ethyl, n-propyl, isopropyl and n-butyl, C _3-8 cycloalkyl groups such as cyclopentyl and cyclohexyl, C such as phenyl and α-naphthyl. _6-12 aryl group, phenyl-C _1-2 alkyl such as benzyl, phenethyl, benzhydryl, or C such as α-naphthyl-C _1-2 alkyl such as α-naphthylmethyl.
_In addition to the _7-14 aralkyl group, a pivaloyloxymethyl group widely used as an oral ester and the like can be mentioned.
When the peptide of the present invention has a carboxyl group or carboxylate other than the C-terminal, those in which the group is amidated or esterified are also included in the polypeptide of the present invention. As the ester at this time, for example, the above-mentioned C-terminal ester or the like is used. Further, in the peptide or peptide chain of the present invention, the amino group of the N-terminal amino acid residue is a substituent (for example, C _2-6 alkanoyl group such as formyl and acetyl, guanidinoacetyl, thienylacrylyl and pyridylacetyl). C
_1-8 acyl group, C _1-6 alkyl group such as methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl and hexyl,
C _6-10 aryl group such as phenyl and naphthyl, or C _7-16 aralkyl group such as benzyl and phenethyl,
Tosyl group, benzyloxycarbonyl group, formula: -S
(O) in ^{a-R 22} (wherein, a is an integer of 0 to ^{2, R 22}
Represents a group represented by C _1-6 alkyl (specific examples thereof include the same ones as described above) (eg, methylthio, methanesulfinyl, methanesulfonyl, ethylthio, ethanesulfinyl, ethanesulfonyl, etc.), t -Butoxycarbonyl group, N-9-fluorenylmethoxycarbonyl group, etc.), N-terminal glutamine residue produced by cleavage in vivo is pyroglutamine-oxidized, and amino acid in the molecule Substituents on the side chain (for example, -OH, -SH, amino group, imidazolyl group,
Indolyl group, guanidino group, etc.) protected by an appropriate protecting group (eg, C _1-6 acyl group such as C _1-6 alkanoyl group such as formyl group, acetyl group), or sugar chain bonded It also includes complex proteins such as so-called glycoproteins.

The modified form (I) of apelin has the formula X ¹ -Ar
^{g-Pro-Arg-X 2} -Ser-His-X 3 -G
It is represented by ly-Pro-X ⁴ -X ⁵ , and is -Arg-Pro.
-Arg-, -Ser-His- and -Gly-Pr
The side chain of each amino acid residue in o- may be substituted, and examples of the substituent include the above-mentioned substituents and the like.
In the present specification, X ¹ represents “a hydrogen atom or an amino acid residue or a peptide chain consisting of 1 to 25 amino acids which may be the same or different and whose side chains may be substituted”. Examples of the substituent in the “1 to 25 amino acids whose side chain may be substituted” include, for example,
Examples thereof include those similar to the above-mentioned “substituents which may be substituted on the side chain of an amino acid residue”. Preferred examples when X ¹ represents “an amino acid residue whose side chain may be substituted” include, for example, optionally substituted pyroglutamic acid and optionally substituted side chain glutamine. And more preferably pyroglutamic acid or glutamine. Examples of the substituent of the amino acid residue in the “side chain optionally substituted amino acid residue”, “optionally substituted pyroglutamic acid”, and “side chain optionally substituted glutamine” include The same as the above "substituent which may be substituted on the side chain of the amino acid residue" and the like can be mentioned. Moreover, a benzyloxycarbonyl group etc. are mentioned as a preferable substituent of "pyroglutamic acid which may be substituted". Specific examples of when X ¹ represents “a peptide chain consisting of 2 to 25 amino acids which may be the same or different and whose side chains may be substituted” include, for example, the formula Y
^1- Y ² (In the formula, Y ¹ is the same or different and represents an amino acid residue or a peptide chain consisting of 1 to 17 amino acids whose side chains may be substituted, and Y ² is the same or different. A peptide represented by (an amino acid residue or a peptide chain consisting of 1 to 8 amino acids whose side chain may be substituted) is shown.

Y above¹And Y^TwoAmino acid residue represented by
Groups or side chain substituents of amino acid residues in the peptide chain
For example, substituting the side chain of the amino acid residue described above
And the like.
Above Y¹As a specific example of, for example, (a) formula A
¹-A^Two-A^Three-A^Four-A⁵-A⁶-A⁷-A⁸-A⁹
-A¹⁰-A ¹¹-A¹²-A^Thirteen-A¹⁴-A¹⁵−
A¹⁶-A¹⁷(In the formula, A¹Through A ¹⁷Are the same
One or different amino acids whose side chains may be substituted
Residue), (b) Formula A^Two-A^Three-A^Four-A⁵-A⁶
-A⁷-A⁸-A⁹-A¹⁰-A¹¹-A¹²-A^Thirteen
-A¹⁴-A¹⁵-A¹⁶-A¹⁷(In the formula, each symbol is
The same meaning as above), (c) Formula A^Three-A^Four-A⁵-A⁶
-A⁷-A⁸-A⁹-A¹⁰-A¹¹-A¹²-A^Thirteen
-A¹⁴-A¹⁵-A¹⁶-A¹⁷(In the formula, each symbol is
The same meaning as above), (d) Formula A^Four-A⁵-A⁶-A⁷
-A⁸-A⁹-A¹⁰-A¹¹-A¹²-A^{1 Three}-A
¹⁴-A¹⁵-A¹⁶-A¹⁷(In the formula, each symbol is as described above.
(Same meaning), (e) Formula A⁵-A⁶-A⁷-A⁸-A
⁹-A¹⁰-A¹¹-A¹²-A^Thirteen-A ¹⁴-A¹⁵
-A¹⁶-A¹⁷(In the formula, each symbol has the same meaning as above.
), (F) Formula A⁶-A⁷-A⁸-A⁹-A¹⁰-A
¹¹-A¹²-A^Thirteen-A¹⁴-A¹⁵-A¹⁶-A
¹⁷(Wherein each symbol has the same meaning as described above), (g) formula
A⁷-A⁸-A⁹-A¹⁰-A¹¹-A¹²-A^Thirteen−
A¹⁴-A¹⁵-A¹⁶-A¹⁷(In the formula, each symbol is as described above.
And (h) formula A⁸-A⁹-A¹⁰-A
¹¹-A¹²-A^Thirteen-A¹⁴-A¹⁵-A^{1 6}-A
¹⁷(Wherein each symbol has the same meaning as described above), (i) formula
A⁹-A¹⁰-A¹¹-A¹²-A^Thirteen-A¹⁴-A
¹⁵-A¹⁶-A ¹⁷(In the formula, each symbol has the same meaning as above.
Shown), (j) Formula A¹⁰-A¹¹-A¹²-A^Thirteen-A
¹⁴-A¹⁵-A¹⁶-A¹⁷(In the formula, each symbol is as described above.
Have the same meaning), (k) Formula A¹¹-A¹²-A^Thirteen-A
¹⁴-A¹⁵-A¹⁶-A¹⁷(In the formula, each symbol is as described above.
Have the same meaning), (l) Formula A¹²-A^Thirteen-A¹⁴-A
¹⁵-A¹⁶-A¹⁷(In the formula, each symbol has the same meaning as above.
Shown), (m) Formula A^Thirteen-A¹⁴-A¹⁵-A¹⁶-A
¹⁷(Wherein each symbol has the same meaning as described above), (n) formula
A¹⁴-A¹⁵-A¹⁶-A¹⁷(In the formula, each symbol is as described above.
The same meaning as), (0) Formula A¹⁵-A¹⁶-A
¹⁷(Wherein each symbol has the same meaning as above), (p) formula
A¹⁶-A¹⁷(In the formula, each symbol has the same meaning as above)
Or (q) A¹⁷(A¹⁷Represents the same meaning as above)
Amino acid residues or peptide chains
It

The above A ¹ represents an amino acid residue whose side chain may be substituted, preferably an amino acid residue having an aromatic side chain, and more preferably L-having an aromatic side chain. Amino acid residues, more preferably L-tyrosine and the like are shown. The above A ² and A ³ are the same or different and each represents an amino acid residue whose side chain may be substituted, preferably a neutral amino acid residue whose side chain may be substituted, more preferably , L-neutral amino acid residue whose side chain may be substituted, more preferably, A ² is L-leucine and the like, and A ³ is L-valine and the like. The above A ⁴ represents an amino acid residue whose side chain may be substituted, preferably a neutral or basic amino acid residue whose side chain may be substituted, more preferably a side chain substituted. Optionally L-neutral or L-basic amino acid residue, more preferably L-lysine or N ^ε -acetyllysine. The above A ⁵ represents an amino acid residue whose side chain may be substituted, preferably a neutral amino acid residue whose side chain may be substituted, more preferably L-which may be substituted. Proline, more preferably L-proline and the like are shown. The above A ⁶ and A ⁹ are the same or different and each represent an amino acid residue whose side chain may be substituted, preferably a basic amino acid residue whose side chain may be substituted, and more preferably , L-basic amino acid residue whose side chain may be substituted, more preferably L-arginine. The above A ⁷ and A ¹⁰ are the same or different and each represent an amino acid residue whose side chain may be substituted, but preferably, an amino acid residue having a hydroxy group in the side chain or a side chain is substituted. It also indicates a neutral amino acid residue. As A ⁷ , glycine which may be substituted, particularly glycine, is preferably used. The above A ⁸ represents an amino acid residue whose side chain may be substituted, preferably an amino acid residue having L-proline or a hydroxy group in its side chain, more preferably L-serine, L
-Indicates proline or oxyproline (hydroxyproline) and the like. The above A ¹⁰ is preferably an amino acid residue having a hydroxy group in its side chain or a neutral amino acid residue whose side chain may be substituted, more preferably serine, threonine, asparagine and the like. A ¹¹ above
To A ¹⁴ are the same or different and each represent an amino acid residue whose side chain may be substituted, preferably a neutral amino acid residue whose side chain may be substituted, more preferably A ¹¹ Are glycine, A ¹² is L-proline, A ¹³ is glycine, and A ¹⁴ is L-alanine, L-proline and the like. The above A ¹⁵ represents an amino acid residue whose side chain may be substituted, preferably an amino acid residue having an aromatic side chain, more preferably an L-amino acid having an aromatic side chain. Residues, more preferably L-tryptophan and the like are shown. The above A ¹⁶ represents an amino acid residue whose side chain may be substituted, preferably a neutral amino acid residue whose side chain may be substituted, more preferably a neutral L- having a carbamoyl group. Amino acid residue, more preferably L-
Indicates glutamine. Examples of the neutral L-amino acid residue having a carbamoyl group include L-glutamine and L-asparagine. A ¹⁷ represents an amino acid residue whose side chain may be substituted, preferably a neutral amino acid residue whose side chain may be substituted, more preferably glycine and the like.

Y above^TwoFor example,
For example, formula B¹-B^Two-B^Three-B^Four-B⁵-B⁶-B⁷
-B⁸(In the formula, B¹Through B ⁸Are the same or different
Indicates an amino acid residue whose side chain may be substituted.
), Formula B^Two-B^Three-B^Four-B⁵-B⁶-B⁷-B
⁸(Wherein each symbol has the same meaning as above), Formula B^Three
-B^Four-B⁵-B⁶-B⁷-B⁸(In the formula, each symbol is as described above.
And has the same meaning as), formula B^Four-B⁵-B⁶-B⁷-B
⁸(Wherein each symbol has the same meaning as above), Formula B⁵
-B⁶-B⁷-B⁸(In the formula, each symbol has the same meaning as above.
), Formula B⁶-B⁷-B⁸(In the formula, each symbol is as above.
Have the same meaning), Formula B⁷-B⁸(In the formula, each symbol is above
And the formula B⁸(B⁸Is the same as above
Amino acid residue or peptide chain represented by
And so on. B above¹Even if the side chain is substituted
A good amino acid residue is shown, but preferably the side chain is substituted.
A neutral amino acid residue which may be
A neutral L-amino acid residue whose chain may be substituted, further
Is preferably an optionally substituted glycine, most preferably
More preferably, it represents glycine or the like. B above^TwoThrough B^FourIs
Even if each side chain is the same or different and substituted
A good amino acid residue is shown, but preferably the side chain is substituted.
Optionally basic amino acid residue, more preferably,
A basic L-amino acid residue whose side chain may be substituted,
More preferably, B^TwoAs L-arginine, B^Three
As L-arginine, B^FourAs L-lysine
I will show you. B above⁵Is an amino group whose side chain may be substituted.
No acid residue is shown, but preferably has an aromatic side chain
Has an amino acid residue, more preferably an aromatic side chain.
L-amino acid residue, more preferably L-phenyl
Indicates lualanine and the like. B above⁶And B⁷Are each
The same or different amino groups whose side chains may be substituted
No acid residue, preferably with a substituted side chain
A basic amino acid residue, more preferably a side chain
A basic L-amino acid residue which may be replaced, more preferably
More preferably, it represents L-arginine or the like. B above⁸Is the side chain
Represents an amino acid residue which may be substituted,
More preferably, glutamine, which may have a substituted side chain, is more preferable.
More preferably, L-glutamine and the like are shown.

Y¹And Y^TwoAs a combination of
When expressed by (a) expression + above expression
(Ie X¹But A ¹-A^Two-A^Three-A^Four-A⁵-A⁶−
A⁷-A⁸-A⁹-A¹⁰-A¹¹-A^{1 Two}-A^Thirteen−
A¹⁴-A¹⁵-A¹⁶-A¹⁷-B¹-B^Two-B^Three−
B^Four-B⁵-B⁶-B⁷-B⁸When represented by:
It is omitted in the explanation of the combination), and is shown in (a) above.
When expressed by the above formula + the above formula, the above
(a) + the above expression
If it is expressed as (a) above + the above expression
If the above is true, the formula represented by (a) above + the formula represented by above
When expressed by, the expression expressed in (a) above + expressed in the above
When expressed by the formula, the formula expressed by (a) above + the above
When expressed by the formula, the formula expressed by (a) above +
When represented by the formula represented above, represented by (b) above
When expressed by the formula + the above formula, in (b) above
When expressed by the expression + the above expression, the above
(b) + the above expression
In this case, the formula expressed by (b) above + the formula expressed by above
If the above is true, the formula expressed in (b) above + the formula expressed above
When expressed by, the formula expressed by (b) above + expressed by the above
When expressed by the formula, the formula expressed by (b) above + the above
When expressed by the formula, the formula expressed by (b) above +
When represented by the formula represented above, represented by the above (c)
In case of the formula + the formula above, in (c) above
When expressed by the expression + the above expression, the above
(c) + (expression above)
In this case, it is represented by the formula (c) above + the formula above
If the above is true, the formula represented by (c) above + the formula represented by above
When expressed by, the formula expressed by (c) above + expressed by the above
When expressed by the formula, the formula expressed by (c) above + the above
When expressed by the formula, the formula expressed by (c) above +
When represented by the formula represented above, it is represented by (d) above.
In the case of the formula + the formula shown above, in (d) above
When expressed by the expression + the above expression, the above
(d) + the above expression
In this case, it is represented by the formula represented by (d) above + the formula represented by above
In case of the above, the formula represented by the above (d) + the formula represented by the above
When expressed by, the formula expressed by (d) above + expressed by the above
When expressed by the formula, the formula expressed by (d) above + the above
When expressed by the formula, the formula expressed by (d) above +
When represented by the formula represented above, it is represented by (e) above.
In case of the formula + the formula shown above, in (e) above
When expressed by the expression + the above expression, the above
(e) + the above expression
In this case, the formula expressed by (e) above + the formula expressed by above
If the above is true, the formula expressed in (e) above + the formula expressed above
When expressed by, the expression expressed by (e) above + expressed by the above
When expressed by the formula, the formula expressed by (e) above + the above
When expressed by the formula, the formula expressed by (e) above +
When represented by the formula represented above, it is represented by (f) above.
In the case of being expressed by the formula + the above formula, in (f) above
When expressed by the expression + the above expression, the above
(f) + the above expression
In this case, it is expressed by the formula shown in (f) above + the formula shown above
In case of the above, the formula represented by the above (f) + the formula represented by the above
When expressed by, the formula expressed by (f) above + expressed by
When expressed by the formula, the formula expressed by (f) above + the above
When expressed by the formula, the formula expressed by (f) above +
When represented by the formula represented above, represented by (g) above
Formula + the above formula, in (g) above
When expressed by the expression + the above expression, the above
(g) + the above expression
If it is expressed by the formula (g) above + the formula above
If the above is true, the formula represented by the above (g) + the formula represented by the above
When expressed by, the formula expressed by (g) above + expressed by
When expressed by the formula, the formula expressed by (g) above + the above
When expressed by the formula, the formula expressed by (g) above +
When represented by the formula represented above, it is represented by (h) above.
In the case of being expressed by the formula + the above formula, in (h) above
When expressed by the expression + the above expression, the above
(h) + the above expression
In this case, it is expressed by the formula represented by (h) + the formula represented by the above.
In case of the above, the formula represented by the above (h) + the formula represented by the above
When expressed by, the formula expressed by (h) above + expressed by the above
When expressed by the formula, the formula expressed by (h) above + the above
When expressed by the formula, the formula expressed by (h) above +
When represented by the formula represented above, represented by (i) above
In the case of the above formula + the above formula, in (i) above
When expressed by the expression + the above expression, the above
(i) + the above expression
In this case, it is represented by the formula (i) above + the formula above
If the above is true, the formula represented by (i) above + the formula represented by above
When expressed by, the expression expressed by (i) above + expressed by the above
When expressed by the formula, the formula expressed by (i) above + the above
When expressed by the formula, the formula expressed by (i) above +
When represented by the above formula, it is represented by (j) above.
Formula + the above formula, in (j) above
When expressed by the expression + the above expression, the above
(j) + (expression above)
If it is expressed as (j) above + the above expression
If the above is true, the formula expressed in (j) above + the formula expressed above
When expressed by, the expression expressed by (j) above + expressed by the above
When expressed by the formula, the formula expressed by (j) above + the above
When expressed by the formula, the formula expressed by (j) above +
When represented by the formula represented above, it is represented by (k) above.
In the case of being expressed by the formula + the above formula, in (k) above
When expressed by the expression + the above expression, the above
(k) + the above expression
If it is expressed by the above formula (k) + the above formula,
In case of the above, the formula represented by the above (k) + the formula represented by the above
When expressed by, the expression expressed by (k) above + expressed by the above
When expressed by the formula, the formula expressed by (k) above + the above
When expressed by the formula, the formula expressed by (k) above +
When represented by the formula represented above, it is represented by (l) above.
Formula + the above formula, in (l) above
When expressed by the expression + the above expression, the above
(l) + the above expression
The formula expressed by (l) above + the formula expressed by above
If the above is true, the formula represented by (l) above + the formula represented above
When expressed by, the formula expressed by (l) above + the above expressed
When expressed by the formula, the formula expressed by (l) above + the above
When expressed by the formula, the formula expressed by (l) above +
When represented by the formula represented above, it is represented by (m) above.
In the case of being expressed by the formula + the above formula, in (m) above
When expressed by the expression + the above expression, the above
(m) + the above expression
If it is expressed by the formula (m) above + the formula above
In case of the above, the formula represented by the above (m) + the formula represented by the above
When expressed by, the formula expressed by (m) above + expressed by the above
When expressed by the formula, the formula expressed by (m) above + the above
When expressed by the formula, the formula expressed by (m) above +
When represented by the formula represented above, represented by (n) above
When expressed by the formula + the formula above, in (n) above
When expressed by the expression + the above expression, the above
(n) + the above expression
In this case, it is represented by the formula represented by (n) above + the formula represented by above
If the above is true, the formula represented by (n) above + the formula represented above
Is expressed by the above formula (n) + the above
When expressed by the formula, the formula expressed by (n) above + the above
When expressed by the formula, the formula expressed by (n) above +
When represented by the formula represented above, it is represented by (o) above.
In case of the formula + the formula shown above, the above (o)
When expressed by the expression + the above expression, the above
(o) + the above expression
If it is expressed as (o) above + the above expression
If the above is true, the formula represented by (o) above + the formula represented by above
When expressed by, the expression expressed by (o) above + expressed by the above
When expressed by the formula, the formula expressed by (o) above + the above
When expressed by the formula, the formula expressed by (o) above +
When represented by the formula represented above, it is represented by (p) above.
In the case of the formula + the formula shown above, in (p) above
When expressed by the expression + the above expression, the above
(p) + the above expression
In this case, it is expressed by the formula (p) above + the formula above
In case of the above, the formula represented by the above (p) + the formula represented by the above
When expressed by, the expression expressed by (p) above + expressed by the above
When expressed by the formula, the formula expressed by (p) above + the above
When expressed by the formula, the formula expressed by (p) above +
When expressed by the above formula, it is expressed by (q) above.
In the case of the formula + the formula shown above, the above (q)
When expressed by the expression + the above expression, the above
(q) + the above expression
If it is expressed as (q) above + (expression above)
In case of the above, the formula represented by the above (q) + the formula represented by the above
When expressed by, the expression expressed by (q) above + expressed by the above
When expressed by the formula, the formula expressed by (q) above + the above
When represented by the formula represented by, and represented by (q) above
There are cases where it is expressed by the formula + the formula shown above.
However, above all, it is expressed by the formula (a) above + the above
When expressed by the formula, the formula expressed by (b) above +
When represented by the formula represented, the formula represented by (c) above +
When represented by the formula described below, it is represented by the above (d)
When expressed by the formula + the formula above, the formula (e) above
When expressed by the above formula + the above formula, the above
(f) + the above expression
If it is expressed by the formula (g) above + the formula above
In case of the above, the formula represented by the above (h) + the formula represented by the above
When expressed by, the expression expressed by (i) above + expressed by the above
When expressed by the formula, the formula expressed by (j) above + the above
When expressed by the formula, the formula expressed by (k) above +
When represented by the formula represented above, it is represented by (l) above.
In the case of being expressed by the formula + the above formula, in (m) above
When expressed by the expression + the above expression, the above
(n) + the above expression
If it is expressed as (o) above + the above expression
In case of the above, the formula represented by the above (p) + the formula represented by the above
And the formula (q) above + the above
The case of being represented by the formula

Above all, the formula represented by the above (a) + the above
When represented by the formula represented by and represented by (b) above
The case of being represented by the formula + the formula shown above is more preferable.
Take as an example. Formula (a) above + above
When represented by the formula represented and the formula represented by (b) above
+ Further preferred ingredients when represented by the formulas described above
A body example is shown below. Formula shown in (b) above + Table shown above
Is represented by the formula¹Is the expression A ^Two-A^Three−
A^Four-A⁵-A⁶-A⁷-A⁸-A⁹-A¹⁰-A¹¹
-A¹²-A ^Thirteen-A¹⁴-A¹⁵-A¹⁶-A¹⁷−
B¹-B^Two-B^Three-B^Four-B⁵-B⁶-B⁷-B⁸(formula
Medium, A²Through A¹⁷And B¹Through B⁸Is the same as above
In this case,
As a preferred specific example of^TwoAnd A^ThreeRespectively
L-, which may be the same or different and whose side chain may be substituted.
Neutral amino acid residue, preferably A^TwoAs L-Royce
A, etc.^ThreeIs L-valine or the like, and A^FourIs on the side
L-neutral or L-basic amide, whose chain may be substituted
Mino acid residue, preferably L-glutamine, L-lysine or
Or N^ε-Acetyllysine, etc., A⁵Is the side chain
Optionally substituted L-proline, preferably L-proline
Such as phosphorus, A⁶And A⁹Are the same or
Differently, the L-basic amino group may have a side chain substituted.
Acid residue, preferably L-arginine and the like,⁷
Optionally substituted glycine, preferably glycine
And so on, A⁸Is an L-proline or hydroxy group
An amino acid residue having a side chain, preferably L-serine,
L-proline or oxyproline (hydroxyproline
, Etc., and A¹⁰Has a hydroxy group in the side chain
Neutral amino acid residue or side chain may be substituted
Amino acid residue, preferably L-serine, L-threoni
A, L-asparagine, etc.¹¹Is glycine,
A¹²Is L-proline, A^ThirteenIs glycine, A¹⁴Is L-
Such as alanine or L-proline, A¹⁵Is fragrance
L-amino acid residue having an aromatic side chain, preferably L-
Tryptophan, etc., A¹⁶Is a carbamoyl group
Having a neutral L-amino acid residue, preferably L-glutamine
And A¹⁷Is a neutral amino acid residue, preferably
Shin, etc.,

B ¹ is a neutral L in which the side chain may be substituted.
-An amino acid residue, preferably glycine which may be substituted, more preferably glycine and the like, in which B ² to B ⁴ are the same or different from each other, and a basic L- whose side chain may be substituted- An amino acid residue, preferably
B ² is L-arginine, B ³ is L-arginine, B ⁴ is L-lysine, etc., and B ⁵ is an L-amino acid residue having an aromatic side chain, preferably,
L-phenylalanine, etc., B ⁶ and B ⁷ are the same or different, and a basic L-amino acid residue whose side chain may be substituted, preferably L-arginine, etc., and B ⁸ is Examples thereof include the case where the chain is glutamine which may be substituted, preferably L-glutamine.

Formula represented by (a) above + represented by above
When expressed by a formula, X¹Is the expression A ¹-A^Two-A^Three−
A^Four-A⁵-A⁶-A⁷-A⁸-A⁹-A¹⁰-A¹¹
-A^{1 Two}-A^Thirteen-A¹⁴-A¹⁵-A¹⁶-A¹⁷−
B¹-B^Two-B^Three-B^Four-B⁵-B⁶-B⁷-B⁸(formula
Medium, A¹Through A¹⁷And B¹Through B⁸Is the same as above
In this case,
As a preferred specific example of¹Has aromatic side chains
L-amino acid residue, more preferably L-tyrosine
And A^TwoAnd A^ThreeAre the same or different
And an L-neutral amino acid residue whose side chain may be substituted
A group, preferably A^TwoAs L-leucine, A^ThreeWhen
Is L-valine, and A^FourHas side chains replaced
L-neutral or L-basic amino acid residue which may be
More preferably, L-glutamine, L-α aminoadipic acid, L-
Lysine or N^ε-Acetyllysine, etc., A⁵But
Optionally substituted L-proline, preferably L-proline
Such as Lorin, A⁶And A⁹Are the same
Are different from each other, and L-basic acid optionally substituted in the side chain.
A mino acid residue, preferably L-arginine and the like, A
⁷Optionally substituted glycine, preferably glycine
A, etc., and⁸Is L-proline or hydroxy group
An amino acid residue having a side chain, preferably L-seri
, L-proline or oxyproline (hydroxyproline
Lorin) etc., and A¹⁰Has a hydroxy group in the side chain
The amino acid residue or side chain to
Amino acid residue, preferably L-serine, L-threoni
A, L-asparagine, etc.¹¹Is glycine,
A¹²Is L-proline, A^ThirteenIs glycine, A¹⁴Is L-
Such as alanine or L-proline, A¹⁵Is fragrance
L-amino acid residue having an aromatic side chain, preferably L-
Tryptophan, etc., A¹⁶Is a carbamoyl group
Having a neutral L-amino acid residue, preferably L-glutamine
And A¹⁷Is a neutral amino acid residue, preferably
Shin, etc.,

B ¹ is a neutral L in which the side chain may be substituted.
-An amino acid residue, preferably glycine which may be substituted, more preferably glycine and the like, in which B ² to B ⁴ are the same or different from each other, and a basic L- whose side chain may be substituted- An amino acid residue, preferably
B ² is L-arginine, B ³ is L-arginine, B ⁴ is L-lysine, etc., and B ⁵ is an L-amino acid residue having an aromatic side chain, preferably,
L-phenylalanine, etc., B ⁶ and B ⁷ are the same or different, and a basic L-amino acid residue whose side chain may be substituted, preferably L-arginine, etc., and B ⁸ is Examples thereof include the case where the chain is glutamine which may be substituted, and preferably L-glutamine L-pyroglutamic acid.

As more specific and preferable examples of X ¹ , (1) hydrogen atom, (2) Leu-Val-Gln-Pro-Arg-Gly-Ser-
Arg-Asn-Gly-Pro-Gly-Pro-Trp-Gln-Gly-Gly-Arg-Arg-Ly
s-Phe-Arg-Arg-Gln, (3) pGlu, (4) Leu-Val-Adi (NH ₂ )-
Pro-Arg-Gly-Ser-Arg-Asn-Gly-Pro-Gly-Pro-Trp-Gln-Gl
y-Gly-Arg-Arg-Lys-Phe-Arg-Arg-Gln, (5) Leu-Val-Ly
s (Ac) -Pro-Arg-Thr-Ser-Arg-Thr-Gly-Pro-Gly-Ala-Trp-
Gln-Gly-Gly-Arg-Arg-Lys-Phe-Arg-Arg-Gln, (6) Tyr-
Leu-Val-Lys-Pro-Arg-Thr-Ser-Arg-Thr-Gly-Pro-Gly-Al
a-Trp-Gln-Gly-Gly-Arg-Arg-Lys-Phe-Arg-Arg-Gln, and (7) Z-pGlu.

In the present specification, X ² represents a neutral amino acid residue in which the side chain may be substituted, but preferably L-leucine in which the side chain may be substituted, or the side chain is substituted. Optionally L-norleucine, more preferably L
-Leucine, L-norleucine and the like.

In the present specification, X ³ represents a neutral amino acid residue whose side chain may be substituted or a basic amino acid residue whose side chain may be substituted. Examples of the substituent on the side chain of the basic amino acid residue include C _1-4 acyl group, tosyl group, C _1-6 alkyl group and the like.
Examples of the C _1-4 acyl group include formyl such as formyl, acetyl, propionyl and butyryl, and C.
Examples include _2-4 alkanoyl. Examples of the C _1-6 alkyl group include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, hexyl and the like. Preferred examples of X ³ include L-lysine whose side chain may be substituted, L-norleucine whose side chain may be substituted, and L-arginine whose side chain may be substituted. More preferably, the side chain is a C _1-4 acyl group (eg, formyl such as formyl, acetyl, propionyl, butyryl and C _2-4 alkanoyl), C
_1-6 alkyl group (eg, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert.
-Butyl, pentyl, hexyl, etc.) or L-lysine optionally substituted with a tosyl group, L-norleucine or L-arginine, and the like, more preferably L-lysine, L-norleucine, L-arginine,
N ^epsilon - acetyllysine, N ^epsilon - methyllysine, N ^epsilon -
Examples thereof include tosyl lysine and N ^ε -tosyl arginine.

In the present specification, X ⁴ represents a neutral or aromatic amino acid residue which may have a bond or a side chain substituted. As X ⁴ , a bond, L-norleucine whose side chain may be substituted, L-methionine whose side chain may be substituted, and L-methionine sulfoxide whose side chain may be substituted. Or L-alanine which may have a side chain substituted, and the like, more preferably a bond, L-norleucine or L-methionine,
Examples thereof include L-methionine sulfoxide and L-cyclohexylalanine.

In the present specification, X ⁵ is an amino acid residue whose side chain may be substituted or an amino acid derivative in which its C-terminal carboxyl group is reduced to a hydroxymethyl group or a formyl group, a hydroxyl group or a side chain is substituted. A dipeptide chain in which an amino acid residue which may be substituted and an amino acid residue whose side chain is substituted or a C-terminal carboxyl group thereof is reduced to a hydroxylmethyl group or a formyl group is shown as a peptide derivative. X ⁵ is preferably a neutral amino acid residue whose side chain may be substituted or an amino acid derivative in which its C-terminal carboxyl group is reduced to a hydroxymethyl group or a formyl group, or a hydroxyl group or side chain may be substituted. A dipeptide chain comprising a good neutral amino acid residue and an amino acid residue having an aromatic side chain which may be substituted in the side chain or its C-terminal carboxyl group is reduced to a hydroxylmethyl group or a formyl group. And peptide derivatives. More preferably, X ⁵ is an amino acid derivative in which the side chain may be substituted, L-proline or its C-terminal carboxyl group is reduced to a hydroxymethyl group or a formyl group, and the side chain may be substituted 4- Chlorophenylalanine or an amino acid derivative whose C-terminal carboxyl group is reduced to a hydroxymethyl group or a formyl group, 2-naphthylalanine whose side chain may be substituted or its C-terminal carboxyl group is reduced to a hydroxymethyl group or a formyl group Amino acid derivative, a side chain-substituted cyclohexylalanine or an amino acid derivative whose C-terminal carboxyl group is reduced to a hydroxymethyl group or a formyl group, a hydroxyl group or an optionally substituted L-proline and (a ) L- whose side chain may be substituted Phenylalanine, (b) side chain optionally substituted L-tyrosine, (c) side chain optionally substituted L-2-thienylalanine, (d) side chain optionally substituted L -Phenylglycine or (e) a dipeptide chain having L-2-pyridylalanine optionally substituted on its side chain, or a peptide derivative in which its C-terminal carboxyl group is reduced to a hydroxylmethyl group or a formyl group, etc. Can be given. More preferably, X ⁵ is (1) L
-Proline or an amino acid derivative whose C-terminal carboxyl group is reduced to a hydroxymethyl group or a formyl group, (2) 4-chlorophenylalanine or an amino acid derivative whose C-terminal carboxyl group is reduced to a hydroxymethyl group or a formyl group, ( 3) Amino acid derivative in which 2-naphthylalanine or its C-terminal carboxyl group is reduced to a hydroxymethyl group or a formyl group, (4)
Amino acid derivative in which cyclohexylalanine or its C-terminal carboxyl group is reduced to a hydroxymethyl group or formyl group, (5) hydroxyl group, (6) dipeptide chain formed by binding L-proline and L-phenylalanine or its C-terminal carboxyl group A peptide derivative in which is reduced to a hydroxylmethyl group or formyl group, (7) A peptide derivative in which L-proline and L-tyrosine are bound or a C-terminal carboxyl group thereof is reduced to a hydroxylmethyl group or a formyl group , (8) L-proline and L-2-thienylalanine-bonded dipeptide chain or its C-terminal carboxyl group reduced to a hydroxylmethyl group or a formyl group, (9) L-proline and L- A dipeptide chain or its bound to phenylglycine A peptide derivative having a C-terminal carboxyl group reduced to a hydroxylmethyl group or a formyl group, (10) a dipeptide chain formed by binding L-proline and 4-chlorophenylalanine or its C-terminal carboxyl group to a hydroxylmethyl group or a formyl group. Reduced peptide derivative, (11) L-proline and 2
A dipeptide chain having naphthylalanine bound thereto or a peptide derivative having a C-terminal carboxyl group reduced to a hydroxylmethyl group or a formyl group, (12) a dipeptide chain having L-proline bound to 3-iodotyrosine or A peptide derivative in which the C-terminal carboxyl group is reduced to a hydroxylmethyl group or a formyl group, (1
3) A peptide derivative in which L-proline and O-methyltyrosine are bound or a C-terminal carboxyl group thereof is reduced to a hydroxylmethyl group or a formyl group, or (14) L-proline and L-2-pyridyl Examples thereof include a dipeptide chain formed by binding alanine or a peptide derivative in which the C-terminal carboxyl group thereof is reduced to a hydroxylmethyl group or a formyl group.

As “-X ⁴ -X ⁵ ”, (1) -Nle-Pro-Phe, (2) -Nle-Pro-Tyr, (3) -Nle-P are particularly preferable.
ro, (4) -Nle, (5) -Met-Pro-Phe, (6) -Nle-Pro-Thi,
(7) -Nle-Pro-Phg, (8) -Nle-Pro-Pya (2), (9) -Met
(O), (10) -Met-Phe (Cl), (11) -Met-Pro-Phe (Cl), (1
2) -Met-Pro-Nal (2), (13) -Met-Nal (2), (14) -Met-Ch
a, (15) -Cha-Pro-Phe, (16) -Cha, (17) -Met-Pro-Tyr
(I) and (18) -Met-Pro-Tyr (Me).

Specific examples of modified apelin (I) include, for example, (1) Leu-Val-Gln-Pro-Arg-Gly-Ser-Arg-As.
n-Gly-Pro-Gly-Pro-Trp-Gln-Gly-Gly-Arg-Arg-Lys-Phe-
Arg-Arg-Gln-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Nl
e-Pro-Phe (SEQ ID NO: 13), (2) Leu-Val-Gln-Pro
-Arg-Gly-Ser-Arg-Asn-Gly-Pro-Gly-Pro-Trp-Gln-Gly-G
ly-Arg-Arg-Lys-Phe-Arg-Arg-Gln-Arg-Pro-Arg-Leu-Ser
-His-Lys-Gly-Pro-Nle-Pro-Tyr (SEQ ID NO: 14),
(3) pGlu-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Nle-P
ro-Phe (SEQ ID NO: 15), (4) pGlu-Arg-Pro-Arg-L
eu-Ser-His-Lys-Gly-Pro-Nle-Pro-Tyr (SEQ ID NO: 1
6), (5) pGlu-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro
-Nle-Pro (SEQ ID NO: 17), (6) pGlu-Arg-Pro-Arg
-Leu-Ser-His-Lys-Gly-Pro-Nle (SEQ ID NO: 18),
(7) Ac-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Nle-Pro
-Tyr (SEQ ID NO: 19), (8) Ac-Arg-Pro-Arg-Leu-S
er-His-Lys-Gly-Pro-Nle-Pro (SEQ ID NO: 20),
(9) Ac-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Nle
(SEQ ID NO: 21), (10) pGlu-Arg-Pro-Arg-Leu-Ser-
His-Lys (Ac) -Gly-Pro-Met-Pro-Phe (SEQ ID NO: 2
2), (11) pGlu-Arg-Pro-Arg-Leu-Ser-His-Lys (Me) -Gl
y-Pro-Met-Pro-Phe (SEQ ID NO: 23), (12) pGlu-A
rg-Pro-Arg-Leu-Ser-His-Lys (Ac) -Gly-Pro-Nle-Pro-Phe
(SEQ ID NO: 24), (13) pGlu-Arg-Pro-Arg-Leu-Se
r-His-Lys (Me) -Gly-Pro-Nle-Pro-Phe (SEQ ID NO: 2
5), (14) pGlu-Arg-Pro-Arg-Leu-Ser-His-Lys (Tos) -G
ly-Pro-Nle-Pro-Phe (SEQ ID NO: 26), (15) pGlu-
Arg-Pro-Arg-Leu-Ser-His-Arg (Tos) -Gly-Pro-Nle-Pro-P
he (SEQ ID NO: 27), (16) pGlu-Arg-Pro-Arg-Nle-
Ser-His-Lys-Gly-Pro-Nle-Pro-Phe (SEQ ID NO: 2
8), (17) pGlu-Arg-Pro-Arg-Nle-Ser-His-Lys-Gly-Pr
o-Nle-Pro-Tyr (SEQ ID NO: 29), (18) pGlu-Arg-P
ro-Arg-Leu-Ser-His-Lys-Gly-Pro-Nle-Pro-Thi (SEQ ID NO: 30), (19) pGlu-Arg-Pro-Arg-Leu-Ser-His-Ly
s-Gly-Pro-Nle-Pro-Phg (SEQ ID NO: 31), (20) pG
lu-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Nle-Pro-Pya
(2) (SEQ ID NO: 32), (21) Arg-Pro-Arg-Leu-Ser
-His-Lys-Gly-Pro-Nle-Pro-Tyr (SEQ ID NO: 33),
(22) Leu-Val-Adi (NH ₂ ) -Pro-Arg-Gly-Ser-Arg-Asn-Gly-
Pro-Gly-Pro-Trp-Gln-Gly-Gly-Arg-Arg-Lys-Phe-Arg-Ar
g-Gln-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Nle-Pro-
Phe (SEQ ID NO: 34), (23) Leu-Val-Lys (Ac) -Pro-
Arg-Thr-Ser-Arg-Thr-Gly-Pro-Gly-Ala-Trp-Gln-Gly-Gl
y-Arg-Arg-Lys-Phe-Arg-Arg-Gln-Arg-Pro-Arg-Leu-Ser-
His-Lys-Gly-Pro-Nle-Pro-Tyr (SEQ ID NO: 35),
(24) Tyr-Leu-Val-Lys-Pro-Arg-Thr-Ser-Arg-Thr-Gly-P
ro-Gly-Ala-Trp-Gln-Gly-Gly-Arg-Arg-Lys-Phe-Arg-Arg
-Gln-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Nle-Pro-P
he (SEQ ID NO: 36), (25) Z-pGlu-Arg-Pro-Arg-Le
u-Ser-His-Lys (Ac) -Gly-Pro-Nle-Pro-Phe (SEQ ID NO: 37), (26) Arg-Arg-Gln-Arg-Pro-Arg-Leu-Ser-H
is-Lys-Gly-Pro-Met (O) (SEQ ID NO: 38), (27) Ar
g-Arg-Gln-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Nle-
Pro-Tyr (SEQ ID NO: 39), (28) pGlu-Arg-Pro-Arg
-Leu-Ser-His-Lys-Gly-Pro-Met-Phe (Cl) (SEQ ID NO:
40), (29) pGlu-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-
Pro-Met-Pro-Phe (Cl) (SEQ ID NO: 41), (30) Arg-
Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Met-Pro-Nal (2)
(SEQ ID NO: 42), (31) Arg-Pro-Arg-Leu-Ser-His-L
ys-Gly-Pro-Met-Nal (2) (SEQ ID NO: 43), (32) Ar
g-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Met-Pro-Phe (Cl)
(SEQ ID NO: 44), (33) Arg-Pro-Arg-Leu-Ser-His
-Lys-Gly-Pro-Met-Phe (Cl) (SEQ ID NO: 45), (34)
Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Met-Cha (SEQ ID NO: 46), (35) pGlu-Arg-Pro-Arg-Leu-Ser-His
-Lys-Gly-Pro-Cha-Pro-Phe (SEQ ID NO: 47), (36)
Arg-Arg-Gln-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-C
ha (SEQ ID NO: 48), (37) Arg-Arg-Gln-Arg-Pro-A
rg-Leu-Ser-His-Lys-Gly-Pro-Met-Pro-Phe (Cl) (SEQ ID NO: 49), (38) Arg-Arg-Gln-Arg-Pro-Arg-Leu-Ser
-His-Nle-Gly-Pro-Met-Pro-Phe (Cl) (SEQ ID NO: 5)
0), (39) Arg-Arg-Gln-Arg-Pro-Arg-Leu-Ser-His-Nle
-Gly-Pro-Met-Pro-Tyr (I) (SEQ ID NO: 51), and (40) Arg-Arg-Gln-Arg-Pro-Arg-Leu-Ser-His-Nle-Gly
-Pro-Met-Pro-Tyr (Me) (SEQ ID NO: 52) and the like.

The modified form (II) of apelin has the formula P1-Ar
g-Pro-Arg-Leu-Phe-P2-P3-G
With ly-Pro-P4-P5, a modified form of apelin (II
I) is of the formula Q1-Arg-Pro-Arg-Leu-S.
er-Ala-Q2-Gly-Q5-Q3-Q4, the modified form (IV) of apelin has the formula R1-Arg-Pro-A.
rg-Leu-Ser-His-Lys-Gly-Pr
Represented by o-R2-Pro-R3, each amino acid residue (side chain) in the formula may be substituted, and examples of the substituent include the above-mentioned substituents and the like. In the present specification, P1, Q1 and R1 represent “a hydrogen atom or an amino acid residue or a peptide chain consisting of 1 to 25 amino acids which may be the same or different and whose side chains may be substituted”. Examples of the substituent in the “1 to 25 amino acids whose side chain may be substituted” are the same as the above “Substituents which may be substituted in the side chain of an amino acid residue”. Can be given. Preferred examples when P1, Q1 and R1 represent “an amino acid residue whose side chain may be substituted” include, for example, optionally substituted pyroglutamic acid or optionally substituted side chain glutamine. And the like, and more preferably pyroglutamic acid or glutamine. The “amino acid residue whose side chain may be substituted”,
Examples of the substituent of the amino acid residue in the “optionally substituted pyroglutamic acid” and “the side chain may be substituted glutamine” include, for example, the above “the side chain of the amino acid residue may be substituted. The same as "good substituents" can be mentioned. Moreover, a benzyloxycarbonyl group etc. are mentioned as a preferable substituent of "pyroglutamic acid which may be substituted". Specific examples when P1, Q1 and R1 represent “a peptide chain consisting of 2 to 25 amino acids which may be the same or different and whose side chains may be substituted” include, for example, the formula Y ¹ -Y ² ( In the formula, Y ¹ represents an amino acid residue or a peptide chain consisting of 1 to 17 amino acids in which the side chains may be the same or different and the side chains may be substituted, and Y ² is the same or different and the side chains are substituted. A peptide represented by an amino acid residue or a peptide chain consisting of 1 to 8 amino acids which may be present. Examples of the substituent on the side chain of the amino acid residue represented by Y ¹ and Y ² or the amino acid residue in the peptide chain include the above-mentioned “substituent which may be substituted on the side chain of the amino acid residue”. And the like.

Y above¹For example,
For example, formula (a) A¹-A^Two-A^Three-A^Four-A⁵-A⁶-A
⁷-A⁸-A⁹-A¹⁰-A ¹¹-A¹²-A^Thirteen-A
¹⁴-A¹⁵-A¹⁶-A¹⁷(In the formula, A¹Through A
¹⁷Have the same or different side chains
An amino acid residue which may be present), (b) Formula A^Two-A^Three−
A^Four-A⁵-A⁶-A⁷-A⁸-A⁹-A¹⁰-A¹¹
-A¹²-A^Thirteen-A¹⁴-A¹⁵-A¹⁶-A
¹⁷(Wherein each symbol has the same meaning as described above), (c) formula
A^Three-A^Four-A⁵-A⁶-A⁷-A⁸-A⁹-A¹⁰−
A¹¹-A¹²-A^Thirteen-A¹⁴-A¹⁵-A¹⁶-A
¹⁷(Wherein each symbol has the same meaning as described above), (d) formula
A^Four-A⁵-A⁶-A⁷-A⁸-A⁹-A¹⁰-A¹¹
-A¹²-A^{1 Three}-A¹⁴-A¹⁵-A¹⁶-A
¹⁷(Wherein each symbol has the same meaning as described above), (e) formula
A⁵-A⁶-A⁷-A⁸-A⁹-A¹⁰-A¹¹-A
¹²-A^Thirteen-A ¹⁴-A¹⁵-A¹⁶-A¹⁷(formula
Where each symbol has the same meaning as above), (f) Formula A⁶-A
⁷-A⁸-A⁹-A¹⁰-A¹¹-A¹²-A^Thirteen-A
¹⁴-A¹⁵-A¹⁶-A¹⁷(In the formula, each symbol is as described above.
Have the same meaning), (g) Formula A⁷-A⁸-A⁹-A¹⁰−
A¹¹-A¹²-A^Thirteen-A¹⁴-A¹⁵-A¹⁶-A
¹⁷(In the formula, each symbol has the same meaning as described above), (h) formula
A⁸-A⁹-A¹⁰-A¹¹-A¹²-A^Thirteen-A¹⁴
-A¹⁵-A^{1 6}-A¹⁷(In the formula, each symbol is the same as above.
Meaning)), (i) Formula A⁹-A¹⁰-A¹¹-A¹²−
A^Thirteen-A¹⁴-A¹⁵-A¹⁶-A ¹⁷(In the formula, each note
No. has the same meaning as above), (j) Formula A¹⁰-A¹¹−
A¹²-A^Thirteen-A¹⁴-A¹⁵-A¹⁶-A¹⁷(formula
Where each symbol has the same meaning as above), (k) Formula A¹¹−
A¹²-A^Thirteen-A¹⁴-A¹⁵-A¹⁶-A¹⁷(formula
Where each symbol has the same meaning as above), (l) Formula A¹²−
A^Thirteen-A¹⁴-A¹⁵-A¹⁶-A¹⁷(In the formula, each note
No. has the same meaning as above), (m) Formula A^Thirteen-A¹⁴−
A¹⁵-A¹⁶-A¹⁷(In the formula, each symbol has the same meaning as above.
), (N) Formula A¹⁴-A¹⁵-A¹⁶-A
¹⁷(Wherein each symbol has the same meaning as described above), (0) formula
A¹⁵-A¹⁶-A¹⁷(In the formula, each symbol has the same meaning as above.
, (P) Formula A¹⁶-A¹⁷(Each symbol in the formula
Has the same meaning as above) or (q) A¹⁷(A¹⁷Is before
Which has the same meaning as the above)
Examples include tide chains.

The above A ¹ represents an amino acid residue whose side chain may be substituted, preferably an amino acid residue having an aromatic side chain, and more preferably L-having an aromatic side chain. Amino acid residues, more preferably L-tyrosine and the like are shown. The above A ² and A ³ are the same or different and each represents an amino acid residue whose side chain may be substituted, preferably a neutral amino acid residue whose side chain may be substituted, more preferably , L-neutral amino acid residue whose side chain may be substituted, more preferably, A ² is L-leucine and the like, and A ³ is L-valine and the like. The above A ⁴ represents an amino acid residue whose side chain may be substituted, preferably a neutral or basic amino acid residue whose side chain may be substituted, more preferably a side chain substituted. Optionally L-neutral or L-basic amino acid residue, more preferably L-lysine or N ^ε -acetyllysine. The above A ⁵ represents an amino acid residue whose side chain may be substituted, preferably a neutral amino acid residue whose side chain may be substituted, more preferably L-which may be substituted. Proline, more preferably L-proline and the like are shown. The above A ⁶ and A ⁹ are the same or different and each represent an amino acid residue whose side chain may be substituted, preferably a basic amino acid residue whose side chain may be substituted, and more preferably , L-basic amino acid residue whose side chain may be substituted, more preferably L-arginine. The above A ⁷ and A ¹⁰ are the same or different and each represent an amino acid residue whose side chain may be substituted, but preferably, an amino acid residue having a hydroxy group in the side chain or a side chain is substituted. It also indicates a neutral amino acid residue. As A ⁷ , glycine which may be substituted, particularly glycine, is preferably used. The above A ⁸ represents an amino acid residue whose side chain may be substituted, preferably an amino acid residue having L-proline or a hydroxy group in its side chain, more preferably L-serine, L
-Indicates proline or oxyproline (hydroxyproline) and the like. The above A ¹⁰ is preferably an amino acid residue having a hydroxy group in its side chain or a neutral amino acid residue whose side chain may be substituted, more preferably serine, threonine, asparagine and the like. A ¹¹ above
To A ¹⁴ are the same or different and each represent an amino acid residue whose side chain may be substituted, preferably a neutral amino acid residue whose side chain may be substituted, more preferably A ¹¹ Are glycine, A ¹² is L-proline, A ¹³ is glycine, and A ¹⁴ is L-alanine, L-proline and the like. The above A ¹⁵ represents an amino acid residue whose side chain may be substituted, preferably an amino acid residue having an aromatic side chain, more preferably an L-amino acid having an aromatic side chain. Residues, more preferably L-tryptophan and the like are shown. The above A ¹⁶ represents an amino acid residue whose side chain may be substituted, preferably a neutral amino acid residue whose side chain may be substituted, more preferably a neutral L- having a carbamoyl group. Amino acid residue, more preferably L-
Indicates glutamine. Examples of the neutral L-amino acid residue having a carbamoyl group include L-glutamine and L-asparagine. A ¹⁷ represents an amino acid residue whose side chain may be substituted, preferably a neutral amino acid residue whose side chain may be substituted, more preferably glycine and the like.

Y above^TwoFor example,
For example, formula B¹-B^Two-B^Three-B^Four-B⁵-B⁶-B⁷
-B⁸(In the formula, B¹Through B ⁸Are the same or different
Indicates an amino acid residue whose side chain may be substituted.
), Formula B^Two-B^Three-B^Four-B⁵-B⁶-B⁷-B
⁸(Wherein each symbol has the same meaning as above), Formula B^Three
-B^Four-B⁵-B⁶-B⁷-B⁸(In the formula, each symbol is as described above.
And has the same meaning as), formula B^Four-B⁵-B⁶-B⁷-B
⁸(Wherein each symbol has the same meaning as above), Formula B⁵
-B⁶-B⁷-B⁸(In the formula, each symbol has the same meaning as above.
), Formula B⁶-B⁷-B⁸(In the formula, each symbol is as above.
Have the same meaning), Formula B⁷-B⁸(In the formula, each symbol is above
And the formula B⁸(B⁸Is the same as above
Amino acid residue or peptide chain represented by
And so on. B above¹Even if the side chain is substituted
A good amino acid residue is shown, but preferably the side chain is substituted.
A neutral amino acid residue which may be
A neutral L-amino acid residue whose chain may be substituted, further
Is preferably an optionally substituted glycine, most preferably
More preferably, it represents glycine or the like. B above^TwoThrough B^FourIs
Even if each side chain is the same or different and substituted
A good amino acid residue is shown, but preferably the side chain is substituted.
Optionally basic amino acid residue, more preferably,
A basic L-amino acid residue whose side chain may be substituted,
More preferably, B^TwoAs L-arginine, B^Three
As L-arginine, B^FourAs L-lysine
I will show you. B above⁵Is an amino group whose side chain may be substituted.
No acid residue is shown, but preferably has an aromatic side chain
Has an amino acid residue, more preferably an aromatic side chain.
L-amino acid residue, more preferably L-phenyl
Indicates lualanine and the like. B above⁶And B⁷Are each
The same or different amino groups whose side chains may be substituted
No acid residue, preferably with a substituted side chain
A basic amino acid residue, more preferably a side chain
A basic L-amino acid residue which may be replaced, more preferably
More preferably, it represents L-arginine or the like. B above⁸Is the side chain
Represents an amino acid residue which may be substituted,
More preferably, glutamine, which may have a substituted side chain, is more preferable.
More preferably, L-glutamine and the like are shown.

Y¹And Y^TwoAs a combination of
When expressed by (a) expression + above expression
(Ie X¹But A ¹-A^Two-A^Three-A^Four-A⁵-A⁶−
A⁷-A⁸-A⁹-A¹⁰-A¹¹-A^{1 Two}-A^Thirteen−
A¹⁴-A¹⁵-A¹⁶-A¹⁷-B¹-B^Two-B^Three−
B^Four-B⁵-B⁶-B⁷-B⁸When represented by:
It is omitted in the explanation of the combination), and is shown in (a) above.
When expressed by the above formula + the above formula, the above
(a) + the above expression
If it is expressed as (a) above + the above expression
If the above is true, the formula represented by (a) above + the formula represented by above
When expressed by, the expression expressed in (a) above + expressed in the above
When expressed by the formula, the formula expressed by (a) above + the above
When expressed by the formula, the formula expressed by (a) above +
When represented by the formula represented above, represented by (b) above
When expressed by the formula + the above formula, in (b) above
When expressed by the expression + the above expression, the above
(b) + the above expression
In this case, the formula expressed by (b) above + the formula expressed by above
If the above is true, the formula expressed in (b) above + the formula expressed above
When expressed by, the formula expressed by (b) above + expressed by the above
When expressed by the formula, the formula expressed by (b) above + the above
When expressed by the formula, the formula expressed by (b) above +
When represented by the formula represented above, represented by the above (c)
In case of the formula + the formula above, in (c) above
When expressed by the expression + the above expression, the above
(c) + (expression above)
In this case, it is represented by the formula (c) above + the formula above
If the above is true, the formula represented by (c) above + the formula represented by above
When expressed by, the formula expressed by (c) above + expressed by the above
When expressed by the formula, the formula expressed by (c) above + the above
When expressed by the formula, the formula expressed by (c) above +
When represented by the formula represented above, it is represented by (d) above.
In the case of the formula + the formula shown above, in (d) above
When expressed by the expression + the above expression, the above
(d) + the above expression
In this case, it is represented by the formula represented by (d) above + the formula represented by above
In case of the above, the formula represented by the above (d) + the formula represented by the above
When expressed by, the formula expressed by (d) above + expressed by the above
When expressed by the formula, the formula expressed by (d) above + the above
When expressed by the formula, the formula expressed by (d) above +
When represented by the formula represented above, it is represented by (e) above.
In case of the formula + the formula shown above, in (e) above
When expressed by the expression + the above expression, the above
(e) + the above expression
In this case, the formula expressed by (e) above + the formula expressed by above
If the above is true, the formula expressed in (e) above + the formula expressed above
When expressed by, the expression expressed by (e) above + expressed by the above
When expressed by the formula, the formula expressed by (e) above + the above
When expressed by the formula, the formula expressed by (e) above +
When represented by the formula represented above, it is represented by (f) above.
In the case of being expressed by the formula + the above formula, in (f) above
When expressed by the expression + the above expression, the above
(f) + the above expression
In this case, it is expressed by the formula shown in (f) above + the formula shown above
In case of the above, the formula represented by the above (f) + the formula represented by the above
When expressed by, the formula expressed by (f) above + expressed by
When expressed by the formula, the formula expressed by (f) above + the above
When expressed by the formula, the formula expressed by (f) above +
When represented by the formula represented above, represented by (g) above
Formula + the above formula, in (g) above
When expressed by the expression + the above expression, the above
(g) + the above expression
If it is expressed by the formula (g) above + the formula above
If the above is true, the formula represented by the above (g) + the formula represented by the above
When expressed by, the formula expressed by (g) above + expressed by
When expressed by the formula, the formula expressed by (g) above + the above
When expressed by the formula, the formula expressed by (g) above +
When represented by the formula represented above, it is represented by (h) above.
In the case of being expressed by the formula + the above formula, in (h) above
When expressed by the expression + the above expression, the above
(h) + the above expression
In this case, it is expressed by the formula represented by (h) + the formula represented by the above.
In case of the above, the formula represented by the above (h) + the formula represented by the above
When expressed by, the formula expressed by (h) above + expressed by the above
When expressed by the formula, the formula expressed by (h) above + the above
When expressed by the formula, the formula expressed by (h) above +
When represented by the formula represented above, represented by (i) above
In the case of the above formula + the above formula, in (i) above
When expressed by the expression + the above expression, the above
(i) + the above expression
In this case, it is represented by the formula (i) above + the formula above
If the above is true, the formula represented by (i) above + the formula represented by above
When expressed by, the expression expressed by (i) above + expressed by the above
When expressed by the formula, the formula expressed by (i) above + the above
When expressed by the formula, the formula expressed by (i) above +
When represented by the above formula, it is represented by (j) above.
Formula + the above formula, in (j) above
When expressed by the expression + the above expression, the above
(j) + (expression above)
If it is expressed as (j) above + the above expression
If the above is true, the formula expressed in (j) above + the formula expressed above
When expressed by, the expression expressed by (j) above + expressed by the above
When expressed by the formula, the formula expressed by (j) above + the above
When expressed by the formula, the formula expressed by (j) above +
When represented by the formula represented above, it is represented by (k) above.
In the case of being expressed by the formula + the above formula, in (k) above
When expressed by the expression + the above expression, the above
(k) + the above expression
If it is expressed by the above formula (k) + the above formula,
In case of the above, the formula represented by the above (k) + the formula represented by the above
When expressed by, the expression expressed by (k) above + expressed by the above
When expressed by the formula, the formula expressed by (k) above + the above
When expressed by the formula, the formula expressed by (k) above +
When represented by the formula represented above, it is represented by (l) above.
Formula + the above formula, in (l) above
When expressed by the expression + the above expression, the above
(l) + the above expression
The formula expressed by (l) above + the formula expressed by above
If the above is true, the formula represented by (l) above + the formula represented above
When expressed by, the formula expressed by (l) above + the above expressed
When expressed by the formula, the formula expressed by (l) above + the above
When expressed by the formula, the formula expressed by (l) above +
When represented by the formula represented above, it is represented by (m) above.
In the case of being expressed by the formula + the above formula, in (m) above
When expressed by the expression + the above expression, the above
(m) + the above expression
If it is expressed by the formula (m) above + the formula above
In case of the above, the formula represented by the above (m) + the formula represented by the above
When expressed by, the formula expressed by (m) above + expressed by the above
When expressed by the formula, the formula expressed by (m) above + the above
When expressed by the formula, the formula expressed by (m) above +
When represented by the formula represented above, represented by (n) above
When expressed by the formula + the formula above, in (n) above
When expressed by the expression + the above expression, the above
(n) + the above expression
In this case, it is represented by the formula represented by (n) above + the formula represented by above
If the above is true, the formula represented by (n) above + the formula represented above
Is expressed by the above formula (n) + the above
When expressed by the formula, the formula expressed by (n) above + the above
When expressed by the formula, the formula expressed by (n) above +
When represented by the formula represented above, it is represented by (o) above.
In case of the formula + the formula shown above, the above (o)
When expressed by the expression + the above expression, the above
(o) + the above expression
If it is expressed as (o) above + the above expression
If the above is true, the formula represented by (o) above + the formula represented by above
When expressed by, the expression expressed by (o) above + expressed by the above
When expressed by the formula, the formula expressed by (o) above + the above
When expressed by the formula, the formula expressed by (o) above +
When represented by the formula represented above, it is represented by (p) above.
In the case of the formula + the formula shown above, in (p) above
When expressed by the expression + the above expression, the above
(p) + the above expression
In this case, it is expressed by the formula (p) above + the formula above
In case of the above, the formula represented by the above (p) + the formula represented by the above
When expressed by, the expression expressed by (p) above + expressed by the above
When expressed by the formula, the formula expressed by (p) above + the above
When expressed by the formula, the formula expressed by (p) above +
When expressed by the above formula, it is expressed by (q) above.
In the case of the formula + the formula shown above, the above (q)
When expressed by the expression + the above expression, the above
(q) + the above expression
If it is expressed as (q) above + (expression above)
In case of the above, the formula represented by the above (q) + the formula represented by the above
When expressed by, the expression expressed by (q) above + expressed by the above
When expressed by the formula, the formula expressed by (q) above + the above
When represented by the formula represented by, and represented by (q) above
There are cases where it is expressed by the formula + the formula shown above.
But,

Above all, the formula represented by the above (a) + the above
When expressed by the formula, the formula expressed by (b) above +
When represented by the formula represented above, represented by the above (c)
In the case of the formula + the formula shown above, in (d) above
When expressed by the expression + the above expression, the above
(e) + the above expression
In this case, it is expressed by the formula shown in (f) above + the formula shown above
If the above is true, the formula represented by the above (g) + the formula represented by the above
When expressed by, the formula expressed by (h) above + expressed by the above
When expressed by the formula, the formula expressed by (i) above + the above
When expressed by the formula, the formula expressed by (j) above +
When represented by the formula represented above, it is represented by (k) above.
Formula + the above formula, in (l) above
When expressed by the expression + the above expression, the above
(m) + the above expression
In this case, it is represented by the formula represented by (n) above + the formula represented by above
If the above is true, the formula represented by (o) above + the formula represented by above
When expressed by, the expression expressed by (p) above + expressed by the above
When expressed by the formula, and the formula expressed by (q) above +
The case represented by the formula shown above is preferable. in
Is also expressed by the formula shown in (a) above + the formula shown above
And the formula shown in (b) above + the above
The case represented by the formula
It Expressed by the formula shown in (a) above + the formula shown above
And the formula shown in (b) above + the above
A more preferable specific example of the case represented by the formula
You Expressed by the formula shown in (b) above + the formula shown above
And P1, Q1 and / or R1 are of the formula A
^Two-A^Three-A^Four-A⁵-A⁶-A⁷-A⁸-A⁹-A
¹⁰-A¹¹-A¹²-A^Thirteen-A¹⁴-A¹⁵-A
¹⁶-A¹⁷-B¹-B ^Two-B^Three-B^Four-B⁵-B⁶−
B⁷-B⁸(In the formula, A²Through A¹⁷And B¹No
B⁸Has the same meaning as above).
However, a preferred specific example in this case is A^Twoand
A^ThreeAre the same or different and the side chains are
Optional L-neutral amino acid residue, preferably A^Twoage
Such as L-leucine, A^ThreeAs for L-valine etc.
Yes, A^FourIs an L-neutral optionally substituted side chain,
Is L-basic amino acid residue, preferably L-glutamine
L-lysine or N^ε-Such as acetyllysine
A⁵Is L-proline in which the side chain may be substituted,
Preferred is L-proline or the like, and A⁶And A⁹
Are the same or different and the side chains are
Good L-basic amino acid residue, preferably L-argi
Such as nin, A⁷Glycy optionally substituted
A, preferably glycine and the like, A⁸Is L-Proli
Amino acid residues having side chains or hydroxyl groups,
Preferably, L-serine, L-proline or oxypro
Such as phosphorus (hydroxyproline), A¹⁰But hi
Amino acid residue or side chain having droxy group
An optionally substituted neutral amino acid residue, preferably L-
Serine, L-threonine, L-asparagine, etc.
A¹¹Is glycine, A¹²Is L-proline, A^Thirteen
Is glycine, A¹⁴Is L-alanine or L-proline
What is A¹⁵L-amino having an aromatic side chain
Acid residue, preferably L-tryptophan and the like,
¹⁶Is a neutral L-amino acid residue having a carbamoyl group,
More preferably L-glutamine, A¹⁷Is a neutral amino acid
A residue, preferably glycine and the like, B¹Has side chains
An optionally substituted neutral L-amino acid residue, preferably
Is an optionally substituted glycine, more preferably,
Such as glycine, B^TwoThrough B^FourAre the same
Alternatively, a basic L-, in which the side chain may be substituted,
Amino acid residue, preferably B^TwoAs L-Arginii
B,^ThreeAs L-arginine, B^FourAs L-
Such as lysine, B⁵L-has an aromatic side chain
Amino acid residue, preferably L-phenylalanine etc.
And B⁶And B⁷Are the same or different
And a basic L-amino acid residue whose side chain may be substituted.
A group, preferably L-arginine and the like, B⁸Is on the side
Glutamine whose chain may be substituted, preferably L
-Examples include glutamine.

Formula represented by (a) above + represented by above
When expressed by a formula, X¹Is the expression A ¹-A^Two-A^Three−
A^Four-A⁵-A⁶-A⁷-A⁸-A⁹-A¹⁰-A¹¹
-A^{1 Two}-A^Thirteen-A¹⁴-A¹⁵-A¹⁶-A¹⁷−
B¹-B^Two-B^Three-B^Four-B⁵-B⁶-B⁷-B⁸(formula
Medium, A¹Through A¹⁷And B¹Through B⁸Is the same as above
In this case,
As a preferred specific example of¹Has aromatic side chains
L-amino acid residue, more preferably L-tyrosine
And A^TwoAnd A^ThreeAre the same or different
And an L-neutral amino acid residue whose side chain may be substituted
A group, preferably A^TwoAs L-leucine, A^ThreeWhen
Is L-valine, and A^FourHas side chains replaced
L-neutral or L-basic amino acid residue which may be
More preferably, L-glutamine, L-α aminoadipic acid, L-
Lysine or N^ε-Acetyllysine, etc., A⁵But
Optionally substituted L-proline, preferably L-proline
Such as Lorin, A⁶And A⁹Are the same
Are different from each other, and L-basic acid optionally substituted in the side chain.
A mino acid residue, preferably L-arginine and the like, A
⁷Optionally substituted glycine, preferably glycine
A, etc., and⁸Is L-proline or hydroxy group
An amino acid residue having a side chain, preferably L-seri
, L-proline or oxyproline (hydroxyproline
Lorin) etc., and A¹⁰Has a hydroxy group in the side chain
The amino acid residue or side chain to
Amino acid residue, preferably L-serine, L-threoni
A, L-asparagine, etc.¹¹Is glycine,
A¹²Is L-proline, A^ThirteenIs glycine, A¹⁴Is L-
Such as alanine or L-proline, A¹⁵Is fragrance
L-amino acid residue having an aromatic side chain, preferably L-
Tryptophan, etc., A¹⁶Is a carbamoyl group
Having a neutral L-amino acid residue, preferably L-glutamine
And A¹⁷Is a neutral amino acid residue, preferably
Shin, etc., B¹In which the side chain may be substituted
Sex L-amino acid residue, preferably optionally substituted
Glycine, more preferably glycine and the like, B
^TwoThrough B^FourAre the same or different and the side chains are
A basic L-amino acid residue which may be replaced, preferably
Is B^TwoAs L-arginine, B^ThreeAs L-a
Luginin, B^FourIs L-lysine or the like, and B⁵
Is an L-amino acid residue having an aromatic side chain, preferably
Is L-phenylalanine or the like, and B⁶And B⁷
Are the same or different and the side chains are
A basic L-amino acid residue, preferably L-alcohol
Guinin, etc., B⁸May have a side chain substituted
Glutamine, preferably L-glutamine L-pyrogluta
Examples include cases where it is a mycotic acid.

Preferred components for P1, Q1 and R1
As body examples, (1) hydrogen atom, (2) Arg-Gln, (3) Arg, (4)
Gln, (5) pGlu, or (6) Arg-Arg-Gln.
It Further, P1 is a hydrogen atom, pGlu or
Arg-Arg-Gln is more preferable, and Q1 is hydrogen atom.
Child, pGlu or Arg-Arg-Gln is more preferred, and R1
Is a hydrogen atom, pGlu or Arg-Arg-Gln (further
Is more preferably a hydrogen atom or Arg-Arg-Gln). True spirit
In the detailed text, P2 is a neutral group whose side chain may be substituted.
Basicity in which amino acid residues or side chains may be substituted
Indicates an amino acid residue, preferably substituted (side chain)
Optionally L-alanine, substituted (side chain)
Moyoi L-histidine and the like can be mentioned. In this specification
And side chains of P3 and Q2 may be substituted.
Aromatic amino acid residue, aromatic group which side chain may be substituted
Minoic acid residue or basic that side chain may be substituted
Indicates an amino acid residue. Placement of a basic amino acid residue on the side chain
Examples of the substituent include C_1-4Acyl group, tosyl group, C
_1-6Examples thereof include an alkyl group. C_1-4Acyl group
As, for example, formyl, acetyl, propionyl,
Butyryl and C_2-4Such as alkanoyl
Be done. C_1-6Examples of the alkyl group include methyl and ether.
Chill, propyl, isopropyl, butyl, isobutyl,
sec-butyl, tert-butyl, pentyl, hexyl etc.
Can be given. P3 and Q2 are preferably side chains
L-lysine optionally substituted, side chain substituted
L-norleucine which may be present, or a side chain is substituted
L-arginine, etc., which can be used, are preferred and more preferred.
The side chain is C_1-4Acyl group (eg formyl, acetyl
And propionyl, butyryl and C and_2-4Arca
Noil), C_1-6Alkyl group (eg, methyl, ethyl
Le, propyl, isopropyl, butyl, isobutyl, se
(C-butyl, tert-butyl, pentyl, hexyl etc.)
Or L-lysine optionally substituted with a tosyl group, L
-Norleucine or L-arginine and the like,
More preferably, L-lysine, L-norleucine, L
-Arginine, N^ε-Acetyllysine, N^ε-Methyl
Jin, N ^ε-Tosyl lysine, N^g-Tosyl arginine
And so on. Furthermore, as P3 and Q2,
Optionally substituted L-arginine or substituted
Optional L-lysine is preferred. In this specification,
P4 and Q3 may have a bond or side chain substituted
Aromatic amines with good neutral or optionally substituted side chains
No acid residue is shown. P4 and Q3 are preferably
L-norleucine in which a bond or side chain may be substituted
L-methionine in which side chain may be substituted, side chain
L-methionine sulfoxide which may be substituted
Or L-alanine optionally substituted in the side chain
And more preferably a bond, L-norleucine,
L-methionine, L-methionine sulfoxide or
L-cyclohexylalanine and the like can be mentioned. Furthermore
In addition, as P4, L-norleucine, L-methionine
Or L-cyclohexylalanine is particularly preferable.
Yes. Further, as Q3, a bond, L-methionine or
Is particularly preferably L-cyclohexylalanine. Book
In the specification, P5 and Q4 have side chains substituted
Optional amino acid residue or its C-terminal carboxyl
Group reduced to hydroxymethyl or formyl group
Amino acid derivative, hydroxyl group or side chain is substituted
Optional amino acid residue and side chain may be substituted
Dipeptide chain formed by binding mino acid residue or C-terminal thereof
If the end carboxyl group is a hydroxylmethyl group or
Shows a peptide derivative reduced to a phenyl group.

P5 and Q4 are preferably neutral amino acid residues whose side chains may be substituted or C thereof.
Amino acid derivative whose terminal carboxyl group is reduced to hydroxymethyl group or formyl group, neutral amino acid residue which may be substituted on hydroxyl group or side chain and aromatic side chain which may be substituted on side chain Examples thereof include a dipeptide chain having an amino acid residue bound thereto or a peptide derivative in which the C-terminal carboxyl group thereof is reduced to a hydroxylmethyl group or a formyl group. More preferably as P5 and Q4, L-proline optionally substituted in the side chain or an amino acid derivative in which the C-terminal carboxyl group thereof is reduced to a hydroxymethyl group or a formyl group, or the side chain may be substituted 4 -Amino acid derivative in which chlorophenylalanine or its C-terminal carboxyl group is reduced to a hydroxymethyl group or a formyl group, 2-naphthylalanine whose side chain may be substituted or its C-terminal carboxyl group is converted to a hydroxymethyl group or a formyl group A reduced amino acid derivative, an amino acid derivative in which a C-terminal carboxyl group of cyclohexylalanine whose side chain may be substituted is reduced to a hydroxymethyl group or a formyl group,
Hydroxyl group or optionally substituted L-proline and
(a) L-phenylalanine whose side chain may be substituted, (b) L-tyrosine whose side chain may be substituted, (c)
L-2-thienylalanine whose side chain may be substituted, (d) L-phenylglycine whose side chain may be substituted, or (e) whose side chain may be substituted L-
Examples thereof include a dipeptide chain formed by binding 2-pyridylalanine, or a peptide derivative in which the C-terminal carboxyl group thereof is reduced to a hydroxylmethyl group or a formyl group. More preferably as P5 and Q4,
(1) Amino acid derivative in which L-proline or its C-terminal carboxyl group is reduced to a hydroxymethyl group or formyl group, (2) 4-chlorophenylalanine or its C-terminal carboxyl group is reduced to a hydroxymethyl group or formyl group Amino acid derivative, (3) Amino acid derivative in which 2-naphthylalanine or its C-terminal carboxyl group is reduced to hydroxymethyl group or formyl group, (4) Cyclohexylalanine or its C-terminal carboxyl group is reduced to hydroxymethyl group or formyl group Amino acid derivative, (5) hydroxyl group, (6) dipeptide chain formed by binding L-proline and L-phenylalanine or a peptide derivative in which its C-terminal carboxyl group is reduced to a hydroxylmethyl group or a formyl group, (7) L
-A peptide derivative in which proline and L-tyrosine are bound or a peptide derivative in which the C-terminal carboxyl group thereof is reduced to a hydroxylmethyl group or a formyl group, (8)
(9) L-proline bound to L-2-thienylalanine or a peptide derivative having a C-terminal carboxyl group reduced to a hydroxylmethyl group or a formyl group, (9) L-proline bound to L-phenylglycine Or a peptide derivative in which the C-terminal carboxyl group thereof is reduced to a hydroxylmethyl group or a formyl group, (10) L-proline and 4-chlorophenylalanine bound to the dipeptide chain or its C-terminal carboxyl group Peptide derivative reduced to a hydroxylmethyl group or formyl group, (11) Peptide derivative in which L-proline and 2-naphthylalanine are bound or a C-terminal carboxyl group thereof is reduced to a hydroxylmethyl group or a formyl group , (12)
A dipeptide chain consisting of L-proline and 3-iodotyrosine bound or a peptide derivative whose C-terminal carboxyl group is reduced to a hydroxylmethyl group or formyl group, (13) L-proline and O-methyltyrosine bound Peptide derivative or a peptide derivative in which the C-terminal carboxyl group thereof is reduced to a hydroxylmethyl group or a formyl group, or (14) a dipeptide chain formed by binding L-proline and L-2-pyridylalanine or its C-terminal carboxyl group Examples thereof include peptide derivatives in which is reduced to a hydroxylmethyl group or a formyl group.

"-P4-P5" and "-Q3-Q4"
As particularly preferable, (1) -Nle-Pro-Phe, (2) -Nle
-Pro-Tyr, (3) -Nle-Pro, (4) -Nle, (5) -Met-Pro-Ph
e, (6) -Nle-Pro-Thi, (7) -Nle-Pro-Phg, (8) -Nle-Pr
o-Pya (2), (9) -Met (O), (10) -Met-Phe (Cl), (11) -Me
t-Pro-Phe (Cl), (12) -Met-Pro-Nal (2), (13) -Met-Nal
(2), (14) -Met-Cha, (15) -Cha-Pro-Phe, (16) -Cha,
(17) -Met-Pro-Tyr (I), (18) -Cha-Pro-Phe (Cl), (19)
-Cha-Phe (Cl), (20) -Nle-Pro-Tyr (I), (21) -Nle-Phe
(Cl), (22) -Cha-Pro-Tyr (I), (23) -Cha-Tyr (I), (24)
-Cha-Phe, (25) -Met-Phe, (26) -Met-Pro-Tyr (Me),
(27) -OH, (28) -Met, (29) -Met-Pro-Phe, and (30)
-Ala-Pro-Phe (Cl) etc. are mentioned. Also, "-P4
-P5 "means (1) -Cha-Pro-Phe (Cl), (2) -Cha-P
ro-Phe, (3) -Met-Pro-Phe (Cl), (4) -Met-Pro-Phe (5)
-Cha-Phe, and (6) -Met-Phe are preferable, and (1) -Cha-P
ro-Phe (Cl), (2) -Cha-Pro-Phe, (3) -Met-Pro-Phe (C
l) and (4) -Met-Pro-Phe are particularly preferred. further,
"-Q3-Q4" includes (1) -Met-Pro-Phe (Cl),
(2) -Cha-Phe (Cl), (3) -Cha-Pro-Phe (Cl), (4) -Cha,
(5) -Cha-Pro-Phe, (6) -OH, (7) -Met, (8) -Met-Pro-
Phe and (9) -Ala-Pro-Phe (Cl) are especially preferred.

In the present specification, Q5 represents a neutral amino acid residue whose side chain may be substituted, preferably L-proline which may be substituted, L-glycine which may be substituted or This shows L-alanine which may be substituted. Particularly preferably as Q5, L-proline,
Indicates L-glycine or L-alanine. In the present specification, R2 represents optionally substituted L-cyclohexylalanine, preferably L-cyclohexylalanine. In the present specification, R3 is an optionally substituted L-phenylalanine, an optionally substituted L-
2-naphthylalanine, optionally substituted L-cyclohexylalanine or optionally substituted tyrosine is shown, and preferably L-4-chlorophenylalanine, L-2-naphthylalanine, L-cyclohexylalanine, L-phenylalanine. Alternatively, it represents L-tyrosine.

As a specific example of the modified form (II) of apelin
Is, for example, (1) Arg-Arg-Gln-Arg-Pro-Arg-Leu-Ser-A
la-Arg-Gly-Pro-Met-Pro-Phe (Cl), (2) Arg-Arg-Gln-A
rg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Cha-Pro-Phe (C
l), (3) Arg-Pro-Arg-Leu-Ser-Ala-Arg-Gly-Pro-Met-P
ro-Phe (Cl), (4) Arg-Pro-Arg-Leu-Ser-Ala-Arg-Gly-P
ro-Cha-Phe (Cl), (5) Arg-Pro-Arg-Leu-Ser-Ala-Arg-G
ly-Pro-Cha-Pro-Phe (Cl), (6) Arg-Arg-Gln-Arg-Pro-A
rg-Leu-Ser-Ala-Arg-Gly-Pro-Cha, (7) Arg-Pro-Arg-L
eu-Ser-His-Lys-Gly-Pro-Cha-Pro-Phe (Cl), (8) Arg-P
ro-Arg-Leu-Ser-His-Lys-Gly-Pro-Met-Pro-Phe (Cl),
(9) pGlu-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Cha-
Pro-Phe, (10) pGlu-Arg-Pro-Arg-Leu-Ser-His-Lys-Gl
y-Pro-Met-Pro-Phe (Cl), (11) Arg-Pro-Arg-Leu-Ser-A
la-Arg-Gly-Pro-Cha-Pro-Phe, (12) Arg-Pro-Arg-Leu-
Phe-Ala-Arg-Gly-Pro-Cha-Pro-Phe (Cl), (13) Arg-Pro
-Arg-Leu-Phe-His-Lys-Gly-Pro-Cha-Pro-Phe (Cl), (14)
  Arg-Arg-Gln-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-
Nle-Pro-Tyr, (15) Arg-Pro-Arg-Leu-Phe-His-Lys-Gly
-Pro-Cha-Pro-Phe, (16) Arg-Pro-Arg-Leu-Phe-His-Ly
s-Gly-Pro-Met-Pro-Phe (Cl), (17) Arg-Arg-Gln-Arg-P
ro-Arg-Leu-Ser-Ala-Arg-Gly-Pro-Met-Pro-Phe, (18)
Arg-Arg-Gln-Arg-Pro-Arg-Leu-Ser-Ala-Arg-Gly-Pro-Me
t, (19) Arg-Arg-Gln-Arg-Pro-Arg-Leu-Ser-Ala-Arg-G
ly-Pro, (20) Arg-Arg-Gln-Arg-Pro-Arg-Leu-Ser-His-
Lys-Gly-Pro-Met (O), (21) Arg-Arg-Lys (Arg-Arg) -A
rg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Met-Pro-Phe, (2
2) Arg-Arg-Arg-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pr
o-Met-Pro-Phe, (23) Arg-Arg-Lys-Arg-Pro-Arg-Leu-S
er-His-Lys-Gly-Pro-Met-Pro-Phe, (24) Arg-Pro-Arg-
Leu-Ser-Ala-Arg-Gly-Pro-Met-Pro-Phe, (25) Arg-Arg
-Ala-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Met-Pro-P
he, (26) pGlu-Arg-Pro-Arg-Leu-Ser-Ala-Arg-Gly-Pro
-Met-Pro-Phe, (27) Arg-Pro-Arg-Leu-Ser-Ala-Arg-Gl
y-Pro-Met, (28) Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-P
ro-Met-Phe (Cl), (29) pGlu-Arg-Pro-Arg-Leu-Ser-Ala
-Lys-Gly-Pro-Met-Pro-Phe, (30) pGlu-Arg-Pro-Arg-L
eu-Ser-Arg-Lys-Gly-Pro-Met-Pro-Phe, (31) Arg-Pro-
Arg-Leu-Phe-Ala-Arg-Gly-Pro-Met-Pro-Phe, (32) Arg
-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Met-Pro-Nal (2),
(33) Arg-Arg-Phe-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-
Pro-Met-Pro-Phe, (34) pGlu-Arg-Pro-Arg-Leu-Ser-Hi
s-Arg-Gly-Pro-Met-Pro-Phe, (35) pGlu-Arg-Pro-Arg-
Leu-Ser-His-Lys-Gly-Pro-Met-Phe (Cl), (36) Arg-Pro
-Arg-Leu-Ser-His-Lys-Gly-Pro-Met-Cha, (37) Arg-Pr
o-Arg-Leu-Phe-His-Lys-Gly-Pro-Cha-Phe (Cl), (38) p
Glu-Arg-Pro-Arg-Leu-Ser-Leu-Lys-Gly-Pro-Met-Pro-Ph
e, (39) pGlu-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-
Met-Pro-Nal (2), (40) Arg-Pro-Arg-Leu-Ser-His-Lys-
Gly-Pro-Met-Nal (2), (41) pGlu-Arg-Pro-Arg-Leu-Ser
-Arg-Arg-Gly-Pro-Met-Pro-Phe, (42) pGlu-Arg-Pro-A
rg-Leu-Phe-Arg-Arg-Gly-Pro-Met-Pro-Phe, (43) pGlu
-Arg-Pro-Arg-Leu-Ser-Phe-Lys-Gly-Pro-Met-Pro-Phe,
(44) pGlu-Arg-Pro-Arg-Leu-Phe-His-Lys-Gly-Pro-Met
-Pro-Phe, (45) pGlu-Arg-Pro-Arg-Leu-Ser-His-Lys-G
ly-Pro-Met-Cha, (46) pGlu-Arg-Pro-Arg-Leu-Ser-His
-Lys-Gly-Pro-Met-Nal (2), (47) Arg-Pro-Arg-Leu-Phe
-Ala-Arg-Gly-Pro-Met-Phe, (48) pGlu-Arg-Pro-Arg-L
eu-Ser-His-Phe-Gly-Pro-Met-Pro-Phe, (49) Arg-Pro-
Arg-Leu-Ser-His-Lys-Gly-Pro-Met-Pro-Cha, (50) pGl
u-Arg-Pro-Arg-Leu-Ser-His-Leu-Gly-Pro-Met-Pro-Ph
e, (51) Arg-Arg-Gln-Arg-Pro-Arg-Leu-Ser-Ala-Arg-G
ly-NMe₂, (52) Arg-Arg-Gln-Arg-Pro-Arg-Leu-Ser-Ala
-Arg-Gly-Mor, (53) Arg-Pro-Arg-Leu-Ser-Ala-Arg-Gl
y-Pro-Ala-Pro-Phe (Cl), (54) Arg-Pro-Arg-Leu-Ser-A
la-Arg-Gly-Gly-Met-Pro-Phe (Cl), (55) Arg-Pro-Arg-
Leu-Ser-Ala-Arg-Gly-N-MeAla-Met-Pro-Phe (Cl), (56)
  Arg-Pro-Arg-Leu-Ser-His-Ala-Gly-Pro-Cha-Pro-Phe
(Cl), (57) Arg-Pro-Arg-Ala-Ser-His-Lys-Gly-Pro-Ch
a-Pro-Phe (Cl), (58) Arg-Pro-Ala-Leu-Ser-His-Lys-G
ly-Pro-Cha-Pro-Phe (Cl), (59) Arg-Arg-Gln-Arg-Pro-
Arg-Leu-Ser-Ala-Arg-Gly-Pro-Met-Pro-Phe (Cl) -NH ₂,
(60) Arg-Pro-Arg-Leu-Ser-Ala-Arg-Gly-Pro-Cha-Py
n, (61) Arg-Pro-Arg-Leu-Ser-Ala-Arg-Gly-Pro-Cha-P
ro-Pyn, (62) Arg-Arg-Gln-Arg-Pro-Arg-Leu-Ser-Ala-
Arg-Gly-Gly-Cha, (63) Arg-Pro-Lys (Me)₂-Leu-Ser-Al
a-Arg-Gly-Pro-Met-Pro-Phe, (64) Arg-Pro-Arg-Leu-S
er-Ala-Lys (Me)₂-Gly-Pro-Met-Pro-Phe, (65) Arg-Pro
-Arg-Leu-Ser-Dap-Arg-Gly-Pro-Cha-Pro-Phe (Cl), (66)
  Arg-Pro-Arg-Leu-Ser-Dap (Ac) -Arg-Gly-Pro-Cha-Pr
o-Phe (Cl), (67) Arg-Pro-Arg-Leu-Ser-Dap (C₆) -Arg
-Gly-Pro-Cha-Pro-Phe (Cl), and (68) Arg-Pro-Arg-
Leu-Ser-Dap (Adi) -Arg-Gly-Pro-Cha-Pro-Phe (Cl) etc.
Can be given.

Specific examples of modified apelin (III) include Arg-Pro-Arg-Leu-Phe-Ala-Arg-Gly-Pro-Cha-Pro-Phe.
(Cl), Arg-Pro-Arg-Leu-Phe-His-Lys-Gly-Pro-Cha-Pro-Phe
(Cl), Arg-Pro-Arg-Leu-Phe-His-Lys-Gly-Pro-Cha-Pro-Ph
e, Arg-Pro-Arg-Leu-Phe-His-Lys-Gly-Pro-Met-Pro-Phe
(Cl), Arg-Pro-Arg-Leu-Phe-Ala-Arg-Gly-Pro-Met-Pro-Ph
e, Arg-Pro-Arg-Leu-Phe-His-Lys-Gly-Pro-Cha-Phe (C
l), pGlu-Arg-Pro-Arg-Leu-Phe-Arg-Arg-Gly-Pro-Met-Pro
-Phe, pGlu-Arg-Pro-Arg-Leu-Phe-His-Lys-Gly-Pro-Met-Pro
-Phe, the peptide represented by Arg-Pro-Arg-Leu-Phe-Ala-Arg-Gly-Pro-Met-Phe, its ester, its salt, etc. are mentioned. Specific examples of modified apelin (IV) include (i) Arg-Arg-Gln-Arg-Pro-Arg-Leu-Ser-Ala-Arg-Gl.
y-Pro-Met-Pro-Phe (Cl), (ii) Arg-Pro-Arg-Leu-Ser-Al
a-Arg-Gly-Pro-Met-Pro-Phe (Cl), (iii) Arg-Pro-Arg-L
eu-Ser-Ala-Arg-Gly-Pro-Cha-Phe (Cl), (iv) Arg-Pro-A
rg-Leu-Ser-Ala-Arg-Gly-Pro-Cha-Pro-Phe (Cl), (v) Ar
g-Arg-Gln-Arg-Pro-Arg-Leu-Ser-Ala-Arg-Gly-Pro-Ch
a, (vi) Arg-Pro-Arg-Leu-Ser-Ala-Arg-Gly-Pro-Cha-Pr
o-Phe, (vii) Arg-Arg-Gln-Arg-Pro-Arg-Leu-Ser-Ala-A
rg-Gly-Pro-Met-Pro-Phe, (viii) Arg-Arg-Gln-Arg-Pro
-Arg-Leu-Ser-Ala-Arg-Gly-Pro-Met, (ix) Arg-Arg-Gln
-Arg-Pro-Arg-Leu-Ser-Ala-Arg-Gly-Pro, (x) Arg-Pro-
Arg-Leu-Ser-Ala-Arg-Gly-Pro-Met-Pro-Phe, (xi) pGlu
-Arg-Pro-Arg-Leu-Ser-Ala-Arg-Gly-Pro-Met-Pro-Phe,
(xii) Arg-Pro-Arg-Leu-Ser-Ala-Arg-Gly-Pro-Met, (xi
ii) pGlu-Arg-Pro-Arg-Leu-Ser-Ala-Lys-Gly-Pro-Met-P
ro-Phe, (xiv) Arg-Pro-Arg-Leu-Ser-Ala-Arg-Gly-Pro-
Ala-Pro-Phe (Cl), (xv) Arg-Pro-Arg-Leu-Ser-Ala-Arg-
Gly-Gly-Met-Pro-Phe (Cl), (xvi) Arg-Pro-Arg-Leu-Ser
-Ala-Arg-Gly-NMe-Ala-Met-Pro-Phe (Cl), (xvii) Arg-P
ro-Arg-Leu-Ser-Ala-Arg-Gly-Pro-Cha-Pyn, (xviii) Ar
g-Pro-Arg-Leu-Ser-Ala-Arg-Gly-Pro-Cha-Pro-Pyn, (xi
x) Arg-Arg-Gln-Arg-Pro-Arg-Leu-Ser-Ala-Arg-Gly-Gly
-Cha or (xx) Arg-Pro-Arg-Leu-Ser-Ala-Lys (Me) _2-
Examples include a peptide represented by Gly-Pro-Met-Pro-Phe, an ester thereof, or a salt thereof.

Specific examples of modified apelin (IV) include Arg-Arg-Gln-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-.
Cha-Pro-Phe (Cl), Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Cha-Pro-Phe
(Cl), Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Met-Pro-Phe
(Cl), pGlu-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Cha-Pro
-Phe, pGlu-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Met-Pro
-Phe (Cl), Arg-Arg-Gln-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-
Nle-Pro-Tyr, Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Met-Pro-Nal
(2), pGlu-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Met-Pro
-Nal (2), Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Met-Pro-Cha
The peptide represented by or its ester, its salt, etc. are mentioned. Furthermore, (i) Arg-Arg-Gln-Arg-Pro-
Arg-Leu-Ser-His-Lys-Gly-Pro-Met (O), (ii) Arg-Arg-L
ys (Arg-Arg) -Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Me
t-Pro-Phe, (iii) Arg-Arg-Arg-Arg-Pro-Arg-Leu-Ser-H
is-Lys-Gly-Pro-Met-Pro-Phe, (iv) Arg-Arg-Lys-Arg-P
ro-Arg-Leu-Ser-His-Lys-Gly-Pro-Met-Pro-Phe, (v) Ar
g-Arg-Ala-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Met-
Pro-Phe, (vi) Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-
Met-Phe (Cl), (vii) pGlu-Arg-Pro-Arg-Leu-Ser-Arg-Ly
s-Gly-Pro-Met-Pro-Phe, (viii) Arg-Arg-Phe-Arg-Pro-
Arg-Leu-Ser-His-Lys-Gly-Pro-Met-Pro-Phe, (ix) pGlu
-Arg-Pro-Arg-Leu-Ser-His-Arg-Gly-Pro-Met-Pro-Phe,
(x) pGlu-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Met-P
he (Cl), (xi) Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-M
et-Cha, (xii) pGlu-Arg-Pro-Arg-Leu-Ser-Leu-Lys-Gly
-Pro-Met-Pro-Phe, (xiii) Arg-Pro-Arg-Leu-Ser-His-L
ys-Gly-Pro-Met-Nal (2), (xiv) pGlu-Arg-Pro-Arg-Leu-
Ser-Arg-Arg-Gly-Pro-Met-Pro-Phe, (xv) pGlu-Arg-Pro
-Arg-Leu-Ser-Phe-Lys-Gly-Pro-Met-Pro-Phe, (xvi) pG
lu-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Met-Cha, (x
vii) pGlu-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-Met-
Nal (2), (xviii) pGlu-Arg-Pro-Arg-Leu-Ser-His-Phe-G
ly-Pro-Met-Pro-Phe, (xix) pGlu-Arg-Pro-Arg-Leu-Ser
-His-Leu-Gly-Pro-Met-Pro-Phe, (xx) Arg-Arg-Gln-Arg
-Pro-Arg-Leu-Ser-Ala-Arg-Gly-NMe2, (xxi) Arg-Arg-G
ln-Arg-Pro-Arg-Leu-Ser-Ala-Arg-Gly-Mor, (xxii) Arg
-Pro-Arg-Leu-Ser-His-Ala-Gly-Pro-Cha-Pro-Phe (Cl),
(xxiii) Arg-Pro-Arg-Ala-Ser-His-Lys-Gly-Pro-Cha-Pr
o-Phe (Cl), (xxiv) Arg-Pro-Lys (Me) ₂ -Leu-Ser-Ala-Arg
-Gly-Pro-Met-Pro-Phe, (xxv) Arg-Pro-Arg-Leu-Ser-Da
p-Arg-Gly-Pro-Cha-Pro-Phe (Cl), (xxvi) Arg-Pro-Arg-
Leu-Ser-Dap (Ac) c-Arg-Gly-Pro-Cha-Pro-Phe (Cl), (xxv
ii) Arg-Pro-Arg-Leu-Ser-Dap (C6) -Arg-Gly-Pro-Cha-Pr
o-Phe (Cl), (xxviii) Arg-Pro-Arg-Leu-Ser-Dap (Adi) -A
rg-Gly-Pro-Cha-Pro-Phe (Cl), or (xxix) Arg-Pro-A
It can also be used for a peptide represented by la-Leu-Ser-His-Lys-Gly-Pro-Cha-Pro-Phe (Cl), or an ester or salt thereof. Modified forms of apelin (I) to (I
The modified form of apelin such as V) may be an amide form or an ester form in the same manner as the above-mentioned apelin.

As salts of the modified forms of apelin (I) to (IV), salts with physiologically acceptable bases (eg alkali metals) and acids (organic acids, inorganic acids) are used.
Particularly, physiologically acceptable acid addition salts are preferable. Examples of such salts include salts with inorganic acids (for example, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid), or organic acids (for example, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid, Tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like salts are used. Modified form of apelin (I)
Is a known compound described in WO00 / 18793, and can be produced by the method described in WO00 / 18793. Modified Apelin (II) ~
(IV) is a known compound described in WO01 / 70769, and can be produced by the method described in WO01 / 70769. Hereinafter, the modified form of apelin, the partial peptide thereof, the amide or ester thereof, or the salt thereof may be abbreviated as the modified form of apelin.

The antibody against the apelin receptor of the present invention is
As long as it is an antibody capable of recognizing the apelin receptor of the present invention, it may be either a polyclonal antibody or a monoclonal antibody. The antibody against the apelin receptor of the present invention can be produced using the apelin receptor of the present invention as an antigen according to a method known per se for producing an antibody or antiserum.

[Preparation of Monoclonal Antibody] (a) Preparation of Monoclonal Antibody-Producing Cell The apelin receptor of the present invention is administered to a mammal at a site where the antibody can be produced by administration, itself or together with a carrier and a diluent. It Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered to enhance the antibody-producing ability upon administration. The administration is usually performed once every 2 to 6 weeks, about 2 to 10 times in total. Examples of mammals used include monkeys, rabbits, dogs, guinea pigs, mice, rats, sheep, and goats, but mice and rats are preferably used. For preparation of monoclonal antibody-producing cells, warm-blooded animals immunized with an antigen, for example, individuals with an antibody titer were selected from mice, and 2 to 5 days after the final immunization, spleens or lymph nodes were collected and By fusing the antibody-producing cells contained therein with myeloma cells, a monoclonal antibody-producing hybridoma can be prepared. The antibody titer in the antiserum can be measured, for example, by reacting the labeled receptor protein described below with the antiserum and then measuring the activity of the labeling agent bound to the antibody. The fusion operation is a known method, for example, the method of Koehler and Milstein [Nature, 256, 495 (197).
5 years)]]. Examples of the fusion promoter include polyethylene glycol (PEG) and Sendai virus, and preferably PEG.
Is used. Examples of myeloma cells include NS-
1, P3U1, SP2 / 0, etc., but P3U
1 is preferably used. The preferred ratio of the number of antibody-producing cells (spleen cells) to the number of myeloma cells used is 1: 1 to
It is about 20: 1, and PEG (preferably PEG10
(00-PEG6000) is added at a concentration of about 10 to 80%, and the cells can be efficiently fused by incubating at about 20 to 40 ° C, preferably at about 30 to 37 ° C for about 1 to 10 minutes.

Although various methods can be used for screening monoclonal antibody-producing hybridomas, for example, a hybridoma culture supernatant is added to a solid phase (eg, a microplate) on which an antigen of a receptor protein is directly or adsorbed with a carrier, Next, add anti-immunoglobulin antibody labeled with a radioactive substance or enzyme (if mouse cells are used for cell fusion, anti-mouse immunoglobulin antibody is used) or protein A, and detect monoclonal antibody bound to solid phase Method, a method in which a hybridoma culture supernatant is added to a solid phase on which anti-immunoglobulin antibody or protein A is adsorbed, a receptor protein labeled with a radioactive substance or an enzyme is added, and a monoclonal antibody bound to the solid phase is detected, etc. Is mentioned. The monoclonal antibody can be selected according to a method known per se or a method analogous thereto, but usually it can be carried out in a medium for animal cells to which HAT (hypoxanthine, aminopterin, thymidine) is added. As the medium for selection and breeding, any medium may be used as long as the hybridoma can grow. For example, 1 to 20
%, Preferably 10-20% fetal calf serum
I 1640 medium, GI containing 1-10% fetal bovine serum
T medium (Wako Pure Chemical Industries, Ltd.) or serum-free medium for hybridoma culture (SFM-101, Nissui Pharmaceutical Co., Ltd.) can be used. Culture temperature is usually 20-40
℃, preferably about 37 ℃. Cultivation time is usually 5 days to 3 weeks, preferably 1 week to 2 weeks. The culture is
Usually, it can be performed under 5% carbon dioxide gas. The antibody titer of the hybridoma culture supernatant can be measured in the same manner as the above antibody titer measurement in antiserum.

(B) Purification of monoclonal antibody Monoclonal antibody can be separated and purified by the same method as the separation and purification of ordinary polyclonal antibodies [eg, salting out method, alcohol precipitation method, isoelectric focusing method, Electrophoresis method, adsorption / desorption method with ion exchanger (eg, DEAE), ultracentrifugation method, gel filtration method, antigen-binding solid phase or active antibody such as protein A or protein G is used to dissociate the antibody. Specific Purification Method of Obtaining Antibody to Obtain Antibody]

[Preparation of Polyclonal Antibody] The polyclonal antibody of the present invention can be manufactured by publicly known methods or modifications thereof. For example, a complex of an immunizing antigen (apelin receptor antigen) and a carrier protein is formed, and a mammal is immunized in the same manner as in the above-described method for producing a monoclonal antibody, and the immunized animal contains an antibody against the apelin receptor of the present invention. It can be produced by collecting the product and separating and purifying the antibody. Regarding a complex of an immunizing antigen and a carrier protein used for immunizing a mammal, the kind of the carrier protein and the mixing ratio of the carrier and the hapten are such that the antibody against the hapten immunized by crosslinking the carrier can be efficiently prepared. ,
What kind of thing may be crosslinked at any ratio, but, for example, bovine serum albumin, bovine thyroglobulin, keyhole limpet hemocyanin, etc. in a weight ratio of about 0.1 to 20 per hapten, Preferably, a method of coupling at a ratio of about 1 to 5 is used. Although various condensing agents can be used for coupling the hapten and carrier, glutaraldehyde, carbodiimide, maleimide active ester, active ester reagent containing thiol group, dithiopyridyl group, etc. are used. The condensation product is administered to a warm-blooded animal at a site where antibodies can be produced, by itself or together with a carrier and a diluent.
Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered to enhance the antibody-producing ability upon administration. The administration can be performed once every about 2 to 6 weeks, about 3 to 10 times in total. The polyclonal antibody can be collected from blood, ascites, etc., preferably blood of a mammal immunized by the above method. The polyclonal antibody titer in the antiserum can be measured in the same manner as the above-mentioned antibody titer in the serum. Separation and purification of the polyclonal antibody can be performed according to the same immunoglobulin separation and purification method as the above-described separation and purification of the monoclonal antibody.

The apelin receptor of the present invention, DNA encoding the apelin receptor (hereinafter sometimes abbreviated as the DNA of the present invention), antibody against the apelin receptor (hereinafter sometimes abbreviated as the antibody of the present invention) ), The antisense DNA to the DNA of the present invention (hereinafter sometimes abbreviated as the antisense DNA of the present invention) has the following uses. (1) A medicinal apelin containing an apelin receptor or a DNA encoding the apelin receptor or a modified form thereof is:
It has an adrenocorticotropic hormone (ACTH) secretion control action. Therefore, when apelin or a modified form thereof has an adrenocorticotropic hormone secretagogue action, the apelin receptor or the DNA encoding the apelin receptor is
For example, hypoaldosteronism, hypocortisolemia, secondary and chronic hypoadrenocorticism, Addison's disease (eg,
Fatigue, nausea, pigmentation, hypogonadism, hair loss, hypotension),
It can be used as a prophylactic / therapeutic agent for adrenal insufficiency, pain, obesity, etc. On the other hand, when apelin or its modified form has an adrenocorticotropic hormone secretion inhibitory action,
Apelin receptor or DN encoding the apelin receptor
A is, for example, Cushing's disease, Cushing's syndrome (eg,
Central obesity, full moon face, hypertension, magenta striatum, hirsutism, corticotropin (ACTH) producing pituitary tumor, C
RH-producing tumor, aldosterone-producing tumor, aldosteronism (primary, secondary), primary cortisol resistance,
It can be used as a prophylactic / therapeutic agent for congenital adrenal enzyme deficiency, anti-stress, depression, anorexia nervosa, insomnia, gastric / duodenal ulcer, irritable bowel syndrome and the like.

Furthermore, apelin or its modified form has an oxytocin secretion regulating action. Therefore, when apelin or a modified form thereof has an oxytocin secretagogue action, the apelin receptor or the DNA encoding the apelin receptor can be used as, for example, delivery induction, weak labor, loose bleeding, placental delivery, uterine retrograde insufficiency, Caesar It can be used as a prophylactic / therapeutic agent for incision, abortion, abortion, lactation deficiency, post-traumatic stress syndrome, milk stasis, etc. On the other hand, when apelin or a modified form thereof has an oxytocin secretion inhibitory action, the apelin receptor or the DNA encoding the apelin receptor may be, for example, excessive labor pain, infertility, ankylosing uterine contraction, fetal distress, uterine rupture,
It can be used as a prophylactic / therapeutic agent for cervical laceration, dysmenorrhea, preterm birth, Prader-Willi syndrome, etc.

When the apelin receptor or the DNA encoding the apelin receptor is used as the above-mentioned medicine, it can be carried out in a conventional manner. For example, tablets coated with sugar or an enteric coating as required, orally as a capsule, elixir, microcapsule, or aseptic solution with water or other pharmaceutically acceptable liquid, Alternatively, it can be used parenterally in the form of injection such as suspension. For example, the compound or salt thereof is admixed with a physiologically acceptable carrier, flavoring agent, excipient, vehicle, preservative, stabilizer, binder and the like in a unit dosage form generally required for pharmaceutical practice. It can be manufactured by The amount of active ingredient in these preparations is such that a suitable amount within the indicated range can be obtained. The DNA encoding the apelin receptor is
(A) By administering and expressing a DNA encoding an apelin receptor to the patient, or (b) inserting a DNA encoding an apelin receptor into a cell and expressing the same, and then transplanting the cell into the patient By doing
Increasing the amount of apelin receptors in the patient's cells,
The action of apelin can be fully exerted. When a DNA encoding an apelin receptor is used, the DN
After A is inserted alone or in an appropriate vector such as a retrovirus vector, an adenovirus vector, an adenovirus associated virus vector, etc., it can be carried out by a conventional method.

Additives which can be mixed with tablets, capsules and the like include, for example, gelatin, corn starch, tragacanth gum, binders such as gum arabic, excipients such as crystalline cellulose, corn starch, gelatin, alginic acid and the like. Such as a leavening agent, a lubricant such as magnesium stearate, a sweetener such as sucrose, lactose or saccharin, and a flavoring agent such as peppermint, red oil or cherry. When the unit dosage form is a capsule, a liquid carrier such as fat may be included in addition to materials of the above type. Sterile compositions for injection can be formulated according to conventional pharmaceutical practices such as dissolving or suspending the active substance in a vehicle such as water for injection, naturally occurring vegetable oils such as sesame oil, coconut oil, etc. .. Examples of the aqueous solution for injection include physiological saline, isotonic solution containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, etc.), and suitable solubilizing agents. , Eg alcohols (eg ethanol), polyalcohols (eg propylene glycol, polyethylene glycol), nonionic surfactants (eg polysorbate 80 (TM), HCO-5).
0) etc. may be used together. Examples of the oily liquid include sesame oil and soybean oil, which may be used in combination with solubilizing agents such as benzyl benzoate and benzyl alcohol. Also,
Buffer (eg, phosphate buffer, sodium acetate buffer), soothing agent (eg, benzalkonium chloride, procaine hydrochloride, etc.), stabilizer (eg, human serum albumin, polyethylene glycol, etc.), preservative ( For example,
(Benzyl alcohol, phenol, etc.), antioxidant, etc. The prepared injection solution is usually filled in a suitable ampoule. Since the preparation thus obtained is safe and has low toxicity, for example, humans and mammals (for example, mouse, rat, guinea pig, rabbit, chicken,
Sheep, pigs, cows, cats, dogs, monkeys, baboons,
Chimpanzee). For example, the dose of apelin receptor or the DNA encoding the apelin receptor varies depending on the symptoms, but when administered orally, it is generally About 0.
1 to 100 mg, preferably about 1.0 to 50 mg,
More preferably about 1.0 to 20 mg. When administered parenterally, the single dose varies depending on the administration subject, target organs, symptoms, administration method, etc., but for example in the form of an injection, an adult patient with hypoaldosteronism (body weight 6
(As 0 kg) is about 0.
About 01 to 30 mg, preferably about 0.1 to 20 m
It is convenient to administer about g, more preferably about 0.1 to 10 mg by intravenous injection. In the case of other animals, the dose converted per 60 kg can be administered.

(2) Pharmaceuticals Containing Antibodies to Apelin Receptor Antibodies having an action of neutralizing the activity of apelin receptors are
Since it is possible to suppress the adrenocorticotropic hormone (ACTH) secretagogue activity of apelin, examples of the adrenocorticotropic hormone (ACTH) secretion inhibitor include, for example, Cushing's disease, Cushing's syndrome (eg, central obesity, full moon-like face,
Hypertension, magenta striatum, hirsutism, adrenocorticotropic hormone (ACTH) producing pituitary tumor, CRH producing tumor, aldosterone producing tumor, aldosteronism (primary, secondary),
It can be used as a prophylactic / therapeutic agent for primary cortisol resistance, congenital adrenal deficiency, anti-stress, depression, anorexia nervosa, insomnia, gastroduodenal ulcer, irritable bowel syndrome and the like. Furthermore, an antibody having an action of neutralizing the activity of an apelin receptor can suppress the oxytocin secretion promoting action of apelin, and therefore, as an oxytocin secretion inhibitor, for example, for example, excessive labor pain, infertility, and ankylosis. Uterine contraction, fetal distress, uterine rupture, cervical laceration,
It can be used as a prophylactic / therapeutic agent for dysmenorrhea, premature birth, Prader-Willi syndrome, etc. The therapeutic / prophylactic agent for the above diseases containing the antibody of the present invention is used as a liquid formulation as it is,
Alternatively, it can be orally or parenterally administered to a human or a mammal (eg, rat, rabbit, sheep, pig, cow, cat, dog, monkey, etc.) as a pharmaceutical composition in an appropriate dosage form. . Although the dose varies depending on the administration subject, target disease, symptom, administration route, etc., for example, when it is used for an adult for the purpose of treating hypoaldosteronism, the antibody of the present invention is usually used as a single dose. 01-
20 mg / kg body weight, preferably 0.1-10 mg
/ Kg body weight, more preferably 0.1-5 mg / k
g about 1 to 5 times a day, preferably 1 to 1 a day
It is convenient to administer by intravenous injection about three times.
In the case of other parenteral administration and oral administration, an amount similar to this can be administered. If the symptoms are particularly severe, the dose may be increased according to the symptoms.

The antibody of the present invention can be administered per se or as an appropriate pharmaceutical composition. The pharmaceutical composition used for the above administration contains the above or a salt thereof and a pharmacologically acceptable carrier, diluent or excipient. Such a composition is provided as a dosage form suitable for oral or parenteral administration. That is, for example, as a composition for oral administration, a solid or liquid dosage form, specifically tablets (including sugar-coated tablets, film-coated tablets),
Examples include pills, granules, powders, capsules (including soft capsules), syrups, emulsions and suspensions.
Such a composition is produced by a method known per se and contains a carrier, a diluent or an excipient which is usually used in the field of formulation. For example, lactose, starch, sucrose, magnesium stearate and the like are used as carriers and excipients for tablets. As the composition for parenteral administration, for example, injections, suppositories, etc. are used, and the injections are in the form of intravenous injection, subcutaneous injection, intradermal injection, intramuscular injection, drip injection, etc. Includes. Such an injection is prepared according to a method known per se, for example, by dissolving, suspending or emulsifying the above-mentioned antibody or a salt thereof in a sterile aqueous or oily liquid usually used for injection. As the aqueous solution for injection, for example, physiological saline, isotonic solution containing glucose and other auxiliary agents, and the like,
Suitable solubilizing agents such as alcohol (eg ethanol), polyalcohol (eg propylene glycol, polyethylene glycol), nonionic surfactant [eg polysorbate 80, HCO-50 (polyoxyethylene).
(50 mol) adduct of hydrogenated castor oil)] and the like. As the oily liquid, for example, sesame oil, soybean oil and the like are used, and solubilizing agents such as benzyl benzoate and benzyl alcohol may be used in combination.
The prepared injection solution is usually filled in a suitable ampoule. The suppository used for rectal administration is prepared by mixing the above antibody or a salt thereof with an ordinary suppository base. The oral or parenteral pharmaceutical compositions described above are conveniently prepared in dosage unit form for administration of the active ingredient. Examples of the dosage form of such a dosage unit include tablets, pills, capsules, injections (ampoules), suppositories, etc., usually 5 to 500 mg per dosage unit dosage form, especially 5 to 100 mg for injections,
Other dosage forms preferably contain 10-250 mg of the antibody. Each composition described above may contain other active ingredients as long as the composition does not cause an unfavorable interaction with the antibody.

(3) Diagnostic agent containing an antibody against apelin Since an antibody against an apelin receptor can specifically recognize an apelin receptor, quantification of the apelin receptor in a test solution, particularly sandwich immunoassay. It can be used for quantitative determination by the method. The method for quantifying apelin using an antibody against apelin can be carried out according to the method described in WO99 / 33976. Therefore, an antibody against the apelin receptor can detect abnormal secretion of adrenocorticotropic hormone (ACTH) and abnormal secretion of oxytocin due to abnormal expression (overexpression or decreased expression) of apelin. Specifically, an antibody against the apelin receptor is an adrenocorticotropic hormone (ACTH) associated with aberrant expression of apelin in humans or mammals (eg, rat, rabbit, sheep, pig, cow, cat, dog, monkey, etc.). Dysregulated secretion of hypoaldosteronism, hypocortisolemia, secondary and chronic hypoadrenocorticism, Addison's disease (eg, fatigue, nausea, pigmentation, hypogonadism, hair loss, hypotension), adrenal insufficiency, pain , Obesity, Cushing's disease, Cushing's syndrome (eg, central obesity, full-face like face, hypertension, violet striatum, hirsutism), adrenocorticotropic hormone (ACTH) -producing pituitary tumor, CRH-producing tumor, aldosterone-producing tumor, Aldosteronism (primary, secondary), primary cortisol resistance, congenital adrenal deficiency, antistress, depression, anorexia nervosa, Sleep, gastroduodenal ulcers, can be used as a diagnostic agent, such as irritable bowel syndrome. Antibodies to the apelin receptor induce labor due to abnormal secretion of oxytocin due to abnormal expression of apelin in humans or mammals, weak labor, loose bleeding, placental delivery, uterine retrograde failure, cesarean section, abortion, artificial pregnancy. Diagnosis of abortion, lactation insufficiency, post-traumatic stress syndrome, milk retention, overwork labor, infertility, ankylosing uterine contraction, fetal distress, uterine rupture, cervical laceration, dysmenorrhea, preterm birth, Prader-Willi syndrome, etc. It can be used as an agent.

(4) Genetic Diagnostic Agent The DNA encoding the apelin receptor can be used, for example, as a probe to obtain human or mammal (eg, rat, mouse, guinea pig, rabbit, sheep,
Since it is possible to detect an abnormality (gene abnormality) in the DNA or mRNA encoding the apelin receptor in pig, cow, horse, cat, dog, monkey, etc., for example,
It is useful as a gene diagnostic agent for damaging, mutating or lowering the expression of the DNA or mRNA, and increasing or excessive expression of the DNA or mRNA. The above-mentioned gene diagnosis using a DNA encoding an apelin receptor or an antisense polynucleotide thereto may be carried out by, for example, Northern hybridization or PC known per se.
R-SSCP method (Genomics, Volume 5,
Pp. 874-879 (1989), Proc.
Proceedings of the Natio of the National Academy of Sciences of USA
nal Academy of Sciences of the United States of Am
erica), Vol. 86, pp. 2766-2770 (1989).
Year)) etc. For example, when abnormal expression of apelin receptor is detected by Northern hybridization, adrenocorticotropic hormone (A
CTH) hyposecretory aldosteronism, hypocortisolemia, secondary and chronic hypoadrenocorticism,
Addison's disease (eg, fatigue, nausea, pigmentation, hypogonadism,
Hair loss, hypotension), adrenal insufficiency, pain, obesity, Cushing's disease, Cushing's syndrome (eg, central obesity, full moon face, hypertension, purple-red skin striae, hirsutism), under adrenocorticotropic hormone (ACTH) production Pituitary tumors, CRH-producing tumors, aldosterone-producing tumors, aldosteronism (primary and secondary), primary cortisol resistance, congenital adrenal deficiency, anti-stress, depression, anorexia nervosa, insomnia, stomach / duodenum It can be diagnosed as being likely to have a disease such as ulcer, irritable bowel syndrome, or having a future disease. When abnormal expression of apelin receptor is detected by Northern hybridization,
Induction of labor due to abnormal secretion of oxytocin due to abnormal expression of apelin, weak labor, laxative hemorrhage, placental delivery before and after delivery, uterine restoration, cesarean section, abortion, artificial abortion, lactation deficiency, posttraumatic stress syndrome, milk stasis , Excessive labor pain,
Diagnose as likely or likely to have a disease such as infertility, ankylosing uterine contractions, fetal distress, uterine rupture, cervical laceration, dysmenorrhea, preterm birth, Prader-Willi syndrome You can

(5) DN containing antisense DNA
The antisense DNA against the DNA encoding the A apelin receptor can suppress the adrenocorticotropic hormone (ACTH) secretagogue activity by suppressing the expression of the apelin receptor. As an ACTH secretion inhibitor, for example, Cushing's disease, Cushing's syndrome (eg, central obesity, full-face like face, hypertension, reddish purple striatum, hirsutism), adrenocorticotropic hormone (ACTH) -producing pituitary tumor, CRH production Tumor, aldosterone-producing tumor, aldosteronism (primary or secondary), primary cortisol resistance, congenital adrenal deficiency, anti-stress, depression, anorexia nervosa, insomnia, gastroduodenal ulcer, irritable bowel It can be used as a prophylactic / therapeutic agent for syndromes and the like. The antisense DNA against the DNA encoding the apelin receptor can suppress the oxytocin secretion promoting action of apelin by suppressing the expression of the apelin receptor. Labor, infertility, tonic contractions, fetal distress, uterine rupture, cervical laceration,
It can be used as a prophylactic / therapeutic agent for dysmenorrhea, premature birth, Prader-Willi syndrome, etc. Antisense D above
When NA is used as the above-mentioned therapeutic / prophylactic agent, the antisense DNA is a DN encoding an apelin receptor.
It can be formulated in the same manner as A. The preparation thus obtained has low toxicity and should be orally or parenterally administered to humans or mammals (eg, rat, rabbit, sheep, pig, cow, cat, dog, monkey, etc.) You can The antisense DNA can be administered as it is or with a physiologically acceptable carrier such as an auxiliary agent for promoting ingestion through a gene gun or a catheter such as a hydrogel catheter. The dose of the antisense DNA varies depending on the target disease, the subject to be administered, the administration route, etc.
When administered locally to the liver, lungs, heart, kidneys, etc., about 0.1 to 100 mg per day for an adult (body weight 60 kg)
Is.

Further, the RN encoding the apelin receptor
Double-stranded R containing part of A and RNA complementary thereto
NA (RNAi; RNA interference method), ribozymes containing a part of RNA encoding the apelin receptor, etc.
Similar to the above antisense DNA, the expression of DNA encoding apelin receptor can be suppressed, and DN encoding apelin or apelin receptor in vivo can be obtained.
The function of A can be suppressed. Therefore, the double-stranded RNA or ribozyme can suppress the adrenocorticotropin (ACTH) secretion promoting activity of apelin by suppressing the expression of the apelin receptor. As an inhibitor, for example, Cushing's disease, Cushing's syndrome (eg, central obesity, full-face like face, hypertension, reddish purple striatum, hirsutism), adrenocorticotropic hormone (ACTH) -producing pituitary tumor, C
RH-producing tumor, aldosterone-producing tumor, aldosteronism (primary, secondary), primary cortisol resistance,
It can be used as a prophylactic / therapeutic agent for congenital adrenal enzyme deficiency, anti-stress, depression, anorexia nervosa, insomnia, gastric / duodenal ulcer, irritable bowel syndrome and the like. Further, the double-stranded RNA or ribozyme, by suppressing the expression of the apelin receptor, it is possible to suppress the oxytocin secretion promoting action of apelin, as an oxytocin secretion inhibitor, for example, excessive labor, Infertility, tonic contraction, fetal distress, uterine rupture, cervical laceration,
It can be used as a prophylactic / therapeutic agent for dysmenorrhea, preterm birth, Prader-Willi syndrome and the like. Double-stranded RNA can be designed and produced based on the sequence of the DNA of the present invention according to a known method (eg, Nature, 411, 494, 2001). Ribozymes can be prepared by known methods (eg, TRENDS in
Molecular Medicine, Volume 7, 221 pages, 2001),
It can be designed and manufactured based on the DNA sequence of the apelin receptor. For example, R encoding the apetin receptor
It can be produced by linking a known ribozyme to a part of NA. R encoding the apelin receptor
As a part of NA, a portion (RNA fragment) close to the cleavage site on RNA of apelin that can be cleaved by a known ribozyme can be mentioned. When the above double-stranded RNA or ribozyme is used as the above-mentioned preventive / therapeutic agent,
It can be formulated and administered in the same manner as antisense DNA.

(6) Screening Method The screening method of the present invention comprises (6A-1) apelin or a modified form thereof and an apelin receptor (hereinafter also referred to as a partial peptide), and A method for screening a compound or its salt that changes the binding property to an apelin receptor, (6A
-2) A method for screening a compound or a salt thereof that regulates the expression level of an apelin receptor, which comprises using a DNA encoding the apelin receptor. A compound or a salt thereof that changes the binding property between apelin or a modified form thereof and an apelin receptor, a compound or a salt thereof that regulates the expression level of the apelin receptor, is a compound having an adrenocorticotropin secretion-regulating action, or oxytocin secretion regulation. It is a compound or a salt thereof having an action.

First, apelin or its modified form (hereinafter referred to as
A screening method for a substance that changes the binding property between apelin receptor and apelin receptor will be described.
By using an apelin receptor or constructing a recombinant apelin receptor expression system and using a receptor binding assay system using the expression system, a substance that changes the binding property between apelin and an apelin receptor can be identified. Can be screened. Such substances include cell-stimulating activity (eg, arachidonic acid release, via apelin receptors,
Acetylcholine release, intracellular Ca ²⁺ release, intracellular cA
MP production, intracellular cGMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, cf
a substance having an activity of promoting or suppressing os, pH lowering, etc. (ie, an apelin receptor agonist) and a substance having no such cell stimulating activity (ie, an apelin receptor antagonist), etc. Be done. The term “alter the binding property between apelin and apelin receptor” includes both the case of inhibiting the binding between apelin and apelin receptor and the case of promoting the binding between apelin and apelin receptor. is there.

That is, the present invention relates to (i) the case where apelin receptor is contacted with apelin or a modified form thereof (i)
i) A method for screening a substance that alters the binding property between apelin and an apelin receptor, which is characterized by performing a comparison with the case where the apelin receptor is contacted with apelin and a test compound. In the screening method of the present invention, for example, the binding amount of apelin to the apelin receptor in (i) the case where apelin is brought into contact with apelin and (ii) the case where apelin and the test compound are brought into contact with the apelin receptor, Cell stimulating activity etc. are measured and compared.

Specifically, the screening method of the present invention comprises contacting labeled apelin or a modified form thereof with an apelin receptor, and contacting labeled apelin or a modified form thereof and a test compound with an apelin receptor. In the case of, a method for screening a substance that changes the binding property between apelin and an apelin receptor, which comprises measuring and comparing the amount of binding of the labeled apelin or its modified form to the apelin receptor, labeled apelin or When the modified product is brought into contact with a cell containing an apelin receptor or a membrane fraction of the cell, the labeled apelin or a modified product thereof and a test compound are added to a cell containing the apelin receptor or a membrane fraction of the cell. The labeled apelin or its modified form to the cell or the membrane fraction when contacted with A method for screening a substance that changes the binding property between apelin and an apelin receptor, characterized by measuring and comparing the amount of binding, a labeled apelin or a modified form thereof containing a DNA encoding an apelin receptor When a transformant is contacted with an apelin receptor expressed on the cell membrane by culturing the transformant, a labeled apelin or a modified form thereof and a test compound are cultured in a transformant containing a DNA encoding the apelin receptor. When the apelin receptor expressed on the cell membrane is brought into contact with the apelin receptor by measuring the binding amount of the labeled apelin or its modified product to the apelin receptor, and comparing the apelin and the apelin receptor. A method for screening a substance that changes the binding property,

When a compound that activates an apelin receptor (for example, apelin or a modified form thereof) is contacted with a cell containing the apelin receptor, a compound that activates the apelin receptor and a test compound are added to the apelin receptor. Cell-stimulating activity mediated by apelin receptors (eg, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release, intracellular cAM) when contacted with cells containing
P production, intracellular cGMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, cf
os activation, activity promoting or suppressing pH lowering, etc.) is measured and compared, and a screening method for a substance that changes the binding property between apelin and apelin receptor, and apelin receptor A compound that activates the body (for example, apelin or a modified form thereof) that encodes an apelin receptor
When a transformant containing NA is brought into contact with an apelin receptor expressed on the cell membrane by culturing, a compound containing a DNA encoding the apelin receptor is used as a compound activating the apelin receptor and a test compound. Cell-stimulating activity mediated by apelin receptors (eg, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release, intracellular cAMP production) when the transformant is brought into contact with the apelin receptor expressed on the cell membrane. , Intracellular cGMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, c-fos activation, activity promoting or suppressing pH decrease, etc.) are measured and compared. For screening substances that alter the binding between apelin and apelin receptor Is.

A detailed description of the screening method of the present invention is given below. First, the apelin receptor used in the screening method of the present invention may be any as long as it contains the above-mentioned apelin receptor, but it may be a membrane fraction of an organ of human or warm-blooded animal. It is suitable.
However, since human-derived organs are extremely difficult to obtain, apelin receptors expressed in large amounts using recombinants and the like are suitable for use in screening. In the screening method of the present invention, when a cell containing an apelin receptor or a cell membrane fraction thereof is used, the preparation method described below may be followed. When a cell containing an apelin receptor is used, the cell may be fixed with glutaraldehyde, formalin or the like. The immobilization method can be performed according to a method known per se. The cell containing the apelin receptor refers to a host cell expressing the apelin receptor, and the host cell includes the above-mentioned Escherichia coli, Bacillus subtilis, yeast, insect cell, animal cell and the like. The membrane fraction refers to a fraction containing a large amount of cell membrane obtained by a method known per se after crushing cells. As a method of crushing cells, a method of crushing cells with a Potter-Elvehjem type homogenizer, crushing with a Waring blender or polytron (Kinematica), crushing with ultrasonic waves, and blasting cells from a thin nozzle while applying pressure with a French press etc. Examples include crushing by things. For the fractionation of the cell membrane, a fractionation method by centrifugal force such as a fractionation centrifugation method or a density gradient centrifugation method is mainly used. For example, the cell lysate may be fed at a low speed (500 rpm to 3
Centrifuge at 000 rpm for a short time (usually about 1 to 10 minutes), and then the supernatant is spun at a higher speed (15,000 to 30,000 rpm).
It is usually centrifuged for 30 minutes to 2 hours at (rpm) and the resulting precipitate is used as a membrane fraction. The membrane fraction is rich in expressed apelin receptors and membrane components such as cell-derived phospholipids and membrane proteins. The amount of apelin receptor in cells or membrane fraction containing the apelin receptor is 10 ³ to 10 ⁸ per cell.
It is preferably a molecule, and is preferably 10 ⁵ to 10 ⁷ molecules. It should be noted that the higher the expression level, the higher the ligand binding activity (specific activity) per membrane fraction, making it possible not only to construct a highly sensitive screening system, but also to measure a large number of samples in the same lot. .

In order to carry out (1) to (3) above for screening a substance that changes the binding property between apelin and an apelin receptor, a suitable apelin receptor fraction and a labeled apelin or a modified form thereof are used. The apelin receptor fraction is preferably a natural apelin receptor fraction or a recombinant apelin receptor fraction having an activity equivalent to that. Here, the equivalent activity refers to equivalent ligand binding activity and the like. As the labeled apelin or its modified product, a labeled ligand, a labeled ligand analog compound, or the like is used. For example, [ ³ H],
^[125 I], ^{[1 4} C], it can be utilized such as apelin or modification thereof that is labeled with a ^[35 S]. Specifically, in order to screen a substance that changes the binding property between apelin or a modified form of apelin and the apelin receptor, first, a cell containing the apelin receptor or a membrane fraction of the cell is treated with a buffer suitable for screening. A receptor preparation is prepared by suspending in. Any buffer may be used as long as it does not inhibit the binding between apelin and an apelin receptor, such as a phosphate buffer having a pH of 4 to 10 (preferably a pH of 6 to 8) and a Tris-hydrochloric acid buffer. Further, for the purpose of reducing non-specific binding, a surfactant such as CHAPS, Tween-80 ^™ (Kao-Atlas), digitonin and deoxycholate may be added to the buffer. Furthermore, PMSF, leupeptin, for the purpose of suppressing the degradation of apelin receptor, apelin or its modified product by proteases,
A protease inhibitor such as E-64 (produced by Peptide Laboratories) or pepstatin can also be added. 0.01 ml
-10 ml of the apelin receptor solution, a fixed amount (500
0 cpm to 500000 cpm) labeled apelin or a modified form thereof is added, and at the same time, 10 ⁻⁴ to 10 ⁻¹ μm is added.
M test compounds are allowed to coexist. Non-specific binding (NS
To know B), prepare a reaction tube containing a large excess of unlabeled apelin or its modified product. The reaction is about 0 ℃
To about 50 ° C, preferably about 4 ° C to about 37 ° C to about 20 ° C.
Minutes to about 24 hours, preferably about 30 minutes to about 3 hours. After the reaction, the mixture is filtered through a glass fiber filter paper or the like, washed with an appropriate amount of the same buffer, and the radioactivity remaining on the glass fiber filter paper is measured with a liquid scintillation counter or a γ-counter. Count when there is no competing substance
_{(B 0)} when the amount of non-specific binding count obtained by subtracting the _(NSB) (B 0 -NSB) was 100%, antagonize specific binding (B-NSB) of, for example, the test compound giving 50% or less It can be selected as a candidate substance having inhibitory ability.

In order to carry out the above methods (1) to (3) for screening a substance that changes the binding property between apelin and an apelin receptor, cell-stimulating activity mediated by apelin receptor (eg, arachidonic acid release, acetylcholine release, cell Intracellular Ca ²⁺ release, intracellular cAMP production, intracellular cGMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, c-fos activation, p
Activity that promotes or suppresses reduction of H, etc.)
Can be measured using a known method or a commercially available measurement kit. Specifically, first, cells containing the apelin receptor are cultured in a multiwell plate or the like. For screening, the medium was exchanged with a fresh medium or an appropriate buffer that did not show toxicity to cells in advance, and after adding a test compound or the like and incubating for a certain period of time, cells were extracted or supernatant was collected to generate The product is quantified according to the respective method. When the production of a substance that serves as an index of cell stimulating activity (for example, arachidonic acid) is difficult to assay with a degrading enzyme contained in cells, an inhibitor for the degrading enzyme may be added to the assay. Further, the activity of suppressing cAMP production and the like can be detected as a production suppressing action on cells in which the basic production amount of cells has been increased by forskolin or the like. In order to measure the cell stimulating activity and perform screening, cells expressing an appropriate apelin receptor are required. As the cells expressing the apelin receptor of the present invention, the above-mentioned recombinant apelin receptor-expressing cell line and the like are desirable. Examples of test compounds include peptides,
Examples include proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, and the like, and these compounds may be novel compounds or known compounds. Good.

A kit for screening a substance that changes the binding property between apelin and an apelin receptor comprises an apelin receptor, cells containing the apelin receptor or a membrane fraction of the cell, and / or apelin or a modified form thereof. Is included. Examples of the screening kit of the present invention include the following. 1. To the screening reagent measurement buffer and washing buffer Hanks' Balanced Salt Solution (manufactured by Gibco), 0.
To which 05% bovine serum albumin (manufactured by Sigma) was added. Sterilize by filtration with a 0.45μm filter at 4 ℃
It may be stored at or prepared at the time of use. Apelin receptor preparation CHO cells expressing apelin receptor were subcultured on a 12-well plate at 5 × 10 ⁵ cells / well and incubated at 37 ° C., 5% C
Cultured in O ₂ and 95% air for 2 days. Apelin labeled with labeled ligand [ ³ H], [ ¹²⁵ I], [ ¹⁴ C], [ ³⁵ S], etc. Then, dilute to 1 μM with the measurement buffer before use. The ligand standard solution apelin or its modified form is dissolved in PBS containing 0.1% bovine serum albumin (manufactured by Sigma) to 1 mM and stored at -20 ° C.

2. Assay method Apelin receptor-expressing cells cultured in a 12-well tissue culture plate are washed twice with 1 ml of measurement buffer, and then 490 μl of measurement buffer is added to each well. After adding 5 μl of a test compound solution of 10 ⁻³ to 10 ⁻¹⁰ M, 5 μl of labeled apelin or its modified product is added, and the mixture is reacted at room temperature for 1 hour. In order to know the amount of non-specific binding, 5 μl of 10 ⁻³ M ligand was added in place of the test compound. Remove the reaction solution and wash 3 times with 1 ml of wash buffer. The cell-bound labeled apelin or its modified form is lysed with 0.2N NaOH-1% SDS and mixed with 4 ml of liquid scintillator A (manufactured by Wako Pure Chemical Industries). Liquid scintillation counter (Beckman)
Radioactivity was measured using a Percent Maximum Binding
(PMB) is calculated by the following equation [Equation 1]. [Number 1] PMB = [(B- NSB) / (B 0 -NSB)] × 10
0 PMB: Percent Maximum Binding B: Value when a sample is added NSB: Non-specific Binding B ₀ : Maximum binding amount

The compound obtained by using the screening method or the screening kit of the present invention is a compound that changes (inhibits or promotes) the binding between apelin and the apelin receptor, and specifically, the apelin receptor It is a substance having cell stimulating activity (so-called apelin receptor agonist) or a compound having no such stimulating activity (so-called apelin receptor antagonist).
Examples of the compound include peptides, proteins, non-peptidic compounds, synthetic compounds and fermentation products selected from the above-mentioned test compounds, and these compounds may be novel compounds or known compounds. Good. The specific evaluation method for determining whether it is an apelin receptor agonist or an antagonist may follow (i) or (ii) below. (I) After performing the binding assay shown in the above-mentioned screening methods to obtain a substance that changes the binding property of apelin or its modified form to the apelin receptor (in particular, inhibits the binding), the substance is It is determined whether or not it has the cell stimulating activity mediated by the apelin receptor described above. A substance having a cell stimulating activity is an apelin receptor agonist, and a substance having no such activity is an apelin receptor antagonist. (Ii) (a) A test compound is brought into contact with cells containing an apelin receptor, and the cell-stimulating activity mediated by the apelin receptor is measured. The substance having cell stimulating activity is an apelin receptor agonist. (b) when a compound that activates the apelin receptor (for example, apelin or a modified form thereof) is contacted with cells containing the apelin receptor, and when a compound that activates the apelin receptor and a test compound are The cell-stimulating activity mediated by the apelin receptor when contacted with cells containing the body is measured and compared. The substance capable of reducing the cell stimulating activity of the compound activating the apelin receptor is an apelin receptor antagonist.

Since the apelin receptor agonist has the same physiological activity as that of apelin, it is useful as a safe and low-toxic pharmaceutical agent like apelin or its modified form. On the contrary, since the apelin receptor antagonist can suppress the physiological activity of apelin, it is useful as a safe and low toxic pharmaceutical that suppresses the activity of apelin or its modified form. Since apelin has an adrenocorticotropic hormone secretion regulating action (preferably an adrenocorticotropic hormone secretagogue action) or an oxytocin secretion regulating action (preferably an oxytocin secretagogue action), the above-mentioned apelin receptor agonist or apelin The receptor antagonist also has an adrenocorticotropic hormone secretion regulating action or an oxytocin secretion regulating action. More specifically, the apelin receptor agonist has an adrenocorticotropic hormone secretagogue action or an oxytocin secretagogue action, and the apelin receptor antagonist has an adrenocorticotropic hormone secretagogue action or an oxytocin secretagogue action.

Therefore, an apelin receptor agonist is, for example, as an adrenocorticotropic hormone secretagogue.
Hypoaldosteronism, hypocortisolemia, secondary and chronic hypoadrenocorticism, Addison's disease (fatigue, nausea,
Pigmentation, hypogonadism, hair loss, hypotension), adrenal insufficiency, pain, obesity, etc. can be used as a medicine for preventing or treating. Further, apelin receptor agonist, as an oxytocin secretagogue, for example, induction of labor, weak labor, relaxation bleeding, placental delivery, uterine retrograde failure, cesarean section, miscarriage, abortion, lactation deficiency,
It can be used as a medicine such as a prophylactic / therapeutic agent for post-traumatic stress syndrome, milk stasis and the like.

Apelin receptor antagonists are adrenocorticotrophic hormone secretion inhibitors such as Cushing's disease, Cushing's syndrome (central obesity, full moon-like face, hypertension, purple-red skin striae, hirsutism), adrenocorticotropic hormone ( A
CTH) producing pituitary tumor, CRH producing tumor, aldosterone producing tumor, aldosteronism (primary, secondary), primary cortisol resistance, congenital adrenal deficiency, antistress, depression, anorexia nervosa, insomnia , A gastric / duodenal ulcer, an irritable bowel syndrome, etc. can be used as a medicine for preventing / treating agents. Further, apelin receptor antagonist, as an oxytocin secretion inhibitor, for example, overwork labor, infertility, ankylosing uterine contraction, fetal distress, uterine rupture, cervical laceration, dysmenorrhea, preterm birth, Prader-Willi syndrome, etc. It can be used as a medicine such as a prophylactic / therapeutic agent.

The compound obtained by using the above-mentioned screening method or screening kit may form a salt, for example, a pharmaceutically acceptable salt is used. Specific examples include salts with inorganic bases, salts with organic bases, salts with inorganic acids, salts with organic acids, salts with basic or acidic amino acids, and the like. Preferable examples of the salt with an inorganic base include alkali metal salts such as sodium salt and potassium salt, alkaline earth metal salts such as calcium salt and magnesium salt, and aluminum salt and ammonium salt. Preferable examples of the salt with an organic base include, for example, trimethylamine, triethylamine, pyridine, picoline, 2,6-lutidine, ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine,
Examples thereof include salts with N, N′-dibenzylethylenediamine and the like. Preferable examples of salts with inorganic acids include salts with hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid and the like. Preferable examples of salts with organic acids include, for example, formic acid, acetic acid, propionic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, benzoic acid. And salt. Preferable examples of the salt with basic amino acid include salts with arginine, lysine, ortinine, and preferable examples with the acidic amino acid include salts with aspartic acid, glutamic acid and the like. When the substance obtained by using the screening method or the screening kit of the present invention is used as the above-mentioned drug, it can be formulated and used in the same manner as the above-mentioned pharmaceutical composition containing apelin or its modified product.

Next, a method for screening a compound that regulates the expression level of the apelin receptor will be described. Specifically, the screening method of the present invention comprises (i) the expression level of each apelin receptor when cells or tissues capable of expressing the apelin receptor are cultured in the presence and absence of a test compound. Alternatively, it is a method for screening a compound or its salt that promotes or inhibits the expression of an apelin receptor, which comprises measuring and comparing the amount of mRNA encoding apelin. The cells or tissues capable of expressing the apelin receptor include humans and warm-blooded animals (eg, guinea pig, rat, mouse, chicken, rabbit,
Pig cells, sheep, cattle, monkeys, etc.) (eg, nerve cells, endocrine cells, neuroendocrine cells, glial cells, pancreatic β)
Cells, bone marrow cells, hepatocytes, splenocytes, mesangial cells,
Epidermal cells, epithelial cells, endothelial cells, fibroblasts, fibrocytes, muscle cells, adipocytes, immune cells (eg, macrophages, T cells, B cells, natural killer cells, mast cells, neutrophils, basophils, Eosinophils, monocytes, dendritic cells), megakaryocytes, synovial cells, chondrocytes, osteocytes, osteoblasts, osteoclasts, mammary cells, or stromal cells, or precursors of these cells, stem cells or Cancer cells, etc.) or any tissue in which those cells exist, for example, brain, each part of the brain (eg, olfactory bulb, amygdala, basal sphere, hippocampus, thalamus, hypothalamus, cerebral cortex, medulla oblongata, cerebellum), Spinal cord, pituitary gland, stomach,
Pancreas, kidney, liver, gonad, thyroid, gallbladder, bone marrow, adrenal gland, skin, muscle, lung, digestive tract (eg, large intestine, small intestine), blood vessel, heart, thymus, spleen, salivary gland, peripheral blood, prostate, testis (testis ), Ovary, placenta, uterus, bone, cartilage, joint, skeletal muscle, etc. may be used. At that time, cell lines and primary culture system may be used. In addition, a transformant transformed with a recombinant vector containing the above-mentioned DNA encoding the apelin receptor may be used. The method for culturing cells capable of expressing the apelin receptor is the same as the above-mentioned method for culturing transformants. As the test compound, a DNA library or the like can be used in addition to the above test compounds.

The expression level of the apelin receptor can be measured by a known method such as an immunochemical method using an antibody or the like, and mRNA encoding apelin can be analyzed by Northern hybridization method, RT-PCR or TaqMan.
It can also be measured by a known method using the PCR method. To compare the expression levels of mRNAs by a hybridization method, a known method or a method similar thereto, for example, molecular cloning (Mole
cular Cloning) 2nd (J. Sambrook et al., Cold Spri
ng Harbor Lab. Press, 1989). Specifically, the amount of mRNA encoding the apelin receptor is measured by RNA extracted from cells according to a known method, and DNA encoding the apelin receptor or a part thereof or the antisense / antisense of the present invention.
It is carried out by contacting with a polynucleotide and measuring the amount of mRNA bound to the DNA encoding the apelin receptor or a part thereof or the antisense polynucleotide of the present invention. Apelin receptor-encoding DNA or a part thereof, or the antisense polynucleotide of the present invention is labeled with, for example, a radioisotope, a dye, or the like, whereby the apelin receptor-encoding DNA or a part thereof or the present invention. The amount of mRNA bound to the antisense polynucleotide can be easily measured. Examples of radioisotopes include ³² P and ³ H
And the like are used as the dye, for example, fluorescein,
FAM (made by PE Biosystems), JOE (PE Biosystems)
), TAMRA (PE Biosystems), ROX (P
E Biosystems), Cy5 (Amersham), Cy3
A fluorescent dye such as (Amersham) is used. Also,
The amount of mRNA is determined by converting RNA extracted from cells into cDNA by reverse transcriptase and then using DNA encoding apelin receptor or a part thereof or the antisense polynucleotide of the present invention as a primer.
This can be done by measuring the amount of cDNA amplified by R. Thus, a test compound that increases the amount of mRNA encoding the apelin receptor,
A compound which can be selected as a compound having an activity of promoting the expression level of the apelin receptor, and a test compound which reduces the amount of mRNA encoding the apelin receptor is a compound having an activity of inhibiting the expression level of the apelin receptor. Can be selected as

Furthermore, the present invention provides (ii) a recombinant D in which a reporter gene is ligated downstream of a promoter region or an enhancer region of a gene encoding an apelin receptor.
Screening for a compound that promotes or inhibits the promoter activity, characterized by measuring and comparing reporter activities of NA-transformed transformants in the presence and absence of a test compound Provide a way. Examples of the reporter gene include lacZ (β-galactosidase gene), chloramphenicol acetyltransferase (CA
T), luciferase, growth factor, β-glucuronidase, alkaline phosphatase, Green fluorescent prot
Ein (GFP), β-lactamase, etc. are used. By measuring the amount of the reporter gene product (eg, mRNA, protein) using a known method, the test compound that increases the amount of the reporter gene product controls the activity of the promoter or enhancer of the apelin receptor of the present invention ( It can be selected as a compound having an action of particularly promoting), that is, a compound having an activity of promoting the expression of an apelin receptor. Conversely, a test compound that decreases the amount of the reporter gene product is selected as a compound having an action of controlling (particularly inhibiting) the activity of the promoter or enhancer of the apelin receptor, that is, a compound having an activity of inhibiting the expression of the apelin receptor. can do. The same test compounds as described above are used. Cultivation of the transformant can be performed in the same manner as in the above transformant. The vector construction of the reporter gene and the assay method can follow known techniques (for example, Mole
cular Biotechnology 13, 29-43, 1999).

The compound having the activity of promoting the expression of the apelin receptor has the effect of promoting the physiological activity of apelin, and is therefore useful as a safe and low-toxic pharmaceutical agent like apelin. On the contrary, a substance having an activity of inhibiting the expression of an apelin receptor can suppress the physiological activity of apelin, and is therefore useful as a safe and low-toxic drug for suppressing the activity of apelin. Therefore, a compound having an activity of promoting the expression level of an apelin receptor is used as an adrenocorticotropic hormone secretagogue, for example, hypoaldosteronism, hypocortisolemia, secondary and chronic hypoadrenocorticism, Addison's disease ( It can be used as a medicine such as a prophylactic / therapeutic agent for fatigue, nausea, pigmentation, hypogonadism, hair loss, hypotension), adrenal insufficiency, pain, obesity and the like. Further, the compound having the activity of promoting the expression level of the apelin receptor, as an oxytocin secretagogue, for example, induction of labor, weak labor, relaxation bleeding,
It can be used as a medicine such as a prophylactic / therapeutic agent for pre- and post-placental delivery, uterine retrograde failure, cesarean section, abortion, artificial abortion, lactation deficiency, post-traumatic stress syndrome, milk stasis and the like.

Compounds having an activity of inhibiting the expression level of the apelin receptor are, for example, Cushing's disease, Cushing's syndrome (central obesity, full face like face, hypertension, purple-red skin striae) as an adrenocorticotropic hormone secretion inhibitor. , Hairy),
Corticotropin (ACTH) -producing pituitary tumor, CRH-producing tumor, aldosterone-producing tumor, aldosteronism (primary, secondary), primary cortisol resistance, congenital adrenal deficiency, anti-stress, depression, neurological It can be used as a medicine such as a prophylactic / therapeutic agent for anorexia, insomnia, gastric / duodenal ulcer, irritable bowel syndrome and the like.
Further, a compound having an activity of inhibiting the expression level of the apelin receptor, as an oxytocin secretion inhibitor, for example, excessive labor pain, infertility, ankylosing uterine contraction, fetal distress, uterine rupture, cervical laceration, dysmenorrhea. , Premature birth, Prader-Willi syndrome, etc. The compound obtained by using the screening method of the present invention is selected from, for example, peptides, proteins, non-peptide compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, plasma and the like. It is a compound. As the salt of the compound, the same salts as the above-mentioned salts of apelin are used. When the compound obtained by using the screening method of the present invention is used as the above-mentioned therapeutic / prophylactic agent, it can be carried out in a conventional manner. For example, tablets, capsules, elixirs, microcapsules, sterile solutions, suspensions and the like can be prepared in the same manner as the above-mentioned pharmaceutical composition containing apelin or its modified form. Since the preparation thus obtained is safe and has low toxicity, for example, humans or warm-blooded animals (for example, mouse, rat, rabbit, sheep, pig, cow,
Horses, birds, cats, dogs, monkeys, chimpanzees, etc.). Although the dose of the compound or its salt varies depending on its action, target disease, administration subject, administration route, etc., for example, a compound that promotes the expression level of apelin receptor is orally administered for the purpose of treating hypoaldosteronism In general, in adults (per 60 kg body weight), the compound is generally added in an amount of about 0.1 to 10 per day.
0 mg, preferably about 1.0-50 mg, more preferably about 1.0-20 mg. When administered parenterally, the single dose of the compound varies depending on the administration subject, target disease, etc., but for example, a compound that promotes the expression level of the apelin receptor for the purpose of treating hypoaldosteronism is injected. When generally administered to an adult (per 60 kg) in the form of about 0.01 to 30 mg of the compound per day,
It is convenient to administer about 0.1 to 20 mg, preferably about 0.1 to 10 mg by intravenous injection. In the case of other animals, the dose converted per 60 kg can be administered. These drugs can be formulated and used in the same manner as the above-mentioned drugs containing apelin or its modified form.

(7) DNA Transfer Animal The present invention provides a DNA encoding an exogenous apelin receptor.
A non-human mammal having (hereinafter abbreviated as exogenous DNA of the present invention) or a mutant DNA thereof (may be abbreviated as exogenous mutant DNA of the present invention) is provided. That is, the present invention includes (1) a non-human mammal having the exogenous DNA of the present invention or a mutant DNA thereof, (2) the animal according to (1), wherein the non-human mammal is a rodent, (3) The rodent is a mouse or rat (2)
The present invention also provides (4) a recombinant vector containing the exogenous DNA of the present invention or a mutant DNA thereof, which can be expressed in mammals. The non-human mammal having the exogenous DNA of the present invention or the mutant DNA thereof (hereinafter, abbreviated as the DNA-transferred animal of the present invention) is used for embryo cells including unfertilized eggs, fertilized eggs, sperms and their progenitor cells. Preferably, at the stage of embryogenesis in development of non-human mammals (more preferably at the stage of single cells or fertilized egg cells and generally before the 8-cell stage), the calcium phosphate method, electric pulse method, lipofection method, agglutination method, It can be produced by transferring the target DNA by the microinjection method, particle gun method, DEAE-dextran method, or the like. In addition, by the DNA transfer method, somatic cells,
It is also possible to transfer the foreign DNA of interest of the present invention to organs, tissue cells, etc. of a living body and utilize it for cell culture, tissue culture, etc., and further to use these cells with the above-mentioned embryo cells in a cell fusion method known per se. It is also possible to produce the DNA-transferred animal of the present invention by fusing. Examples of the non-human mammal include cow, pig, sheep, goat, rabbit, dog, cat, guinea pig, hamster, mouse, rat and the like. Among them, rodents that have relatively short ontogenesis and biological cycle from the viewpoint of creating a pathological animal model system and are easy to reproduce, especially mice (for example, C57BL / 6 strain, DBA2 as a pure strain).
As the hybrid system such as strain, B6C3F ₁ strain, BDF ₁ strain, B6D2F ₁ strain, BALB / c strain, ICR strain etc.) or rat (eg Wistar, SD etc.) and the like are preferable. Examples of the “mammal” in the recombinant vector that can be expressed in mammals include humans in addition to the above-mentioned non-human mammals.

The exogenous DNA of the present invention means the apelin receptor originally possessed by non-human mammals (hereinafter referred to as D of the present invention).
(Abbreviated as NA) but not the DNA of the present invention once isolated and extracted from a mammal. Mutant DN of the present invention
As A, a mutation (for example, a mutation) has occurred in the base sequence of the original DNA of the present invention, specifically, a DNA having a base addition, deletion, substitution with another base, etc. Is also used, and abnormal DNA is also included. The abnormality D
As NA, DN that expresses an abnormal apelin receptor
It means A, and for example, DNA that expresses a peptide that suppresses normal apelin receptor function is used.
The exogenous DNA of the present invention may be derived from mammals of the same or different species as the target animal.
In transferring the DNA of the present invention to a target animal,
It is generally advantageous to use the DNA as a DNA construct linked downstream of a promoter that can be expressed in animal cells. For example, when transferring the human DNA of the present invention, expression of DNA derived from various mammals (for example, rabbit, dog, cat, guinea pig, hamster, rat, mouse, etc.) having the DNA of the present invention having high homology with the human DNA The DNA construct of the present invention is highly expressed by microinjecting a DNA construct (eg, a vector) having the human DNA of the present invention bound downstream of various promoters capable of causing the fertilized egg of a target mammal, for example, a mouse fertilized egg. A DNA-transferred mammal that produces

Examples of the apelin receptor expression vector include:
E. coli-derived plasmid, Bacillus subtilis-derived plasmid, yeast-derived plasmid, bacteriophage such as λ phage, retrovirus such as Moloney leukemia virus,
Animal viruses such as vaccinia virus or baculovirus are used. Of these, a plasmid derived from Escherichia coli, a plasmid derived from Bacillus subtilis, a plasmid derived from yeast, and the like are preferably used. Examples of the above promoter for controlling DNA expression include, for example, promoters of DNA derived from viruses (eg, simian virus, cytomegalovirus, Moloney leukemia virus, JC virus, breast cancer virus, poliovirus, etc.),
Promoters derived from various mammals (human, rabbit, dog, cat, guinea pig, hamster, rat, mouse, etc.), such as albumin, insulin II, uroplakin II, elastase, erythropoietin, endothelin, muscle creatine kinase, glial fibrillary acidic protein , Glutathione S-transferase, platelet-derived growth factor β, keratins K1, K10 and K14, collagen types I and II, cyclic AMP-dependent protein kinase βI subunit, dystrophin,
Tartrate-resistant alkaline phosphatase, atrial natriuretic factor, endothelial receptor tyrosine kinase (generally abbreviated as Tie2), sodium potassium adenosine 3 phosphatase (Na, K-ATPase), neurofilament light chain, metallothionein I and II
A, metalloproteinase 1 tissue inhibitor, MHC
Class I antigen (H-2L), H-ras, renin, dopamine β-hydroxylase, thyroid peroxidase (TP
O), peptide chain elongation factor 1α (EF-1α), β actin, α and β myosin heavy chain, myosin light chain 1 and 2, myelin basic protein, thyroglobulin, Thy
-1, immunoglobulin, heavy chain variable region (VNP), serum amyloid P component, myoglobin, troponin C, smooth muscle α-actin, preproenkephalin A, vasopressin and other promoters are used. Among them, cytomegalovirus promoter, human peptide chain elongation factor 1α (EF), which can be highly expressed systemically,
-1α) promoter, human and chicken β-actin promoter and the like are preferable. The above vector is D
Targeted messenger R in mammals with NA transition
It is preferable to have a sequence that terminates the transcription of NA (generally called terminator). For example, the sequences of DNAs derived from viruses and various mammals can be used, and preferably Simian virus SV40.
Terminator or the like is used.

In addition, for the purpose of further highly expressing the desired foreign DNA, the splicing signal of each DNA, the enhancer region, a part of the intron of eukaryotic DNA and the like are provided 5 ′ upstream of the promoter region, between the promoter region and the translation region. Alternatively, it may be linked to the 3'downstream of the translation region depending on the purpose. The translation region of the normal apelin receptor includes DNA derived from liver, kidney, thyroid cells, fibroblasts derived from human or various mammals (eg, rabbit, dog, cat, guinea pig, hamster, rat, mouse) and commercially available DNA. It can be obtained from all or a part of genomic DNA from various genomic DNA libraries, or complementary DNA prepared by a known method from RNA derived from liver, kidney, thyroid cells, and fibroblasts as a raw material. In addition, an exogenous abnormal DNA can be produced by mutating a translation region of a normal peptide obtained from the above cells or tissues by a point mutagenesis method. The translation region can be prepared as a DNA construct that can be expressed in a transgenic animal by a conventional DNA engineering method in which it is linked to the downstream of the promoter and, if desired, the upstream of the transcription termination site.
The transfer of the foreign DNA of the present invention at the fertilized egg cell stage is ensured to be present in all germinal cells and somatic cells of the target mammal. The presence of the exogenous DNA of the present invention in the embryonic cell of the produced animal after DNA transfer means that all the progeny of the produced animal retain the exogenous DNA of the present invention in all of its embryonic cells and somatic cells. means. The offspring of this type of animal that inherits the exogenous DNA of the present invention has the exogenous DNA of the present invention in all of its germ cells and somatic cells. The non-human mammal to which the exogenous normal DNA of the present invention has been transferred has the exogenous DNA by mating.
After confirming that the DNA is stably maintained, the DNA-carrying animal can be subcultured in a normal breeding environment. The transfer of the exogenous DNA of the present invention at the fertilized egg cell stage is ensured to be present in excess in all germinal cells and somatic cells of the target mammal. Excessive presence of the exogenous DNA of the present invention in the germinal cells of the producing animal after DNA transfer means that all the progeny of the producing animal have the exogenous DNA of the present invention in all of their germinal cells and somatic cells. Means The offspring of this type of animal that inherited the exogenous DNA of the present invention have the exogenous DNA of the present invention in excess in all of their germ cells and somatic cells. By obtaining a homozygous animal having the introduced DNA in both homologous chromosomes and mating the male and female animals, all offspring can be passaged so that the DNA has an excess.

In the non-human mammal having the normal DNA of the present invention, the normal DNA of the present invention is highly expressed, and the function of the endogenous normal DNA is promoted to finally enhance the function of the apelin receptor. The disease may develop and can be used as a model animal for the pathological condition. For example, by using the normal DNA-transferred animal of the present invention, it is possible to elucidate the pathological mechanisms of hyperfunction of apelin receptors and diseases associated with apelin receptors and to study methods for treating these diseases. is there. In addition, the exogenous normal D of the present invention
Since mammals having transferred NA have an increased symptom of free apelin receptors, they can be used for screening tests of therapeutic agents for diseases associated with apelin receptors. On the other hand, the non-human mammal having the exogenous abnormal DNA of the present invention can be subcultured as a DNA-carrying animal in a normal breeding environment after confirming that the exogenous DNA is stably retained by mating. Furthermore, the foreign DNA of interest can be incorporated into the above-mentioned plasmid and used as a protozoa. The DNA construct with the promoter can be prepared by a usual DNA engineering technique. Abnormal DN of the present invention at the fertilized egg cell stage
The A transfer is ensured to be present in all germinal and somatic cells of the subject mammal. The presence of the abnormal DNA of the present invention in the germinal cells of the producing animal after DNA transfer means that all the progeny of the producing animal have the abnormal DNA of the present invention in all of its germinal cells and somatic cells.
The offspring of this type of animal that inherited the exogenous DNA of the present invention has the abnormal D of the present invention in all of its germ cells and somatic cells.
Has NA. By obtaining a homozygous animal having the introduced DNA in both homologous chromosomes and mating the male and female animals, all the progeny can be passaged so that they have the DNA.

In the non-human mammal having the abnormal DNA of the present invention, the abnormal DNA of the present invention is highly expressed, and by inhibiting the function of the endogenous normal DNA, the function of the apelin receptor is finally impaired. It may become active refractory and can be used as a model animal for its pathological condition.
For example, by using the abnormal DNA-transferred animal of the present invention, it is possible to elucidate the pathological mechanism of the functionally inactive refractory to the apelin receptor of the present invention and to investigate the method of treating this disease. In addition, as a specific applicability, the animal with high expression of abnormal DNA of the present invention is capable of inhibiting the function of a normal apelin receptor (dominant negative action) by the abnormal apelin receptor in a functionally inactive type of apelin receptor. It becomes a model to elucidate. In addition, since the mammal to which the foreign abnormal DNA of the present invention has been transferred has a symptom of an increase in the released apelin receptor of the present invention, it can also be used for a therapeutic drug screening test for functionally inactive refractory apelin receptor. It is possible. Further, other applications of the above-mentioned two kinds of the DNA-transferred animals of the present invention include, for example, use as a cell source for tissue culture, DNA or R in tissues of the DNA-transferred animals of the present invention.
Analysis of the relationship with peptides specifically expressed or activated by apelin receptors by directly analyzing NA or peptide tissues expressed by DNA, and standardizing cells of tissues having DNA The cells are cultured by a tissue culture technique, and these are used to study the functions of cells from tissues that are generally difficult to culture, screening for agents that enhance the functions of cells by using the cells described above, and mutations of the present invention. Isolation and purification of the peptide and production of an antibody thereof can be considered.

Furthermore, by using the DNA-transferred animal of the present invention, it is possible to include functionally inactive refractory disease of the apelin receptor,
It is possible to investigate the clinical manifestations of apelin receptor-related diseases, and obtain more detailed pathological findings in each organ of the apelin receptor-related disease model, develop new therapeutic methods, and further, It can contribute to the research and treatment of secondary diseases caused by the disease. Further, each organ was taken out from the DNA-transferred animal of the present invention, cut into small pieces, and then released by a proteolytic enzyme such as trypsin.
It is possible to obtain NA-transferred cells, culture them, or systematize the cultured cells. Furthermore, it is possible to investigate the specificity of apelin receptor-producing cells, their relationship with apoptosis, differentiation or proliferation, or their signal transduction mechanisms, and to investigate their abnormalities. It becomes an effective research material. Furthermore, in order to develop a therapeutic agent for a disease associated with apelin receptor, including a functionally inactive type of apelin receptor, using the DNA-transferred animal of the present invention, the above-mentioned test method and quantitative method, etc. It becomes possible to provide an effective and rapid screening method for the drug for treating the disease by using. In addition, it is possible to study and develop a DNA therapeutic method for diseases associated with apelin receptors using the DNA-transferred animal of the present invention or the foreign DNA expression vector of the present invention.

(8) Knockout Animal The present invention provides a non-human mammal embryonic stem cell in which the DNA of the present invention is inactivated and a DNA expression-deficient non-human mammal of the present invention. That is, the present invention provides (1) a non-human mammal embryonic stem cell in which the DNA of the present invention is inactivated,
(2) The embryonic stem cell according to item (1), wherein the DNA is inactivated by introducing a reporter gene (eg, β-galactosidase gene derived from Escherichia coli), (3) neomycin-resistant item (1) The embryonic stem cell according to item (4), the embryonic stem cell according to item (1), wherein the non-human mammal is a rodent, (5) the embryonic stem cell according to item (4), wherein the rodent is a mouse, ( 6) The DNA expression-deficient non-human mammal in which the DNA of the present invention is inactivated, (7) The DNA is inactivated by introducing a reporter gene (eg, β-galactosidase gene derived from Escherichia coli), The non-human mammal according to item (6), wherein the reporter gene can be expressed under the control of a promoter for the DNA of the present invention,
(8) The non-human mammal according to item (6), wherein the non-human mammal is a rodent, (9) the non-human mammal according to item (8), wherein the rodent is a mouse, and (10) ) D of the present invention, which comprises administering a test compound to the animal according to item (7) and detecting the expression of a reporter gene.
Provided is a screening method for a compound or its salt that promotes or inhibits the promoter activity against NA.

The non-human mammal embryonic stem cells in which the DNA of the present invention is inactivated means that the expression ability of the DNA can be suppressed by artificially mutating the DNA of the present invention possessed by the non-human mammal. Alternatively, the DNA is substantially incapable of expressing the apelin receptor of the present invention by substantially deactivating the activity of the apelin receptor of the present invention encoded by the DNA (hereinafter, referred to as “of the present invention”). Knockout DN
Non-human mammalian embryonic stem cells (sometimes referred to as A) (hereinafter abbreviated as ES cells). As the non-human mammal, the same ones as described above are used. DNA of the present invention
As a method for artificially adding mutations to, for example, deletion of a part or all of the DNA sequence by a genetic engineering method,
This can be done by inserting or substituting another DNA. Due to these mutations, for example, the reading frame of the codon is shifted or the function of the promoter or exon is disrupted, so that the knockout DN of the present invention can be obtained.
A may be produced.

Specific examples of the non-human mammalian embryonic stem cell in which the DNA of the present invention is inactivated (hereinafter abbreviated as the DNA inactivated ES cell of the present invention or the knockout ES cell of the present invention) include, for example, The DNA of the present invention contained in the target non-human mammal is isolated, and its exon portion has a neomycin resistance gene, a drug resistance gene represented by a hygromycin resistance gene, lacZ (β-galactosidase gene), cat (chloram). A DNA sequence (eg, polyA) that disrupts the function of an exon by inserting a reporter gene typified by a phenicol acetyl transferase gene) or terminates gene transcription at an intron portion between exons.
Insert additional signals, etc., and complete messenger R
By disabling NA synthesis, a DNA chain having a DNA sequence constructed so as to destroy the gene as a result (hereinafter abbreviated as targeting vector) is introduced into the chromosome of the animal by, for example, homologous recombination method. , D on the Southern hybridization analysis or targeting vector of the obtained ES cells using the DNA sequence of the present invention or a DNA sequence in the vicinity thereof as a probe
The knockout E of the present invention was analyzed by the PCR method using the NA sequence and the DNA sequence of the neighboring region other than the DNA of the present invention used for the preparation of the targeting vector as a primer.
It can be obtained by selecting S cells. Also,
As the original ES cells for inactivating the DNA of the present invention by the homologous recombination method, for example, those already established as described above may be used, or newly established according to the method of known Evans and Kaufma. You can also use it. For example, in the case of mouse ES cells, currently, 129 ES cells are generally used.
Although cells have been used, the immunological background is not clear. For the purpose of obtaining an ES cell whose immunological genetic background is clear in a pure system as an alternative, for example, C
57BL / 6 mice and those established using BDF ₁ mice (F ₁ between C57BL / 6 and DBA / 2), in which the number of eggs collected by C57BL / 6 was improved by crossing with DBA / 2, are also good. Can be used. The BDF ₁ mouse has the advantage that the number of eggs collected is large and the eggs are strong, and since it has the C57BL / 6 mouse as a background, the ES cells obtained using this can be used as a pathological model mouse. , C57BL / 6 mice can be advantageously used in that its genetic background can be changed to that of C57BL / 6 mice. In addition, when ES cells are established, blastocysts on the 3.5th day after fertilization are generally used, but other than this, 8-cell stage embryos are ovulated and cultured up to the blastocysts for efficient and large numbers. The early embryos of can be obtained. Either male or female ES cells may be used, but male ES cells are usually more convenient for producing a germ line chimera. In addition, it is desirable to distinguish males and females as soon as possible in order to reduce troublesome culturing.

As a method for determining the sex of ES cells, for example, a method of amplifying and detecting a gene of the sex determining region on the Y chromosome by the PCR method can be mentioned. Using this method, conventionally, for example G-banding method, requires about 10 ⁶ cells for karyotype analysis, since suffices ES cell number of about 1 colony (about 50), culture It is possible to perform the primary selection of ES cells in the early stage by discriminating males and females, and the early selection of male cells can significantly reduce the labor required in the initial stage of culture.
The secondary selection can be performed, for example, by confirming the number of chromosomes by the G-banding method. The number of chromosomes of ES cells obtained is 100% of the normal number
However, if it is difficult because of physical manipulations during establishment, the gene of ES cell is knocked out, and then cloned again into normal cell (for example, cell having 2n = 40 chromosomes in mouse). Is desirable. The embryonic stem cell line thus obtained usually has a very good proliferative property, but since it is easy to lose the ability to develop ontogeny, it is necessary to carefully subculture. For example, on a suitable feeder cell such as STO fibroblast, LIF (1-
Incubate in a carbon dioxide incubator (preferably 5% carbon dioxide, 95% air or 5% oxygen, 5% carbon dioxide, 90% air) in the presence of 10,000 U / ml at about 37 ° C. However, at the time of subculture, for example, trypsin / EDTA
Solution (usually 0.001-0.5% trypsin / 0.1-5
mM EDTA, preferably about 0.1% trypsin / 1m
(M EDTA) treatment to obtain single cells and seeding on newly prepared feeder cells. Such passage is usually carried out every 1 to 3 days. At this time, it is desirable to observe the cells and to discard the cultured cells when morphologically abnormal cells are found. ES cells are differentiated into various types of cells such as parietal muscle, visceral muscle, and myocardium by performing monolayer culture until reaching a high density or suspension culture until forming a cell aggregate under appropriate conditions. Is possible [MJ Evans and MH
Kaufman, Nature Volume 292, 154, 1981.
Year; GR Martin Proceedings of National Academy of Sciences USA (Proc. Natl. Acad. Sci. USA) 78, 7634, 1
981; TC Doetschman et al., Journal of Embiology and Experimental Morphology, Vol. 87, p. 27, 1985], deficient DNA expression of the present invention obtained by differentiating ES cells of the present invention. The cells are useful in cell biological studies of the apelin receptors of the invention in vitro.

The non-human mammal deficient in DNA expression of the present invention can be distinguished from a normal animal by measuring the mRNA level of the animal using a known method and indirectly comparing the expression level. is there. As the non-human mammal,
The same as the above is used. The non-human mammal deficient in DNA expression of the present invention can be obtained by, for example, introducing the targeting vector prepared as described above into mouse embryonic stem cells or mouse egg cells, and inactivating the DNA of the present invention in the targeting vector. The DNA of the present invention can be knocked out by homologous recombination in which the sequence replaces the DNA of the present invention on the chromosome of mouse embryonic stem cells or mouse egg cells by homologous recombination. A cell in which the DNA of the present invention has been knocked out is a DNA on or near the DNA of the present invention.
A DNA sequence on a Southern hybridization analysis or targeting vector using the sequence as a probe,
It can be determined by analysis by the PCR method using a DNA sequence of a region other than the mouse-derived DNA of the present invention used as the targeting vector as a primer. When a non-human mammal embryonic stem cell is used, a cell line in which the DNA of the present invention is inactivated by gene homologous recombination is cloned, and the cell is cloned at an appropriate time, for example, at the 8-cell stage. It is injected into an animal embryo or blastocyst, and the produced chimeric embryo is transplanted into the uterus of the pseudopregnant non-human mammal. The produced animal is a chimeric animal composed of both cells having the normal DNA locus of the present invention and cells having the artificially mutated DNA locus of the present invention. When a part of germ cells of the chimeric animal has the mutated DNA locus of the present invention, all tissues are artificially mutated from the population obtained by mating such a chimeric individual with a normal individual. It can be obtained by selecting an individual composed of cells having the added DNA locus of the present invention, for example, by judging the coat color. The individual thus obtained is usually an individual deficient in heteroexpression of the peptide of the present invention, and heterologous individuals deficient in heteroexpression of the peptide of the present invention are bred to homozygous expression of the peptide of the present invention from their offspring. Defective individuals can be obtained.

When egg cells are used, for example, a transgenic non-human mammal having a targeting vector introduced into its chromosome can be obtained by injecting a DNA solution into the egg cell nucleus by the microinjection method. It can be obtained by selecting those having a mutation in the DNA locus of the present invention by gene homologous recombination as compared with a transgenic non-human mammal. In this way, an individual whose DNA of the present invention has been knocked out can be passaged in a normal breeding environment after confirming that the DNA of the animal individual obtained by mating is also knocked out. Furthermore, the acquisition and maintenance of the germ line may be carried out according to the conventional method. That is, by mating male and female animals carrying the inactivated DNA,
A homozygous animal having the inactivated DNA on both homologous chromosomes can be obtained. The homozygous animals obtained are
It can be efficiently obtained by breeding a mother animal in a state where there are one normal individual and a plurality of homozygotes. By mating male and female heterozygous animals, homozygous and heterozygous animals having the inactivated DNA are bred. DNA of the present invention
The non-human mammal embryonic stem cells inactivated by the method are very useful for producing the non-human mammal deficient in DNA expression of the present invention. In addition, the non-human mammal deficient in DNA expression of the present invention lacks various biological activities that can be induced by the peptide of the present invention, and thus is a model of diseases caused by inactivation of biological activity of the peptide of the present invention. Therefore, it is useful for investigating the causes of these diseases and examining therapeutic methods.

(8a) Method for Screening Substance Having Curative / Preventive Effect on Disease Caused by DNA Deficiency or Damage of the Present Invention The non-human mammal deficient in DNA expression of the present invention is D
It can be used for screening a substance having a therapeutic / preventive effect on a disease caused by NA deficiency or damage. That is, the present invention results from a defect or damage of the DNA of the present invention, which comprises administering a test compound to a non-human mammal deficient in DNA expression of the present invention and observing and measuring the change in the animal. Provided is a method for screening a substance having a therapeutic / preventive effect on a disease. Examples of the non-human mammal deficient in DNA expression of the present invention used in the screening method include the same ones as described above. Examples of test compounds include peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, plasma, etc., and these compounds are novel compounds. Or a known compound may be used. Specifically, the non-human mammal deficient in DNA expression of the present invention is treated with a test compound and compared with a non-treated control animal, and tested using changes in each organ, tissue, disease symptoms, etc. of the animal as an index. The therapeutic / prophylactic effect of a compound can be tested. As a method of treating the test animal with the test compound, for example, oral administration, intravenous injection, etc. are used, and it can be appropriately selected depending on the symptoms of the test animal, the properties of the test compound, and the like. Also,
The dose of the test compound can be appropriately selected depending on the administration method, the properties of the test compound, and the like.

In the screening method, when the test compound is administered to the test animal, the function of the test animal is about 1
When the concentration is reduced by 0% or more, preferably about 30% or more, more preferably about 50% or more, the test compound can be selected as a substance having a therapeutic / prophylactic effect against the above-mentioned diseases. Specifically, the test compound has, for example, an adrenocorticotropic hormone secretion-regulating action, and is useful as an adrenocorticotropic hormone secretagogue, preferably an adrenocorticotropic hormone secretagogue, for example, low aldosterone. , Hypocortisolemia, secondary and chronic hypoadrenocorticism, Addison's disease (eg, fatigue, nausea, pigmentation, hypogonadism, hair loss, hypotension), adrenal insufficiency, pain, obesity, etc. It can be used as a medicine such as a therapeutic agent. In addition, the test compound has an oxytocin secretion regulatory action, and as an oxytocin secretion regulator, preferably an oxytocin secretion promoter, for example, induction of labor, weak labor, loose bleeding, placental delivery, uterine retrograde failure, cesarean section. Surgery, miscarriage, abortion, lactation deficiency,
It is useful as a drug such as a prophylactic / therapeutic agent for post-traumatic stress syndrome, milk stasis, etc. In addition, the test compound can be applied as a test agent for investigating the secretory function of adrenocorticotropic hormone and the secretory function of oxytocin. The substance obtained by using the screening method is a substance selected from the above-mentioned test compounds, and is used for treating diseases caused by apelin receptor deficiency or damage.
Since it has a preventive effect, it can be used as a medicine such as a safe and low toxic therapeutic / prophylactic agent against the disease.
Furthermore, compounds derived from the substances obtained by the above screening can be used as well.

The substance obtained by the screening method may form a salt, and as the salt of the substance, a physiologically acceptable acid (eg, inorganic acid, organic acid, etc.) or base (eg, A salt with an alkali metal or the like) is used, and a physiologically acceptable acid addition salt is particularly preferable. Examples of such salts include salts with inorganic acids (for example, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid, etc.), or organic acids (for example, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, Succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid, etc.) and the like salts are used. The drug containing the substance obtained by the screening method can be produced in the same manner as the drug containing the apelin or a modified product thereof described above. Since the preparation thus obtained is safe and has low toxicity, it can be used, for example, in humans or mammals (for example, rat, mouse, guinea pig, rabbit, sheep, pig, cow, horse, cat, dog, monkey, etc.). Can be administered. Although the dose of the substance varies depending on the target disease, administration subject, administration route, etc., for example, when the substance is orally administered for the purpose of treating hypoaldosteronism, generally in an adult patient (with a body weight of 60 kg). Is about 0.1 to 100 mg, preferably about 1.0 to 50 mg, and more preferably about 1.0 to about 100 mg of the compound per day.
Administer 20 mg. When administered parenterally, the single dose of the substance varies depending on the administration subject, target disease, etc., but for example, for the purpose of treating hypoaldosteronism, the substance is usually administered in the form of an injection to an adult patient (60 kg It is convenient to administer about 0.01 to 30 mg, preferably about 0.1 to 20 mg, and more preferably about 0.1 to 10 mg of the substance by intravenous injection per day. Is. In the case of other animals, the dose converted per 60 kg can be administered.

(8b) Method for Screening Compound Promoting or Inhibiting Promoter Activity for DNA of the Present Invention The present invention provides a non-human mammal deficient in expression of the DNA of the present invention,
Provided is a method for screening a substance that promotes or inhibits the activity of a promoter for DNA of the present invention, which comprises administering a test compound and detecting the expression of a reporter gene. In the above screening method, the non-human mammal deficient in DNA expression of the present invention, among the non-human mammal deficient in DNA expression of the present invention, the DNA of the present invention is inactivated by introducing a reporter gene, A reporter gene that can be expressed under the control of a promoter for the DNA of the present invention is used. Examples of the test compound include the same ones as described above. As the reporter gene, the same ones as described above are used, and the β-galactosidase gene (lacZ), the soluble alkaline phosphatase gene, the luciferase gene and the like are preferable. In the non-human mammal deficient in expression of the DNA of the present invention in which the DNA of the present invention is replaced with a reporter gene, the reporter gene exists under the control of the promoter for the DNA of the present invention, and thus the expression of the substance encoded by the reporter gene is traced. By doing so, the activity of the promoter can be detected. For example, a part of the DNA region encoding the peptide of the present invention is a β-galactosidase gene (lacZ) derived from Escherichia coli.
In the tissue where the peptide of the present invention is expressed, β-galactosidase is originally expressed in place of the peptide of the present invention. Thus, for example, 5-bromo-4-
Chloro-3-indolyl-β-galactopyranoside (X
It is possible to easily observe the expression state of the apelin receptor of the present invention in an animal body by staining with a reagent such as -gal) that serves as a substrate for β-galactosidase. Specifically, the apelin receptor-deficient mouse of the present invention or a tissue section thereof is fixed with glutaraldehyde or the like, washed with phosphate buffered saline (PBS), and then X
-React with a staining solution containing gal at room temperature or around 37 ° C for about 30 minutes to 1 hour,
The β-galactosidase reaction may be stopped by washing with an EDTA / PBS solution, and the coloration may be observed. In addition, according to the conventional method, mRNA encoding lacZ
May be detected. The substance salt obtained by using the above-mentioned screening method is a substance selected from the above-mentioned test compounds, and is a substance that promotes or inhibits the promoter activity for the DNA of the present invention. The substance obtained by the screening method may form a salt, and the salt of the substance may be a physiologically acceptable acid (eg, inorganic acid) or base (eg, organic acid) or the like. Are used, and physiologically acceptable acid addition salts are particularly preferable. Such salts include, for example, inorganic acids (for example, hydrochloric acid, phosphoric acid,
Salts with hydrobromic acid, sulfuric acid, etc., or organic acids (eg acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid) , Benzenesulfonic acid, etc.)
Salt and the like are used.

The substance which promotes the promoter activity for DNA of the present invention can promote the expression of the apelin receptor and the function of the apelin receptor, and thus is useful as, for example, an adrenocorticotropic hormone secretagogue. Yes, for example, hypoaldosteronism, hypocortisolemia, secondary and chronic hypoadrenocorticism, Addison's disease (eg, fatigue, nausea, pigmentation, hypogonadism, hair loss, hypotension), adrenal insufficiency, pain It can be used as a medicine for preventing and / or treating obesity and the like. In addition, the substance that promotes the promoter activity for DNA of the present invention is, as an oxytocin secretion promoter, for example, induction of labor, weak labor, relaxation bleeding, placental delivery, uterine retrograde failure, cesarean section, abortion, artificial abortion, It is useful as a drug such as a prophylactic / therapeutic agent for lactation insufficiency, post-traumatic stress syndrome, milk retention and the like. On the other hand, the substance that inhibits the promoter activity for the DNA of the present invention can inhibit the expression of the apelin receptor and inhibit the function of the apelin receptor, and thus is useful as, for example, an adrenocorticotropic hormone secretion inhibitor. , For example, Cushing's disease, Cushing's syndrome (eg, central obesity, full-face like face, hypertension, violet skin striatum, hirsutism), adrenocorticotropic hormone (ACTH) -producing pituitary tumor, CRH-producing tumor, aldosterone-producing tumor, Aldosteronism (primary, secondary), primary cortisol resistance, congenital adrenal deficiency, anti-stress, depression,
It can be used as a medicine such as a prophylactic / therapeutic agent for anorexia nervosa, insomnia, gastric / duodenal ulcer, irritable bowel syndrome and the like. In addition, the substance that inhibits the promoter activity for DNA of the present invention is, as an oxytocin secretion inhibitor, for example, hypertonic labor, infertility, ankylosing uterine contraction, fetal distress, uterine rupture, cervical laceration, dysmenorrhea, preterm birth. , Prader
-Useful as a drug such as a preventive / therapeutic agent for Willi syndrome. Further, substances derived from the substances obtained by the above screening can be used as well.

The drug containing the substance obtained by the screening method can be produced in the same manner as the drug containing the above-mentioned apelin or its modified form. Since the preparation thus obtained is safe and has low toxicity, for example, humans or mammals (for example, rat, mouse,
Guinea pig, rabbit, sheep, pig, cow, horse, cat, dog, monkey, etc.).
The dose of the substance varies depending on the target disease, the subject to be administered, the administration route, etc. In an adult patient (with a body weight of 60 kg), the substance is about 0.1 to 100 mg, preferably about 1.0 to 50 m per day.
g, more preferably about 1.0-20 mg. When administered parenterally, the single dose of the substance varies depending on the administration subject, target disease, etc., but for example, a substance that promotes the promoter activity for the DNA of the present invention is injected for the purpose of treating hypoaldosteronism. When administered to an adult patient (as 60 kg) in the form of a drug, the substance is about 0.01 to 30 mg per day, preferably about 0.1 to 30 mg.
It is convenient to administer about 20 mg, more preferably about 0.1 to 10 mg by intravenous injection. In the case of other animals, the dose converted per 60 kg can be administered.

As described above, the non-human mammal deficient in expression of the DNA of the present invention is extremely useful for screening a compound or its salt that promotes or inhibits the activity of the promoter for the DNA of the present invention, and the DNA of the present invention. It can greatly contribute to the investigation of the causes of various diseases caused by the expression failure or the development of preventive / therapeutic drugs. Further, a DNA containing the promoter region of the apelin receptor of the present invention
Using, the genes encoding various proteins are ligated to the downstream, and this is injected into the egg cell of an animal to create a so-called transgenic animal (transgenic animal). It is also possible to study the action in the living body. Further, by binding an appropriate reporter gene to the promoter portion and establishing a cell line in which it is expressed, a low-molecular compound having the action of specifically promoting or suppressing the in vivo production ability of the peptide itself of the present invention. Can be used as a search system for.

In the present specification and drawings, when abbreviations for bases and amino acids are used, IUPAC-IUB is used.
Based on the abbreviations used in Commision on Biochemical Nomenclature or conventional abbreviations in this field,
An example is given below. When amino acids may have optical isomers, the L form is shown unless otherwise specified.

[0153]   DNA: Deoxyribonucleic acid   cDNA: Complementary deoxyribonucleic acid     A: Adenine     T: thymine     G: Guanine     C: cytosine     Y: thymine or cytosine     N: thymine, cytosine, adenine or guanine     R: adenine or guanine     M: cytosine or adenine     W: Thymine or adenine     S: Cytosine or guanine   RNA: Ribonucleic acid   mRNA: messenger ribonucleic acid   dATP: Deoxyadenosine triphosphate   dTTP: Deoxythymidine triphosphate   dGTP: Deoxyguanosine triphosphate   dCTP: Deoxycytidine triphosphate   ATP: Adenosine triphosphate   EDTA: ethylenediaminetetraacetic acid   SDS: Sodium dodecyl sulfate   TFA: trifluoroacetic acid   EIA: Enzyme immunoassay   Gly or G: Glycine   Ala or A: Alanine   Val or V: Valine   Leu or L: Leucine   Ile or I: Isoleucine   Ser or S: Serine

[0154]   Thr or T: threonine   Cys or C: cysteine   Met or M: methionine   Glu or E: Glutamic acid   Asp or D: Aspartic acid   Lys or K: lysine   Arg or R: Arginine   His or H: Histidine   Phe or F: Phenylalanine   Tyr or Y: Tyrosine   Trp or W: Tryptophan   Pro or P: Proline   Asn or N: Asparagine   Gln or Q: Glutamine   pGlu: pyroglutamic acid   Me: Methyl group   Et: ethyl group   Bu: butyl group   Ph: Phenyl group   TC: thiazolidine-4 (R) -carboxamide group   Bom: benzyloxymethyl   NMP: N-methylpyrrolidone   PAM: Phenylacetamidomethyl

The substituents, protecting groups and reagents commonly used in the present specification are represented by the following symbols. Tos: p-toluenesulfonyl HONB: N-hydroxy-5-norbornene-2,3
-Dicarboximide Bzl: benzyl Z: benzyloxycarbonyl Br-Z: 2-bromobenzyloxycarbonyl Cl-Z: 2-chlorobenzyloxycarbonyl Boc: t-butyloxycarbonyl HOBt: 1-hydroxybenztriazole DCC: N, N'-dicyclohexylcarbodiimide TFA: trifluoroacetic acid Fmoc: N-9-fluorenylmethoxycarbonyl DNP: dinitrophenyl Bum: tertiary butoxymethyl Trt: trityl MeBzl: 4-methylbenzyl

The SEQ ID NOs in the sequence listing of the present specification show the following sequences. [SEQ ID NO: 1] This shows the amino acid sequence of bovine apelin receptor (17 sequences from the N terminus). [SEQ ID NO: 2] This shows the base sequence of cDNA encoding the bovine apelin receptor having the amino acid sequence represented by SEQ ID NO: 1. [SEQ ID NO: 3] This shows the amino acid sequence of bovine apelin (17 sequences from the N terminus). [SEQ ID NO: 4] This shows the base sequence of cDNA encoding bovine apelin having the amino acid sequence represented by SEQ ID NO: 3. [SEQ ID NO: 5] cDNA encoding mouse apelin
The amino acid sequence encoded by A is shown. [SEQ ID NO: 6] cDNA encoding mouse apelin
The base sequence of A is shown. [SEQ ID NO: 7] cDNA encoding rat apelin
The amino acid sequence encoded by A is shown. [SEQ ID NO: 8] cDNA encoding rat apelin
The base sequence of A is shown. [SEQ ID NO: 9] cDNA encoding human apelin
The amino acid sequence encoded by [SEQ ID NO: 10] cDNA encoding human apelin
The base sequence of A is shown. [SEQ ID NO: 11] cDNA encoding bovine apelin
The amino acid sequence encoded by A is shown. [SEQ ID NO: 12] cDNA encoding bovine apelin
The base sequence of A is shown. [SEQ ID NO: 13] to [SEQ ID NO: 52] This shows the amino acid sequence of a specific peptide of the modified apelin (I). [SEQ ID NO: 53] to [SEQ ID NO: 119] This shows the amino acid sequence of a specific peptide of the modified apelin (II) to (IV). [SEQ ID NO: 120] This shows the base sequence of the DNA primer used in EXAMPLE 1. [SEQ ID NO: 121] This shows the base sequence of the DNA primer used in EXAMPLE 1. The transformant Escheric obtained in Example 1 described later
hia coli JM109 / pTAbAPJ-5 is 2
Deposit number FERM BP- at the Japan Patent Organism Depositary Center, National Institute of Advanced Industrial Science and Technology from May 13, 002
8044 has been deposited with the Fermentation Institute (IFO) on April 2, 2002 under the deposit number IFO16784.

[0157]

The present invention will be described in more detail with reference to the following examples, which are not intended to limit the scope of the present invention.

Example 1 A by PCR from bovine lung cDNA
Acquisition of PJ receptor gene Bovine lung poly (A) RNA purchased from Unigene was amplified by PCR using the following two types of synthetic DNA using the cDNA synthesized using the Marathon cDNA Kit from Clontech as a template. went. F1 5'-TCTGTGCACCCCAGCATGCAAGAAGGT -3 '(SEQ ID NO: 120) R2 5'-GCCAGCTCCCCGCCCTTCAGAGAGCAA -3' (SEQ ID NO: 121) PCR reaction solution was cDNA solution 1 microl, 0.5 microl F1 (10 m
icroM), 0.5 microlR1 (10 microM), 5 x reaction solution attached to 5 microl, 2.5 microl Gcmelt, 2.5 microl dNTP
(10 mM), 0.5 microl Advantage Gcmelt polymeras
e Mix (Clontech) and 12.5 microl Otsuka distilled water were added to make a total of 25 microl. The reaction solution was transferred to the Thermal Cycler.
PCR reaction was performed using 9600. Regarding the PCR conditions, after denaturing at 95 ° C for 2 minutes, a cycle of 98 ° C for 10 seconds, 63 ° C for 20 seconds and 72 ° C for 120 seconds was repeated 35 times. After confirming the amplification of a PCR product of about 1200 bp by electrophoresis using a part of the PCR product, the PCR product was purified using the Quiagen PCR purification Kit, and the sequence shown in Fig. 1 was obtained by direct sequencing. I got it.
The amino acid sequence predicted from the DNA sequence in FIG. 1 was as shown in FIG. The homology with the human APJ receptor (apelin receptor) is shown in FIG.
It was considered to be a receptor (apelin receptor). next,
PCR products recovered from the gel were cloned into TA Cloning Kit (Inv
E. coli JM109 / pTAbAPJ-5 was obtained by subcloning into E. coli JM109 using itrogen). Plasmid pTAbAPJ-5 was extracted from Escherichia coli obtained by subcloning using a plasmid extractor (Kurabo Co., Ltd.), and the nucleotide sequence of the inserted fragment was determined. The bovine APJ receptor gene cDNA having the same sequence as in FIG. 1 was determined.
Was confirmed.

Reference Example 1 Effect of Apelin on Pituitary Hormone Concentration The effect of administration of apelin on the pituitary hormone level in plasma was examined. Adult Wistar male rats (body weight during surgery: 320 to 350 g) were anesthetized by intraperitoneal administration of pentobarbital 50 mg / kg, and fixed to a rat stereotaxic apparatus. The incisor bar was 3.3 mm lower than the interoral line. The skull is exposed and the guide cannula AG-8 (inner diameter 0.4 mm, outer diameter 0.5) is placed in the third ventricle.
mm, ecom) was drilled into the bone using a dental drill. In addition, anchor screws were buried in three places around it. Stainless steel guide cannula, AG-8
Was inserted so that its tip was located above the third ventricle. The stereotaxic coordinates are AP: -0.8mm, L: 0.0 according to Bregma according to Atlas of Paxinos and Watson (1998).
mm, H: -5.4 mm. The guide cannula was fixed to the skull with dental cement and anchor screws.
The guide cannula has a stainless steel dummy cannula,
AD-8 (outer diameter 0.35 mm, Acom) was inserted and fixed with a cap nut (Acom). After surgery, the rats were housed in individual cages. After implanting the guide cannula, it was kept for about 1 week and allowed to recover after the operation. Then, the cap nut and dummy cannula attached to the skull of the rat were removed, and instead, a Teflon (registered trademark) tube (length 5) was used.
0 cm, inner diameter 0.1 mm, outer diameter 0.35 mm, stainless steel microinjection cannula AMI-9 (inner diameter 0.17 mm, outer diameter 0.35 m)
m, E.com). The length of the microinjection cannula was adjusted so that the tip 1 mm was exposed from the guide cannula. One of the Teflon (registered trademark) tubes was connected to a microsyringe pump, and phosphate buffered saline (pH 7.2) or rat apelin (the 42nd to the 77th amino acid sequence in the amino acid sequence represented by SEQ ID NO: 7) was used. With a peptide) (10
A total of 10 μL of phosphate buffered saline in which (nmol) was dissolved was injected into the lateral ventricle at a flow rate of 5 μL / min. 5 after injection
After waiting for a minute, the microinjection cannula was removed, and the dummy cannula was fixed again with the cap nut. Ten minutes after the completion of the injection, the animals were decapitated and blood was collected.
Blood is 300 KIU / ml containing 3 mg / ml EDTA in a 50 ml tube (Corning) to prevent coagulation.
300 μL of aprotinin solution was added. The collected blood was centrifuged (2,500 rpm, 25 minutes) using a high-speed cooling centrifuge (HIMAC 5DL, Hitachi, Ltd.) to collect a supernatant (plasma). Adrenocorticotropic hormone contained in plasma (A
CTH), luteinizing hormone (LH), thyroid stimulating hormone (TSH), follicle stimulating hormone (FSH), prolactin, oxytocin and arginine-vasopressin (Arg-Vaso).
pressin)) to a commercially available radioimmunoassay (ACTH and A
rg-Vasopressin; Yuka Medias, LH, TSH, FSH and prolactin; Amersham). Oxytocin was measured according to a previously reported method [Neuroscience Letters, Volume 285, Page 234 (2000)]. As shown in FIG. 4, the apelin-administered group showed a significant increase only in blood ACTH and oxytocin concentrations as compared with the control group.

Reference Example 2 Effect of Apelin on ACTH Concentration With respect to the effect of intracerebroventricular administration of apelin on ACTH concentration in plasma, changes with time after administration of apelin were examined. Adult Wistar male rats treated in the same manner as in Reference Example 1 were implanted with a guide cannula, and were bred for about 1 week, awaited recovery after the surgery, and operated for free blood collection. Rats that underwent the above operation were pentobarbital 5
Anesthesia was performed by intraperitoneal administration of 0 mg / kg. The dorsal position was fixed on the dissection pad, and the left jugular vein was exposed. Polyethylene tube SP35 (inner diameter 0.5 mm, outer diameter 0.
9mm, Natsume Seisakusho), cut into about 30cm length, 20
After filling with 0 unit / ml of heparin-containing physiological saline, it was inserted into the jugular vein for about 4.5 cm and fixed. The other end of the tube was subcutaneously exposed on the dorsal side and exposed from the neck (dorsal side).
After waiting overnight after the operation, 300 μL of blood was collected before administration of apelin using a tuberculin syringe with a dose of 1 ml and a 25 gauge needle (both are Terumo Corp.). To prevent blood coagulation, 10 μL of 300 KIU / ml aprotinin solution containing 3 mg / ml EDTA was previously put in the syringe.
The capnite and dummy cannula attached to the skull of the rat were removed, and instead, a Teflon (registered trademark) tube (length 50 cm, inner diameter 0.1 mm, outer diameter 0.35 m) was used.
m, Eicom) stainless steel microinjection cannula (inner diameter 0.17 mm, outer diameter 0.
35 mm, E.com) was inserted. The length of the microinjection cannula was adjusted so that the tip 1 mm was exposed from the guide cannula. One of the Teflon (registered trademark) tubes was connected to a microsyringe pump, and phosphate buffered saline (pH 7.2) or rat apelin (the 42nd to 77th amino acids in the amino acid sequence represented by SEQ ID NO: 7) was used. Sequence-containing peptide) (3, 10 nmol) at a flow rate of 5 μL / min for a total of 10
μL was injected into the third ventricle. After waiting 5 minutes after the completion of the injection, the microinjection cannula was removed, and the dummy cannula was fixed again with the capnite. 300 μL of blood was collected from the jugular vein 0, 10, 20, 30, 60 minutes after the start of intraventricular administration. The collected blood is centrifuged using a micro high-speed cooling centrifuge (MR-150, Tommy Seiko).
(13,000 rpm, 5 minutes), and the supernatant (plasma) was collected. ACTH contained in plasma was measured using a radioimmunoassay (Yuka Medias). As shown in FIG. 5, the apelin-administered group was compared with the target group in comparison with the apelin 3n group.
A rising tendency was observed in the mol administration group, and apelin 10 nm
In the ol-administered group, a significant increase in blood ACTH concentration was observed at any blood collection point, with a peak at 10 minutes after administration.

Reference Example 3 Effect of Apelin on Oxytocin Concentration With respect to the effect of third intracerebroventricular administration of apelin on oxytocin concentration in plasma, changes with time after administration of apelin were examined. Rat apelin (42nd to 77th amino acid sequence represented by SEQ ID NO: 7) as in Reference Example 2
After the administration of the peptide having the th amino acid sequence), blood was collected and plasma was collected. ACTH contained in plasma was measured using a radioimmunoassay (Yuka Medias). As shown in FIG. 6, the apelin administration group was compared with the control group, and the apelin 10 nmol administration group was changed from 10 minutes to 2 minutes after administration.
A significant increase in blood oxytocin concentration was observed at 0 minutes.

[0162]

INDUSTRIAL APPLICABILITY The apelin receptor of the present invention is a receptor for apelin having an adrenocorticotropic hormone secretion regulating action and an oxytocin secretion regulating action, and is useful as an adrenocorticotropic hormone secretion regulating agent and an oxytocin secretion regulating agent. . In addition, the apelin receptor of the present invention is useful for screening a corticotropin secretion regulator or an oxytocin secretion regulator.

[0163]

[SEQUENCE LISTING]

<110> Takeda Chemical Industries, Ltd. <120> Novel Apelin Receptor And Its DNA <130> B02088 <160> 121 <210> 1 <211> 400 <212> PRT <213> Bovine <400> 1 Met Gln Glu Gly Gly Glu Tyr Asp Gly Tyr Tyr Gly Ala Asp Asn Gln 5 10 15 Ser Glu Cys Glu Tyr Glu Asp Trp Gln Ser Ser Gly Ala Leu Ile Pro 20 25 30 Ala Ile Tyr Met Val Val Phe Val Leu Gly Thr Ala Gly Asn Gly Leu 35 40 45 Val Leu Trp Thr Ile Phe Arg Ser Gly Arg Asp Arg Arg Arg Ala Ala 50 55 60 Asp Val Phe Ile Ala Ser Leu Ala Val Ala Asp Leu Thr Phe Val Val 65 70 75 80 Thr Leu Pro Leu Trp Ala Thr Tyr Thr Tyr Arg Asp Tyr Asp Trp Pro 85 90 95 Phe Gly Ala Phe Ala Cys Lys Leu Ser Ser Tyr Leu Ile Phe Val Asn 100 105 110 Met Tyr Ala Ser Val Phe Cys Leu Thr Gly Leu Ser Leu Asp Arg Tyr 115 120 125 Leu Ala Ile Val Arg Pro Val Ala Asn Ala Arg Leu Arg Pro Arg Val 130 135 140 Gly Gly Ala Val Ala Thr Ala Gly Leu Trp Ala Leu Ala Gly Leu Leu 145 150 155 160 Ala Leu Pro Val Leu Val Phe Arg Ala Thr Ser Thr Val Leu Gln Ala 165 170 175 Glu Asn Ala Thr Lys Val G ln Cys Tyr Met Asp Tyr Ser Leu Val Ala 180 185 190 Gly Pro Asp Ala Glu Trp Ala Trp Glu Val Gly Leu Gly Val Ser Ser 195 200 205 Thr Ala Leu Gly Phe Ala Gly Pro Phe Ala Val Met Leu Thr Cys Tyr 210 215 220 Phe Cys Ile Gly Arg Thr Val Ala Gly His Phe Gly Lys Glu Arg Ala 225 230 235 240 Arg Gly Leu Arg Lys Arg Arg Arg Leu Leu Ala Ile Ile Ala Val Leu 245 250 255 Val Leu Thr Phe Ala Leu Cys Trp Leu Pro Tyr His Leu Val Lys Thr 260 265 270 Leu Tyr Val Leu Gly Ser Leu Leu Arg Trp Pro Cys Ala Phe Asp Leu 275 280 285 Phe Leu Met Asn Val Phe Pro Tyr Cys Thr Cys Val Ser Tyr Val Asn 290 295 300 Ser Cys Leu Asn Pro Phe Leu Tyr Ala Phe Phe Asp Pro Arg Phe Arg 305 310 315 320 Gln Ala Cys Ala Ser Val Leu Cys Trp Gly Arg Arg Gly Cys Gly Gly 325 330 335 Ala Trp Arg Ala Gly Gly Gly Gly Gly Gly Gly Gly Gly Arg Gly Gly 340 345 350 Gly Gly Gly Asp Lys Ser Ala Ser Ser Ser Ser Ser Ala Ser Ser Gly 355 360 365 His Ser Gln Gly Pro Gly Pro Gly Gly Ala Gly Lys Gly Gly Glu Pro 370 375 380 Met Pro Glu Lys Ser Ile Pro T yr Ser Gln Glu Thr Leu Leu Val Asp 385 390 395 400 <210> 2 <211> 1200 <212> DNA <213> Bovine <400> 2 atgcaagaag gtggcgagta cgacggatac tatggggcgg acaaccagtctg tccgtcctcatc tcc tcc atc cggcctg tggaccatct tccgtagcgg ccgcgaccgg 180 cggcgggcgg ccgacgtctt catcgccagc ctggcggtgg ctgacctcac cttcgtggtg 240 accctgccgc tctgggccac ctacacctat cgggactacg actggccctt cggggccttc 300 gcctgcaagc tcagcagcta tctcatcttc gtcaacatgt acgccagcgt cttctgcctc 360 accggcctca gcctggaccg ctacctggcc atcgtgaggc cggtggccaa cgcccggctg 420 cggccgcggg tcggcggcgc cgtggccacg gccggcctgt gggcgctggc cggcctgctc 480 gccctgcccg tgctggtctt ccgcgccacc agcaccgtgc tgcaggcgga gaatgccacc 540 aaggtgcagt gctacatgga ctactcgctg gtggccggcc ccgacgccga gtgggcctgg 600 gaggtgggcc tgggcgtctc gtccaccgcg ctgggcttcg cggggccctt cgcggtcatg 660 ctgacctgct acttctgcat cggccgcggcggcggcggcggcggcggcggcggcggcggcggctg ccttc 780 gcgctctgct ggctgcccta ccacctggtc aagaccctct acgtgctggg cagcctgctg 840 cgctggccct gcgccttcga cctcttcctc atgaacgtct tcccctactg cacgtgcgtc 900 agctacgtca acagctgcct caaccccttc ctctacgcct tcttcgaccc ccgcttccgc 960 caggcctgcg cctcggtgct ctgctggggc cgccggggct gcggaggagc ctggcgcgcg 1020 ggcggcggcg gcggcggcgg cggcggccgg ggcggcggcg gcggggacaa gtcagccagc 1080 tcctcctcct cggcgtcgtc ggggcacagc cagggccccg ggcccggcgg cgcggggaag 1140 ggcggggagc cgatgccgga gaagtccatc ccctacagcc aggagaccct cctggtggac 1200 <210> 3 <211> 17 <212> PRT <213> Bovine <400> 3 Leu Val Gln Pro Arg Gly Pro Arg Ser Gly Pro Gly Pro Trp Gln Gly 1 5 10 15 Gly 17 <210> 4 <211> 51 <212> DNA <213> Bovine <400> 4 ytngtncarc cnmgnggncc nmgnwsnggn ccnggnccnt ggcarggngg n 51 <210> 5 <211> 77 <212> PRT <213> Mouse <400> 5 Met Asn Leu Arg Leu Cys Val Gln Ala Leu Leu Leu Leu Trp Leu Ser 1 5 10 15 Leu Thr Ala Val Cys Gly Val Pro Leu Met Leu Pro Pro Asp Gly Thr 20 25 30 Gly Leu Glu Glu Gly Ser Met Arg Tyr Leu Val Lys Pro Arg Thr Ser 3 5 40 45 Arg Thr Gly Pro Gly Ala Trp Gln Gly Gly Arg Arg Lys Phe Arg Arg 50 55 60 Gln Arg Pro Arg Leu Ser His Lys Gly Pro Met Pro Phe 65 70 75 77 <210> 6 <211> 231 <212> DNA <213> Mouse <400> 6 atgaatctga ggctctgcgt gcaggcgctg ctgctgctct ggctctcctt gactgcagtt 60 tgtggagtgc cactgatgtt gcctccagat ggaacaggac tagaagaagg aagcatgcgc 120 tacctggtga agcccagaac ttcgaggact ggaccaggag cctggcaggg aggcaggagg 180 aaatttcgca gacagcgccc ccggctctcc cataagggcc ccatgccttt c 231 <210> 7 <211> 77 <212> PRT <213> Rat <400> 7 Met Asn Leu Ser Phe Cys Val Gln Ala Leu Leu Leu Leu Trp Leu Ser 1 5 10 15 Leu Thr Ala Val Cys Gly Val Pro Leu Met Leu Pro Pro Asp Gly Lys 20 25 30 Gly Leu Glu Glu Gly Asn Met Arg Tyr Leu Val Lys Pro Arg Thr Ser 35 40 45 Arg Thr Gly Pro Gly Ala Trp Gln Gly Gly Arg Arg Lys Phe Arg Arg 50 55 60 Gln Arg Pro Arg Leu Ser His Lys Gly Pro Met Pro Phe 65 70 75 77 <210> 8 <211> 231 <212> DNA <213> Rat <400> 8 atgaatctga gtttctgcgt gcaggcgctg ctgctgctct ggctctcctt gactgccgtg 60 tgtggagtgc cactgatgc t gcctccagat gggaaagggc tagaagaagg caacatgcgc 120 tacctggtga agcccagaac ttcgaggact ggaccagggg cctggcaggg aggcaggagg 180 aaatttcgca gacagu Leu Leu Leu Leu Trp Leu Ser 1 5 10 15 Leu Thr Ala Val Cys Gly Gly Ser Leu Met Pro Leu Pro Asp Gly Asn 20 25 30 Gly Leu Glu Asp Gly Asn Val Arg His Leu Val Gln Pro Arg Gly Ser 35 40 45 Arg Asn Gly Pro Gly Pro Trp Gln Gly Gly Arg Arg Lys Phe Arg Arg 50 55 60 Gln Arg Pro Arg Leu Ser His Lys Gly Pro Met Pro Phe 65 70 75 77 <210> 10 <211> 231 <212> DNA <213> Human <400> 10 atgaatctgc ggctctgcgt gcaggcgctc ctgctgctct ggctctcctt gaccgcggtg 60 tgtggagggt ccctgatgcc gcttcccgat gggaatgggc tggaagacgg caatgtccgc 120 cacctggtgc agcccagagg gtcaaggaat gggccagggc cctggcaggg aggtcggagg 180 aaattccgcc gccagcggcc ccgcctctcc cataagggac ccatgccttt c 231 <210> 11 <211> 77 <212> PRT <213> Bovine <400 > 11 Met Asn Leu Arg Arg Cys Val Gln Ala Leu Leu L eu Leu Trp Leu Cys 1 5 10 15 Leu Ser Ala Val Cys Gly Gly Pro Leu Leu Gln Thr Ser Asp Gly Lys 20 25 30 Glu Met Glu Glu Gly Thr Ile Arg Tyr Leu Val Gln Pro Arg Gly Pro 35 40 45 Arg Ser Gly Pro Gly Pro Trp Gln Gly Gly Arg Arg Lys Phe Arg Arg 50 55 60 Gln Arg Pro Arg Leu Ser His Lys Gly Pro Met Pro Phe 65 70 75 77 <210> 12 <211> 231 <212> DNA <213> Bovine <400> 12 atgaatctgc ggcgctgcgt gcaggcgctc ctgctgctct ggctctgcct gagcgcggtg 60 tgcggaggac ccctgctgca gacttctgac gggaaggaga tggaagaagg caccatccga 120 tacctggtgc agcccagggg gccgaggagc ggcccaggcc cctggcaggg aggtcggagg 180 aagttccggc gccagcggcc acgcctctcc cacaagggtc ccatgccttt c 231 <210> 13 <211> 36 <212> PRT <213> Artificial Sequence <223 > Xaa means Nle. <400> 13 Leu Val Gln Pro Arg Gly Ser Arg Asn Gly Pro Gly Pro Trp Gln Gly 1 5 10 15 Gly Arg Arg Lys Phe Arg Arg Gln Arg Pro Arg Leu Ser His Lys Gly 20 25 30 Pro Xaa Pro Phe 35 <210> 14 <211> 36 <212> PRT <213> Artificial Sequence <223> Xaa means Nle. <400> 14 Leu Val Gln Pro Arg Gly Ser Arg A sn Gly Pro Gly Pro Trp Gln Gly 1 5 10 15 Gly Arg Arg Lys Phe Arg Arg Gln Arg Pro Arg Leu Ser His Lys Gly 20 25 30 Pro Xaa Pro Tyr 35 <210> 15 <211> 13 <212> PRT <213 > Artificial Sequence <223> Xaa on the 1st position means pGlu, Xaa on the 11th position means Nle. <400> 15 Xaa Arg Pro Arg Leu Ser His Lys Gly Pro Xaa Pro Phe 1 5 10 <210> 16 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa on the 1st position means pGlu, Xaa on the 11th position means Nle. <400> 16 Xaa Arg Pro Arg Leu Ser His Lys Gly Pro Xaa Pro Tyr 1 5 10 <210 > 17 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa on the 1st position means pGlu, Xaa on the 11th position means Nle. <400> 17 Xaa Arg Pro Arg Leu Ser His Lys Gly Pro Xaa Pro 1 5 10 <210> 18 <211> 11 <212> PRT <213> Artificial Sequence <223> Xaa on the 1st position means pGlu, Xaa on the 11th position means Nle. <400> 18 Xaa Arg Pro Arg Leu Ser His Lys Gly Pro Xaa 1 5 10 <210> 19 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa on the 1st posi tion means Ac-Arg, Xaa on the 10th position mea ns Nle. <400> 19 Xaa Pro Arg Leu Ser His Lys Gly Pro Xaa Pro Tyr 1 5 10 <210> 20 <211> 11 <212> PRT <213> Artificial Sequence <223> Xaa on the 1st position means Ac-Arg, Xaa on the 10th position mea ns Nle. <400> 20 Xaa Pro Arg Leu Ser His Lys Gly Pro Xaa Pro 1 5 10 <210> 21 <211> 10 <212> PRT <213> Artificial Sequence <223> Xaa on the 1st position means Ac-Arg, Xaa on the 10th position mea ns Nle. <400> 21 Xaa Pro Arg Leu Ser His Lys Gly Pro Xaa 1 5 10 <210> 22 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa on the 1st position means pGlu, Xaa on the 8th position means Lys (Ac). <400> 22 Xaa Arg Pro Arg Leu Ser His Xaa Gly Pro Met Pro Phe 1 5 10 <210> 23 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa on the 1st position means pGlu, Xaa on the 8th position means Lys (Me). <400> 23 Xaa Arg Pro Arg Leu Ser His Xaa Gly Pro Met Pro Phe 1 5 10 <210> 24 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa on the 1st position mean s pGlu, Xaa on the 8th position means Lys (Ac), Xaa on the 11th position means Nle. <400> 24 Xaa Arg Pro Arg Leu Ser His Xaa Gly Pro Xaa Pro Phe 1 5 10 <210> 25 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa on the 1st position means pGlu, Xaa on the 8th position means Lys (Me), Xaa on the 11th position means Nle. <400> 25 Xaa Arg Pro Arg Leu Ser His Xaa Gly Pro Xaa Pro Phe 1 5 10 <210> 26 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa on the 1st position means pGlu, Xaa on the 8th position means Lys (Tos), Xaa on the 11th position means Nle. <400> 26 Xaa Arg Pro Arg Leu Ser His Xaa Gly Pro Xaa Pro Phe 1 5 10 <210> 27 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa on the 1st position means pGlu, Xaa on the 8th position means Arg (Tos), Xaa on the 11th position means Nle. <400> 27 Xaa Arg Pro Arg Leu Ser His Xaa Gly Pro Xaa Pro Phe 1 5 10 <210> 28 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa on the 1st position means pGlu, Xaa on the 5th position means Nle, Xaa on the 11th position means Nle. <400> 28 Xaa Arg Pro Arg Xaa Ser His Lys Gly Pro Xaa Pro Phe 1 5 10 <210> 29 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa on the 1st position means pGlu, Xaa on the 5th position means Nle, Xaa on the 11th position means Nle. <400> 29 Xaa Arg Pro Arg Xaa Ser His Lys Gly Pro Xaa Pro Tyr 1 5 10 <210> 30 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa on the 1st position means pGlu, Xaa on the 11th position means Nle, Xaa on the 13th position means Thi. <400> 30 Xaa Arg Pro Arg Leu Ser His Lys Gly Pro Xaa Pro Xaa 1 5 10 <210> 31 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa on the 1st position means pGlu, Xaa on the 11th position means Nle, Xaa on the 13th position means Phg. <400> 31 Xaa Arg Pro Arg Leu Ser His Lys Gly Pro Xaa Pro Xaa 1 5 10 <210> 32 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa on the 1st position means pGlu, Xaa on the 11th position means Nle, Xaa on the 13th position means Pya (2). <400> 32 Xaa Arg Pro Arg Leu Ser His Lys Gly Pro Xaa Pro Xaa 1 5 10 <210> 33 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa means Nle. <400> 33 Arg Pro Arg Leu Ser His Lys Gly Pro Xaa Pro Tyr 1 5 10 <210> 34 <211> 36 <212> PRT <213> Artificial Sequence <223> Xaa on the 3rd position means Adi (NH ₂ ), Xaa on the 34th position m eans Nle. <400 > 34 Leu Val Xaa Pro Arg Gly Ser Arg Asn Gly Pro Gly Pro Trp Gln Gly 1 5 10 15 Gly Arg Arg Lys Phe Arg Arg Gln Arg Pro Arg Leu Ser His Lys Gly 20 25 30 Pro Xaa Pro Phe 35 <210> 35 <211> 36 <212> PRT <213> Artificial Sequence <223> Xaa on the 3rd position means Lys (Ac), Xaa on the 34th position me ans Nle. <400> 35 Leu Val Xaa Pro Arg Thr Ser Arg Thr Gly Pro Gly Ala Trp Gln Gly 1 5 10 15 Gly Arg Arg Lys Phe Arg Arg Gln Arg Pro Arg Leu Ser His Lys Gly 20 25 30 Pro Xaa Pro Tyr 35 <210> 36 <211> 37 <212> PRT <213> Artificial Sequence <223> Xaa on 35th position means Nle. <400> 36 Tyr Leu Val Lys Pro Arg Thr Ser Arg Thr Gly Pro Gly Ala Trp Gln 1 5 10 15 Gly Gly Ar g Arg Lys Phe Arg Arg Gln Arg Pro Arg Leu Ser His Lys 20 25 30 Gly Pro Xaa Pro Phe 35 <210> 37 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa on the 1st position means Z -pGlu, Xaa on the 8th position mean s Lys (Ac), Xaa on the 11th position means Nle. <400> 37 Xaa Arg Pro Arg Leu Ser His Xaa Gly Pro Xaa Pro Phe 1 5 10 <210> 38 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa on the 13th position means Met (O). <400> 38 Arg Arg Gln Arg Pro Arg Leu Ser His Lys Gly Pro Xaa 1 5 10 13 <210> 39 <211> 15 <212> PRT <213> Artificial Sequence <223> Xaa on the 13th position means Nle. <400> 39 Arg Arg Gln Arg Pro Arg Leu Ser His Lys Gly Pro Xaa Pro Tyr 1 5 10 15 <210> 40 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa on the 1st position means pGlu, Xaa on the 12th position means Phe (Cl). <400> 40 Xaa Arg Pro Arg Leu Ser His Lys Gly Pro Met Xaa 1 5 10 12 <210> 41 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa on the 1st position means pGlu, Xaa on the 13th position mea ns Phe (Cl). <400> 41 Xaa Arg Pro Arg Leu Ser His Lys Gly Pro Met Pro Xaa 1 5 10 13 <210> 42 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa on the 12th position means Nal (2). <400> 42 Arg Pro Arg Leu Ser His Lys Gly Pro Met Pro Xaa 1 5 10 12 <210> 43 <211> 11 <212> PRT <213> Artificial Sequence <223> Xaa on the 11th position means Nal (2). <400> 43 Arg Pro Arg Leu Ser His Lys Gly Pro Met Xaa 1 5 10 11 <210> 44 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa on the 12th position means Phe (Cl). <400> 44 Arg Pro Arg Leu Ser His Lys Gly Pro Met Pro Xaa 1 5 10 12 <210> 45 <211> 11 <212> PRT <213> Artificial Sequence <223> Xaa on the 11th position means Phe (Cl). <400> 45 Arg Pro Arg Leu Ser His Lys Gly Pro Met Xaa 1 5 10 11 <210> 46 <211> 11 <212> PRT <213> Artificial Sequence <223> Xaa on the 11th position means Cha. <400> 46 Arg Pro Arg Leu Ser His Lys Gly Pro Met Xaa 1 5 10 11 <210> 47 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa on the 1st position means pGlu, Xaa on the 11th position means Cha. <400> 47 Xaa Arg Pro Arg Leu Ser His Lys Gly Pro Xaa Pro Phe 1 5 10 13 <210> 48 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa on the 13th position means Cha. <400> 48 Arg Arg Gln Arg Pro Arg Leu Ser His Lys Gly Pro Xaa 1 5 10 13 <210> 49 <211> 15 <212> PRT <213> Artificial Sequence <223> Xaa on the 15th position means Phe (Cl). <400> 49 Arg Arg Gln Arg Pro Arg Leu Ser His Lys Gly Pro Met Pro Xaa 1 5 10 15 <210> 50 <211> 15 <212> PRT <213> Artificial Sequence <223 > Xaa on the 10th position means Nle, Xaa on the 15th position means Phe (Cl). <400> 50 Arg Arg Gln Arg Pro Arg Leu Ser His Xaa Gly Pro Met Pro Xaa 1 5 10 15 <210> 51 <211> 15 <212> PRT <213> Artificial Sequence <223> Xaa on the 10th position means Nle, Xaa on the 15th position means Tyr (I). <400> 51 Arg Arg Gln Arg Pro Arg Leu Ser His Xaa Gly Pro Met Pro Xaa 1 5 10 15 <210> 52 <211> 15 <212> PRT <213> Artificial Sequence <223> Xaa on the 10th position means Nle, Xaa on the 15th position m eans Tyr (Me). <400> 52 Arg Arg Gln Arg Pro Arg Leu Ser His Xaa Gly Pro Met Pro Xaa 1 5 10 15 <210> 53 <211> 15 <212> PRT <213> Artificial Sequence <223> Xaa means Phe (Cl) <400> 53 Arg Arg Gln Arg Pro Arg Leu Ser Ala Arg Gly Pro Met Pro Xaa 1 5 10 15 <210> 54 <211> 15 <212> PRT <213> Artificial Sequence <223> Xaa on the 13th position means Cha, Xaa on the 15th position means Phe (Cl) <400> 54 Arg Arg Gln Arg Pro Arg Leu Ser His Lys Gly Pro Xaa Pro Xaa 1 5 10 15 <210> 55 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa means Phe (Cl) <400> 55 Arg Pro Arg Leu Ser Ala Arg Gly Pro Met Pro Xaa 1 5 10 <210> 56 <211> 11 <212> PRT <213> Artificial Sequence <223> Xaa on the 10th position means Cha, Xaa on the 11th position means Phe (Cl). <400> 56 Arg Pro Arg Leu Ser Ala Arg Gly Pro Xaa Xaa 1 5 10 <210> 57 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa on the 10th position means Cha, Xaa on the 12th position means Phe (Cl). <400> 57 Arg Pro Arg Leu Ser Ala Arg Gly Pro Xaa Pro Xaa 1 5 1 0 <210> 58 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa means Cha. <400> 58 Arg Arg Gln Arg Pro Arg Leu Ser Ala Arg Gly Pro Cha 1 5 10 <210> 59 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa on the 10th position means Cha, Xaa on the 12th position means Phe (Cl). <400> 59 Arg Pro Arg Leu Ser His Lys Gly Pro Xaa Pro Xaa 1 5 10 <210> 60 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa means Phe (Cl). <400> 60 Arg Pro Arg Leu Ser His Lys Gly Pro Met Pro Xaa 1 5 10 <210> 61 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa on the 1st position means pGlu, Xaa on the 11th position means Cha. <400> 61 Xaa Arg Pro Arg Leu Ser His Lys Gly Pro Xaa Pro Phe 1 5 10 <210> 62 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa on the 1st position means pGlu, Xaa on the 13th position means Phe (Cl). <400> 62 Xaa Arg Pro Arg Leu Ser His Lys Gly Pro Met Pro Xaa 1 5 10 <210> 63 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa means Cha. <400> 63 Arg Pro Arg Leu Ser Ala Arg Gly Pro Xaa Pro Phe 1 5 10 <210> 64 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa on the 10th position means Cha, Xaa on the 12th position means Phe (Cl). <400 > 64 Arg Pro Arg Leu Phe Ala Arg Gly Pro Xaa Pro Xaa 1 5 10 <210> 65 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa on the 10th position means Cha, Xaa on the 12th position means Phe (Cl). <400> 65 Arg Pro Arg Leu Phe His Lys Gly Pro Xaa Pro Xaa 1 5 10 <210> 66 <211> 15 <212> PRT <213> Artificial Sequence <223> Xaa means Nle. <400> 66 Arg Arg Gln Arg Pro Arg Leu Ser His Lys Gly Pro Xaa Pro Tyr 1 5 10 15 <210> 67 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa means Cha. <400> 67 Arg Pro Arg Leu Phe His Lys Gly Pro Xaa Pro Phe 1 5 10 <210> 68 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa means Phe (Cl). <400> 68 Arg Pro Arg Leu Phe His Lys Gly Pro Met Pro Xaa 1 5 10 <210> 69 <211> 15 <212> PRT <213> Artificial Sequence <223><400> 69 Arg Arg Gln Arg Pro Arg Leu Ser Ala Arg Gly Pro Met Pro Phe 1 5 10 15 <210> 70 <211> 13 <212> PRT <213> Artificial Sequence <223><400> 70 Arg Arg Gln Arg Pro Arg Leu Ser Ala Arg Gly Pro Met 1 5 10 13 <210> 71 <211> 12 <212> PRT <213> Artificial Sequence <223><400> 71 Arg Arg Gln Arg Pro Arg Leu Ser Ala Arg Gly Pro 1 5 10 12 <210> 72 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa means Met (O) <400> 72 Arg Arg Gln Arg Pro Arg Leu Ser His Lys Gly Pro Xaa 1 5 10 13 <210> 73 <211> 15 <212> PRT <213> Artificial Sequence <223> Xaa means Lys (Arg-Arg) <400> 73 Arg Arg Xaa Arg Pro Arg Leu Ser His Lys Gly Pro Met Pro Phe 1 5 10 15 <210> 74 <211> 15 <212> PRT <213> Artificial Sequence <223>><400> 74 Arg Arg Arg Arg Pro Arg Leu Ser His Lys Gly Pro Met Pro Phe 1 5 10 15 <210> 75 <211> 15 <212> PRT <213> Artificial Sequence <223><400> 75 Arg Arg Lys Arg Pro Arg Leu Ser His Lys Gly Pro Met Pro Phe 1 5 10 15 <210> 76 <211> 12 <212> PRT <213> Artificial Sequence <223><400> 76 Arg Pro Arg Leu Ser Ala Arg Gly Pro Met Pro Phe 1 5 10 12 <210> 77 <211> 15 <21 2> PRT <213> Artificial Sequence <223><400> 77 Arg Arg Ala Arg Pro Arg Leu Ser His Lys Gly Pro Met Pro Phe 1 5 10 15 <210> 78 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa means pGlu <400> 78 Xaa Arg Pro Arg Leu Ser Ala Arg Gly Pro Met Pro Phe 1 5 10 13 <210> 79 <211> 10 <212> PRT <213> Artificial Sequence <223><400> 79 Arg Pro Arg Leu Ser Ala Arg Gly Pro Met 1 5 10 <210> 80 <211> 11 <212> PRT <213> Artificial Sequence <223> Xaa means Phe (Cl) <400> 80 Arg Pro Arg Leu Ser His Lys Gly Pro Met Xaa 1 5 10 11 <210> 81 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa means pGlu <400> 81 Xaa Arg Pro Arg Leu Ser Ala Lys Gly Pro Met Pro Phe 1 5 10 13 <210> 82 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa means pGlu <400> 82 Xaa Arg Pro Arg Leu Ser Arg Lys Gly Pro Met Pro Phe 1 5 10 13 <210 > 83 <211> 12 <212> PRT <213> Artificial Sequence <223><400> 83 Arg Pro Arg Leu Phe Ala Arg Gly Pro Met Pro Phe 1 5 10 12 <210> 84 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa means Nal (2) <400> 84 Arg Pro Arg Leu Ser His Lys Gly Pro Met Pro Xaa 1 5 10 12 <210> 85 <211> 15 <212> PRT <213> Artificial Sequence <223><400> 85 Arg Arg Phe Arg Pro Arg Leu Ser His Lys Gly Pro Met Pro Phe 1 5 10 15 <210> 86 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa means pGlu <400> 86 Xaa Arg Pro Arg Leu Ser His Arg Gly Pro Met Pro Phe 1 5 10 13 <210> 87 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa on the 1st position means pGlu, Xaa on the 12th position means Phe (Cl ) <400> 87 Xaa Arg Pro Arg Leu Ser His Lys Gly Pro Met Xaa 1 5 10 12 <210> 88 <211> 11 <212> PRT <213> Artificial Sequence <223> Xaa means Cha <400> 88 Arg Pro Arg Leu Ser His Lys Gly Pro Met Xaa 1 5 10 11 <210> 89 <211> 11 <212> PRT <213> Artificial Sequence <223> Xaa on the 10th position means Cha, Xaa on the 11th position means Phe (Cl ) <400> 89 Arg Pro Arg Leu Phe His Lys Gly Pro Xaa Xaa 1 5 10 11 <210> 90 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa means pGlu <400> 90 Xaa Arg Pr o Arg Leu Ser Leu Lys Gly Pro Met Pro Phe 1 5 10 13 <210> 91 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa on the 1st position means pGlu, Xaa on the 13th position means Nal (2) <400> 91 Xaa Arg Pro Arg Leu Ser His Lys Gly Pro Met Pro Xaa 1 5 10 13 <210> 92 <211> 11 <212> PRT <213> Artificial Sequence <223> Xaa means Nal (2) <400> 92 Arg Pro Arg Leu Ser His Lys Gly Pro Met Xaa 1 5 10 11 <210> 93 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa means pGlu <400> 93 Xaa Arg Pro Arg Leu Ser Arg Arg Gly Pro Met Pro Phe 1 5 10 13 <210> 94 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa means pGlu <400> 94 Xaa Arg Pro Arg Leu Phe Arg Arg Gly Pro Met Pro Phe 1 5 10 13 <210> 95 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa means pGlu <400> 95 Xaa Arg Pro Arg Leu Ser Phe Lys Gly Pro Met Pro Phe 1 5 10 13 <210> 96 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa means pGlu <400> 96 Xaa Arg Pro Arg Leu Phe His Lys Gly Pro Met Pro Phe 1 5 10 13 <210> 97 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa on the 1st position means pGlu, Xaa on the 12th position means Cha <400> 97 Xaa Arg Pro Arg Leu Ser His Lys Gly Pro Met Xaa 1 5 10 12 <210> 98 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa on the 1st position means pGlu, Xaa on the 12th position means Nal (2) <400> 98 Xaa Arg Pro Arg Leu Ser His Lys Gly Pro Met Xaa 1 5 10 12 <210> 99 <211> 11 <212> PRT <213> Artificial Sequence <223><400> 99 Arg Pro Arg Leu Phe Ala Arg Gly Pro Met Phe 1 5 10 11 <210> 100 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa means pGlu <400> 100 Xaa Arg Pro Arg Leu Ser His Phe Gly Pro Met Pro Phe 1 5 10 13 <210> 101 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa means Cha <400> 101 Arg Pro Arg Leu Ser His Lys Gly Pro Met Pro Xaa 1 5 10 12 <210> 102 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa means pGlu <400> 102 Xaa Arg Pro Arg Leu Ser His Leu Gly Pro Met Pro Phe 1 5 10 13 <210> 103 <211> 12 <212> PRT <213> Artificial Sequence <22 3> Xaa means NMe ₂ <400> 103 Arg Arg Gln Arg Pro Arg Leu Ser Ala Arg Gly Xaa 1 5 10 12 <210> 104 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa means Mor <400> 104 Arg Arg Gln Arg Pro Arg Leu Ser Ala Arg Gly Xaa 1 5 10 12 <210> 105 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa means Phe (Cl) <400> 105 Arg Pro Arg Leu Ser Ala Arg Gly Pro Ala Pro Xaa 1 5 10 12 <210> 106 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa means Phe (Cl) <400> 106 Arg Pro Arg Leu Ser Ala Arg Gly Gly Met Pro Xaa 1 5 10 12 <210> 107 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa on the 9th position means N-MeAla, Xaa on the 12th position me ans Phe ( Cl) <400> 107 Arg Pro Arg Leu Ser Ala Arg Gly Xaa Met Pro Xaa 1 5 10 12 <210> 108 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa on the 10th position means Cha, Xaa on the 12th position means Phe (Cl) <400> 108 Arg Pro Arg Leu Ser His Ala Gly Pro Xaa Pro Xaa 1 5 10 12 <210> 109 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa on the 10th position means Cha, Xaa on the 12th position means Phe (Cl) <400> 109 Arg Pro Arg Ala Ser His Lys Gly Pro Xaa Pro Xaa 1 5 10 12 <210> 110 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa on the 10th position means Cha, Xaa on the 12th position means Phe (Cl) <400> 110 Arg Pro Ala Leu Ser His Lys Gly Pro Xaa Pro Xaa 1 5 10 12 <210> 111 <211> 11 <212> PRT <213> Artificial Sequence <223> Xaa on the 10th position means Cha, Xaa on the 11th position means Pyn <400> 111 Arg Pro Arg Leu Ser Ala Arg Gly Pro Xaa Xaa 1 5 10 11 <210> 112 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa on the 10th position means Cha, Xaa on the 12th position means Pyn <400> 112 Arg Pro Arg Leu Ser Ala Arg Gly Pro Xaa Pro Xaa 1 5 10 12 <210> 113 <211> 13 <212> PRT <213> Artificial Sequence <223> Xaa on the 13th position means Cha <400> 113 Arg Arg Gln Arg Pro Arg Leu Ser Ala Arg Gly Gly Xaa 1 5 10 13 <210> 114 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa on the 3rd position means L ys (Me) ₂ <400> 114 Arg Pro Xaa Leu Ser Ala Arg Gly Pro Met Pro Phe 1 5 10 12 <210> 115 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa on the 7th position means Lys (Me) ₂ <400> 115 Arg Pro Arg Leu Ser Ala Xaa Gly Pro Met Pro Phe 1 5 10 12 <210> 116 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa on the 6th position means Dap, Xaa on the 10th position means Cha, Xaa on the 12th position means Phe (Cl) <400> 116 Arg Pro Arg Leu Ser Xaa Arg Gly Pro Xaa Pro Xaa 1 5 10 12 <210> 117 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa on the 6th position means Dap (Ac), Xaa on the 10th position me ans Cha, Xaa on the 12th position means Phe (Cl) <400> 117 Arg Pro Arg Leu Ser Xaa Arg Gly Pro Xaa Pro Xaa 1 5 10 12 <210> 118 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa on the 6th position means Dap (C ₆ ), Xaa on the 10th position me ans Cha, Xaa on the 12th position means Phe (Cl) <400> 118 Arg Pro Arg Leu Ser Xaa Arg Gly Pro Xaa Pro Xaa 1 5 10 12 <210> 119 <211> 12 <212> PRT <213> Artificial Sequence <223> Xaa on the 6th position means Dap (Adi), Xaa on the 10th position m eans Cha, Xaa on the 12th position means Phe (Cl) <400> 119 Arg Pro Arg Leu Ser Xaa Arg Gly Pro Xaa Pro Xaa 1 5 10 12 <210> 120 <211> 27 <212> DNA <213> Artificial Sequence <220><223> Primer <400> 120 tctgtgcacc ccagcatgca agaaggt 27 <210> 121 <211> 27 <212> DNA <213> Artificial Sequence <220><223> Primer <400> 121 gccagctccc cgcccttcag agagcaa 27

[Brief description of drawings]

FIG. 1 shows the DNA sequence of the bovine APJ receptor (apelin receptor) of the present invention.

FIG. 2 shows an amino acid sequence of a bovine APJ receptor (apelin receptor) of the present invention.

FIG. 3 shows a comparison diagram of the amino acid sequences of the bovine APJ receptor (apelin receptor) and the human APJ receptor (apelin receptor) of the present invention.

FIG. 4 shows changes in blood ACTH, LH, TSH, FSH, Prolactin, oxytocin and Arg-Vasopressin concentrations 10 minutes after administration of apelin into the rat third ventricle.

FIG. 5 shows time-course changes in blood ACTH concentration when apelin was administered into the third ventricle of the rat.

FIG. 6 shows time-course changes in blood oxytocin concentration when apelin was administered into the third ventricle of the rat.

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) A61K 45/00 A61P 1/04 4C084 48/00 1/12 4C085 A61P 1/04 3/04 4H045 1/12 5/38 3/04 5/40 5/38 13/12 5/40 15/04 13/12 15/08 15/04 15/14 15/08 25/00 15/14 25/24 25/00 25 / 30 25/24 29/00 25/30 35/00 29/00 43/00 111 35/00 C07K 14/705 43/00 111 16/28 C07K 14/705 C12N 1/15 16/28 1/19 C12N 1 / 15 1/21 1/19 C12P 21/02 C 1/21 C12Q 1/26 5/10 1/40 C12P 21/02 1/42 C12Q 1/26 1/68 A 1/40 G01N 33/15 Z 1 / 42 33/50 Z 1/68 C12N 15/00 ZNAA G01N 33/15 5/00 A 33/50 B A61K 37/02 F term (reference) 2G045 AA34 AA35 BB20 CB01 DA13 DA36 FB02 4B024 AA01 AA11 BA63 CA02 CA12 DA06 HA11 HA1 7 4B063 QA18 QQ08 QQ22 QQ33 QQ35 QQ43 QQ53 QR02 QR13 QR15 QR32 QR36 QR55 QR77 QS34 4B064 AG20 CA19 CC24 DA01 DA13 4B065 AA90Y AB01 CA24 CA44 CA46 4C084ZA22 ZA2 022C224A025A22 BA58 BA22 BA58 BA22 DA58 NA22 CA58 BA22 BA58 BA22 BA23 NA20 CA20 AA13 AA14 BB11 CC04 CC05 DD22 DD34 DD37 DD38 DD41 DD42 DD43 EE01 4H045 AA10 AA11 AA20 AA30 BA10 CA40 DA50 DA75 EA20 EA50 FA74

Claims (94)

[Claims] 1. An apelin receptor protein or a salt thereof, which contains the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1. 2. The apelin receptor protein according to claim 1, which contains the amino acid sequence represented by SEQ ID NO: 1. 3. A partial peptide of the apelin receptor protein according to claim 1 or a salt thereof. 4. A polynucleotide containing a polynucleotide encoding the apelin receptor protein or the partial peptide thereof according to claim 1. 5. The polynucleotide according to claim 4, which is DNA. (6) The polynucleotide according to (5), which contains the base sequence represented by SEQ ID NO: 2. 7. A recombinant vector containing the polynucleotide according to claim 4. 8. A transformant transformed with the recombinant vector according to claim 7. 9. The apelin receptor protein according to claim 1 or a part thereof is produced by culturing the transformant according to claim 8 to produce the apelin receptor protein according to claim 1 or a partial peptide thereof. A method for producing a peptide or a salt thereof. 10. A medicine comprising the apelin receptor protein according to claim 1, the partial peptide according to claim 3, or a salt thereof. 11. A medicine comprising the polynucleotide according to claim 4. 12. The pharmaceutical according to claim 10 or 11, which is a corticotropin secretion regulator. 13. The medicament according to claim 10 or 11, which is a prophylactic / therapeutic agent for hypoaldosteronism, hypocortisolemia, secondary and chronic hypoadrenocortical function, Addison's disease, adrenal insufficiency, pain or obesity. 14. An oxytocin secretion regulator.
The medicine according to 0 or 11. 15. A prophylactic / therapeutic agent for induction of labor, weak labor, loose bleeding, pre- and post-placental delivery, uterine restoration failure, cesarean section, miscarriage, abortion, lactation deficiency, posttraumatic stress syndrome or milk stasis. The pharmaceutical according to claim 10 or 11. 16. A diagnostic agent comprising the polynucleotide according to claim 4. 17. Hypoaldosteronism, hypocortisolemia, secondary and chronic hypoadrenocorticism, Addison's disease, adrenal insufficiency, pain, obesity, induction of labor, weak labor,
Relaxation bleeding, placental delivery, uterine incompetence, cesarean section,
Miscarriage, abortion, lactation deficiency, posttraumatic stress syndrome, milk stasis, Cushing's disease, Cushing's syndrome,
Adrenocorticotropic hormone-producing pituitary tumor, CRH-producing tumor, aldosterone-producing tumor, aldosteronism, primary cortisol resistance, congenital adrenal deficiency, anti-stress, depression, anorexia nervosa, insomnia, gastroduodenal ulcer 17. A diagnostic agent for irritable bowel syndrome, overactive labor, infertility, ankylosing uterine contraction, fetal distress, uterine rupture, cervical laceration, dysmenorrhea, preterm birth or Prader-Willi syndrome.
Described diagnostic agent. 18. An antibody against the apelin receptor protein according to claim 1, the partial peptide according to claim 3, or a salt thereof. 19. The antibody according to claim 18, which is a neutralizing antibody that inactivates signal transduction of the apelin receptor protein according to claim 1. 20. A medicine comprising the antibody according to claim 18. 21. The medicine according to claim 20, which is a corticotropin secretion regulator. 22. Cushing's disease, Cushing's syndrome, adrenocorticotropic hormone-producing pituitary tumor, CRH-producing tumor, aldosterone-producing tumor, aldosteronism, primary cortisol resistance, congenital adrenal enzyme deficiency, anti-stress,
The pharmaceutical according to claim 20, which is a prophylactic / therapeutic agent for depression, anorexia nervosa, insomnia, gastric / duodenal ulcer, or irritable bowel syndrome. 23. An oxytocin secretion regulator.
The medicine according to 0. 24. Overwork labor, infertility, tonic contraction, fetal distress, uterine rupture, cervical laceration, dysmenorrhea, preterm birth or
The pharmaceutical according to claim 20, which is a prophylactic / therapeutic agent for Prader-Willi syndrome. 25. A diagnostic agent comprising the antibody according to claim 18. 26. Hypoaldosteronism, hypocortisolemia, secondary and chronic hypoadrenocorticism, Addison's disease, adrenal insufficiency, pain, obesity, labor induction, weak labor,
Relaxation bleeding, placental delivery, uterine incompetence, cesarean section,
Miscarriage, abortion, lactation deficiency, posttraumatic stress syndrome, milk stasis, Cushing's disease, Cushing's syndrome,
Adrenocorticotropic hormone-producing pituitary tumor, CRH-producing tumor, aldosterone-producing tumor, aldosteronism, primary cortisol resistance, congenital adrenal deficiency, anti-stress, depression, anorexia nervosa, insomnia, gastroduodenal ulcer 26. A diagnostic agent for irritable bowel syndrome, overactive labor, infertility, tonic contraction, fetal distress, uterine rupture, cervical laceration, dysmenorrhea, preterm birth or Prader-Willi syndrome.
Described diagnostic agent. 27. A polynucleotide comprising a base sequence complementary to the polynucleotide of claim 4 or a part thereof. 28. A medicine comprising the polynucleotide according to claim 27. 29. The medicine according to claim 28, which is a corticotropin secretion regulator. 30. Cushing's disease, Cushing's syndrome, adrenocorticotropic hormone-producing pituitary tumor, CRH-producing tumor, aldosterone-producing tumor, aldosteronism, primary cortisol resistance, congenital adrenal deficiency, antistress,
29. The pharmaceutical agent according to claim 28, which is a prophylactic / therapeutic agent for depression, anorexia nervosa, insomnia, gastric / duodenal ulcer, or irritable bowel syndrome. 31. An oxytocin secretion regulator.
8. The medicine according to 8. 32. Labor force pain, infertility, ankylosing uterine contraction, fetal distress, uterine rupture, cervical laceration, dysmenorrhea, preterm birth or
29. The medicine according to claim 28, which is a prophylactic / therapeutic agent for Prader-Willi syndrome. 33. A diagnostic agent comprising the polynucleotide according to claim 27. 34. Hypoaldosteronism, hypocortisolemia, secondary and chronic hypoadrenocorticism, Addison's disease, adrenal insufficiency, pain, obesity, labor induction, weak labor,
Relaxation bleeding, placental delivery, uterine incompetence, cesarean section,
Miscarriage, abortion, lactation deficiency, posttraumatic stress syndrome, milk stasis, Cushing's disease, Cushing's syndrome,
Adrenocorticotropic hormone-producing pituitary tumor, CRH-producing tumor, aldosterone-producing tumor, aldosteronism, primary cortisol resistance, congenital adrenal deficiency, anti-stress, depression, anorexia nervosa, insomnia, gastroduodenal ulcer 34. A diagnostic agent for irritable bowel syndrome, excessive labor pain, infertility, ankylosing uterine contraction, fetal distress, uterine rupture, cervical laceration, dysmenorrhea, preterm birth or Prader-Willi syndrome.
Described diagnostic agent. 35. Apelin, a modified form thereof, an amide thereof, an ester thereof, or a salt thereof, and an apelin receptor containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, a partial peptide thereof, or An apelin receptor containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 with apelin, its modified form or its amide or its ester or its salt, which is characterized by using the salt thereof, A method for screening a compound or a salt thereof, which changes the binding property to the partial peptide or the salt thereof. 36. An apelin receptor, a modified form thereof, an amide thereof, an ester thereof, or a salt thereof, and an apelin receptor containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, a partial peptide thereof, or An apelin receptor containing the salt, an apelin receptor containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 with its modified form or its amide or its ester or its salt; , A kit for screening a compound or a salt thereof that changes the binding property to a partial peptide or a salt thereof. 37. Apelin, a modified product thereof, an amide thereof, an ester thereof, or a salt thereof, which can be obtained by using the screening method according to claim 35 or the screening kit according to claim 36, and is represented by SEQ ID NO: 1. A compound or a salt thereof which changes the binding property to an apelin receptor, a partial peptide thereof or a salt thereof, which contains the same or substantially the same amino acid sequence as the amino acid sequence. 38. The compound according to claim 37 or a salt thereof which is an agonist. 39. The compound according to claim 37, which is an antagonist, or a salt thereof. (40) A pharmaceutical comprising the compound according to (37) or a salt thereof. 41. The medicine according to claim 40, which is an adrenocorticotropic hormone secretion regulator. 42. An oxytocin secretory regulator.
The medicine according to 0. 43. A prophylactic / therapeutic agent for hypoaldosteronism, hypocortisolemia, secondary and chronic hypoadrenocorticism, Addison's disease, adrenal insufficiency, pain or obesity, which comprises the agonist according to claim 38. . 44. Induction of labor, weak labor, relaxation bleeding, placental delivery before and after delivery, uterine restoration failure, cesarean section, abortion, artificial abortion, lactation failure, posttraumatic stress, which comprises the agonist according to claim 38. A preventive / therapeutic agent for syndrome or milk stasis. 45. Cushing's disease, Cushing's syndrome, adrenocorticotropic hormone-producing pituitary tumor, CRH-producing tumor, aldosterone-producing tumor, aldosteronism, primary cortisol resistance, congenital, which comprises the antagonist according to claim 39. A prophylactic / therapeutic agent for adrenal enzyme deficiency, anti-stress, depression, anorexia nervosa, insomnia, gastric / duodenal ulcer, or irritable bowel syndrome. 46. Labor force labor, infertility, ankylosing uterine contraction, fetal distress, uterine rupture, cervical laceration, dysmenorrhea, preterm birth or Prad, which comprises the antagonist of claim 39.
Prophylactic / therapeutic agent for er-Willi syndrome. 47. D encoding an apelin receptor or a partial peptide thereof containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1.
A method for screening a compound or a salt thereof which changes the expression level of an apelin receptor or its partial peptide containing an amino acid sequence which is the same or substantially the same as the amino acid sequence represented by SEQ ID NO: 1, characterized by using NA . 48. D encoding an apelin receptor or its partial peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1.
Screening for a compound or its salt that changes the expression level of an apelin receptor or its partial peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, which contains NA. Kit. 49. It contains the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, which can be obtained using the screening method according to claim 47 or the screening kit according to claim 48. A compound or a salt thereof that regulates the expression level of an apelin receptor or a partial peptide thereof. 50. The compound or a salt thereof according to claim 49, which is a compound or a salt thereof that promotes the expression level. 51. The compound or a salt thereof according to claim 49, which is a compound or a salt thereof that inhibits the expression level. 52. A medicine comprising the compound according to claim 49 or a salt thereof. 53. The pharmaceutical agent according to claim 52, which is a corticotropin secretion regulator. 54. An oxytocin secretion regulator.
2. The medicine according to 2. 55. Hypoaldosteronism, hypocortisolemia, secondary and chronic hypoadrenocortical function, Addison's disease, adrenal insufficiency, which comprises the compound or a salt thereof which promotes the expression level according to claim 50. A prophylactic / therapeutic agent for pain or obesity. 56. Delivery induction, weak labor, flaccid hemorrhage, placental delivery before and after delivery, uterine retrograde failure, cesarean section, abortion, artificial abortion, which comprises the compound or a salt thereof which promotes the expression level according to claim 50. , A prophylactic / therapeutic agent for lactation deficiency, post-traumatic stress syndrome or milk stasis. 57. A Cushing's disease, a Cushing's syndrome, a corticotropin-producing pituitary tumor, or a CR, which comprises the compound or a salt thereof which inhibits the expression level according to claim 51.
Prevention / treatment of H-producing tumors, aldosterone-producing tumors, aldosteronism, primary cortisol resistance, congenital adrenal deficiency, anti-stress, depression, anorexia nervosa, insomnia, gastroduodenal ulcer or irritable bowel syndrome Agent. 58. A hypercompulsive labor pain, infertility, ankylosing uterine contraction, fetal distress, uterine rupture, cervical laceration, dysmenorrhea, which comprises the compound or salt thereof which inhibits the expression level according to claim 51. Prophylactic / therapeutic agent for preterm birth or Prader-Willi syndrome. 59. The screening method according to claim 35, wherein the apelin is a peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 3. 60. Apelin has SEQ ID NO: 5 and SEQ ID NO:
7. A peptide containing a partial sequence of the amino acid sequence represented by SEQ ID NO: 9 or SEQ ID NO: 11.
5. The screening method according to 5. 61. Apelin is (a) SEQ ID NO: 5, 7, 9
Or the 6th to 7th of the amino acid sequence represented by 11
Peptide having the 7th amino acid sequence, (b) Peptide having the 40th to 77th amino acid sequence of the amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11, (c) SEQ ID NO: 5 , A peptide having the 42nd to 77th amino acid sequence of the amino acid sequence represented by 7, 9 or 11, (d) the 47th position of the amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11. From 77th
A peptide having the amino acid sequence of position (e), a peptide having the 61st to 77th amino acid sequence of the amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11, (f) SEQ ID NO: 5, A peptide having the 65th to 77th amino acid sequence of the amino acid sequence represented by 7, 9 or 11 or its N-terminal amino acid (Gl
(n) a peptide having an amino acid sequence that is pyroglutamine-oxidized, (g) a peptide having the 1st to 25th amino acid sequence of the amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11, (h) 6th to 25th amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11
A peptide having the amino acid sequence of position (i), a peptide having the 42nd to 64th amino acid sequence of the amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11, (j) SEQ ID NO: 5, A peptide having the 61st to 64th amino acid sequence of the amino acid sequence represented by 7, 9 or 11, (k) from the 43rd position of the amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11 77th
A peptide having the amino acid sequence of (1), (l) a peptide having the amino acid sequence of 41st to 77th of the amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11, (m) SEQ ID NO: 5, A peptide having the 66th to 77th amino acid sequence of the amino acid sequence represented by 7, 9 or 11, (n) from the 67th amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11 77th
A peptide having the amino acid sequence of position (o), a peptide having the amino acid sequence from the 64th position to the 77th position of the amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11, (p) SEQ ID NO: 5, A peptide having the 63rd to 77th amino acid sequence of the amino acid sequence represented by 7, 9 or 11, (q) from the 65th amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11 76th
36. The screening method according to claim 35, which is a peptide having the amino acid sequence at position 65 or (r) a peptide having the amino acid sequence at positions 65 to 75 of the amino acid sequence represented by SEQ ID NO: 5, 7, 9 or 11. . 62. Apelin has SEQ ID NO: 5 and SEQ ID NO:
36. The screening method according to claim 35, which is a peptide containing the 65th to 77th amino acid sequences of the amino acid sequence represented by 7, SEQ ID NO: 9 or SEQ ID NO: 11. 63. Apelin is pGlu Arg Pro Arg Leu Ser H
36. The screening method according to claim 35, which is a peptide containing an amino acid sequence represented by is Lys Gly Pro Met ProPhe. 64. Apelin has SEQ ID NO: 5 and SEQ ID NO:
36. The screening method according to claim 35, which is a peptide containing the 42nd to 77th amino acid sequences of the amino acid sequence represented by 7, SEQ ID NO: 9 or SEQ ID NO: 11. 65. A modified form of apelin has the formula X ¹ -Arg-Pro-Arg-X ² -Ser-His-X ³ -Gly-Pro-X ⁴ -X ⁵ (I) [wherein X ¹ is hydrogen. An amino acid or an amino acid residue or a peptide chain consisting of 1 to 25 amino acids, each of which may be the same or different and whose side chain is substituted,
² represents a neutral amino acid residue whose side chain may be substituted, X ³ represents a neutral amino acid residue whose side chain may be substituted, and an aromatic amino acid residue whose side chain may be substituted. A basic amino acid residue whose group or side chain may be substituted, X ⁴ represents a neutral or aromatic amino acid residue whose bond or side chain may be substituted, and X ⁵ represents a side chain An amino acid residue which may be substituted or an amino acid derivative in which the C-terminal carboxyl group thereof is reduced to a hydroxymethyl group or a formyl group, an amino acid residue which may be substituted a hydroxyl group or a side chain and a side chain are substituted A dipeptide chain having an optionally attached amino acid residue or a C-terminal carboxyl group thereof is reduced to a hydroxymethyl group or a formyl group to represent a peptide derivative represented by the formula -Arg-Pro- Arg-, -Ser-His-
Alternatively, the side chain of each amino acid residue in -Gly-Pro- may be substituted. However, X ² represents Leu, X ³ represents Lys, X ⁴ represents Met, and X ⁵ represents Pro or Pro-Phe, and -Arg-Pro in the formula.
-Arg- is an unsubstituted -Arg-Pro-Arg-,
-Ser-His- is an unsubstituted -Ser-His-
And -Gly-Pro- is an unsubstituted -Gly-Pro-
Except when ] The screening method of Claim 35 which is a peptide represented by these. 66. A modified form of apelin has the formula P1-Arg-Pro-Arg-Leu-Phe-P2-P3-Gly-Pro-P4-P5 (II) [wherein P1 is a hydrogen atom or the same or different, respectively] An amino acid residue or a peptide chain consisting of 1 to 25 amino acids whose side chain may be substituted,
2 represents a neutral amino acid residue whose side chain may be substituted or a basic amino acid residue whose side chain may be substituted, and P3 is a neutral amino acid residue whose side chain may be substituted. , A side chain may be substituted with an aromatic amino acid residue or a side chain may be substituted with a basic amino acid residue, P4 is a bond or a neutral side chain may be substituted or An aromatic amino acid residue is shown. P5 is an amino acid residue whose side chain may be substituted or an amino acid derivative in which its C-terminal carboxyl group is reduced to a hydroxymethyl group or a formyl group, or a hydroxyl group or side chain is substituted. A dipeptide chain consisting of an amino acid residue which may be substituted with an amino acid residue whose side chain may be substituted or its C-terminal carboxyl group is reduced to a hydroxymethyl group or a formyl group. Shows the peptide derivative, the side chain of -Arg-Pro-Arg-Leu-Phe- or -Gly-Pro- each amino acid residue in the middle in the formula may be substituted. ] It is a peptide represented by these.
5. The screening method according to 5. 67. A modified form of apelin has the formula Q1-Arg-Pro-Arg-Leu-Ser-Ala-Q2-Gly-Q5-Q3-Q4 (III) [wherein Q1 is a hydrogen atom or the same or different, respectively] An amino acid residue or a peptide chain consisting of 1 to 25 amino acids whose side chain may be substituted,
2 represents a neutral amino acid residue whose side chain may be substituted, an aromatic amino acid residue whose side chain may be substituted, or a basic amino acid residue whose side chain may be substituted,
Q3 represents a neutral or aromatic amino acid residue whose bond or side chain may be substituted, Q4 represents an amino acid residue whose side chain may be substituted or its C-terminal carboxyl group is a hydroxymethyl group or A formyl group-reduced amino acid derivative, a dipeptide chain formed by binding an amino acid residue which may be substituted with a hydroxyl group or a side chain and an amino acid residue which may be substituted with a side chain, or its C-terminal carboxyl group is Shows a peptide derivative reduced to a hydroxymethyl group or a formyl group, Q5 represents a neutral amino acid residue whose side chain may be substituted, and is -Arg-Pro-Arg-Leu-Ser-Ala in the formula.
The side chain of each amino acid residue in-may be substituted. ] The screening method according to claim 35, which is a peptide represented by the following formula: or its ester, its amide, or its salt. 68. A modified form of apelin has the formula R1-Arg-Pro-Arg-Leu-Ser-His-Lys-Gly-Pro-R2-Pro-R3 (IV) [wherein, R1 is a hydrogen atom or respectively. An amino acid residue or a peptide chain consisting of 1 to 25 amino acids, which may be the same or different and whose side chains are substituted,
2 represents Cha which may be substituted, Met which may be substituted or Nle which may be substituted, and R
3 is optionally substituted Phe (Cl), optionally substituted Phe, optionally substituted Nal
(2) represents an optionally substituted Cha or an optionally substituted Tyr, and represents -Arg-Pro-A in the formula.
rg-Leu-Ser-His-Lys-Gly-Pr
The side chain of each amino acid residue in o or -Pro- may be substituted. ] It is a peptide represented by these, its ester, its amide, or its salt.
5. The screening method according to 5. 69. A non-human mammal having the exogenous DNA according to claim 5 or a mutant DNA thereof. 70. The animal of claim 69, wherein the non-human mammal is a rodent. 71. The animal according to claim 70, wherein the rodent is a mouse or rat. 72. A recombinant vector containing the exogenous DNA according to claim 5 or a mutant DNA thereof and capable of being expressed in mammals. 73. A non-human mammalian embryonic stem cell in which the DNA according to claim 5 is inactivated. 74. The embryonic stem cell according to claim 73, wherein said DNA is inactivated by introducing a reporter gene. 75. The embryonic stem cell according to claim 73, which is resistant to neomycin. 76. The embryonic stem cell according to claim 73, wherein the non-human mammal is a rodent. 77. The embryonic stem cell according to claim 76, wherein the rodent is a mouse. 78. A non-human mammal deficient in DNA expression, wherein the DNA according to claim 5 is inactivated. 79. The non-human mammal according to claim 78, wherein the DNA is inactivated by introducing a reporter gene, and the reporter gene can be expressed under the control of the promoter for the DNA according to claim 5. 80. The non-human mammal according to claim 78, wherein the non-human mammal is a rodent. 81. The non-human mammal according to claim 80, wherein the rodent is a mouse. 82. A test compound is administered to the animal according to claim 79 to detect the expression of a reporter gene, wherein the compound or its salt that promotes or inhibits the promoter activity for DNA according to claim 5. Screening method. 83. For mammals, the apelin receptor protein according to claim 1, its partial peptide or salt thereof, the polynucleotide according to claim 4, and 37.
50. A method for regulating adrenocorticotropic hormone secretion, which comprises administering an effective amount of the compound or salt thereof according to claim 49 or the compound or salt thereof according to claim 49. 84. For mammals, the apelin receptor protein according to claim 1, its partial peptide or a salt thereof, the polynucleotide according to claim 4, and 37.
52. A method for regulating oxytocin secretion, which comprises administering an effective amount of the compound or salt thereof according to claim 49 or the compound or salt thereof according to claim 49. 85. For mammals, the apelin receptor protein according to claim 1, its partial peptide or salt thereof, the polynucleotide according to claim 4, and 38.
51. Hypoaldosteronism, hypocortisolemia, comprising administering an effective amount of the agonist according to claim 50 or the compound or salt thereof that promotes the expression level according to claim 50.
A method for preventing and / or treating secondary and chronic hypoadrenocorticism, Addison's disease, adrenal insufficiency, pain or obesity. 86. For mammals, the apelin receptor protein according to claim 1, its partial peptide or a salt thereof, the polynucleotide according to claim 4, and 38.
51. An agonist according to claim 50, or an effective amount of a compound or a salt thereof that promotes the expression level according to claim 50, which induces parturition, weak labor, relaxation bleeding, placental delivery, uterine retrograde failure, and cesarean section. , Abortion, abortion,
A method for preventing or treating lactation insufficiency, post-traumatic stress syndrome or milk stasis. 87. An antibody against the apelin receptor protein according to claim 1, a partial peptide thereof or a salt thereof against a mammal, the polynucleotide according to claim 27, the antagonist according to claim 39, or the claim 51. Cushing's disease, Cushing's syndrome, adrenocorticotropic hormone-producing pituitary tumor, characterized by administering an effective amount of a compound that inhibits the expression level of
Prevention / treatment of RH-producing tumor, aldosterone-producing tumor, aldosteronism, primary cortisol resistance, congenital adrenal deficiency, anti-stress, depression, anorexia nervosa, insomnia, gastroduodenal ulcer or irritable bowel syndrome Method. 88. An antibody against the apelin receptor protein according to claim 1, a partial peptide thereof or a salt thereof against a mammal, the polynucleotide according to claim 27, the antagonist according to claim 39, or the claim 51. , An infertility disorder, ankylosing uterine contraction, fetal distress, uterine rupture, cervical laceration, dysmenorrhea, preterm birth or Prader -How to prevent and treat Willi syndrome. 89. An apelin receptor protein according to claim 1, a partial peptide or a salt thereof, a polynucleotide according to claim 4, a compound according to claim 37 or a compound thereof for producing an adrenocorticotropic hormone secretagogue. Use of a salt or a compound according to claim 49 or a salt thereof. 90. An apelin receptor protein according to claim 1, a partial peptide thereof or a salt thereof, a polynucleotide according to claim 4, a compound according to claim 37, or a salt thereof, for producing an oxytocin secretion regulator, or Use of the compound according to claim 49 or a salt thereof. 91. The apelin according to claim 1 for producing a prophylactic / therapeutic agent for hypoaldosteronism, hypocortisolemia, secondary and chronic hypoadrenocorticism, Addison's disease, adrenal insufficiency, pain or obesity. Use of a receptor protein, a partial peptide thereof or a salt thereof, a polynucleotide according to claim 4, an agonist according to claim 38, or a compound or a salt thereof that promotes the expression level according to claim 50. 92. A prophylactic / therapeutic agent for induction of labor, weak labor, loose bleeding, placental delivery, uterine restoration, cesarean section, miscarriage, abortion, lactation insufficiency, posttraumatic stress syndrome or milk stasis. The apelin receptor protein according to claim 1, a partial peptide or a salt thereof for producing, the polynucleotide according to claim 4, and the polynucleotide according to claim 3.
Use of the agonist according to claim 8, or the compound or salt thereof that promotes the expression level according to claim 50. 93. Cushing's disease, Cushing's syndrome, adrenocorticotropic hormone-producing pituitary tumor, CRH-producing tumor, aldosterone-producing tumor, aldosteronism, primary cortisol resistance, congenital adrenal deficiency, antistress,
An antibody against the apelin receptor protein, a partial peptide thereof, or a salt thereof according to claim 1, for producing a prophylactic / therapeutic agent for depression, anorexia nervosa, insomnia, gastric / duodenal ulcer or irritable bowel syndrome, Use of the polynucleotide according to claim 27, the antagonist according to claim 39, or the compound or salt thereof that inhibits the expression level according to claim 51. 94. Overwork labor, infertility, tonic contraction, fetal distress, uterine rupture, cervical laceration, dysmenorrhea, preterm birth or
An antibody against the apelin receptor protein according to claim 1, a partial peptide thereof or a salt thereof for producing a prophylactic / therapeutic agent for Prader-Willi syndrome, the polynucleotide according to claim 27, the antagonist according to claim 39, or the claim. Item 51. Use of a compound or its salt that inhibits the expression level according to item 51.