JP2003018998A - Human g-protein receptor hpraj70 - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a human G-protein-binding receptor polypeptide, a DNA (RNA) encoding the polypeptide, and a method for producing the polypeptide by a recombination technique. SOLUTION: This invention provides a method for utilizing the polypeptide for identifying an antagonist or agonist against the polypeptide, a method utilizing the antagonist or agonist for therapy of diseases relating to insufficient and excessive expression of the G-protein-binding receptor polypeptide, and a method for diagnosis of detecting mutation in the nucleic acid sequence of the G-protein-binding receptor and change of the level of the soluble receptor.

Description

Description: BACKGROUND OF THE INVENTION The present invention has been newly identified.
Polynucleotides, by such polynucleotides
The encoded polypeptide, such a polynucleotide
Use of polypeptides and polypeptides, and also
The production of novel polynucleotides and polypeptides
The In particular, the polypeptides of the present invention are human 7-transmembrane
It is a receptor. The transmembrane receptor is G-protein binding
It is a receptor. More specifically, the 7-transmembrane receptor
Has been putatively identified as a prostate tissue receptor
Hereinafter, it may be referred to as “HPRAJ70”. Book
The invention also inhibits the action of such polypeptides
It also relates to that. [0002] Many medically important biological processes
G-protein and / or second messenger
-For example, tags involved in signal transduction pathways involving cAMP
Is well established to be mediated by proteins
(Lefkowitz, Nature, 351: 353-354 (199
1)). In the present specification, these proteins are referred to as G-tags.
Involved in pathways involving proteins or PPG proteins
Called protein. Some examples of these proteins
Is a receptor for adrenergic drugs and dopamine
GPC receptors like the body (Kobilka, BK, et al., PNA
S, 84: 46-50 (1987); Kobilka, B.K. et al.,
Science, 238: 650-656 (1987); Bunzow,
JR, et al., Nature, 336: 783-787 (198
8)), G-protein itself, effector protein,
For example, phospholipase C, adenyl cyclase,
And phosphodiesterase and actuator (a
ctuator) protein, eg protein kinase A
And protein kinase C (Simon, M.I. et al., Scie
nce, 252: 802-8 (1991). For example, in one type of signal transmission, Holmo
The effect of the binding is due to the enzyme, adenylate cycle, inside the cell.
It is activation of a ase. Enzyme activation by hormones
Depending on the presence of the nucleotide GTP,
Affects Rumon coupling. G-protein is Hormo
The receptor is linked to adenylate cyclase. G-tan
When activated by hormone receptors, the protein is G
It has been shown to exchange TP for bound GDP. Then
The GTP-supported type binds to activated adenylate cyclase.
Match. GTP catalyzed by G-protein itself
Hydrolysis of GDP to G-protein
Return to inactive form. Thus, the G-protein is a receptor
As an intermediate that relays the signal from to the effector,
And double as a clock to control the duration of the signal
Fulfill the price. G-protein coupled receptors are
Various intracellular enzymes, a
Bind on-channel and transporter intracellularly
(Johnson et al., Endoc., Revised edition, 10: 317)
-331 (1989)). Various G-proteins
Α-subunits preferentially select specific effectors
Stimulates and alters various biological functions in cells
The Phosphate of cytoplasmic residues of G-protein coupled receptors
G-tans of some G-protein coupled receptors
Identified as an important mechanism for the regulation of protein binding
Yes. The G-protein coupled receptor is a mammalian host.
It is found at many sites within. According to one aspect of the present invention,
Novel polypeptide as well as biologically active and diagnostic
Fragmental and therapeutically useful fragments and derivatives thereof
Provide the body. The polypeptides of the present invention are of human origin
The According to another aspect of the present invention, mRNA, DNA, cDN
A, the polypeptide of the present invention, including genomic DNA,
Isolated nucleic acid molecules, and also
Chisense analog, as well as biologically active and diagnostic
Provide fragments that are supra-or therapeutically useful
The According to a further aspect of the invention, such a
A method for producing polypeptides by recombinant technology.
Expression of the protein and subsequent tampering
Human G-tamper under conditions that facilitate the recovery of
A recombinant prokaryotic nucleic acid sequence comprising a nucleic acid sequence of a protein binding receptor and / or
Or a method comprising culturing eukaryotic host cells
provide. According to a still further aspect of the invention, such
An antibody against such a polypeptide is provided. Another of the present invention
In some embodiments, binding to a receptor polypeptide of the invention,
Activation of the polypeptide or inhibition of activation
Methods for screening for compounds are provided. According to yet another aspect of the present invention, G-tan
Treatment of pathological conditions related to insufficient expression of protein-binding receptors
For stimulating the receptor polypeptide of the present invention against
A method of using such an activating compound
The According to another aspect of the invention, prostate cancer and other G-
Pathology associated with overexpression of protein-coupled receptors
Inhibiting the action of the polypeptides of the invention against treatment
How to use such inhibitory compounds to harm
provide. According to yet another aspect of the present invention, the G-
At least one transmembrane domain of a protein-coupled receptor
In fragments with isomorphic amino acid substitutions,
A consensus fragment and / or sequence,
Non-naturally occurring, synthetic, isolated, and / or
Or a recombinant polypeptide, the receptor
Binds a G-protein coupled receptor ligand.
Or a G-protein coupled receptor
To change ligand binding quantitatively or qualitatively
it can. According to yet another aspect of the present invention,
Binds to ligands according to expected biological properties
Or by changing ligand binding
The G-protein coupled receptor function
G-protein binding that may be useful as a generator
Synthetic receptor synthesis or recombinant G-protein coupled receptor
Polypeptide, its isomorphous substituted derivatives, antibodies, anti-a
DIOTYPE ANTIBODIES, COMPOSITIONS, AND METHODS
Are used for diagnostic, therapeutic and / or research applications
Can. In accordance with another object of the present invention, various G-tans are provided.
Inhibits protein binding receptors or fragments thereof
Synthetic, isolated, intended to mimic or mimic
Or recombinant polypeptide, the receptor type and
Provide as a subtype. In yet another aspect of the invention
More specifically, the hybridized to the nucleic acid sequence of the present invention
A diagnostic program comprising a nucleic acid molecule of sufficient length to
We also provide a probe. According to another object of the invention,
Diseases related to the G-protein coupled receptor nucleic acid sequence
Diagnosis for detecting a patient or susceptibility to a disease
Provide seysay. These and other aspects of the invention
Such will be apparent to those skilled in the art from the teachings herein. In accordance with one aspect of the present invention, the estimation algorithm of FIGS.
A mature polypeptide having a mino acid sequence (SEQ ID NO: 2);
Or ATCC deposit no. 97 on April 28, 1995
The clone cDNA deposited as No. 131
Isolated, encoding the mature polypeptide to be loaded
Nucleic acids (polynucleotides) are provided. Polypep of the present invention
The polynucleotide encoding tide is found in human prostate
You may find it. The polynucleotide of the present invention is human.
Found in a cDNA library derived from prostate tissue
It was. It is structurally a G-protein coupled receptor factor.
Related to Millie. It has 364 amino acid residues
Open reading frame encoding the protein of
Including The protein is human HGMPO olfactory receptor
Over the length of 320 amino acids to the body, 33.441
% Identity and 58.842% similarity, the highest
It shows a certain degree of homology. The polynucleotide of the present invention is in the form of RNA.
Or in the form of DNA, which contains cD
NA, genomic DNA, and synthetic DNA are included. The
DNA can be double-stranded or single-stranded and can be single-stranded.
Coding strand or non-coding (anti-sense) strand, if any
It can be. A coding sequence encoding a mature polypeptide
Is the coding sequence shown in FIGS.
It may be the same as the coding sequence of the entrusted clone,
Or as a result of duplication or degeneracy of the genetic code,
~ 4 DNA (SEQ ID NO: 1) or deposited cDNA
Different coding sequences encoding the same mature polypeptide as
It may be a column. 1-4 of mature polypeptide (sequence
Number 2) or encoded by the deposited cDNA
Polynucleotides encoding mature polypeptides include:
The following may be included:
Column only; coding sequence and additional code for mature polypeptide
Coding sequence (and in some cases) of the mature polypeptide
Additional coding sequence), and of the mature polypeptide
Intron or non-coding sequence 5 'of the coding sequence and
Non-coding sequence such as 3 '. Therefore, "Po
The term "polynucleotide encoding a repeptide"
Is a polynucleotide that contains only the coding sequence of a polypeptide.
Leotide, and also additional codes and / or
Includes polynucleotides that include non-coding sequences. The present invention further provides a putative amino acid of FIGS.
Polypeptide having an acid sequence (SEQ ID NO: 2) or deposit
Encoded by the cDNA of the cloned clone
Encodes fragments, analogs and derivatives of tide
And a variant of the above polynucleotide. Polinu
A variant of the nucleotide is naturally occurring in the polynucleotide
Naturally occurring allelic variant or polynucleotide
It may be a mutant that does not exist. Accordingly, the present invention includes FIG.
The same mature polypeptide (SEQ ID NO: 2) as shown in ~ 4
Or encoded by the cDNA of the deposited clone
A polynucleotide encoding the same mature polypeptide,
Furthermore, there are also variants of such polynucleotides
These variants are included in the polypeptides of FIGS.
(SEQ ID NO: 2) or the cDNA of the deposited clone
Fragments and derivatives of polypeptides encoded by
Or code analog. Such nucleotides
Variants include deletion mutants, substitution mutants and additions and
Insertion variants are included. As indicated above, the polynucleotide
Is the naturally occurring coding sequence (SEQ ID NO: 1) shown in FIGS.
Code for existing allelic variant or deposited clone
A coding sequence that is a naturally occurring allelic variant of the sequence
Can have. Allele mutations as known in the industry
The body is a substitution or deletion of one or more nucleotides
Or another form of polynucleotide sequence that may have additions
There is a substantial function of the encoded polypeptide
It does n’t change. The polynucleotide also includes all of the invention
Transmembrane and intracellular domains of long polypeptides
An extracellular portion of the polypeptide of the present invention cleaved from
Encoding a soluble form of the receptor polypeptide of the invention
The The present invention also provides a mature polypeptide coat.
Sequence of the polypeptide is expressed and separated from the host cell.
A polynucleotide sequence that aids production, eg from the cell
As a secretory sequence to control polypeptide transport
Active leader sequences that can be fused in the same reading frame
Nucleotides are also included. The polynucleotide of the present invention is
In addition, a marker that enables purification of the polypeptide of the present invention
It may also have a coding sequence fused in-frame to the sequence. Bacteria lodging
In the main case, the marker sequence is fused to the marker.
PQE- to provide purification of the mature polypeptide
Hexa-histidine tag (t
ag) or, for example, a mammalian host, eg
For example, when COS-7 cells are used, the marker
The sequence may be a hemagglutinin (HA) tag. HA
Tag obtained from influenza hemagglutinin protein
(Wilson, I. et al., Cell,
37: 767 (1984)). The term “gene” refers to the production of a polypeptide chain.
Intended for DNA segments involved in
Area before and after the running area (leader and trailer
-), As well as individual coding segments (exo
Sequence (intron). Full length HPRA
Fragment of J70 gene in cDNA library
Use as other hybridization probes
The genes are isolated and these genes are
High sequence similarity or similar biological activity with Otide sequence
Have At least 20 probes of this type
Preferably has 30 bases, but 50 bases or
You may have more. The probe also has a full length transfer.
CDNA clones corresponding to transcripts, and control regions and
Promoter region, exons and introns
Single or multiple containing the complete HPRAJ70 gene
It may be used to identify genomic clones. Scree
An example of ning is to synthesize oligonucleotide probes
Therefore, gene coding by using known DNA sequences
Including isolation of the coding region. The sequence of the gene of the present invention and
Labeled oligonucleotides having complementary sequences
The probe hives to which member of the library
Human cDNA, genome to determine whether to re-lyse
Screen DNA or mRNA libraries
Use to do. The invention further provides at least 70 between sequences.
%, Preferably at least 90%, more preferably low
If there is at least 95% identity,
It relates to polynucleotides to be hybridized. The present invention
In particular, the above polynucleotides under stringent conditions.
The present invention relates to a polynucleotide that hybridizes to a DNA. Book
When used in the specification, “stringent conditions”
The term is at least 95% between sequences and preferably
Hive only if they have at least 97% identity
It means that redization will occur. Good
In a preferred embodiment, the above polynucleotide is hybridized to
The polynucleotide to be synthesized is the cDNA of FIGS.
No. 1) or encoded by the deposited cDNA
Substantially the same biological function as the mature polypeptide or
Encodes a polypeptide that retains activity. In other words, the polynucleotide of the present invention.
Hybridize to the above and have the above-mentioned identity and maintain activity.
The polynucleotide, with or without, is at least
20 bases, preferably at least 30 bases, more preferably
Preferably it has at least 50 bases. For example, this
Such a polynucleotide is, for example, the polyseq.
A polynucleotide against the polynucleotide for nucleotide recovery.
As a lobe, or as a diagnostic probe, or
It can be used as a PCR primer. Therefore, this departure
Ming is a polynucleotide encoding the polypeptide of SEQ ID NO: 2.
At least 70%, preferably low, relative to leotide
At least 90%, more preferably at least 95% of the same
A single polynucleotide, and at least 20
Or 30 bases, preferably at least 50 bases
Its fragments, and such polynucleotides
It relates to a polypeptide encoded by an tide. The deposit referred to in this specification is a
Of the terms of the Budapest Treaty on the international recognition of the deposit of organisms
Will be held down. These deposits are simply those of ordinary skill in the art.
Is given as a convenience to the
Approves what is required under U.S.C. 112
There is no. Polynucleotides contained in the deposited material
Sequences, and also the polypeptides encoded thereby.
The amino acid sequence of the peptide constitutes part of this specification,
When there is a contradiction in any of the descriptions of the sequences herein
But it is collating. Manufacturing and using the deposited materials,
Or to sell, a license may be required and
No such license is granted here. The present invention further provides the deduced amino acids of FIGS.
Coded by cDNA having or deposited sequences
G-protein coupled receptor having the amino acid sequence defined
Body polypeptides, and also such polypeptides
Related fragments, analogs and derivatives. Figure
1-4 polypeptides (SEQ ID NO: 2) or deposited
When referring to a polypeptide encoded by cDNA,
The terms “fragment”, “derivative” and “analog”
Is substantially the same biological mechanism as such a polypeptide.
A polypeptide that retains the ability or activity, ie G
-Function as a protein-binding receptor or
Even if the polypeptide is a G-protein coupled receptor
That do not function (e.g., soluble receptors)
A polypeptide that retains the ability to bind a receptor or receptor
Means. For analog, cut the proprotein part
To activate the active mature polypeptide
Proproteins that can be produced are included. The polypeptide of the present invention is a recombinant polypeptide.
Tide, natural polypeptide or synthetic polypeptide, preferred
Alternatively, it may be a recombinant polypeptide. 1 to 4
Encoded by the repeptide or deposited cDNA
Polypeptide fragments, derivatives or analogs
(I) one or more amino acid residues are isomorphic
Or non-isomorphic amino acid residues (preferably isomorphic amino acid residues
Group) and such substituted amino acid residues
The group may be encoded by the genetic code
Or may not be coded (i
i) One or more amino acid residues contain a substituent
Or (iii) a mature polypeptide
Compounds that increase the half-life of the peptide (e.g., poly
Fused with other compounds, such as ethylene glycol)
Or (iv) a leader or secretory sequence,
Or the sequence used to purify the mature polypeptide, or
Is an additional amino acid, such as a proprotein sequence
Is fused to the mature polypeptide, or (v)
The polypeptide fragment is soluble, i.e. in the membrane
Does not bind and is still a ligand for membrane-bound receptors
Can be combined. Such a fragment
, Derivatives and analogs are derived from the teachings herein.
It seems to be within the contractor's scope. The polypeptides and polynucleotides of the present invention
The tide is preferably and preferably provided in an isolated form.
Alternatively, it is purified to homogeneity. "I was isolated"
The terminology means that the substance is in its original environment (e.g. it is naturally
(If present, it is removed from the natural environment)
means. For example, it exists naturally in living animals
The polynucleotide or polypeptide is isolated
Not, but some or all of the coexisting substances in natural systems
Isolated from the same polynucleotide or polypeptide
Chido has been isolated. Such polynucleotides are
Can be part of a vector and / or
Renucleotides or polypeptides become part of the composition
And such vectors or compositions may be of their natural nature.
Is still isolated in that it is not part of the environment
The The polypeptide of the present invention comprises a polypeptide of SEQ ID NO: 2.
Repeptides (especially mature polypeptides) and sequences
At least 70% similarity to the polypeptide of number 2
Sex (preferably at least 70% identity), even better
Preferably at least 90% similarity (more preferably
At least 90% identity), even more preferably low
At least 95% similarity (even more preferably 95%
Of polypeptides), and generally less
At least 30 amino acids, more preferably at least 50 amino acids
A portion of such a polypeptide containing a mino acid is included. This
As known in the industry, between two polypeptides
“Similarity” refers to the amino acid sequence of a single polypeptide.
And the conserved amino acid substitutions of the second polypeptide
By comparing with the amino acid sequence of the domain. A fragment of the polypeptide of the present invention or
Part of the corresponding full-length polypeptide by peptide synthesis.
Can be used to produce tide;
The fragment comprises an intermediate for the production of a full-length polypeptide and
Can be used. The polypeptide of the present invention
Segment or portion of the full-length polypeptide of the present invention.
Can be used for The present invention also provides the poly of the present invention.
A vector containing nucleotides, the vector of the present invention
Genetically engineered host cells and the polypeptides of the invention
It also relates to the production of chido by recombinant technology. The host cell can be, for example, a cloning vector.
-Or a vector of the invention which can be an expression vector
Manipulated traditionally (transduced or
Transformed or transfected).
Such vectors include, for example, plasmids, viral particles,
It can be in the form of a gauge or the like. Engineered host cells are
Activate the motor, select the transformant,
Or amplify the G-protein coupled receptor gene
In conventional nutrient media modified to suit
Can do. Culture conditions such as temperature, pH, etc.
The culture conditions previously used in the currently selected host cell.
Will be apparent to those skilled in the art. The polynucleotide of the present invention comprises a peptide.
It can be used to produce by recombinant technology.
Thus, for example, the polynucleotide may be
Any one of various expression vectors for expressing
Can be included. Such vectors include staining
Body, non-chromosomal and synthetic DNA sequences, eg SV40
Derivatives; bacterial plasmids; phage DNA; baculo
Irus; yeast plasmid; plasmid and phage DNA
Vector obtained from the combination of: vaccinia, adeno
Such as illus, fowlpox virus, pseudorabies
Rus DNA is included. But any other vector
It is replicable in the host and is viable
As long as it can be used. The appropriate DNA sequence can be vectorized by various methods.
Can be inserted. In general, the DNA sequence
Appropriate restriction endonuclear by methods known in the art
Insert into the site. Such and other methods are
It appears to be within the scope of those skilled in the art. DN of expression vector
A sequence can be operated as an appropriate expression control sequence (promoter)
Binding to the ability to synthesize mRNA. Such a professional
Typical examples of motors include:
TR or SV40 promoter, E. coli lac or t
rp, phage lambda PL promoter, and prokaryotic moshi
Or expression of genes in eukaryotic cells or their viruses
Other promoters known to control. Expression
The vector also has a ribosome binding site for translation initiation.
Including transcription termination region. The vector also increases expression.
An array suitable for width may also be included. Furthermore, the expression vector can be used for eukaryotic cell culture.
In some cases dihydrofolate reductase or neoma
Such as resistance to isin, or tetra in E. coli
Tomatoes such as cyclin or ampicillin resistance
Phenotypic features for selection of transformed host cells
One or more selectable macros to give sex
It preferably contains a car gene. Appropriate as above
DNA sequences, and also suitable promoters or
Transform the vector containing the control sequences into the appropriate host.
The host expresses the protein
Can be made possible. Representative examples of suitable hosts include:
Named: E. coli, Streptomyces, Salmonella typ
bacterial cells such as himurium; fungal cells such as yeast
Cells; insect cells such as Drosohila and Sf9; C
Movements such as HO, COS or Bowes melanoma
Physical cells; adenoviruses; plant cells and the like. Selection of appropriate host
Selection is deemed to be within the scope of those skilled in the art from the teachings herein.
Is called. Among other things, the present invention has also been described extensively above.
Also includes recombinant constructs comprising one or more sequences.
Be turned. The construct has a sequence according to the invention in the forward or reverse direction.
A plasmid or viral vector inserted in
And a vector such as Of this embodiment
In a preferred embodiment, the construct further comprises, for example, the sequence
Control sequences, including a promoter operably linked to
Comprising. Many suitable vectors and promoters
Several are known to those skilled in the art and are commercially available. The following
Take an example. For bacteria: pQE70, pQE6
0, pQE-9 (Qiagen), pbs, pD10, phage screen
Lipto (phagescript), psiX174, pbluescript S
K, pbsks, pNH8A, pNH16a, pNH18A, pN
H46A (Stratagene); ptrc99a, pKK223-3,
pKK233-3, pDR540, pRIT5 (Pharmaci
a). For eukaryotes: pWLNEO, pSV2CAT, pOG4
4, pXT1, pSG (Stratagene), pSVK3, pBP
V, pMSG, pSVL (Pharmacia). But the other Izu
These plasmids or vectors are also duplicated in the host.
As long as it is manufacturable and viable
it can. The promoter region is CAT (chloramf
Enicoltransferase) vector or selection marker
Using any other vector with a car, any desired
Can be selected from these genes. 2 suitable vectors
Are PKK232-8 and PCM7. individual
Bacterial promoters named in lacI, lacZ,
Includes T3, T7, gpt, lambda PR, PL and trp
The For eukaryotic promoters, CMV immediate early (immediate
early), HSV thymidine kinase, early and late S
V40, LTR from retrovirus, and mouse
Metallothionein-I is included. Appropriate vectors and
Selection of promoters and promoters is well within the level of ordinary skill in the art
Is within. In a further aspect, the present invention provides a construction as described above.
Relates to a host cell containing the product. The host cell is a mammal
Higher eukaryotic cells such as cells, lower eukaryotic cells such as yeast cells
Or the host cell can be a bacterial cell, such as a bacterial cell
It can be a prokaryotic cell. The introduction of the construct into the host cell is
Calcium phosphate transfection, DEAE-deki
Strand-mediated transfection or electroporation
This can be done by (Davis, L., Di
bner, M., Battey. L., Basic Methods in Molecul
ar Biology (1986)). Normal constructs in host cells
Gene used by the method and encoded by the recombinant sequence
The product can be manufactured. Alternatively, according to the present invention
Polypeptides can be synthesized using conventional peptide synthesizers.
Can be manufactured. The mature protein is a suitable promoter
In control, in mammalian cells, yeast, bacteria, or other cells
Can be expressed. Such proteins,
Manufactured using RNA obtained from the DNA construct of the present invention
Cell-free translation systems can also be used to
The Appropriate clooni for use in prokaryotic and eukaryotic hosts
And expression vectors are described in Sambrook et al., Molecular.
Cloning: A Laboratory Manual, 2nd edition, Cold Sp
described by ring Harbor, New York, (1989)
And this disclosure forms part of this specification. Book
Higher eukaryotes of DNA encoding the polypeptide of the invention
Transcription by inserts an enhancer sequence into the vector
Will increase. Enhancer is a promoter
Acts to increase its transcription, usually about 10-300
The cis-acting element of DNA, bp. For example, bp10
0 to 270, SV40 engine on the late side of the replication start point
Hansar, cytomegalovirus early promoter
Hansar, Polyomaenha on the late side of the replication origin
And adenovirus enhancers
The Typically, recombinant expression vectors contain replication initiation.
Dot and host cell transformation possible
Selectable markers, eg, E. coli amps
Syrin resistance gene and S. cerevisiae TRP1 inheritance
Advanced to allow transcription of downstream and downstream structural sequences
Contains promoters derived from genes expressed in
It will be. Such promoters are notably 3
-Glycolytic systems such as phosphoglycerate kinase (PGK)
Enzyme, alpha factor, acid phosphatase, or heat shock
Can be obtained from the operon encoding the protein
The A heterologous structural sequence can be a translation initiation and termination sequence,
Preferably, the periplasmic space or cells of the translated protein
Leader sequence that allows secretion into the extracellular medium
In addition, it is constructed in an appropriate phase. In some cases
The heterologous sequence has the desired properties, eg, expressed recombinant
N-terminus providing stabilization of product or simplification of purification
Encodes a fusion protein containing the identified peptide
You can. Useful expression vectors for use in bacteria
Is a structural DNA sequence encoding the desired protein,
A functional promotion with appropriate translation start and stop signals
Inserted into an operable reading phase with
And built by. The vector is a vector maintenance
In the host, and if desired,
Of one or more phenotypes to give an amplification of
Comprising a selectable marker and an origin of replication.
Let ’s go. Prokaryotic host suitable for transformation
Are E. coli, Bacillus subtilis, Salmonella typhi
murium, Pseudomonas, Streptomyces,
And various species within the genus Staphylococcus
However, others can also be used as selective substances.
Yes. As a representative but non-limiting example,
Vectors useful for use in fungi are the well-known clonin
Inheritance of the vector pBR322 (ATCC 37017)
Selection obtained from a commercially available plasmid comprising the element
May comprise possible markers and bacterial origins of replication
The Such commercially available vectors include, for example, pKK2
23-3 (Pharmacia Fine Chemicals, Uppsala, Su
Weden) and GEM1 (Promege Biotec, Madis)
on, WI, USA). These pBR322 “bones
The `` nuclear '' part with an appropriate promoter and the structure to be expressed.
Combined with the structure. Transformation of an appropriate host strain
And after growing the host strain to an appropriate cell density,
The selected promoter can be
Cells by chemical or chemical induction)
Incubate for a period of time. Cells are generally collected by centrifugation.
Collected and destroyed by physical or chemical methods.
Retain the resulting crude extract for further purification
The Microbial cells used for protein expression are frozen
-Thaw cycle, sonication, mechanical disruption, or cell lysis
It can be destroyed by any conventional method, including the use of peptizers.
Such methods are well known to those skilled in the art. In order to express a recombinant protein,
Various mammalian cell culture systems can also be used.
Examples of mammalian expression systems include Gluzman, Cell, 23:17.
5 (1981), monkey kidney fibroblasts
Express COS-7 system of cells and compatible vectors
Other cell lines that can be generated, eg C127, 3
T3, CHO, HeLa and BHK cell lines are included.
Mammalian expression vectors have an origin of replication, an appropriate promoter
And any enhancers and any necessary riboso
Binding sites, polyadenylation sites, splice donors
And acceptor site, transcription termination sequence, and 5 '
Flanking non-transcribed sequences will also comprise. SV4
DNA sequence resulting from zero splicing, and
Non-transcribed inheritance required using a readenylation site
Elements can be given. G-protein coupled receptor polypeptide
Ammonium sulfate or ethanol precipitation, acid extraction,
Anion or cation exchange chromatography, phos
Phosphocellulose chromatography, hydrophobic interaction chromatography
Matography, affinity chromatography,
Hydroxyapatite chromatography and
Recombination by methods involving cutin chromatography
It can be recovered from the cell culture and purified. necessary
Depending on the protein regeneration process, the mature protein
Can be used to complete a configuration. last
High performance liquid chromatography (HPLC)
It can be used for manufacturing processes. The polypeptide of the present invention is naturally purified.
Product or chemical synthesis product, or
From prokaryotic or eukaryotic hosts (e.g. cells in culture).
By fungi, yeast, higher plants, insects and mammalian cells
And can be produced by recombinant technology. Recombinant
The polypeptide of the present invention depends on the host used in the production method.
Can be glycosylated or glycosylated
I don't get it. The polypeptides of the invention also include the first methio
Nin amino acid residues may be included. G-protein of the present invention
Quality-binding receptor activates the receptor polypeptide
Compounds (agonists) and / or compounds that inhibit activation
Methods for screening for compounds (antagonists)
Can be used. In general, such a scan
The cleaning method comprises the receptor polypeptide of the present invention on its surface.
Need to give suitable cells that express peptide
The Such cells include mammals, yeast and drosophila.
Or E.Coli. In particular, encoding the receptor of the present invention
Transfer the cells using the polynucleotide
And thereby the G-protein coupled receptor
To express. The expressed receptor is then converted into a test compound.
Contact to observe binding, stimulation or inhibition of functional response
To do. One such screening method is
In order to express the G-protein coupled receptor of the present invention
Requires the use of melanophores to be transfected
To do. Such technology was published on February 6, 1992.
PCT WO 92/01810.
Thus, for example, such an assay can be performed using G-protein
A melanophore cell encoding a protein-binding receptor
Both receptor ligands and compounds to be screened
The receptor polypeptide of the present invention by contacting with
For compounds that inhibit the activation of
Can be used for. Generated by the ligand
Inhibition of the signal produced by the compound is possible for the receptor
Being an antagonist, i.e. of the receptor
Inhibits activation. The screening involves scanning such cells.
By contacting with the compound to be cleaned,
To determine the compounds that activate the receptor and
Whether such compounds generate a signal, i.e.
Used to measure whether the receptor is activated
be able to. Other screening techniques include, for example,
Science, 246, 181-296 (1989)
By activation of the receptor as described in (October)
System for measuring extracellular pH changes
Cells expressing G-protein coupled receptors in
Use of cells (eg, transfected CHO cells)
Is included. For example, the compound may be a receptor poly
The second messenger is contacted with a cell expressing the peptide.
Measure signal response, eg signal transmission or pH change
Compounds that may activate or inhibit the receptor
It can be determined whether the object is valid. Another such screening technique is G
-RNA encoding protein-binding receptors
Introduced into the Xenopus oocyte, the receptor is temporarily
Need to be expressed. It is thought to inhibit the receptor
When screening the resulting compound, then
Receptor oocytes of the
In contact with the compound to be treated, followed by calcium
Signal inhibition or activation can be detected. another
Screening technology involves G-protein coupled receptors
In which the receptor is
Bind to lipase C or D. Such cells
Representative examples of endothelial cells, smooth muscle cells, embryonic kidney cells, etc.
Can be mentioned. Screening of the receptor
Phospholipase activation or inhibition of activation of the receptor
By detecting from the second signal, the above is achieved.
I can make it. Another method is the surface of the labeled ligand
Measuring inhibition of binding to a cell having the receptor above
Inhibits activation of the receptor polypeptide of the present invention
Need to be screened for certain compounds
The Such a method allows eukaryotic cells to bind G-proteins.
Transfected with DNA encoding a synthetic receptor
The cells express the receptor on their surface
The cells in the presence of a labeled form of a known ligand
Requires contact with a sex antagonist
The The ligand can be labeled, for example, with radioactivity.
You can. Amount of labeled ligand bound to the receptor
Is measured, for example, by the radioactivity of the receptor. The acceptance
Measured by the decrease in labeled ligand bound to the body
Thus, if the compound binds to the receptor, the label
Binding of the activating ligand to the receptor is inhibited. G-protein coupled receptors are found in mammals.
Ubiquitous in many hosts, including many pathologies, many biological
Take on the function. Therefore, on the one hand, G-protein binding
Stimulates receptors and on the other hand G-protein binding
Compounds and drugs that can inhibit receptors
It is desirable to find out. For example, G-protein binding
Compounds that activate sexual receptors include asthma, parkinson
Disease, acute heart failure, hypotension, urinary retention, and osteoporosis
It is also useful for therapeutic purposes, such as treatment. General
G-tamper determined by a screening method
A variety of compounds that inhibit the activation of protein-binding receptors
Can be used for therapeutic purposes, for example, hypertension, narrow
Heart disease, myocardial infarction, ulcer, asthma, allergy, benign prostate
Hypertrophy and schizophrenia, manic excitement, depression,
Delusions, dementia, severe mental retardation, Huntington's disease or dizziness
Nerve such as movement disorders such as Le de la Tourette syndrome
And used in the treatment of mental disorders. G-protein binding
Compounds that inhibit sexual receptors reduce endogenous anorexia
Also used to control bulimia. An antibody, or in some cases an oligonucleotide
Creotide binds to G-protein coupled receptor
However, because it does not elicit a second messenger response,
Antagonize the G-protein coupled receptor.
Antibodies typically have a unique association with the antigen-binding site of the antibody
Anti-idiotype antibodies that recognize these determinants are included.
Potential antagonist compounds also include G-tan
Tan closely related to ligands of protein-binding receptors
Loss of protein, i.e. biological function
Or binding to a G-protein coupled receptor.
Includes ligand fragments that don't yield answers at all.
The A prepared using anti-sense technology
Antisense constructs can form triple helix formation or antisense
Regulates gene expression by DNA or RNA
Both of these methods can be used for polynucleotides.
Based on binding to DNA or RNA. For example, the present invention
A polynucleotide sequence encoding the mature polypeptide of
About 10-40 bases in length using the 5 'coding portion of the sequence
Design paired antisense RNA oligonucleotides
The Inheritance of DNA oligonucleotides involved in transcription
Designed to be complementary to the child region (triple helix-
Lee et al., Nucl. Acids Res., 6: 3073 (1979);
Coney et al., Science, 241: 456 (1988); and
And Dervan et al., Science, 251: 1360 (1991).
See), thereby transcription and G-protein
Prevents production of binding receptors. Antisense RNA orientation
Gonucleotides hive to mRNA in vivo
Re-lysed to accept G-protein binding of mRNA molecules
Block translation into the body (Antisense-Okano,
J. Neurochem., 56: 560 (1991); Oligodeoxyn
ucleotides as Antisense Inhibitors of Gene Exp
ression, CRC Press, Boca Raton, FL (198
8)). The above oligonucleotides are also fed into the cell
Anti-sense RNA or DNA
Of the G-protein coupled receptor
Production can be inhibited. Small peptides or peptide-like molecules
Binds to a G-protein coupled receptor
Prevent normal biological activity from making it inaccessible
Small molecules can also activate the receptor polypeptides of the invention.
Can be used to inhibit. Receptor fragment
Soluble forms of G-protein coupled receptors such as
G-bound to Gand and its ligand bound to the membrane
Prevent interaction with protein-coupled receptors
This can be used to inhibit the activation of the receptor.
You can. The present invention further provides a pharmaceutically acceptable carrier.
In addition, an effective amount of the above inhibitory compound is administered to the patient and
That Gand binds to a G-protein coupled receptor.
By blocking or preventing secondary signals
Inhibits activation of G-protein coupled receptors
And thereby alleviating abnormal conditions
Associated with an excess of G-protein coupled receptor activity
A method of treating an abnormal condition is provided. The present invention also provides
An effective amount of the above activated compound together with a pharmaceutically acceptable carrier.
Administering things to patients, thereby alleviating abnormal conditions
Of G-protein coupled receptor activity, characterized in that
Methods of treating abnormal conditions associated with underexpression are provided. Activate or inhibit such receptors
The compound should be used in combination with a suitable pharmaceutical carrier.
You can. Such compositions comprise a therapeutically effective amount of the
Polypeptide or compound and pharmaceutically acceptable
It comprises a carrier or excipient. Such carriers include
But not limited to, saline, buffered
Saline, dextrose, water, glycerol, eta
Nord, and combinations thereof. Made of
The agent should be compatible with the method of administration. The present invention also provides a book
Filling one or more ingredients of the pharmaceutical composition of the invention;
And a pharmaceutical package comprising one or more containers.
A kit or kit is also provided. Related to such containers
Manufacturing, using or selling pharmaceutical or biological products
With a notice in the form prescribed by the government authorities regulating
Well, this notice is manufactured and used for human administration
Or represents the approval of the sales by the relevant station. Furthermore, the
The pharmaceutical composition can be used with other therapeutic compounds.
Yes. The pharmaceutical composition comprises topical, intravenous, intraperitoneal,
Such as intramuscular, subcutaneous, intranasal or intradermal route,
It can be administered in a convenient manner. The pharmaceutical composition comprises
Effective for treating and / or preventing specific signs
Administered in an amount. In general, the pharmaceutical composition comprises at least
Administered in an amount of about 10 μg / kg (body weight), most often
In amounts that do not exceed about 8 mg / kg body weight per day
Will be administered. Most often, the route of administration and
Taking into account the symptoms and the like, the dosage is about 10 μg / k daily.
g to about 1 mg / kg (body weight). The G-protein binding receptor polypeptide
And activating or inhibiting compounds are referred to as “gene therapy”
Such polypeptides are often called
Can be used according to the present invention due to its expression in bo
it can. Thus, for example, patient-derived cells
A polynucleotide encoding a polypeptide in B
After manipulation with (DNA or RNA), the manipulated cells are
Give to patients to be treated with peptides. Such a way
Are well known in the art. For example, the polypeptide of the present invention
Of retroviral particles containing RNA encoding
Manipulate cells by methods known in the art
be able to. Similarly, for example, by methods known in the art.
For in vivo expression of the polypeptide.
The vesicles can be manipulated in vivo. In the industry
As is known, cells are manipulated in vivo.
To express the polypeptide in vivo.
Further comprising an RNA encoding the polypeptide of the present invention.
Deploy production cells to patients to produce Torovirus particles
Can be given. By such a method, the po
These methods and others for administering the peptides
Methods will be apparent to those skilled in the art from the teachings of the present invention. example
For example, an expression vehicle for manipulating cells is a retrovirus.
Other than Rus, for example, combined with a suitable transport vehicle
And then used to manipulate cells in vivo
It may be an adenovirus that can. Retroviral plasmid vectors are
Lonnie mouse sarcoma virus, Moloney mouse leukemia virus
Luz, Spleen Necrosis Virus, Loose Sarcoma Virus, Harve
Isarcoma virus, avian leukemia virus, gibbon white blood
Disease virus, human immunodeficiency virus, adenovirus,
Leto such as myeloproliferative sarcoma virus and breast cancer virus
Can be derived from rovirus, but limited to these
Is not to be done. In one specific example, retro
Viral plasmid vector is Moloney murine leukemia
Derived from viruses. A vector includes one or more professionals.
A motor is included. Suitable promoters include
Miller et al., Biotechniques, Vol. 7, N
o. 9, 980-990 (1989)
Retroviral LTR; SV40 promoter; and
Human cytomegalovirus (CMV) promoter, too
Or other promoters (eg, histones, p
Eukaryotics such as olIII and β-actin promoter
Cellular promoters such as cellular promoters
-However, it is not limited to these)
However, it is not limited to these. Appropriate
Selection of a lomotor will be apparent to those skilled in the art from the teachings of the present invention.
Will. Nucleic acid sequences encoding the polypeptides of the invention
The train is regulated by a suitable promoter. Appropriate
As a promoter, adenovirus major rate
Adenovirus promoters such as promoters;
Heterologous promoters such as the Tomegalovirus (CMV) promoter
Romotor; RS virus (RSV) promoter; M
TT promoter, metallothionein promoter, etc.
Inducible promoter; heat shock promoter; alb
Min promoter; ApoAI promoter;
Brin promoter; herpes simplex virus thymidine
Viral thymidine, such as a kinase promoter
RNase promoter, retroviral LTR
(Including decorative retrovirus LTR); β-actin promo
And the human growth hormone promoter
However, it is not limited to these. The pro
The motor regulates the gene encoding the polypeptide
It is a native promoter. Using a retroviral plasmid vector
Transducing packaging cell lines and producing
Forming a Sir cell line. Packs that can be transfected
As a caging cell, Miller's Human Gene Therap
PE5 described in y, Vol. 1, 5-14 (1990)
01, PA317, ψ-2, ψ-AM, PA12, T1
9-14X, VT-19-17-H2, ψCRE, ψC
RIP, GP + E-86, GP + envAm12 and
DAN cell lines include, but are not limited to
is not. Characteristics of packaging cells by vectors
The introduction can be performed by methods known to those skilled in the art. This
Such means include electroporation and the use of liposomes.
And CaPO4 precipitation, but are not limited to these
It is not something. Alternatively, retroviral plasmid
Encapsulated vector in liposome or lipid
And may be administered to a host. The producer cell line is a polypeptide of the invention.
Infectious retrovirus comprising a nucleic acid sequence encoding a peptide
Produces vector particles. Then such a retro
In vitro or in vitro using viral vector particles
Eukaryotic cells can be transduced either in vivo
The The transduced eukaryotic cell is a polypeptide of the present invention.
Will express a nucleic acid sequence encoding. Transduced
Possible eukaryotic cells include embryonic stem cells, hepatocytes, fibroblasts
Vesicles, myoblasts, keratinocytes, endothelial cells and bronchial epithelial cells
But is not limited to these.
The present invention relates to ligand binding to G-protein coupled receptors.
G-protein coupled receptor under conditions that allow
Contacting a mammalian cell expressing a ligand with said ligand
Detecting the presence of a ligand that binds to the body, thereby
Whether the ligand binds to a G-protein coupled receptor
The G-tamper of the present invention, characterized by determining whether or not
Riga not known for its ability to bind to protein-binding receptors
Determine whether the host can bind to such receptors
Provide a way to do it. Agonists and / or antagonists
Such a system for determining gonists is also
Use to determine the ligand that binds to the receptor
You can also. The G-protein coupled receptor of the present invention comprises
It has been putatively identified as a prostate tissue receptor. This same
Defined as a result of amino acid sequence homology
It is. With antagonists, prostate enlargement or
Can treat prostate cancer. The antagonist
And a pharmaceutically acceptable carrier as described above, for example
Alternatively, it may be used as a composition. Screening as described above
Prostate cancer using agonists identified by
Prostate hyperplasia can be treated. This receptor
If expressed in prostate-derived cancer cells, the recipient then
An antibody or small molecule that binds to a container with high specificity
Of contrast enhancement of prostate cancer metastasis or surgical resection of tumor
Useful in evaluation. The present invention further provides human G-on the cell surface.
Interacts specifically with protein-binding receptors,
To identify drugs that bind to
A G-protein coupled receptor.
A mammal comprising an isolated DNA molecule
Cells in contact with a plurality of drugs, the mammalian cells
To determine those drugs that bind to
Specific to the human G-protein coupled receptor of the present invention
To identify drugs that interact with
Provide a method comprising. Then such drugs
Therapeutically used to activate the receptor of the present invention or
Inhibits activation. The present invention also provides a G-protein coupled receptor.
By detecting the presence of mRNA encoding the body,
Expression of G-protein coupled receptors on the surface of cells
A method of detection that obtains total mRNA from a cell.
And thus obtained under hybridizing conditions.
MRNA and human G-protein coupled receptor
Specifically higher than the sequence contained within the sequence of the nucleic acid molecule to be
The nucleic acid probe of the present invention capable of bridging
In contact with the probe and hybridized to the probe.
Detecting the presence of RNA, and thereby G-tag
Detection of protein binding receptor expression by the cell
A method comprising the steps of: The present invention also provides a receptor polypeptide of the present invention.
Related to the presence of mutations in the nucleic acid sequence encoding
Diagnosis to detect diseases or susceptibility to diseases
G-protein coupled receptor as part of a breakthrough assay
Also related to the use of somatic genes. Such diseases, for example
Tumors and cancers are related to cell transformation.
There is a clerk. Human G-protein coupled receptor gene
Individuals with mutations can be detected using various techniques.
It can be detected at the NA level. Nucleic acids for diagnosis are
From patient cells, for example, blood, urine, saliva, tissue biopsy
And can be obtained from autopsy material. Genomic DNA is
Can be used directly for detection or before analysis
PCR (Saiki et al., Nature, 324: 163-166 (1
986)) to enzymatically amplify
Can do. RNA or cDNA can also be used for the same purpose.
Can be used. Examples include G-protein binding
PCR complementary to nucleic acids encoding sex receptor proteins
G-protein coupled receptor modification using primers
Differences can be identified and analyzed. For example, deletion and
Insertion is the size of the amplification product compared to the normal genotype.
It can be detected by a change in size. Point mutation
The amplified DNA is radiolabeled G-protein
Binding receptor RNA or alternatively radiolabeled G
-On the antisense DNA sequence of the protein-binding receptor
It can be identified by hybridizing.
Fully matched sequences are obtained by RNase A digestion.
Or unmatched duplexes due to differences in melting temperature
Can be distinguished from duplexes. Sequence differences between the reference gene and the “variant”
Revealed by direct DNA sequencing method
Become. In addition, the cloned DNA segment
Used as a probe to detect different DNA segments
To do. The sensitivity of this method is when combined with PCR.
Very strengthened. For example, a double stranded PCR product or one
The sequencing method used with this strand template molecule is
Produced by a decorated PCR product. Sequencing is radiation
By conventional methods using line-labeled nucleotides.
Or automated sequencing with fluorescent labeling tags
Done by the method. Based on DNA sequence differences
Genetic tests are performed on gels with or without denaturing agents.
Detection of changes in electrophoretic mobility of NA fragments
Can be achieved. Small sequence deletions and
And insertion should be visualized by high resolution gel electrophoresis
Can do. The various sequences of the DNA fragments
Distinguishing amidine gradient gels by denaturing them
Here, we can move various DNA fragments
Degree to their specific melting or partial melting temperature
More delayed at various positions in the gel (e.g.,
See Myers et al., Science, 230: 1242 (1985).
See). Sequence changes at specific positions are also
Nuclease protection assays such as
Or by chemical cutting (e.g.
Cotton et al., PNAS, USA, 85: 4397-4.
401 (1985)). Therefore, the detection of specific DNA sequences
Out, genomic DNA hybridization, RNA
Case protection, chemical cleavage, direct DNA sequencing, or restriction
Use of an enzyme (e.g., restriction enzyme fragment length polymorphism (RFLP)),
And methods like Southern blotting
Can be achieved. Further conventional gel electrophoresis
And in addition to DNA sequencing, mutations are also in situ
It can also be detected by analysis. The present invention further relates to a sample derived from a host.
And is an indicator of disease that can increase in level.
The level of soluble form of the receptor polypeptide of the present invention is
It relates to a diagnostic assay for detecting changes. OK
Can be used to detect soluble receptor polypeptides
Assays are well known to those skilled in the art, eg radio
Immunoassay, competitive binding assay, Western blot
Analysis and preferably an ELISA assay is used.
The The ELISA assay is first performed with a polypeptide of the invention
An antibody specific to the antigen of, preferably a monoclonal antibody
Preparing. In addition, the reporter antibody
Prepare against local antibody. Release to the reporter antibody
Radioactivity, fluorescence or horseradish peru in this example
Bind a detectable agent such as a xidase enzyme
Make it. Immediately remove the sample from the host
Solid supports that bind to proteins in them, eg, polystyrene
Incubate on a Wren dish. Next, bovine serum
Incubate with non-specific proteins such as rubmin
By beating, the vacant protein in that dish
Cover all binding sites. Next, add the monoclonal antibody to the dish.
Incubate in the meantime,
The local antibody was bound to a polystyrene dish and the antibody of the present invention.
It binds to protein. Monoclonal antibody that did not bind
Rinse all body with buffer. Horseradish peroxy
Immediately place the reporter antibody conjugated to the dase on the dish.
The reporter antibody bound to the polypeptide of the present invention.
Binding to the desired monoclonal antibody occurs. Then join
Wash away reporter antibody that did not. Peroki
Add a sidase substrate to the dish and measure the amount of color development over a period of time.
When comparing against a constant volume of patient sample
It is a measure of the amount of protein of the invention present. The sequences of the present invention are also useful for chromosome identification
It is. Place the sequence at a specific location on an individual human chromosome
Specifically targeting and hybridizing to
Can do. In addition, certain sites on the chromosome
Need to be determined. Based on actual sequence data (repeat polymorphism)
Chromosome marking reagent
Can hardly be used to make D according to the invention
The mapping of NA to the chromosome
It is an important first step in associating with related genes. Easy
Simply put, cDNA-derived PCR primers (preferably
Stain the sequence by preparing 15-25 bp)
Can be mapped to the body. 3 'not translated
In the genomic DNA using computer analysis of the region
Primer that does not span one or more exons of
The amplification process is complicated by the rapid selection of
The These primers are then transferred to individual human chromosomes
For PCR screening of somatic cell hybrids containing
Use. Contains the human gene corresponding to the primer, it
Only these hybrids give amplified fragments.
I will. PCR mapping of somatic cell hybrids
Is a quick and easy way to assign a specific DNA to a specific chromosome.
It's a quick way. The same oligonucleotide primer
Sublocalization using the present invention
A pour of concrete chromosomes or large genomic clones
Achieved in a similar way using a panel of
Can be made. Similar to mapping to that chromosome
Other marking methods that can be used for the in s
itu Hybridization, labeling flow-sorty
Pre-cleaning using flow-sorted chromosomes
And construct a chromosome-specific cDNA library
Preselection by hybridization
Is included. Metaphase chromosome spread of cDNA clones
Fluorescence in situ hybridization (FIS)
H) to give accurate chromosome position in one step
You can. This technique is as short as 50 or 60 bases.
Can be used with any cDNA. To review this technology
Verma et al., Human Chromosomes: a Manual of
Basic Techniques, Pergamon Press, New York
(1988). A sequence matches the exact chromosomal location
Once mapped, it inherits the physical location of the sequence on the chromosome
Can be associated with map data. Such de
For example, V. McKusick, Mendelian Inherit
ance in Man (Johns Hopkins University Welch
(Available online through Medical Library)
Is found. Then mapped to the same chromosomal region
Analysis of the relationship between genes and diseases
Confirmed by the co-heritance of the genes in contact
To do. Next, the affected individual and the unaffected individual
Determine differences in cDNA or genomic sequence between individuals
There is a need to. Some of the affected individuals
In all normal individuals
If not, the mutation can cause disease
It seems to be. Currently physical mapping and genetic
Based on the mapping analysis, the chromosomal region associated with the disease
Accurately localized cDNA is 50-500 possible causes
Could be one of the genes. (This is 1
Megabase mapping analysis and one relic per 20kb
Assume a gene). Polypeptides, their fragments
Or other derivatives or analogs thereof
Or use cells that express them as an immunogen.
Antibodies against these can be produced. These anti
The body can be, for example, polyclonal or monoclonal
It can be the body. The invention also includes chimeras, single chains, and
A humanized antibody, or even a Fab fragment, or
Also included are the products of the Fab expression library. Existing in the industry
Various methods of knowing such antibodies and fragments
Can be used in the manufacture of Pairs with polypeptides corresponding to the sequences of the invention
Antibody produced by injecting the polypeptide directly into the animal
Or the polypeptide is preferably an animal,
Can be obtained by administration to non-human animals
The The antibody so obtained is then
It will bind to the peptide itself. In this way, poly
Even a sequence that encodes only a fragment of a peptide
Producing antibodies that bind fully natural polypeptides
Can be used for Then use such antibodies.
From the tissue expressing that polypeptide.
Chido can be isolated. To prepare monoclonal antibodies, continuous
All technologies that provide antibodies produced by typical cell line culture
Can be used. Examples include hybridoma technology
(Kohler and Milstein, 1975, Nature, 25
6: 495-497), trioma technology, human B
Cell hybridoma technology (Kozbor et al., 1983, Immun
ology Today 4:72), and human monoclonal antibodies
EBV-hybridoma technology (Cole
Et al., 1985, Monoclonal Antibodies and Cancer
Therapies, Alan R. Liss, Inc., pp. 77-96
Included). Described for the production of single chain antibodies
Technology (U.S. Pat. No. 4,946,778) is an exemption of the present invention.
Producing single chain antibodies against epidemiogenic polypeptide products
Can fit. Also use transgenic mice
A human against the immunogenic polypeptide product of the invention
An antibody can also be expressed. The invention is further described with reference to the following examples.
However, the present invention is not limited to such examples.
It should be understood that All parts or quantities are special
Unless otherwise stated, the unit is weight. Of the following examples
Some frequently used methods to facilitate understanding
And / or describe terms. “Plasmid”
Lowercase p and / or uppercase and
Or indicated by numbers. Starting plasmid in this specification
Is commercially available and publicly available on an unlimited basis
Possible or available by public means
It can be constructed from a plasmid. In addition, the listed plasmid
Plasmids equivalent to those known in the art are known in the art and
It will be clear to the person. “Digestion” of DNA is the presence of DNA
Catalytic cleavage of DNA with restriction enzymes that act on the sequence
The various restriction enzymes used herein are commercially available
And their reaction conditions, cofactors and other needs
Conditions were used as known to those skilled in the art. Analysis eyes
Generally, 1 μg of plastic in about 20 μl of buffer solution is generally used.
Sumid or DNA fragment with about 2 units of enzyme
Used for. DNA fragmentation for plasmid construction
In general, for the purpose of isolating
Digest 5-50 μg of DNA with 20-250 units of enzyme
The Suitable buffers and substrate weights for specific restriction enzymes are
Specified by the creator. Ink at 37 ° C for about 1 hour
The incubation time is usually used, but at the supplier's instructions
It can therefore be changed. After digestion, the reaction product is
Electrophoresis directly on an acrylamide gel to obtain the desired flag
Isolation. The size separation of the cleaved fragments is G
oeddel, D et al., Nucleic Acids Res., 8: 4057 (1
980) 8% polyacrylamide
Perform with gel. An “oligonucleotide” is chemically
Can be synthesized. Single chain polydeoxynucleoti
Or two complementary polynucleotide strands,
Synthetic oligonucleotides like 5 'phosphate
In the presence of a kinase,
Without adding any additional oligonucleotides, another oligonucleotide
Would not ligate to. Synthetic oligonucleotide
Ligate to undephosphorylated fragment
Will do. “Ligation” means two double-stranded nucleic acids
The formation of phosphodiester bonds between fragments
(Maniatis, T. et al., Ibid., P. 146). Especially this
Unless otherwise noted, ligation is ligated
Per 0.5 μg of approximately equimolar amount of DNA fragment
Along with 10 units of T4 DNA ligase (“ligase”)
Can be accomplished using known buffers and conditions
The Transformation unless otherwise stated
Graham, F. and Van der Eb, A., Virology,
52: 456-457 (1973).
I went like that. EXAMPLE 1 Recombinant HPRAJ70 expression plasmid, HPRAJ70 HA expression in COS7 cells: 1) SV
40 origin of replication, 2) ampicillin resistance gene, 3)
E. coli replication origin, 4) polylinker region, SV40
CMV pro followed by intron and polyadenylation sites
Vector pcDNAI / Amp (in vitro
From Invitrogen). Full HPRA
J70 precursor and its 3 'end in-frame
The DNA fragment encoding the fused HA tag is
From the polylinker region of the
Recombinant protein expression is expressed under the CMV promoter.
Indicated. HA tag is like the above influenza red
Corresponds to epitope derived from hemagglutinin protein
(I. Wilson, H. Nima
n), Haiten (R.Heighten), Cherenson (AC)
herenson), M. Connolly, and Lana
(R. Lerner), 1984, Cell 37, 767).
By fusing the HA tag to our target protein
The recombinant protein can recognize anti-HA epitopes
It can be easily detected by the body. Plasmid construction
The method is described below: A encoding HPRAJ70
The DNA sequence of TCC accession number 97131 is
Original cloned E using primers
Constructed by PCR on ST: 5 'primer sequence: CCCCTCCTGAATTCCAGCA ATG AGTTCCTG
C (SEQ ID NO: 4) is an EcoRI site followed by a GPR starting from the start codon
Contains 12 nucleotides of the coding sequence of C; 3 ′ sequence: GTG [TCTAGA] TCACTTGCCTCCCACAGCCTGCAAGTCC
(SEQ ID NO: 5) is a complementary sequence to the XbaI site, a translation stop codon,
And the last 25 nucleotides of the HPRAJ70 coding sequence
Contains leotide (not including stop codon). Follow
The PCR product is an EcoRI site, HPRAJ70 code.
Sequence, followed by HA fused in-frame
Tag, translation termination codon next to the HA tag, and Xba
Contains the I site. DNA fragments amplified by PCR and
Vector, pcDNAI / Amp, EcoRI and Xba
Digest with I restriction enzyme and ligate. That lie
The gation mixture was added to E. coli strain SURE (Stratagene Cl
oningSystems, La Jolla, CA92037)
Form and untransform the transformed culture.
Place on a picillin medium plate to select resistant colonies
To do. Plasmid DNA from transformant
Isolate and PCR and limit for the presence of the correct fragment
Test by analysis. Expression of recombinant HPRAJ70
For this reason, COS cells were obtained by DEAE-DEXTRAN method.
Is transfected with an expression vector. (Sambu
Look, Fritsch, Maniatis (TM)
aniatis), Molecular Cloning: A Laura
Tree Manual, Cold Spring Laboratories
Lee Press, (1989)). HPRAJ70 HA
Protein expression by radiolabeling and immunoprecipitation
Detect (Harlow, Lane, A
Antibodies: A Laboratory
Manual (A Laboratory Manual), Cold Su
Pulling Laboratory Press, (1988)). G
Two days after transfection, the protein was extracted with 35S-
Label with cysteine for 8 hours. Cell culture medium is then collected.
The cells were washed with detergent (RIPA buffer (150 m
M NaCl, 1% NP-40, 0.1% SDS, 1% N
P-40, 0.5% DOC, 50 mM Tris, pH 7.
5)) (Wilson et al., Ibid. 37: 767 (1
984)). Both cell lysate and culture medium
Precipitate with monoclonal antibody specific for HA. Settling
Of the purified protein on a 15% SDS-PAGE gel
Analyze. Example 2 HPRAJ7 using baculovirus expression system
Cloning of 0 and expression of DNA encoding the full length HPRAJ70 protein
Column, ATCC 97131, gene 5 ′ and 3 ′
PCR oligonucleotide primers corresponding to the sequence
Amplify using. The 5 ′ primer has the sequence: GTCACCCCGGGTCAGTTCCATCAT
GAGTTCCTGCAACTTCAC (SEQ ID NO: 6) and SmaI restriction enzyme site (bold) followed by eukaryotic
11 nu resembles a signal useful for initiating translation in cells
Creotide (J. Mol. Biol. 1987, 196, 947)
-950, Kozak, M.) and immediately after this, H
The first 20 nucleotides of the PRAJ70 gene
The start codon “ATG” is underlined). The 3 ′ primer has the sequence: GTG TCTAGA TCACTTGCCTCCCAC
AGCCTGCAAGTCC (SEQ ID NO: 7) and the cleavage site of the restriction endonuclease XbaI
including. The amplified sequence is extracted with phenol and
Isolated from a 1% agarose gel by the Knoll precipitation method
It was. The fragment is then endonuclease S
digest with maI and XbaI, then as in Example 1
And purified. This fragment is named F2. Vector pA2 (pVL941 vector modification
Decoration, discussed below), baculovirus expression system
Is used to express GPRC protein using
The shows include Summers, MD and Smith
(Smith), GE 1987, A manual of methods f
or baculovirus vectors and insect cell culture pro
cedures, Texas Agricultural Expertial Stati
on Bulletin No. 1555). This expression vector
Autographer (Autographa) California Poly
Powerful polyhedron of hedrosis virus (AcMNPV)
Promoter followed by restriction endonuclease Bam
Contains a recognition site for HI. Simian virus (SV) 40
Of polyadenylation sites for effective polyadenylation
To do. E. coli for easy selection of recombinant viruses
Β-galactosidase gene derived from polyhedrin
Polyhedrin promotion followed by the polyadenylation signal of the gene
Insert in the same direction as the Co-transfected
(cotransfected) Wild-type viral DNA, depending on the cell
Polyhed viral sequences for mediated homologous recombination
Adjacent to both sides of the phosphorus sequence. Many other baculouis
For example, pAc373, pVL941
And substitute for pRG1 such as pAcIM1
(Luckow, V.A. and
Summers, MD, Virology, 170: 3
1-39). The plasmid was transformed into restriction enzymes SmaI and XbaI.
After digestion with calf intestine by methods known in the art.
Dephosphorylation was performed using phosphatase. Then examples
DNA was isolated from 1% agarose gel in the same way
It was. This vector DNA is named V2. Fragmen
F2 and dephosphorylated plasmid V2 were transformed into T4 DNA
Ligated with ligase. Next, E. coli HB1
01 cells transformed, HPRAJ70 genetic
Including a plasmid (pBac-HPRAJ70) having a child
Bacteria were identified using the enzyme Bam HI. clone
The sequence of the fragment obtained by DNA sequencing
confirmed. Lipofection (Felgne
r) et al., Proc. Natl. Acad. Sci. USA, 84: 741.
3-7417 (1987)) using the plasmid pBac
-Commercially available linearized baculoyl with HPRAJ 705 μg
("BaculoGoldTM baculovirus DNA", Pha
rmingen, San Diego, CA) Simultaneous traffic with 1.0μg
I had a great effect. 1 μg of BaculoGold ™ viral DNA
And 5 μg of plasmid pBacHPRAJ70 in serum-free
Grace's medium (Life Technologies Inc.,
Gaitersburg, MD) microtiter containing 50 μl
Mixed in sterile wells of plate. Then lipofe
10 μl of Kupo (Lipofectin) and 90 μl of Grace's medium
In addition, mixed and incubated for 15 minutes at room temperature.
The transfection mixture is then washed with serum-free gray
Seed in a 35 mm tissue culture plate containing 1 ml of cell culture medium
Added to Sf9 insect cells (ATCC CRL 1711)
It was. Shake the plate back and forth and add a new one
The solution was mixed. The plate is then placed at 27 ° C for 5 hours
Incubated for a while. 5 hours later, the transfection
Solution from the plate and 10% fetal bovine blood
1 ml of Grace insect medium supplemented with Qing was added. That play
Return to the incubator and incubate at 27 ° C for 4 days.
Continued. After 4 days, the supernatant was collected and the Summers and Smith
Plaque assay as described by (above)
Went. As a variant, “Blue Gal” (Life Technolo
gies Inc., Gaithersburg)
Plaques stained blue due to this
Can be easily isolated. ("Plaque Assé
A detailed description of “a” is also available for users of insect cell cultures.
Guide, and Life Technologies Inc., Gaithe
Baculovirology distributed by rsburg, 9-10
Can also be found on the page). After 4 days, serial dilutions of virus are added to the cells.
Eppendorf pipette with blue stained plaque
The sample was collected at the tip. Then contains the recombinant virus
Eppendorf containing 200 μl of Grace's medium
It was resuspended in a tube. For quick centrifugation of the agar
Remove the supernatant containing the recombinant baculovirus,
Used to infect Sf9 cells seeded in 35mm dishes
did. After 4 days, the supernatants of these culture dishes were collected and 4
Stored at ° C. Sf9 cells were treated with 10% heat inactivated FBS
And grown in Grace's medium supplemented with Infect the cells
Recombinant baculovirus V-HPR with multiplicity (MOI) 2
AJ70 was infected. After 6 hours, remove the medium
SF900 without methionine and cysteine
II medium (Life Technologies Inc., Gaithersburg)
Replaced. 42 hours later, 5 μCi of 35S-methionine
And 5 μCi of 35S cysteine 5 μCi (Amersham)
Was added. Incubate the cells for an additional 16 hours
And then collected by centrifugation and then labeled protein
Quality, SDS-PAGE and autoradiography
Visualized. Example 3 Expression Pattern of HPRAJ70 in Human Tissue Northern blot analysis was performed to determine HP HP in human tissue.
The expression level of RAJ70 is analyzed. RNAzolTMB
System (Biotech Laboratories, Inc.)
Rated (Biotecx Laboratories, Inc.), Hughes
Ton, Texas) Isolate whole cell RNA samples. Special
About 10% of total RNA isolated from each specific human tissue
μg is separated on 1% agarose gel and nylon fill
Blot on the plate. (Sunbrook, Flitch, Mani
Atis, molecular cloning, cold sp
Ring Laboratory Press, (1989)). Strike
50 ng DNA using Ratagene Prime-It kit
Perform a labeling reaction. Select-G- labeled DNA
Purify on 50 columns. (5 Prime-3 Prime, Inn
Corporate, Boulder, CO). Then 0.
5M NaPO4, 1000000 cpm / ml, pH7.
4 and 7% SDS at 65 ° C. overnight,
Full length HPRAJ70 gene with radiolabeled filter
Hybridize. 0.5XSSC, 0.1% SDS
After washing twice at room temperature and twice at 60 ° C., −70 ° C.
Expose the filter to the reinforced screen overnight. HPRA
Message RNA for J70 is found in human prostate tissue
It is abundant. Example 4 Expression in Gene Therapy Fibroblasts are obtained from a subject by skin biopsy. can get
Place the tissue in tissue culture medium and divide into small pieces. Tissue pieces
Place on wet surface of tissue culture flask (approximately 10 pieces
Each in a separate flask). Upside down the flask
Close tightly and leave at room temperature overnight. 2 at room temperature
After 4 hours, the flask is turned upside down and a small piece of tissue is removed from the flask.
Leave fresh culture medium (eg Ham's
10% FBS, penicillin and strep in F12 medium
Add tomycin). Then this is 3
Incubate at 7 ° C for about 1 week. At this point, the new
Add fresh medium, then change medium every few days. The
After two weeks of culture, monolayer fibroblasts appear.
Single layer trypsinized and applied to larger flask
I will. In the LTR of Moloney mouse sarcoma virus
The flanked pMV-7 (Kashmeiya
ー 、 P. T.A. Et al., 7: 219-25 (198
8)) cut with EcoRI and HindIII, followed by
Treat with bovine intestinal phosphatase. Aga linear vector
Fractionate on a ros gel and purify using glass beads
The PCR programs corresponding to the 5 ′ and 3 ′ terminal sequences, respectively.
A TNF receptor cDNA is amplified using a lymer.
The 5 ′ primer contains an EcoRI site and the 3 ′ primer
Contains the HindIII site. In the presence of T4 DNA ligase
An equal amount of Moloney murine sarcoma virus linear backbo
And the EcoRI fragment and HindIII fragment
Add to the beginning. The resulting mixture is ligated into two fragments
Maintain conditions appropriate to the application. Ligation mixture
Is used to transform bacterial HB101 and then correctly
The vector contains the inserted TNF receptor gene
Place on agar containing kanamycin
The 10% bovine serum (CS), penicillin and strain
Dulbecco's conditioned eagle medium with putomycin
(DMEM), amphoteric pA317 or GP + am
12 packaging cells grown in tissue culture and collected
Make it dense. M containing the TNF receptor gene
The SV vector is added to the medium and the packaging cells are
Transduction with a vector. Packaging cells immediately
Produces infectious viral particles containing the TNF receptor gene
(Packaging cells will be referred to as producer cells in the future.
To do). Fresh into transduced producer cells
Medium, followed by 1 of confluent producer cells
Harvest medium from 0 cm plate. Infectious virus
Filter spent medium containing pups with Millipore filter
And remove the detached producer cells,
Medium is used to infect fibroblasts. Fibroblast sub
Remove the media from the confluent plate and produce cells
Replace with the medium obtained from. Remove this medium
Replace with fresh medium. If the virus titer is high
That all fibroblasts are substantially infected
There is no need for selection. If the titer is very low
Label with a selectable marker such as neo or his
The use of Torovirus vectors is necessary. Then
Alone or Cytodex 3 microcarrier
-Genetically after growing to confluence on beads
The engineered fibroblasts are injected into the host. Fibroblast
Immediately produces the protein product. From the previous teaching
In view, many modifications and variations of the present invention are possible
To those who are not specifically mentioned within the scope of the claims to be described later
The present invention can be carried out by a method. [Sequence Listing] SEQUENCE LISTING <110> Human Genome Sciences, Inc. et al. <120> HUMAN G-PROTEIN RECEPTOR HPRAJ70 <130> PF180JP <160> 8 <170> PatentIn version 3.1 <210> 1 <211> 1474 <212> DNA <213> Homo Sapiens <220><221> CDS <222> (274) .. (1233) <223><400> 1 ccatgctgcc ttccgggcag taccatccat ctccacaccc tggaagacac agtgagttag 60 caccaccacc aggtaattgg ccttatcagc tctgtgcctg tctccagtca ggctggaata 120 agtctcctca tatgtgcaag ctcggccctc ccctggaatc taaagcctcc tcagccttct 180 gagtcagcct gaaaggaaca ggccgaactg ctgtatgggc tctactgcca gtgtgacctc 240 accctctcca gtcacccctc ctcagttcca gct atg agt tcc tgc aac ttc aca 294 Met Ser Ser Cys Asn Phe Thr 1 5 cat gcc acc tgt gtg ctt att ggt atc cca gga tta gag aaa gcc cat 342 His Ala Thr Cys Val Leu Ile Gly Ile Pro Gly Leu Glu Lys Ala His 10 15 20 ttc tgg gtt ggc ttc ccc ctc ctt tcc atg tat gta gtg gca atg tgt 390 Phe Trp Val Gly Phe Pro Leu Leu Ser Met Tyr Val Val Ala Met Cys 25 30 35 gga aac tgc atc gtg gtc ttc atc gta agg acg gaa cgc agc ctg cac 438 Gly Asn Cys Ile Val Val Val Arg Thr Glu Arg Ser Leu His 40 45 50 55 gct ccg atg tac ctc ttt ctc tgc atg ctt gca gcc att gac ctg gcc 486 Ala Pro Met Tyr Leu Phe Leu Cys Met Leu Ala Ala Ile Asp Leu Ala 60 65 70 tta tcc aca tcc acc atg cct aag atc ctt gcc c tt ttc tgg ttt gat 534 Leu Ser Thr Ser Thr Met Pro Lys Ile Leu Ala Leu Phe Trp Phe Asp 75 80 85 tcc cga gag att agc att gag gcc tgt ctt acc cag atg ttc ttt att 582 Ser Arg Glu Ile Ser Ile Glu Ala Cys Leu Thr Gln Met Phe Phe Ile 90 95 100 cat gcc ctc tca gcc att gaa tcc acc atc ctg ctg gcc atg gcc ttt 630 His Ala Leu Ser Ala Ile Glu Ser Thr Ile Leu Leu Ala Met Ala Phe 105 110 115 gac cgt tat gtg gcc atc tgc cac cca ctg cgc cat gct gca gtg ctc 678 Asp Arg Tyr Val Ala Ile Cys His Pro Leu Arg His Ala Ala Val Leu 120 125 130 135 aac aat aca gta aca gcc cag att ggc atc gtg gct 726 Asn Asn Thr Val Thr Ala Gln Ile Gly Ile Val Ala Val Val Arg Gly 140 145 150 tcc ctc ttt ttt ttc cca ctg cct ctg ctg atc aag cgg ctg gcc ttc 774 Ser Leu Phe Phe Phe Pro Leu Pro Leu Leu Ile Lys Leu Ala Phe 155 160 165 tgc cac tcc aat gtc ctc tcg cac tcc tat tgt gtc cac cag gat gta 822 Cys His Ser Asn Val Leu Ser His Ser Tyr Cys Val His Gln Asp Val 170 175 180 atg aag ttg gcc tat gca gac act ttg cc c aat gtg gta tat ggt ctt 870 Met Lys Leu Ala Tyr Ala Asp Thr Leu Pro Asn Val Val Tyr Gly Leu 185 190 195 act gcc att ctg ctg gtc atg ggc gtg gac gta atg ttc atc tcc ttg 918 Thr Ala Ileu Met Gly Val Asp Val Met Phe Ile Ser Leu 200 205 210 215 tcc tat ttt ctg ata ata cga acg gtt ctg caa ctg cct tcc aag tca 966 Ser Tyr Phe Leu Ile Ile Arg Thr Val Leu Gln Leu Pro Ser Lys Ser 220 225 230 gag cgg gcc aag gcc ttt gga acc tgt gtg tca cac att ggt gtg gta 1014 Glu Arg Ala Lys Ala Phe Gly Thr Cys Val Ser His Ile Gly Val Val 235 240 245 ctc gcc ttc tat gtg cca ctt att ggc ctc tca gtt cgc ttt 1062 Leu Ala Phe Tyr Val Pro Leu Ile Gly Leu Ser Val Val His Arg Phe 250 255 260 gga aac agc ctt cat ccc att gtg cgt gtt gtc atg ggt gac atc tac 1110 Gly Asn Ser Leu His Pro Ile Val Arg Val Val Met Gly Asp Ile Tyr 265 270 275 ctg ctg ctg cct cct gtc atc aat ccc atc atc tat ggt gcc aaa acc 1158 Leu Leu Leu Pro Pro Val Ile Asn Pro Ile Ile Tyr Gly Ala Lys Thr 280 285 290 295 aaa cag atc aga a cgg gtg ctg gct atg ttc aag atc agc tgt gac 1206 Lys Gln Ile Arg Thr Arg Val Leu Ala Met Phe Lys Ile Ser Cys Asp 300 305 310 aag gac ttg cag gct gtg gga ggc aag tgacccttaa Cactacactp Leln Gly Gly Lys 315 320 ctccttatct ttattggctt gataaacata attatttcta acactagctt atttccagtt 1313 gcccataagc acatcagtac ttttctctgg ctggacatgt 1373 tacctaaagg actattatgt g433 <210> 2 <211> 320 <212> PRT <213> Homo Sapiens <400> 2 Met Ser Ser Cys Asn Phe Thr His Ala Thr Cys Val Leu Ile Gly Ile 1 5 10 15 Pro Gly Leu Glu Lys Ala His Phe Trp Val Gly Phe Pro Leu Leu Ser 20 25 30 Met Tyr Val Val Ala Met Cys Gly Asn Cys Ile Val Val Phe Ile Val 35 40 45 Arg Thr Glu Arg Ser Leu His Ala Pro Met Tyr Leu Phe Leu Cys Met 50 55 60 Leu Ala Ala Ile Asp Leu Ala Leu Ser Thr Ser Thr Met Pro Lys Ile 65 70 75 80 Leu Ala Leu Phe Trp Phe Asp Ser Arg Glu Ile Ser Ile Glu Ala Cys 85 90 95 Leu Thr Gln Met Phe Phe Ile His Ala Leu Ser Ala Ile Glu Ser Thr 100 105 110 Ile Leu Leu Ala Met Ala Phe Asp Arg Tyr Val Ala Ile Cys His Pro 115 120 125 Leu Arg His Ala Ala Val Leu Asn Asn Thr Val Thr Ala Gln Ile Gly 130 135 140 Ile Val Ala Val Val Arg Gly Ser Leu Phe Phe Phe Pro Leu Pro Leu 145 150 155 160 Leu Ile Lys Arg Leu Ala Phe Cys His Ser Asn Val Leu Ser His Ser 165 170 175 Tyr Cys Val His Gln Asp Val Met Lys Leu Ala Tyr Ala Asp Thr Leu 180 185 190 Pro Asn Val Val Tyr Gly Leu Thr Ala Ile Leu Leu Val Met Gly Val 195 200 205 Asp Val Met Ph e Ile Ser Leu Ser Tyr Phe Leu Ile Ile Arg Thr Val 210 215 220 Leu Gln Leu Pro Ser Lys Ser Glu Arg Ala Lys Ala Phe Gly Thr Cys 225 230 235 240 Val Ser His Ile Gly Val Val Leu Ala Phe Tyr Val Pro Leu Ile Gly 245 250 255 Leu Ser Val Val His Arg Phe Gly Asn Ser Leu His Pro Ile Val Arg 260 265 270 Val Val Met Gly Asp Ile Tyr Leu Leu Leu Pro Pro Val Ile Asn Pro 275 280 285 Ile Ile Tyr Gly Ala Lys Thr Lys Gln Ile Arg Thr Arg Val Leu Ala 290 295 300 Met Phe Lys Ile Ser Cys Asp Lys Asp Leu Gln Ala Val Gly Gly Lys 305 310 315 320 <210> 3 <211> 247 <212> PRT <213> Homo Sapiens <400> 3 Phe Leu Leu Leu Gly Leu Pro Ile Gln Pro Glu Gln Gln Asn Leu Cys 1 5 10 15 Tyr Ala Leu Phe Leu Ala Met Tyr Leu Thr Thr Leu Leu Gly Asn Leu 20 25 30 Leu Ile Ile Val Leu Ile Arg Leu Asp Ser His Leu His Thr Pro Met 35 40 45 Tyr Leu Phe Leu Ser Asn Leu Ser Phe Ser Asp Leu Cys Phe Ser Ser 50 55 60 Val Thr Ile Pro Lys Leu Leu Gln Asn Met Gln Asn Gln Asp Pro Ser 65 70 75 80 Ile Pro Tyr Ala Asp Cys Leu Thr Gln Met Tyr Phe Phe Leu Leu Phe 85 90 95 Gly Asp Leu Glu Ser Phe Leu Leu Val Ala Met Ala Tyr Asp Arg Tyr 100 105 110 Val Ala Ile Cys Phe Pro Leu His Tyr Thr Ala Ile Met Ser Pro Met 115 120 125 Leu Cys Leu Ala Leu Val Ala Leu Ser Trp Val Leu Thr Thr Phe His 130 135 140 Ala Met Leu His Thr Leu Leu Met Ala Arg Leu Cys Phe Cys Ala Asp 145 150 155 160 Asn Val Ile Pro His Phe Phe Cys Asp Met Ser Ala Leu Leu Lys Leu 165 170 175 Ala Phe Ser Asp Thr Arg Val Asn Glu Trp Val Ile Phe Ile Met Gly 180 185 190 Gly Leu Ile Leu Val Ile Pro Phe Leu Leu Ile Leu Gly Ser Tyr Ala 195 200 205 Arg Ile Val Se r Ser Ile Leu Lys Val Pro Ser Ser Lys Gly Ile Cys 210 215 220 Lys Ala Phe Ser Thr Cys Gly Ser His Leu Ser Val Val Ser Leu Phe 225 230 235 240 Tyr Gly Thr Val Ile Gly Leu 245 <210> 4 <211> 31 <212> DNA <213> Homo Sapiens <400> 4 cccctcctga attccagcaa tgagttcctg c 31 <210> 5 <211> 37 <212> DNA <213> Homo Sapiens <400> 5 gtgtctagat cacttgcctc ccacagcctg caagtcc 37 <210> 6 <211> 42 <212> DNA <213> Homo Sapiens <400> 6 gtcaccccgg gtcagttcca tcatgagttc ctgcaacttc ac 42 <210> 7 <211> 37 <212> DNA <213> Homo Sapiens <400> 7 gtgtctagat cacttgcctc ccacagcctg caagtcc 37 <210> 8 <211> 26 <212> PRT <213> Homo Sapiens <400> 8 Val Met Ala Met Met Tyr Thr Val Val Thr Pro Met Leu Asn Pro Phe 1 5 10 15 Ile Tyr Ser Leu Arg Asn Arg Asp Met Lys 20 25 The following drawings illustrate embodiments of the present invention. To do
And the scope of the invention covered by the claims
Not trying to limit.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 cD of the G-protein coupled receptor of the present invention
The NA sequence and the corresponding deduced amino acid sequence are shown. Standard single letter abbreviations for amino acids are used. FIG. 2 cD of G-protein coupled receptor of the present invention
The NA sequence and the corresponding deduced amino acid sequence are shown. Standard single letter abbreviations for amino acids are used. FIG. 3 cD of G-protein coupled receptor of the present invention
The NA sequence and the corresponding deduced amino acid sequence are shown. Standard single letter abbreviations for amino acids are used. FIG. 4 cD of G-protein coupled receptor of the present invention
The NA sequence and the corresponding deduced amino acid sequence are shown. Standard single letter abbreviations for amino acids are used. FIG. 5: Secondary structural features of G-protein coupled receptors. The first seven stages show regions of amino acid sequence such as α helix, β sheet, turn region or coil region. The box area is an area corresponding to the above area. In the figure, the second set shows the area of the amino acid sequence in the cell, in contact with the cytoplasm, or through the membrane. The part showing hydrophilicity shows the area of the protein sequence that is present in the lipid bilayer of the membrane and is therefore hydrophobic, as well as the area of the protein sequence that is hydrophilic and outside the lipid bilayer membrane. Since the antigen area is an area outside the lipid bilayer membrane and capable of binding to the antigen, the antigen index corresponds to the hydrophilicity plot. Furthermore, the surface probability plot corresponds to the antigen index and the hydrophilicity plot. The amphipathic plot shows 13 sequence regions that are polar and non-polar.
The flexible region corresponds to the second set in the sense that the flexible region is an extramembrane region and the inflexible region is a transmembrane region. FIG. 6: Secondary structural features of G-protein coupled receptors. The first seven stages show regions of amino acid sequence such as α helix, β sheet, turn region or coil region. The box area is an area corresponding to the above area. In the figure, the second set shows the area of the amino acid sequence in the cell, in contact with the cytoplasm, or through the membrane. The part showing hydrophilicity shows the area of the protein sequence that is present in the lipid bilayer of the membrane and is therefore hydrophobic, as well as the area of the protein sequence that is hydrophilic and outside the lipid bilayer membrane. Since the antigen area is an area outside the lipid bilayer membrane and capable of binding to the antigen, the antigen index corresponds to the hydrophilicity plot. Furthermore, the surface probability plot corresponds to the antigen index and the hydrophilicity plot. The amphipathic plot shows 13 sequence regions that are polar and non-polar.
The flexible region corresponds to the second set in the sense that the flexible region is an extramembrane region and the inflexible region is a transmembrane region. FIG. 7 is an amino acid alignment of the G-protein coupled receptor and human HGMPO71 olfactory receptor of the present invention. The erased area is an area that matches other amino acid sequences in the figure. FIG. 8 is an amino acid alignment of the G-protein coupled receptor and human HGMPO71 olfactory receptor of the present invention. The erased area is an area that matches other amino acid sequences in the figure. FIG. 9 is an amino acid alignment of the G-protein coupled receptor and human HGMPO71 olfactory receptor of the present invention. The erased area is an area that matches other amino acid sequences in the figure.

─────────────────────────────────────────────────── ─── Continued on the front page (51) Int.Cl. ⁷ Identification code FI Theme code (reference) A61K 48/00 A61P 3/04 4H045 A61P 1/04 7/10 3/04 9/02 7/10 9 / 04 9/02 9/10 9/04 9/12 9/10 11/06 9/12 13/08 11/06 19/10 13/08 25/14 19/10 25/16 25/14 25/18 25 / 16 25/24 25/18 25/28 25/24 37/08 25/28 43/00 111 37/08 C07K 14/705 43/00 111 C12P 21/02 C C07K 14/705 C12N 15/00 ZNAA C12P 21/02 A61K 37/02 (72) Inventor Daniel Earl Sopett United States 22020 Centerville, Virginia, Stillfield Place 15050 (72) Inventor Lee Li United States of America 20878 Maryland, Mary Zadersburg, Howard Landing Drive No. 16125 (72) Ig A Rosen United States 20882 Raytonsville, Maryland, Rolling Hill Road 22400 (72) Inventor Steven M. Ruben United States 20832 Orney, Maryland, Heritage Hills Drive 18528 F-term (reference) 4B024 AA01 AA12 BA63 CA04 DA02 EA02 EA04 GA11 HA12 HA17 4B064 AG20 CA10 CA19 CC24 CE13 DA05 DA14 4C084 AA02 AA03 AA07 AA13 AA17 BA35 BA44 MA17 MA59 MA63 MA66 NA14 ZA052 ZA12 ZA59 ZA182 422 ZC422 4C086 AA01 AA02 AA03 EA16 MA01 MA04 MA17 MA59 MA63 MA66 NA14 ZA05 ZA12 ZA15 ZA18 ZA22 ZA36 ZA37 ZA40 ZA42 ZA43 ZA59 ZA68 ZA81 ZA83 ZA97 ZB13 ZC41 ZC42 4C087 AA01 MA13 BC ZA42 ZA43 ZA59 ZA68 ZA81 ZA83 ZA97 ZB13 ZC41 ZC42 4H045 AA10 AA20 BA10 CA40 DA50 EA20 EA28 EA50 EA51 FA74 GA26

Claims (1)

[Claims] 1. Any of the inventions described herein.