JP2001017181A - GENE OF 38kDa PROTEIN EXPRESSED IN IRON-DEFICIENT BARLEY ROOT - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a new gene composed of a DNA coding for a protein derived from an iron-deficient barley root and having a specific amino acid sequence, participating in the iron absorption of gramineous plant and useful e.g. as an iron-absorption improving agent and a transcription controlling agent of a gramineous plant. SOLUTION: This new DNA codes for a 36kDa protein derived from an iron-deficient barley root and having an amino acid sequence of formula or a sequence of formula wherein a part of amino acids are deleted, added or substituted. The DNA participates in the iron-absorption of gramineous plant and is useful as an iron-absorption improving agent, transcription controlling agent, etc. of gramineous plant. The gene can be produced by sowing and culturing a barley seed by hydroponic culture under iron-deficient condition, extracting an mRNA from the obtained iron-deficient barley root, preparing a cDNA library by a conventional method using the mRNA, plating the library, amplifying by PCR and screening by colony hybridization method using the amplified partial gene as a probe.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to an agent for improving iron absorption of grasses consisting of a 36 kDa protein derived from iron-deficient barley root, a novel gene encoding the protein,
The present invention relates to a transcription regulator comprising the protein and a transcription regulator using a gene encoding the protein.

[0002]

BACKGROUND OF THE INVENTION Nearly 90% of the earth's soil is said to be bad soil with some problems. In general, poor soils are qualitatively or quantitatively devoid of elements essential for plant growth, thereby inhibiting plant growth, or causing growth failure due to soils rich in heavy metals and the like. A typical example of the poor soil is an arid-land salt accumulation soil. There are two types: NaCl and Na ₂ CO ₃ accumulated in the upper layer of soil and CaCO ₃ and CaSO ₄ accumulated in the upper layer of the soil due to artificial over-irrigation and long-term dry climate. Sodium-accumulated soil causes salt concentration damage, and calcareous soil causes iron deficiency damage.

[0003] About 30% of the arable soil on the earth is said to be a potential iron deficient zone (Wallence et al. 1960). In calcareous soils in semi-arid regions, calcareous components eluted from the base material due to capillary action accumulate on the ground surface. In such a soil, the pH increases and the soil becomes alkaline, so that iron in the soil becomes F
exists in the form of e (OH) ₃ and has very low solubility.
Due to the low soluble iron, plants grown in such soils become iron deficient chlorosis and growth is inhibited or withered.

[0004] The iron acquisition mechanism of higher plants is based on the strage-
I (Strategy-I) and Strategies-II (Strategy-II)
It is divided into two. Stratage-I is an iron acquisition mechanism of higher plants excluding Poaceae. This is a mechanism in which trivalent insoluble iron in soil is reduced by ferric iron reductase present on the cell surface of roots and absorbed by a ferrous iron transporter. Some plants having this mechanism release protons into the rhizosphere and have a mechanism to increase the activity of trivalent iron reductase by lowering the pH of the rhizosphere. There are those that release Fe into the sphere and have a mechanism in which the formed Fe (III) -phenolic compound chelate supplies Fe (III) to the trivalent iron reductase present on the cell membrane surface. In a recent study, a ferrous iron transporter IRT1 (Eide et a
l. (1996) Proc. Natl. Acad. Sci. USA 93: 5624-562
8) and an Arabidopsis trivalent iron reductase gene have been isolated (Robinson et al. 1997).

[0005] Stratage-II is an iron acquisition mechanism found only in grasses among monocots. Under iron deficiency conditions, grasses release mugineic acids having trivalent iron chelating activity into the rhizosphere and absorb iron from the roots as `` Fe (III) -mugineic acid '' complexes (Takagi et al. 1984). . Mugineic acids (MAs) include mugineic acid (MA), 2'-deoxymugineic acid (DMA), and 3-hydroxymugineic acid (HM).
A), 3-epihydroxymugineic acid (epiHMA),
Avenic acid (AVA), disticonic acid, and epihydroxydeoxymugineic acid (epiHDMA) are known, and mugineic acids (MAs) are all synthesized using methionine as a precursor as shown in FIG. 1 (Shojima et al.) a
l. 1990, Ma et al. 1998). A circadian rhythm exists in the secretion of mugineic acid (Takagi et al. (1984) J. Plant Nutrn
t., 7: 469-477), its secretion peaks after sunrise and no longer at night. In addition, granules that had swelled before secretion in iron-deficient barley roots were observed to shrink after secretion (Nishizawa et al. (1987) J. Plant Nutr.,
10: 1013-1020), it is believed that mugineic acid is synthesized in these granules. These results suggest that the iron deficiency response of grasses is established not only by mugineic acid synthesis, but also by a complex regulatory system such as transmission of iron deficiency signals and changes in root morphology.

[0006] As an enzyme involved in the mugineic acid synthesis pathway, a gene for nicotianamine synthase has been isolated and reported to be induced by iron deficiency (Higuchi et al. (1)
999) Plant Physiol. (In press)). Also, the gene for nicotianamine aminotransferase (NAAT) has been isolated,
It was induced by iron deficiency (Takahashi et al. 199
7). In addition, differential screening using mRNAs extracted from iron-deficient barley roots and control barley roots isolated genes Ids1 , Ids2 , and Ids3 that are specifically induced under iron-deficiency conditions.
Ids1 is a gene encoding a metallothionein-like protein (Okumura et al. 1991). Ids2 is
The amino acid sequence predicted from the gene sequence is a gene having homology to hydroxylase (Okumura et al. 199).
4), Ids3 was also a gene whose amino acid sequence predicted from its gene sequence had homology to hydroxylase (Nakanishi et al. 1993). There are two hydroxylation reactions in the epihydroxymugineic acid synthesis pathway, and it is thought that this gene encodes an enzyme that catalyzes this reaction.

[0007] Proteins induced by iron deficiency in barley root include Ids3 protein, adenine ribose phosphotransferase (Itai, 1999), formate dehydrogenase (Suzuki et al. 1998), and 36 kDa protein (Irifune, Master's thesis (1991)). Gramines biosynthesize mugineic acid under iron-deficient conditions.At this time, methionine contained in the roots is reduced, so that methionine is synthesized in the methionine cycle, and adenine is converted to AMP. It is thought that ribose phosphotransferase is induced (Itai, 199
9). Formate dehydrogenase degrades formate generated in the methionine cycle. In iron-deficient rice roots, mitochondrial morphological changes and a decrease in the energy charge of the electron transport system have been reported (Mori et al. 1991), and formate dehydrogenase is induced by anaerobic conditions caused by iron deficiency. It is considered that NADH is supplied as an energy source.

[0008] Among the proteins induced by iron deficiency in barley roots, the 36 kDa protein on two-dimensional electrophoresis has not been isolated from the amino acid fragment obtained and its function has not been specified. Did not. Then, it was thought that this protein might be involved in iron absorption in some form, but the present inventors tried various experiments to elucidate this function. Analysis at the protein level, mainly using western blotting analysis, isolation of the gene encoding this protein, and analysis at the genetic level were attempted.

[0009]

DISCLOSURE OF THE INVENTION The present invention provides a novel gene encoding a 36 kDa protein in barley root, and an agent for improving iron absorption of grasses comprising the protein. Furthermore, an object of the present invention is to isolate a gene encoding a 36 kDa protein in barley root, analyze at the genetic level, and clarify the function and usefulness of the protein.

[0010]

SUMMARY OF THE INVENTION The present invention relates to an agent for improving iron absorption of a Poaceae plant comprising a 36 kDa protein derived from an iron-deficient barley root. The 36 kDa protein of the present invention has the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence in which a part of the amino acids are deleted, added, or substituted, and has the above-described action. The present invention also relates to a novel gene encoding the above-mentioned protein. The present invention relates to an iron-deficient barley root-derived 36 kD having the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence in which a part of the nucleotides are deleted, added, or substituted.
a related to the DNA encoding the protein. D of the present invention
NA includes the genome, and examples of the genome include DNA having a base sequence described in SEQ ID NO: 3 or a base sequence in which some bases are deleted, added, or substituted.

[0011] The DNA of the present invention has a kerchi motif (Kelc motif).
h motif), and thus the present invention provides an amino acid sequence represented by SEQ ID NO: 1,
Or an iron-deficient barley root-derived 36 kD having an amino acid sequence in which some of the amino acids are deleted, added, or substituted
The present invention relates to a transcriptional regulator of a gene of a protein, which comprises a protein and is involved in iron absorption of a gramineous plant. The present invention also relates to a transcriptional regulator of a gene of a protein involved in iron absorption of a gramineous plant, comprising a DNA encoding the protein. Furthermore, the present invention relates to a plant, preferably a grass plant, into which a gene encoding the above 36 kDa protein or a gene encoding a protein having a function equivalent to the 36 kDa protein has been introduced.

The amount of 36 kDa protein, which is an active ingredient of the agent for improving iron absorption of grasses of the present invention, increases in barley roots treated with iron deficiency having a molecular weight of 36 kDa and an isoelectric point pI of 5.0 on two-dimensional electrophoresis. It has been found as a protein since the early days of mugineic acid research. However, the gene for this protein has not been isolated and the function of this protein has not been clarified. The present inventors have created antibodies specific to this protein, and by performing Western blotting analysis on plants grown under various cultivation conditions,
The function was clarified, and a novel partial amino acid fragment for isolating the gene of the 36 kDa protein was isolated. Using this fragment, the gene of the protein was cloned and its sequence was determined.

Barley was cultivated under iron deficiency conditions, and the desired 36 kDa protein was isolated from each root by two-dimensional electrophoresis. First, the iron deficiency-inducible 36k of the present invention
The conditions under which the Da protein was induced were detected by Western blotting. The items of the cultivation conditions of the plants to be analyzed are shown in (1) to (5) below.

(1) Gramineous plants (Hordeum vul
gare L. cv. Ehimehadaka no.1), rye (Secale c)
ereale L. cv. Imperial), wheat (Triticum aestivu)
m L. cv. Chinese spring, oats (Avena sativ)
a L. cv. Yakushin, corn (Zea mays L. cv.
Alice), Sorghum (Sorghum bicor L. Moench cv. Bi)
g Jim), rice (Oryza sativa L. cv. Koshihikari))
In iron deficiency conditions, control conditions in roots (only barley and rye include aboveground parts). (2) Changes with time due to iron deficiency treatment in barley roots. (3) Deficiency and excess conditions of barley trace elements (Fe, B, Cu, Mn, Zn). (4) Growth process from seedling of barley to 80 days after sowing. (5) dicotyledonous plant (tomato (Lycopersicon esculentum)
L. cv. Bonner Beste, tobacco (Nicotiana tabacum)
L. cv. Xanthi)) iron deficiency condition, control condition.

As a result, the following was found. (1) Gramineous plants under iron deficiency and control conditions In barley, the 36 kDa protein was strongly detected in the roots under the iron deficiency condition, and a trace amount was detected in the roots under the control condition. In the aerial part, no 36 kDa protein was detected in both iron deficiency and control conditions. The strong induction under iron deficiency conditions was consistent with the results of immigration (1991). However, the fact that it is expressed in a very small amount in barley under control conditions is a finding obtained for the first time this time. The fact that expression of this protein under control conditions is not artificial is described later in the results of the growth process from the seedling of barley to 80 days after sowing.

In the case of rye, no 36 kDa protein was detected in the above-ground part under both iron deficiency and control conditions, but was strongly detected in the roots under iron deficiency conditions. In the rye root under the control condition, this protein was detected more than in the barley. In the analysis using barley, wheat, oat, corn, sorghum, and rice roots, all plants were detected more strongly in iron deficiency condition than in control condition. Arranging these results in descending order of detection intensity, barley>rye>wheat>
Oats ≫ sorghum ≧ corn ≧ rice. One characteristic of the band detected in corn was that the molecular weight was lower than that of other grasses. It is known that the amount of mugineic acid secreted by grasses increases in the order of barley>oats>wheat>rye>corn>sorghum> rice (Marschner et al. 1).
986; Rheld et al. 1991). It is also known that the rate of increase and maintenance of mugineic acid secretion after iron deficiency treatment varies among varieties (Mori et al. 1991). It is considered that there is a high correlation between the detected amount of this protein and the amount of mugineic acid secreted. Therefore, it is considered that this protein is involved in mugineic acid synthesis.

(2) Temporal change in barley during iron deficiency treatment The 36 kDa protein was gradually induced from the 3rd day after the iron deficiency treatment and was detected as a strong band from the 5th day.
From the second day after the iron re-administration, the protein amount was gradually decreased, and returned to the same level as before the iron deficiency treatment on the seventh day after the iron re-administration. The secretion of mugineic acid in barley gradually increases after iron deficiency treatment and peaks at around day 12 to 15 (Mori et al. 1991). In this experiment, although the experiment was performed only until the 7th day of iron deficiency treatment, it can be said that the manner of inducing this protein is parallel to the increase in the amount of mugineic acid secreted in barley. However, 36kD after iron administration
The tendency of the decrease in a protein was different from the decrease in the enzymatic activities of nicotianamine synthase and nicotianamine aminotransferase, which are enzymes of the mugineic acid synthesis system.
The enzyme activities of nicotianamine synthase and nicotianamine aminotransferase were 1 /
6, 1/4 (Kanazawa et al. 199
5) It can be said that the 36-kDa protein shows a more gradual decrease in protein after iron re-administration than these enzymes.
This may be due to the stability of this protein in the plant, or the transcription of the 36 kDa protein gene may be regulated differently from the transcription of the mugineate synthase gene. It may be because there is.

(3) Trace elements of barley (Fe, B, C)
u, Mn, Zn) deficiency, overtreatment The detected amount of the 36 kDa protein is (−) Fe≫ (−) Zn> (++) B> (++) Mn ≧
The order was (−) Cu> (−) B. Characteristically, it was strongly induced under iron deficiency conditions, and the difference was very large even when compared to zinc deficiency, which was more frequently induced. After boron excess, the amount of induced protein was minimal compared to iron deficiency. Since the amount of protein detected in iron deficiency is much higher than in other trace element stresses, this protein is considered to be iron deficiency-inducing. Gramineous plants become deficient in iron because zinc is deficient in migrating iron in the plant and secrete mugineic acid (Walter et al. 1994). Extreme zinc deficiency causes weak chlorosis. It is considered that in plants, zinc deficiency caused secondary weak iron deficiency, which led to the detection of this protein. There is also a report that mugineic acid is secreted in copper deficiency (Gries et al. 1998). It is known that excess manganese generally leads to endogenous iron deficiency in plants (Marschner. 1995). Iron deficiency and excess boron
At this time, it is not possible to imply that this protein was detected, as no findings linking the deficiency are currently available.

(4) Growth process from seedling of barley up to 80 days after sowing No 36 kDa protein was detected from seeds before sowing. A very small amount of this protein was detected on the fourth day after seeding, and the amount of this protein increased in small amounts until 30 days after the seeding. The seedlings from the 4th to 30th days after sowing have the highest growth rate in the growth process of barley. Therefore, it was thought that the endogenous weak iron deficiency occurred in the living body at this time because the supply amount could not keep up with the required amount of iron in the plant. In barley, 3
The fact that a trace amount of the 6 kDa protein was constantly observed means that a trace amount of mugineic acid was constantly secreted (Takagi
et al. 1984). In the root of the rye control condition, a 36 kDa protein was detected more than in the barley control condition. In rye root, this protein may have a gene that is constantly expressed.

(5) In tomato and tobacco under iron-deficient conditions and control conditions, this protein was detected in iron-deficient roots, but in a trace amount compared to the barley band. In addition, it was not detected in the root of the tobacco control condition and in the aerial part of the control condition and iron deficiency condition. In tomato, this protein was not detected in the roots and above-ground parts under the control condition, iron deficiency condition. Strategy-I
This protein was detected in the roots of iron-deficient conditions in tobacco having an iron-acquisition mechanism. Is done. The lack of detection in the iron-deficient roots of tomato may be because the antibodies against barley proteins used in this study could not be detected due to their low homology to proteins having similar functions in dicotyledonous plants.

From the above results, it was also considered that the 36 kDa protein has a function of a regulator of genes of enzymes involved in mugineic acid synthesis. In dicot tobacco that does not produce mugineic acids, a protein recognized by the antibody was induced in iron-deficient roots, and five homologous clones of barley 36 kDa protein were also found in Arabidopsis thaliana (FIG. 4). This also suggests that the 36 kDa protein has the same function in plants having different iron acquisition mechanisms (Strategy-I, Strategy-II). The idea of a protein regulator of iron-related proteins is consistent with this phenomenon. However, as will be described later, a known “nuclear translocation signal sequence” was not recognized in the amino acid sequence predicted from the cDNA clone obtained this time, but rather a translocation signal to the microbody was found (FIG. 2). The question is whether this cDNA clone is full length or not.

From the analysis result at the protein level, 36 k
Da protein was found to be particularly strongly induced by iron deficiency in grasses. It is expected that this protein is deeply involved in the mechanism of iron acquisition via mugineic acid in grasses. To elucidate the function of the 36 kDa protein at the gene level, we attempted to clone the gene. A degenerate primer was prepared based on the obtained partial amino acid sequence, and PCR was performed using barley cDNA as a template. Screening was performed by colony hybridization using the obtained PCR product as a probe.

The reason that the gene of the 36 kDa protein has not been isolated so far is that the obtained partial amino acid sequence was too short to produce a highly specific degenerate primer. Since the currently obtained partial amino acid sequence has been obtained by V8 protease treatment, this time it was decided to treat it with lysyl endopeptidase to obtain an amino acid fragment. Proteins were extracted from iron-deficient barley roots, spots were cut out from the two-dimensional electrophoresed gel, and purified. It was digested with lysyl endopeptidase and the partial amino acid fragment was isolated. The amino acid sequence of this fragment was determined using an amino acid sequencer. The partial amino acid sequence obtained this time is as shown below. DHTELNELYSFDDATAS (X) W (X) L This amino acid sequence is 7 amino acids from the previously obtained amino acid sequence.
The sequence was longer by amino acid residues. None of these sequences matched the sequences of the known mugineic acid biosynthesis enzymes, S-adenosylmethionine synthase, nicotianamine synthase, and nicotianamine aminotransferase (Takizawa et al.) . 1996; Higuchi et
al. 1999; Takahashi et al. 1997).

The degenerate primer 5'-AAYGARYTNTAYWSNTTYGAYA was derived from the nucleotide sequence deduced from DHTELNELYSFDSTATS (X) W (X) L, which is a partial amino acid sequence obtained by digesting the 36 kDa protein with lysyl endopeptase.
CATCG-3 '(primer A) and 5'-GAYC
AYCNGARYTNAAYGARYT-3 ′ (primer B) was prepared. CDNA from iron-deficient barley root
Gene A was used under the following reaction conditions using an adapter primer, primers A and B using the library as a template.
mp PCR System 9600 (PERKIN
ELMER).

As a result of the PCR, a fragment of about 200 bp was obtained (portion indicated by an arrow marked with * in FIG. 2). This PCR product was ligated into the pT7blue vector. The transformed E. coli was transformed into an LB liquid medium [ampicillin (1 μm).
g / mL) and tetracycline (1 μg / mL) at 37 ° C. overnight, and the plasmid was prepared by the alkali / SDS method. This is treated with a restriction enzyme to give 300
Plasmid DNA containing the bp insert was sequenced. On the other hand, a plasmid having a PCR product as an insert was digested with EcoRI and HindIII, and the obtained supernatant was used as a probe template to prepare a Random Prime.
r DNA Labeling Kit Ver. 2.
0 (TaKaRa) was used to prepare a probe.

The cDNA library was plated and screened by the colony hybridization method to obtain a positive clone. The obtained clone was found to be a cDNA encoding a 36 kDa protein. Using this cDNA, Northern protein analysis and genomic Southern analysis were used to analyze this protein at the gene level.

The obtained plasmid was a cDNA clone of the 36 kDa protein. Figure 2 shows the determined sequence.
It was shown to. The nucleotide sequence is shown in SEQ ID NO: 2, and the amino acid sequence is shown in SEQ ID NO: 1. This clone has a total length of 1312b
p had an open reading frame corresponding to a 34 kDa protein consisting of 327 amino acids. According to a database search, rice having homology to the gene sequence of this 36 kDa protein was 3 in rice.
Since it was found that two EST clones existed, it was considered that this gene formed a gene family. These gene families and their homology are shown in FIG.

There were five Arabidopsis thaliana homologues to the amino acid sequence predicted from the cDNA clone of the 36 kDa protein. FIG. 4 shows the amino acid sequence of the homologous clone of Arabidopsis thaliana. This was considered to be a result indirectly supporting that the 36 kDa protein was detected in the iron-deficient root of tobacco, which is a dicotyledon, in Western blotting. One of five Arabidopsis homologous clones was present on chromosome 2 and three were clustered on chromosome 3. The sequences on the chromosomes of Arabidopsis have been revealed by the Genome Project, and it is unknown whether they are all expressed. Another is cDN
A clone of unknown function (AT-S3346)
In 4), it was different from that of chromosomes 2 and 3. An amino acid sequence predicted from the nucleotide sequence of Arabidopsis,
The amino acid sequence predicted from the cDNA clone of the 36 kDa protein contained a conserved region (see FIG. 4). All four regions of the region where 'FGG' was present in the amino acid sequence were conserved, and eight of the nine 'W's were conserved. Computer retrieval of the localization potential of the 36 kDa protein predicted a 75% microbody potential (PSORT, http://www.im
cb.osaka-u.ac.jp/nakai/from.html).

[0029] The decrease in the 36 kDa protein when iron is re-administered to iron-deficient barley tends to decrease the enzyme activities of nicotianamine synthase and nicotianamine aminotransferase involved in mugineate synthesis (Higuchi et al. 1
996, Kanazawa et al. 1998). Computerized prediction of the intracellular localization of the 36 kDa protein from the amino acid sequence predicted from the isolated cDNA clone was a microbody with a high score. This was thought to be because the amino acid sequence had a transition sequence 'ARL' to the microbody. In addition, two homologous clones of Arabidopsis thaliana also had a transfer sequence 'ARL' to the microbody (FIG. 4).
reference).

As shown in FIG. 4, the amino acid sequence of this protein has four 'FGG' (green) and eight 'W'
(Red). In particular, 9 per protein molecule
It seems that there are some positive meanings in the fact that eight of the only one 'W's are preserved. 'W' and 'FGG' are repeated four times at regular intervals. Here, it is called a “W-FGG-W” repeating sequence for convenience. A protein having such a sequence is DN
It is often related to the transcriptional control of A and the stability of RNA. According to a computer search, a protein having a 'W-FGG-W' repeating sequence at least partially
In addition to the Arabidopsis thaliana sequences listed above, human p40 protein and host cell factor C1
(HFC1)), actin-fragmin kinas of Physarum polycephalum
e) Tea of fission yeast (Schizosaccharomyces pombe)
1p protein, ral2 protein, budding yeast (Sacc
Numerous sequences are found, such as the YHR158c protein of S. haromyces cerevisiae). The 'W-FGG-W' repeat sequence found in these proteins is shown in FIG. Those conserved in 17 or more of the 33 sequences shown in FIG. 5 were regarded as consensus. 'W-FGG-W' is very well conserved in both sequences,
In addition, there are some well-conserved amino acid residues (G, P, R, H, Y, V, D).

From 'W' to 'W', 50 to 7
It is constant at 0 amino acids. This strongly suggests that the 36 kDa protein is a protein (factor) related to regulation of gene expression of iron deficiency-related proteins in some sense. Unfortunately, in plants, "F" of microorganisms related to enzymes related to iron nutrition is still present.
ur protein "and animal" cis-aconit "
Transcription factors such as "ase" have not been cloned. Therefore, if this is a gene involved in the regulation of iron, it is the first in the plant kingdom. In microorganisms and animals, “iron-responsive cis sequences” of protein genes induced by iron deficiency (and iron excess) that interact with these transcription factors have been identified.

At present, nicotianamine aminotransferase,
We have succeeded in cloning the genome of the gene for an enzyme on the mugineic acid synthesis pathway called nicotianamine synthase. We have also cloned the gene for IDS3 (probably mugine synthase or deoxymugine hydroxylase), which is the most responsive to iron among the iron deficiency-inducible genes. Was. Therefore, by using these three genomic genes to examine the interaction with the 36 kDa protein in an in vitro system, the properties as a transcription factor could be determined. Furthermore, if this protein is a regulator, the “iron deficiency responsive cis sequence” present at the promoter sites of the above three genes will also be revealed.

At present, among the spots whose induction was confirmed by iron deficiency on two-dimensional electrophoresis, four of them have genes isolated. In addition to this 36 kDa protein, there are three other proteins: adenine ribose phosphotransferase (APRT), formate dehydrogenase (FDH), and IDS3 protein. APRT is a "methionine cycle (Yang
Adenine released from "cycle)" is recovered and regenerated as AMP. It is considered that this AMP is regenerated by ATP and enters the methionine cycle again.
FDH decomposes formic acid generated by the methionine cycle to detoxify it to produce NADH. In addition, iron-deficient roots are in an anaerobic condition in which oxygen cannot be used because heme is not synthesized despite the presence of oxygen (iron is required for synthesis of the porphyrin ring). As a result, mitochondria are deformed and their energy charge is reduced (Mori et al. 1991). FDH is thought to be induced by anaerobic conditions caused by iron deficiency and supply NADH as an energy source. As described above, a protein that is induced by iron deficiency on two-dimensional electrophoresis is involved in a mechanism for protecting plants from iron deficiency stress indirectly without directly synthesizing mugineic acid.
The 36 kDa protein of the present invention may also be a protein that plays a role in avoiding iron deficiency stress in plants.

[0034] It was confirmed that the amino acid sequence contained an ARL transfer sequence to the microbody. Two of the five homologous clones of Arabidopsis thaliana also had a microbody transition sequence 'ARL'. The cDNA clone obtained this time contains the amino acid sequence 'VTIN determined using V8 protease.
Q 'was not present.

Next, Northern hybridization analysis using this cDNA was performed. This gene was strongly expressed under iron deficiency conditions. It was weakly expressed in the control. In the above-ground part, no expression was obtained. In Western blotting analysis, it is considered that this protein is strong in the roots of barleys deficient in iron and that this protein was detected in trace amounts in the roots of barleys under control conditions. From this result, 36 kD
It was considered that the promoter of the gene encoding the a protein had a site controlled by iron deficiency.

In order to analyze the genome of this gene, genomic Southern hybridization analysis was performed.
FIG. 6 shows the results. EcoRI, Ba for barley genome
mHI and HindIII were each cut and 1.3 kbp
Was used as a probe. Among the restriction enzyme treatments used this time, c encoding 36 kDa protein
Those having a cleavage site on the sequence of the DNA clone are Ba
There is only one mHI. In this result, EcoR
Two signals were confirmed in the I treatment, three in BamHI, and two in HindIII. This suggested that at least two genes encoding the 36 kDa protein were present on the barley genome. Considering the results of Western analysis and Northern analysis, one of them is weak but constantly expressed and contributes to the stable supply of iron, and the other is iron-deficient and rapidly It was thought to be involved in the acquisition. FIG. 11 shows the expected secondary structure of the 36 kDa protein of the present invention.

Next, the genome was isolated. First, the genomic library was plated and screened by a plaque hybridization method according to the above-described method, and phage DNA of a positive clone was extracted. From the obtained positive clone, λ
DNA was purified. ΛD obtained by screening
NA is restricted by restriction enzymes SalI, NotI, EcoRI, Ba
Treatment with mHI generated a restriction map. 36kD
FIG. 7 shows a restriction map of a barley genomic clone encoding the a protein. In FIG. 7, black portions indicate coding regions, B is BamHI, and S is Sal.
I is shown. The barley genomic clone encoding the 36 kDa protein isolated this time has a total length of 14.6.
It was a kbp clone (FIGS. 8 and 9). The nucleotide sequence of this genome is shown in SEQ ID NO: 3. This gene is Id
Named s6 . The cDNA clone of the 36 kDa protein was found to be all present in the 2 kbp fragment of SalI. The 3 kbp fragment of BamHI is 36 kD
Includes a part of cDNA clone of a protein and its upstream.

The 36 kDa protein of the present invention has an amino acid sequence represented by SEQ ID NO: 1 and, for example, one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 1. Those having the following amino acid sequence. The protein may be modified to such an extent that its activity is not lost by deletion, substitution or addition of amino acids. Such a protein is usually composed of the amino acid sequence shown in SEQ ID NO: 1 and
It may have an amino acid sequence homology of 75%, preferably ９０90%.

The gene of the present invention may be a gene having the nucleotide sequence of SEQ ID NO: 2 or 3, or a gene having a complementary nucleotide sequence, or a gene capable of hybridizing thereto under stringent conditions or its complement. Those having a specific base sequence are also included. Nucleotides having such a base sequence (oligonucleotides or polynucleotides) can be used as probes for detecting the gene of the present invention, and in order to modulate the expression of the protein of the present invention, for example, antisense oligonucleotides, And ribozymes and decoys. Such nucleotides include, for example,
Normally, a contiguous 1 in the base sequence represented by SEQ ID NO: 2
A nucleotide containing a partial sequence of 4 or more bases or a complementary sequence thereof can be used. To make hybridization more specific, a longer sequence as a partial sequence, for example, a sequence of 20 or more bases or 30 or more bases May be used.

In the present invention, hybridization under stringent conditions is usually carried out in a hybridization solution having a salt concentration of 5 × SSC or an equivalent thereof at a temperature of 37 to 42 ° C. This can be carried out by performing pre-washing for 12 hours with 5 × SSC or a solution having a salt concentration equivalent thereto and then washing with 1 × SSC or a salt concentration equivalent thereto. In order to obtain higher stringency, washing can be performed by washing in 0.1 × SSC or a solution having a salt concentration equivalent thereto. The nucleic acids that can hybridize under stringent conditions in the present invention include those that can hybridize under the conditions described above.

As the cDNA encoding the 36 kDa protein of the present invention, for example, a cDNA having the nucleotide sequence shown in SEQ ID NO: 2 can be used, and it is not limited to the above-mentioned cDNA, but may correspond to an amino acid sequence. Designing DNA and encoding a polypeptide
A can also be used. In this case, codons encoding one amino acid are each known in 1 to 6 types, and the codon to be used may be selected arbitrarily. The sequence can be designed. DN with designed base sequence
A is chemical synthesis of DNA, fragmentation and binding of the cDNA,
It can be obtained by partially modifying the nucleotide sequence. Partial alteration or mutation of an artificial base sequence is performed by using site-specific mutagenesis (Mar) using a primer composed of a synthetic oligonucleotide encoding a desired modification.
k, DF et al., Proc Natl Acad Sci USA Vol. 18, 5662-5666
Page, 1984 ".

In addition, using a synthetic primer designed based on the information of the disclosed nucleotide sequence of the gene of the present invention (the nucleotide sequence shown in SEQ ID NO: 2 or 3 or a part thereof), ordinary PCR is performed. The gene can be isolated from the cDNA library by the method. DNA libraries such as cDNA libraries and genomic DNA libraries are described, for example, in "Molecular Cloning; Sambrook, J., Fr.
itsh, EF and Maniatis, T., Cold Spring Harbor L
aboratory Press, published in 1989 ”. Alternatively, if there is a commercially available library, this may be used.

The 36 kDa protein of the present invention can be produced by, for example, a gene recombination technique using cDNA encoding the protein. For example,
DNA encoding a 36 kDa protein (cDNA
) Into an appropriate expression vector, and the resulting recombinant DNA can be introduced into an appropriate host cell. Expression system for producing polypeptide (host vector system)
Examples thereof include an expression system for plant cells such as bacteria, yeast, and grasses, and animal cells, and the like. Among them, it is desirable to use plant cells in order to obtain a functional protein.

The antibody can be obtained by using the 36 kDa protein of the present invention or a polypeptide having immunological equivalence to the protein. The obtained antibody can be used for detection and purification of the 36 kDa protein of the present invention. The antibody is a 36 kDa protein of the present invention,
It can be produced using a fragment thereof, a synthetic peptide having a partial sequence thereof, or the like as an antigen. The polyclonal antibody can be produced by a usual method of inoculating a host animal (for example, rat or rabbit) with an antigen and collecting an immune serum, and the monoclonal antibody can be produced by a conventional technique such as a hybridoma method.

The gene of the present invention can be introduced into other living organisms. As described above, the 36 kDa of the present invention
Since the protein may have an effect of enhancing iron absorption in an iron deficiency state, by introducing a gene capable of expressing a 36 kDa protein or a protein having the same type of activity, iron deficiency resistance can be reduced. Can be granted. The gene to be introduced may be a cDNA or a genome. Various methods such as a method using a virus and a method using a bacterium can be adopted as the introduction method. The promoter is not particularly limited as long as it can express the target protein, and a 35S promoter or the like can be used. As the living organism to be introduced, a plant, particularly a grass plant is preferable. Therefore, the present invention relates to an iron deficiency-tolerant gramineous plant into which a gene capable of expressing a 36 kDa protein or a protein having the same type of activity has been introduced. The present invention further relates to a crop grown from the transgenic plant.

[0046]

Next, the present invention will be described with reference to specific examples, but the present invention is not limited to these specific examples.

Example 1 (cultivation of iron-deficient barley and control barley) Barley (Hordeum vulgare L. cv. Ehimehadaka no.1)
Were seeded on a paper towel moistened with distilled water and allowed to germinate in the dark at room temperature. The seedlings three days after sowing were transplanted onto a vinyl net, and raised in the following hydroponic solution adjusted to pH 5.5 while constantly feeding air with an air pump.

<Hydroponic liquid composition> N: 40 ppm Ca (NO ₃ ) ₂ .4H ₂ O P: 20 ppm KH ₂ PO ₄ K: 40 ppm KH ₂ PO ₄ -K; 27 ppm, KCl-K; 13 ppm Ca: 40 ppm Ca _{(NO 3) 2 · 4H 2} O Mg: 40ppm MgSO 4 · 7H 2 O B: 0.4ppm H 3 BO 3 Mn: 0.04ppm MnCl 2 · 4H 2 O Mo: 0.04ppm (NH 4) 6 Mo 7 _{O 24 Zn: 0.04ppm ZnSO 4 ·} 7H 2 O Cu: 0.02ppm CuSO 4 · 5H 2 O Fe: 0.05ppm EDTA · Fe (III) in the case of iron deficiency treated section hydroponic solution, Fe is 0pp
m.

Cultivation is performed under light conditions of 19 ° C. for 14 hours and under dark conditions 1
The test was performed in an artificial weather machine set at 5 ° C./10 hours. On the third day after transplantation, the plants were planted in a culture tank containing a hydroponic solution adjusted to pH 5.5. One week after planting, iron-free pH7.
An iron deficiency condition group adjusted to 5 and a control condition group grown in a normal hydroponic solution were set. On the 36th day after seeding (after confirming that chlorosis became remarkable in the iron-deficient treatment group), the cells were harvested as samples and stored at -80 ° C. Except during iron deficiency treatment, the period from vinyl net cultivation to harvest,
The pH of the hydroponic solution is adjusted once daily to pH 5.0 to 5.5 with 1N H
Adjusted with Cl and added fertilizer liquid as needed for the nutrients consumed.

Example 2 (Extraction of protein) 50 g of barley root was extracted from a sample extract (100 mM Tris-HCl).
 (pH 8.6), 5mM MgCl ₂, 5 mM KCl, 1 mM EDTA, 0.1% (v /
v) β-mercaptoethanol, 5% (w / v) polyvinyl alcohol
Lolidone, 2.7μM leupeptin)
Crushed with a juicer mixer for 1 minute. With cheesecloth
After filtration, the mixture was centrifuged at 3000 g for 30 minutes at 4 ° C. Up
Transfer the supernatant to another tube and add an equal volume of 20% trichloroacetic acid.
And centrifuged at 3000g for 30 minutes at 4 ° C.
did. Mortar and pestle in acetone stored precipitate at -20 ° C
And centrifuged at 3000 g for 30 minutes at 4 ° C. Settling
Was dried by centrifugation under reduced pressure to obtain 400 mg of powder.
Add this to the sample buffer (9M urea, 2% Triton X-10)
0,5% β-mercaptoethanol)
Used for two-dimensional electrophoresis. Extract the protein extract
Mercy Villiant Blue R-250 (Coomassie Br
Bradford (Brad using illiant Blue R-250)
ford) method and calculate the concentration from the absorbance at 595nm
did.

Example 3 (two-dimensional electrophoresis) The two-dimensional electrophoresis was performed by partially modifying the method of O'Farrell (1975). In the first dimension electrophoresis gel, 2.5 g of urea, acrylamide mi
x A (30% (w / v) acrylamide, 5.4% (w / v) N, N'-methyle
nebisacrylamide), 10% (w / v) Triton X-100 1000μ
L, Ampholine (pH 5.0-8.0) 200 μL, Ampholine (pH
3.5 ~ 10.0) 50μL, 10% ammonium persulfate 5μ
L, TEMED 3.5 μL, 670 μL, and 980 μL of distilled water)
Filled to 0 mm and made. 10 mM H ₃ P in the upper electrode solution
Using O ₄ and 20 mM NaOH as the lower electrode solution, an extract having a protein amount of 300 μg was loaded on the gel, and electrophoresed at 400 V for 15 hours and at 800 V for 1 hour.
The gel after the electrophoresis was subjected to SDS-PAGE sample buffer (10% (w / v) glycerol, 5% (v / v) β-mercaptoethano).
l, 2.3% (w / v) SDS, 62.5 mM Tris-HCl (pH 6.8)) and shaken for 30 minutes. The second dimension electrophoresis gel is a stacking gel (tacking gel buffer (0.5 M Tr
is-HCl (pH 6.8), 0.4% SDS) 7.5 mL, acrylamide mi
x B (30% (w / v) acrylamide, 2.6% (w / v) N, N'-methylen
ebisacrylamide) 4.5 mL, distilled water 18 mL, 10% ammonium persulfate 120 μL, TEMED 120 μL) 138 × 15
× 1.0mm running gel 138 × 110 × 1.0
mm (running gel buffer (5mM Tris base, 192m
M glycine, 0.1% SDS) 27mL, acrylamide mix B (30%
(w / v) acrylamide, 2.6% (w / v) N, N'-methylenebisacr
ylamide) 45mL, distilled water 36mL, 10% ammonium persulfate
Prepare 450 μL, TEMED 72 μL, and use running buffer (25 mM Tris base, 192
mM glycine, 0.1% SDS). 3 per gel
After electrophoresis at a constant current of 0 mA, the gel was washed with CBB staining solution (0.
25% Coomassie Brilliant Blue R-250, 2.5% methano
l, 7.5% acetic acid) overnight, and destain (25% methano
1, 7.5% acetic acid).

Example 4 (Purification of 36 kDa protein) A spot of 36 kDa protein was cut out from 400 two-dimensional electrophoresis gels, washed twice with 50 mL of distilled water for 5 minutes, and added to a 15 mL running buffer.
After soaking for 0 minutes, the protein was electrophoresed at 200 V for 2.5 hours. Symless cellulose tubing (seam
dialysis in distilled water at 4 ° C. for 72 hours with less cellulose tubing (Sankyojunyaku). The dialysate was centrifuged under reduced pressure to dry the protein. Purification degree is SDS-P
AGE confirmed.

Example 5 (Western blotting analysis) Using the purified 36 kDa protein obtained in Example 4 described above, Western blotting analysis was performed in the following procedure. Protein electrophoresis was performed by SDS-PA
Performed by GE electrophoresis and loaded with 20 μg of protein per lane. The membrane includes a PVDF membrane (Immo
bilon-PSQ transfer Membranes, Millipore)
Transfer was performed by the semi-dry method and detected by the DAB method. Transfer buffer (20 mM glycine, 25 mM Tris, 20% metha
The membrane and the gel were superimposed on the filter paper soaked in nol), and the transfer condition was 50 mA per gel for 1 hour. After the transfer is completed, the membrane is washed with distilled water, and Ponceau S staining solution (3% trichloroacetic acid, 3% (w / v) sulfosalicylic acid, 1%
(w / v) Ponceau S) for 1 minute and washed with distilled water.
Tween-PBS (1.3 M NaCl, 2.7 mM KCl, 8.1 mM
Na ₂ HPO ₄ , 1.5 mM KH ₂ PO ₄ , 1% (w / v) Tween 20)
Washing 3 times for 3 minutes, blocking solution (Tween-PBS 200
It was dissolved NaN ₃ 40 mg of gelatin 2 g in mL. ) For 1 hour. After washing with Tween-PBS, the primary antibody 3
10 mL of a 10,000-fold diluted solution was added, and the mixture was allowed to stand for 1 hour.
Washing was performed three times for 10 minutes with Tween-PBS, 10 mL of a 5,000-fold diluted solution of the secondary antibody was added, and the mixture was allowed to stand for 1 hour. Washing was performed 3 times for 10 minutes with Tween-PBS.
AB reaction (50 mMTris-HCl (pH 7. 4), 0.2% (w / v) 3,
3'-diaminobenzidine) 7.5 μL of 30% in 50 mL
H ₂ O ₂ was added to soak the membrane. After coloring, it was washed with distilled water and dried.

The method of preparing the samples used for the Western blotting analysis is described below. (1) Gramineous plant under iron deficiency condition and control condition
Cultivated in a hydroponic solution composition of The changed points are the time when the iron deficiency treatment was started and the light / dark / temperature conditions during cultivation. Barley, rye, oats,
Wheat and rice were observed at the third leaf, corn at the fifth leaf, and sorghum at the sixth leaf. Two weeks after the iron deficiency treatment, harvested samples were taken. The conditions of light and darkness and temperature of barley, rye, and wheat are the same as those in Example 1, and rice,
Sorghum, corn and oats are light conditions 27 ° C /
For 14 hours, dark conditions were set at 22 ° C./10 hours, and rye and barley were used as roots and leaves, and the others were used only as roots. All the grasses could not be grown at once due to the cultivation area. For this reason, they were grown with a combination of barley and rye, barley and other grasses.

(2) Changes with time in iron deficiency treatment of barley The cultivation method was the same as in Example 1, and the changes with time in iron deficiency treatment were created by shifting the harvest time. First, the day before transfer to the iron deficiency treatment pot was designated as iron deficiency treatment day 0, and the day after the iron deficiency treatment was performed on the same day was designated as iron deficiency treatment day 1. Those which passed 3, 5 and 7 days after the treatment were similarly harvested. An iron-deficient plant transferred to a pot under control conditions was designated as day 0 of iron re-administration. The next day's harvest was taken as 2, 3, 4, 4
Samples were harvested on days 5, 7, 11, and 14. The samples were roots only and no aerial parts were used.

(3) Trace elements of barley (Fe, B, Cu, M
n, Zn) deficiency, excess treatment As a test group, iron deficiency (-Fe), boron excess (++
B), boron deficiency (-B), copper excess (++ Cu), copper deficiency (-Cu), manganese excess (++ Mn), manganese deficiency (-Mn), zinc excess (++ Zn), zinc deficiency (-Z)
n) A treatment section was set. The cultivation method is the same as in Example 1. Regarding the composition of the hydroponic solution in the deficient section, each element was completely removed from the hydroponic solution under the control condition. In the excess section, each trace element was converted to excess boron (100 pp).
m), excess copper (1 ppm), excess manganese (2 pp)
m), zinc excess (50 ppm) (Okumura et.
al. 1994). Only the roots harvested 30 days after the excess / deficiency treatment were used as samples.

(4) Growth process from seedling of barley up to 80 days after sowing The cultivation method is the same as that in the control condition of Example 1. Harvesting was performed with the seeds before sowing as 0 days,
On the 7, 9, 12, 20, 30, 40, and 80 days, those were harvested and used as samples. The iron deficiency condition group was treated with iron deficiency on the 19th day after sowing, and harvested on the 80th day after sowing and used as a sample. On the day 0, the seeds were
After that, only the roots were used.

(5) Tomato and tobacco under control condition and iron deficiency condition Tomato and tobacco seeds were sown on a paper towel moistened with distilled water and allowed to germinate at room temperature in a dark condition. Five days after seeding, the seedlings were transplanted to vermiculite. When the height of the plant is about 5 cm, plant it in a pot of hydroponic solution,
They were raised under control and iron deficiency conditions. The hydroponic solution composition was the same as in Example 1, and was obtained under the light conditions of 27 ° C. for 14 hours.
The test was performed in the dark at 22 ° C. for 10 hours. Two weeks after the treatment, it was harvested and used as a sample.

Example 6 (Preparation of Antibody) A rabbit was immunized with 500 μg (dry weight) of the obtained protein every two weeks. A complete emulsion state up to the second time, an incomplete emulsion state from the third time on, a total of 1
It was administered 0 times. This antiserum was used as a primary antibody, and a goat anti-rabbit IgG (H + L) was used as a secondary antibody. For western blotting, the primary antibody should be 30,000
The secondary antibody was diluted 5,000 times with Tween-PBS and used.

Example 7 (Fragmentation of 36 kDa protein using lysyl endopeptidase and determination of amino acid sequence) The procedure was performed according to the method of Kawasaki et al. (1990). 100
50 μL of lysyl endopeptidase solution (2 mM Tris-HCl (pH 8.0) 50 μL)
L, lysyl endopeptidase (4.5 AU / mg, Wako) 5
μL) and allowed to stand at 37 ° C. for 1 hour. This is SD
The band obtained by S-PAGE electrophoresis and transfer to a PVDF membrane was sequenced.

Example 8 (Preparation of barley cDNA) Iron-deficient barley root-derived cDNA was prepared as follows. Dynabeads mRNA purification kit (DYNABADS mRNA Puri) from total RNA extracted from iron-deficient barley roots
fication Kit (DYNAL)) using poly (A) ⁺ R
NA was purified. Hybrid primer (dT17 adapter primer: 5'-GACTCGAGTCGA
CATCGATTTTTT TTTTTTTTTTT-
3 ′) to reverse transcribe poly (A) ⁺ RNA to cDN
A was obtained. Adapter primers specific to this hybrid primer (5′-GACTCGAGTCGAC
ATCG-3 ') was used for PCR.

Example 9 (Barley 36 kD by PCR
Amplification of cDNA partial fragment of a protein) Partial amino acid sequence 'DHTELNEL obtained by digesting 36 kDa protein with lysyl endopeptidase
Degenerate primer 5'-AAY based on the nucleotide sequence deduced by YSFDDATAS (X) W (X) L '
GARYTNTAYWSNTTYGAYACATCG-
3 '(primer A) and 5'-GAYCAYCNGAR
YTNAAYGARYT-3 '(primer B) was prepared. Using the primer derived from the adapter primer obtained in Example 8 and primers A and B using the cDNA derived from the iron-deficient barley root as a template, Gene Amp was used under the following reaction conditions.
PCR System 9600 (PERKIN EL
MER). PCR reaction conditions. 1st PCR template 0.5 μL 1.25 mM dNTP 8.0 μL 10 × Buffer 5.0 μL Adapter primer (10 pmol / μL) 1.25 μL Primer A (10 pmol / μL) 2.5 μL Ex Taq polymerase (Takara) 0.25 μL

The composition of the reaction solution for the first PCR is as described above. The PCR reaction cycle is 95 ° C for 3 minutes.
After denaturing NA, 1 minute at 94 ° C., 1 minute at 42 ° C.
After 5 cycles of reaction at 72 ° C. for 2 minutes, 94 ° C.
Reaction for 30 seconds, 1 minute at 47 ° C, and 2 minutes at 72 ° C.
The cycle was repeated 5 times, treated at 72 ° C for 10 minutes, and cooled to 4 ° C. Second PCR template 0.5 μL 1.25 mM dNTP 8.0 μL 10 × Buffer 5.0 μL Adapter primer (10 pmol / μL) 1.25 μL Primer B (10 pmol / μL) 2.5 μL Ex Taq polymerase (Takara) 0.25 μL Second time The composition of the PCR reaction solution is as described above.
The template used was a 1000-fold diluted solution after the first PCR reaction. The PCR reaction cycle was performed by subjecting DNA to heat denaturation at 95 ° C for 3 minutes, and then at 94 ° C for 30 seconds.
Forty cycles of the reaction at 47 ° C. for 1 minute and at 72 ° C. for 1 minute were performed, and the mixture was treated at 72 ° C. for 10 minutes and cooled to 4 ° C.

As a result of the PCR, a fragment of 200 bp was obtained (FIG. 2, part indicated by an arrow marked with *). This PCR product is
Ligation was performed on the T7blue vector under the following conditions. Ligation conditions 10 × ligation buffer 2 μL PCR product 1 μL pT7blue 1 μg T4 DNA ligase 1 μL After making up to 20 μL with sterile distilled water, and reacting at 16 ° C. for 1 hour, Escherichia coli XL1-blue was transformed.

Example 10 (Purification of cDNA Fragment) A plasmid having a PCR product as an insert was
I, digested with HindIII. The enzyme reaction solution was electrophoresed on a 0.8% agarose gel, and a band corresponding to about 300 bp was cut out. GENECL for DNA fragment purification
EAN II Kit (BIO 101 Inc) was used. The cut gel was weighed and 3 volumes of Na
I was added and the mixture was treated at 65 ° C. for 10 minutes. Gla solution
5 μL of ssmilk was added, and the mixture was allowed to stand on ice for 5 minutes. Centrifuge in a tabletop centrifuge for 5 seconds, remove the supernatant, and add 200 μL of N
After adding EW wash and suspending the precipitate with a pipetteman, the supernatant was removed by centrifugation on a table. This operation was repeated three times, and 10 μL of sterilized distilled water was added to the obtained precipitate, and the precipitate was suspended and treated at 65 ° C. for 10 minutes. The mixture was centrifuged for 20 seconds in a tabletop centrifuge, and the obtained supernatant was used as a probe template.

Example 11 (Sequencing of PCR product) (1) Preparation of plasmid The transformed Escherichia coli was transformed into an LB liquid medium [ampicillin (1 µg / mL), tetracycline (1 µg / mL).
At 37 ° C. overnight, and the plasmid was prepared by the alkali / SDS method. P in 1.5mL tube
Escherichia coli having a plasmid containing a CR fragment was collected, and the supernatant was removed. Solution I (10 m
M EDTA (pH8.0), 25 mM Tris-HCl (pH8.0), 1 M glucos
e) Add 100 μL, suspend and let stand for 5 minutes.
200 μL of the reaction II (0.2 M NaOH, 1% SDS) was added, mixed by inversion, and cooled on ice for 5 minutes. Thereafter, 150 μL of solution III (5 M KOAc) was added, mixed by inversion, and ice-cooled for 10 minutes.
The supernatant was transferred to another tube by centrifugation at 10 ° C for 10 minutes. Add an equal amount of Tris-saturated phenol to the supernatant and add voltex
And centrifuged at 14000 rpm for 10 minutes at 4 ° C. The aqueous layer was transferred to another tube and an equal volume of Tris saturated phenol / chloroform / isoamyl alcohol (25: 2
4: 1), add voltex, and add 4 at 14000 rpm.
Centrifuged at ℃ for 10 minutes. The aqueous layer was transferred to another tube, and 2.5 volumes of 99.5% ethanol was added thereto.
After cooling at 10 ° C for 10 minutes at 14000 rpm.
Centrifuge for minutes. The supernatant was removed, rinsed with 1 mL of 70% ethanol, and dried under reduced pressure. 50 μL of T was added to the precipitate.
E (containing 4 μg / mL RNase A) and add 37
C. for 30 minutes. 30 μL of PEG-Na was added to this solution.
Cl (20% (w / v) polyethylene glycol 6000, 2.5 M Na
Cl) solution was added thereto, and the mixture was voltexed and cooled with ice for 1 hour. The mixture was centrifuged at 14000 rpm for 10 minutes at 4 ° C., and the precipitate was rinsed with 70% ethanol and then dried under reduced pressure. 30 μl of this precipitate
L TE (10 mM Tris-HCl (pH 8.0), 1 mM EDTA (pH
8.0)). Plasmid DNA containing a 300 bp insert was sequenced by restriction enzyme treatment.

(2) Sequence reaction Thermosequenase fluorescent labeled prime
r cycle sequence kitwith 7-deaza-dGTP
(Amersham Pharmacia), FITC-modified T3 or T7 primer, and plasmid DNA obtained by alkaline SDS method were used. The method followed the kit protocol. PCR Reaction Conditions for Sequencing The PCR reaction cycle consists of denaturing the DNA at 95 ° C. for 5 minutes, followed by 30 seconds at 94 ° C., 30 seconds at 50 ° C.,
The reaction was performed at 72 ° C. for 10 minutes and cooled to 4 ° C. for 36 minutes. PCR product is DSQ-100
The sample was sequenced using 0 L (Shimadzu) DNA sequencer.

Example 12 (Preparation of Probe) The probe was prepared by using Random Primer DNA Labeling Kit V
er.2.0 (TaKaRa) was used. Template DN obtained in Example 10
2 μL of the random primer was added to 1 μg of A, and the total volume was adjusted to 14 μL with sterile distilled water. Stir the solution well and add 95
After treatment at 3 ° C. for 3 minutes, the mixture was cooled on ice for 5 minutes. 2.5 μL of 10 × buffer and dNTP (−dATP), [α- ³²
5 μL of [P] dATP was added. Exo-free Klenow flagme
1 μL of nt was added, and the mixture was treated at 37 ° C. for 10 minutes and then at 95 ° C. for 3 minutes. To this solution was added 25 μL of STE, and centrifuged at 3000 rpm for 2 minutes using a spin column (Probe Quant ™ G-50, Amersham Pharmacia) to remove unreacted [α- ³² P] dATP.

Example 13 (Screening by Colony Hybridization) (1) Plating of cDNA library An LB plate (length 10 cm, width 16 cm) was prepared.
E. coli (XL1-Blue) competent cells 200
To the μL, 15 μL of a cDNA library diluent (concentration of 50,000 colonies per plate) was added, stirred, and then cooled on ice for 30 minutes. Then, at 42 ° C., 40
The mixture was treated for 2 seconds and ice-cooled for 3 minutes, and then uniformly spread on an LB plate. This plate was incubated at 37 ° C. for 12 hours.

(2) Preparation of Membrane A nylon membrane (Hybond-N, Amersham Pharmacia) was placed on the surface of the plate on which the colonies (which had been cooled at 4 ° C. for 1 hour or more in advance) were formed. The colony was transferred to the membrane for 30 seconds, and the membrane was placed on a new LB plate so that the colony face was up. The second membrane was overlaid on the first membrane and left at 37 ° C. for 1 hour. Then, with the colony facing up, place the membrane in 10% SD.
3 minutes on filter paper soaked in S, denaturing solution (1.5 M NaC
l, 0.5 M NaOH) for 5 minutes, and a neutralizing solution (1.5 M NaCl, 0.5 M Tris-HCl (pH7.5)) for 3 minutes. , 2 x SSPE (3.0 M NaCl, 0.
Washing with 2 M NaH ₂ PO ₄ (pH 7.4), 20 mM EDTA) was performed twice for 5 minutes. It was air-dried for about 1 hour, irradiated with UV for 5 minutes, and the plasmid DNA was fixed on the membrane.

Example 14 (Colony Hybridization) Hybridization was performed using a hybridization machine (Hybridization oven, IWAKI). Put the membrane in a hybrid tube, and add 30 mL of Church hybridization solution (0.5 M Church phosphate buffer, 1 mM
EDTA, 7% (w / v) SDS) was added and prehybridization was performed at 65 ° C. for 1 hour, followed by adding a probe and performing hybridization at 65 ° C. for 18 hours. Washing is performed using a Church Hybrid washing solution (40 mM Church phosphate buffer, 1% (w / v) SD
S) was performed twice at 65 ° C for 10 minutes. After washing, the membrane was wrapped in Saran wrap and exposed to an IP imaging plate (Fuji Film) in a cassette overnight. BAS200
Image processing was performed with an imaging analyzer (Fuji Film), and a colony showing a positive signal that was present in common on the two membranes was punched out, suspended in 100 μL of LB liquid medium, and used for secondary screening.

Example 15 (Secondary and Tertiary Screening) A colony dilution of the positive clone obtained in the primary screening was spread on an LB plate in a manner similar to the primary screening so that the colonies did not overlap, and the secondary screening was performed. . Positive clones were punched out and suspended in LB liquid medium, followed by tertiary screening. Plasmids were purified from the clones that were positive in the tertiary screen and sequenced. The obtained clone was found to be a cDNA encoding a 36 kDa protein.

Example 16 (Northern hybridization) The extraction of total RNA was performed according to the method of Naito (1988). 5 g of control or iron-deficient barley roots or leaves were placed in a mortar, liquid nitrogen was added and completely ground.
H9.0), 1% SDS). Equal amounts of Tris-saturated phenol / chloroform / isoamyl alcohol (2
5: 24: 1), and the mixture was centrifuged at 8000 rpm for 15 minutes at 4 ° C., and the aqueous layer was transferred to another tube. Tris-saturated phenol / chloroform / isoamyl alcohol (25: 24: 1) extraction was performed twice more and then chloroform extraction was performed once. The supernatant was transferred to another tube, and 2.5 volumes of 99.5% ethanol and 1/10 volume of sodium acetate were added.
After standing still for 5 minutes, it was centrifuged at 8000 rpm at 4 ° C. for 30 minutes. The obtained supernatant was washed with 70% ethanol and then dried under reduced pressure. Dissolve the precipitate in 1 mL of DEPC water and add 140
After centrifugation at 00 rpm for 5 minutes, the supernatant was transferred to another tube. After adding 1/4 volume of 10M LiCl and cooling on ice for 1 hour, the mixture was centrifuged at 14000 rpm for 20 minutes at 4 ° C. The precipitate was washed with 70% ethanol, dried under reduced pressure, and dissolved in 30 μL of DEPC water. The yield was calculated from the absorbance at 260 nm.

The electrophoresis tank, gel stand, comb, and triangular corben were previously prepared with abSolve (RNase inhibitor, DU
(PONT) overnight. 20x MOPS (0.4 M
MOPS, 0.1 M NaCl, 0.02 M EDTA), 2.4 g agarose, and 100 mL of sterilized water were put in a triangular corben and heated to dissolve the agarose. When cooled to about 50 ° C., add 10 mL of formaldehyde, and add 200 ml of sterilized distilled water.
The L was solidified on a gel table and used. About 800 mL of 1 × MOPS and 5 μL of 10 mg / mL ethidium bromide were added to the electrophoresis tank, and used as an electrophoresis buffer.
For 20 μg of total RNA, add 16 μL of RNA sample buffer (formalte human 1.6 mL, formamit 5.0 mL, 20x MOP
S 0.5 mL, glycerin dye solution (5 ml glycerin, 1 m fluorophenol phenol
g, xylene cyanol 1 mg, 0.5 M EDTA (pH 8.0) 0.02 mL) 1.6 m
L, Total 8.7 mL) and make up to 20 μL with sterile distilled water.
After heating at 5 ° C. for 10 minutes, the mixture was allowed to stand on ice for 5 minutes and electrophoresed. After electrophoresis at 60 V for 1 hour,
Electrophoresed at 20V for 2 hours. After electrophoresis, the gel was placed on a UV transilluminator and photographed with a ruler. 20 × SSPE was used as the transfer buffer. Gel and membrane (Hybond-N +,
(Amersham Pharmacia) 3MM filter paper and paper towel were overlaid, weighed and blotted for 16 hours. Hybridization was performed according to Example 14 in both operation and conditions.
According to. The results are shown in FIG. In FIG. 10, -Fe indicates an iron deficiency condition, and + Fe indicates a control. Using a barley cDNA clone as a probe, the roots and leaves of barley were examined.

Example 17 (Genomic Southern Hybridization) 5 g of barley that had been frozen and stored was crushed in liquid nitrogen using a mortar and pestle until it became powdery.
mL of 2 × CTAB solution (100 mM Tris-HCl (pH 8.0), 20
mM EDTA (pH 8.0), 1.4 M NaCl, 2% (w / v) cetyltrimet
hylammonium bromide (CTAB), 1% (w / v) polyvinylpyr
rolidone (PVP)) in a 50 mL beaker and stirred. The mixture was allowed to stand at 55 ° C. for 10 minutes. Mix 5 mL of chloroform / isoamyl alcohol (24: 1), slowly shake at room temperature for 10 minutes, and then
and centrifugation for 15 minutes. Transfer the upper layer to another tube, add 1xCTAB solution to the lower layer, shake slowly for 10 minutes,
Centrifuged at 3000 rpm for 15 minutes at room temperature. Transfer the aqueous layer to another tube, add 1/10 volume of 10% CTAB, mix by inversion, and mix an equal volume of precipitation buffer (1% (w / v) CTA).
B, 5 mM Tris-HCl (pH 8.0), 10 mM EDTA (pH 8.0)). After standing at room temperature for 30 minutes, 3000 rpm at room temperature
and centrifugation for 15 minutes. At 55 ° C., 5 mL of 1 M NaCl-TE (1 M NaCl, 10 mM Tris-HCl (pH 8.
0), 1 mM EDTA), 5 mL of isopropanol was added and mixed by inversion, followed by centrifugation at room temperature at 3,000 rpm for 10 minutes. The precipitate was washed with 70% ethanol, dissolved in 3 mL TE at 55 ° C., and treated with RNaseA. The measurement of the yield was calculated from the absorbance at 260 nm. The restriction enzyme treatment was performed on BamHI, EcoRI, and HindIII. After electrophoresis with a TAE buffer using a 0.8% agarose gel, the gel was treated with 0.2N HCl for 10 minutes, and then treated with a denaturing solution for 30 minutes and a neutralizing solution for 30 minutes. The blotting operation was performed in the same manner as in Example 16 except that the N
Performed with aOH. The hybridization procedure was the same as in Example 14. However, the hybridization temperature was changed to 70 ° C and the washing temperature was changed to 67 ° C.

Example 18 (Isolation of genomic clone of barley 36 kDa protein) (1) Plating of genomic library Escherichia coli MRA (P2) was streaked on a drug-free LB plate and cultured overnight at 37 ° C. . Single colony is 10 mL LB (containing 10 mM MgSO ₄ )
And cultured at 37 ° C. overnight. This culture solution is 3,000
After centrifugation at 4 ° C. for 5 minutes, E. coli was collected. The supernatant was removed and which was suspended bacteria MgSO ₄ solution of 10mM and phage inoculum. 0.5 mL of this suspension and 15 μL of a library diluent [50,000 plaques were used as SM solution (50 mM Tris · HCl (pH 7.5), 0.1 M NaCl, 7 mM MgS
O ₄ , diluted to 0.01% (w / v) gelatin]] and treated at 37 ° C. for 20 minutes. Melt in advance 5
8 mL of LB + Top agar (10 m
A mixture of E. coli and phage was added to M MgSO ₄ and a 10 cm × 16 cm LB plate (10 mM M
uniformly plated on including MgSO _4). After the top agar was completely solidified, the cells were cultured at 37 ° C. for 12 hours.

(2) Plaque Hybridization Preparation of Membrane A nylon membrane (Hybond-N) was placed on the surface of the plaque-formed plate (previously cooled at 4 ° C. for 1 hour or more). The first sheet was 30 seconds, and the second sheet was 1 minute 30 seconds. After placing the membrane with the plaque facing up for 5 minutes on a filter paper impregnated with a denaturing solution and 3 minutes on a filter paper impregnated with a neutralizing solution, 2 ×
After washing twice with SSPE for 5 minutes, it was air-dried for about 1 hour, and irradiated with UV for 5 minutes to fix the phage DNA on the membrane. Plaque hybridization was performed using the probe prepared according to Example 12 and
Hybridization was carried out according to the same method as described above.

(3) Secondary and Tertiary Screening A phage dilution of the positive clone obtained in the primary screening was spread on the LB plate in a manner similar to the primary screening so that plaques did not overlap, and a secondary screening was performed. Positive clones were punched out, suspended in SM buffer, and subjected to tertiary screening. Phage DN of clones positive in the third screening
A was extracted, a restriction map was created, and subcloning was performed.

Example 19 (λ from positive clone
Purification of DNA) The purification of λ DNA was carried out by the method of Bugio (1999). A single colony of Escherichia coli MRA (P2) was inoculated into 50 mL of LB medium (containing 10 mM CaSO ₄ ), and cultured with shaking at 37 ° C. overnight. The culture was centrifuged at 4 ° C. and 3000 rpm for 5 minutes to remove the supernatant.
It was suspended precipitate 10mM of CaSO ₄ in mL. 0.5
The SM dilution of the phage of the positive clone was added to the mL of the E. coli suspension and allowed to stand on ice for 30 minutes. This was added to 50 mL of LB (containing 10 mM CaSO ₄ ) and cultured with shaking at 37 ° C. overnight. 0.4 mL of chloroform was added, and the mixture was further shaken at 37 ° C. for 10 minutes. 5
Take the bacterial solution in a 0 mL centrifuge tube, and add 11500 rpm
Centrifuge at 4 ° C. for 20 minutes. The supernatant (40 mL) was transferred to another tube, 0.2 volume of 50% PEG6000 was added, the mixture was stirred well, and allowed to stand on ice for 2 hours. 11500rpm2
The supernatant was removed by centrifugation at 4 ° C for 0 minutes. 0.4 precipitation
mL of Tris-Mg-NaCl (100 mM Tris-HCl (p
H7.5), 2.9% (w / v) NaCl, 1 M MgCl ₂ )
μL of RNase A (10 mg / mL) and 10 μL of D
NaseI (10 mg / mL) was added, and the mixture was allowed to stand at 37 ° C. for 30 minutes. Chloroform extraction (when extracting voltex
Was carried out for 1 minute) twice, and an equal amount of 2 × STE
(80 mM Tris-HCl (pH 7.5), 2% (w / v) SDS, 40 mM EDT
A) and 70 μL of proteinase K (20 mg / mL)
And treated at 65 ° C. for 30 minutes. Phenol / chloroform extraction (voltex was performed for 1 minute at the time of extraction) and ethanol precipitation were performed, and the precipitate was dissolved in 50 μL of TE.

[0080]

Industrial Applicability The present invention relates to 36 iron-deficient barley roots.
kDa protein is deeply involved in the mechanism of iron acquisition via mugineic acid in grasses and improves iron absorption in grasses, and
It provides a novel gene encoding the protein. Further, it is revealed that the 36 kDa protein of the present invention has a function of a regulator of a gene of an enzyme group involved in mugineic acid synthesis, and thus a transcription regulator is also useful. Therefore, the present invention
The Da protein reveals that it is particularly strongly induced by iron deficiency in grasses, and reveals the function of the present protein and the gene encoding it.

[Sequence List] SEQUENCE LISTING <110> Japan Science And Technology Corporation <120> A gene ( Ids6 ) for 36kDa protein which appears in iron deficient barley roots <130> PA900508 <160> 3 <210> 1 <211> 327 <212 > PRT <213> Hordeum vulgare L. (cv.Ehimehadaka NO.1) <400> 1 Met Ala Gly Thr Gly Ser Thr Trp Ile Leu Leu Glu Gln Lys Gly 15 Ala Gly Pro Gly Ala Arg Ser Ser His Ala Ile Thr Leu Val Gly 30 Gly Thr Ala Tyr Ser Phe Gly Gly Glu Phe Thr Pro Arg Leu Pro 45 Val Asp Asn Thr Met Tyr Ala Phe Asp Leu Lys Ala Gln Ser Trp 60 Ser Ala Leu Asp Ala Ala Gly Glu Val Pro Pro Arg Val Gly 75 Val Thr Met Ala Ser Val Gly Gly Thr Val Phe Val Phe Gly Gly 90 Arg Asp Lys Asp His Thr Glu Leu Asn Glu Leu Tyr Ser Phe Asp 105 Thr Ala Thr Ser Thr Trp Thr Leu Leu Ser Ser Gly Asp Asp Gly 120 Pro Pro His Arg Ser Tyr His Ser Met Val Ala Asp Gly Glu Gly Gly 135 Ser Arg Val Tyr Val Phe Gly Gly Cys Gly Asn Ala Gly Arg Leu 150 Asn Asp Leu Trp Ala Tyr Asp Val Ala Ala Gly Arg Trp Glu Glu 165 Leu Pro Ser Pro Gly Ala Ala Cy s Pro Pro Arg Gly Gly Pro Gly 180 Leu Ala Phe Ala Asp Gly Lys Val Trp Val Val Tyr Gly Phe Ser 195 Gly Asp Ala Glu Leu Asp Asp Val His Ser Tyr Asp Pro Ala Thr 210 Gly Glu Trp Ala Val Val Asp Thr Thr Gly Asp Lys Pro Thr Pro 225 Arg Ser Val Leu Cys Ala Ala Gly Val Gly Lys His Val Val Val 240 Phe Gly Gly Glu Glu Val Asp Pro Ser Asp Leu Gly His Leu Gly Ala 255 Gly Lys Phe Ser Ala Glu Ala Phe Val Leu Asp Thr Asp Thr Gly 270 Ala Trp Ala Arg Leu Asp Asp Ala Gly Ser Gly His His Pro Gly 285 Pro Arg Gly Trp Cys Ala Phe Ser Ala Gly Ala Leu Asp Gly Arg 300 Arg Gly Met Leu Val Tyr Gly Gly Asn Ser Pro Thr Asn Asp Arg 315 Leu Gly Asp Met Phe Leu Phe Thr Pro Leu Leu Ala 327 <210> 2 <211> 1312 <212> DNA <213> Hordeum vulgare L. (cv.Ehimehadaka NO.1) <400> 2 gtagagcaga gcagaggaag cagttagttc cagcttcagg ttcagcttct ccatcgcaat 60 ggctggcact ggcagtacct ggatcctgct ggagcagaag ggggctgggc cgggagcaag 120 aagctcccac gccatcacgc tcgtcggcgg cacggcctac tccttcggcg gcgagttcac 180 cccgcgcctg cccgtggaca acaccatgta cgccttcgac ctcaaggcgc agtcctggtc 240 cgccctcgac gcggccggcg aggtgccccc gccgcgcgtc ggcgtcacca tggcctccgt 300 cggcggcacg gtgttcgtgt tcggcggccg cgacaaggac cacacggagc tcaacgagct 360 ctactccttc gacacggcca ccagcacctg gaccctgctg tcctccggcg acgacggccc 420 gccgcaccgg agctaccact ccatggtggc cgacggcgag gggagccgcg tgtacgtctt 480 tggcgggtgc ggcaacgccg gcaggctgaa cgacctgtgg gcctacgatg tcgccgccgg 540 gcgctgggag gagctgcctt cgcccggggc ggcgtgccct ccccgcggcg ggcccgggct 600 ggccttcgcc gacgggaaag tgtgggtggt atacgggttc tccggggacg cggagctcga 660 cgacgtgcac tcctacgacc cggccaccgg cgagtgggct gtggtagata ccaccggcga 720 caagcccacc ccgcggagcg tgctctgcgc cgccggggta gggaagcacg tggtggtgtt 780 cggcggcgag gtggacccca gcgatctcgg ccacctaggc gccggcaaat tctccgccga 840 ggccttcgtg ctggacaccg acaccggcgc gtgggccagg ctggatgacg ccgggtctgg 900 tcaccacccc ggtcctcggg gttggtgcgc gttctcggcg ggggcgctcg acggccggcg 960 aggcatgctt gtctacggcg gcaactcgcc gaccaacgac cggcttggcg acatgttcct 1020 cttcactccg cttctagctt gagtcagcac gacagctagg cggtgcccgc acctctgt gt 1080 gcaattggag tggtatgtga ggaactagct gctttgttaa tgttgtgtcc aattgtgttt 1140 atgttgtgtt atgttgtgta tgtaattaat gaagaataat tgtactagta gtaatgatga 1200 attgtgtact ttaaattcct ccgcgaccaa gttctcatgg tcctaataga agtatcataa 1260 atgataatat gaatgccaat taaacttttt tgaaaaaaaa aaaaaaaaaa aa 1312 <210> 3 <211> 4517 <212> DNA <213> Hordeum vulgare L. ( cv. Igri) <220> gene <400> 3 -2758 atccgtcggccagccaatgatgctctcgcttaaggccgacgaaggacatgtgtagtacgt -2699 -2698 ccagctcgtcttgcgagattcttcatgggttgccagtacggcYgcctccattgttgccat -2639 -2638 gccaagcttggtaatggagtgggtgttgacgggctggtactgtgcgggcttgacggatcg -2579 -2578 gagccggagtaggttagcggcatggccgtgacactgtatctgtcgtgcgctccaaccttg -2519 -2518 tacccttgctgacgcgtattcacctttaattgtagagtctcgtcatggcctacgatctga -2459 -2458 tgtgacttgagctccctggccggctagcggctcgctWgcagaaatggccgtctcgccact -2399 -2398 agccgacagacgcttcccagatggccagaaggaggtagccgtctcgcccctagccgacac -2339 -2338 gagctcctagtcggccaggaggagttgaccgtcttgccactagccggcaaggaggatttg -2279 -2278 gccgtatggaacgagttgtggtttcccttcaatcttgaatgc aaaggtgtaggctcgatg -2219 -2218 agcacccggggttatccctcgtctgtatactatatttataaatatactatgctccttaat -2159 -2158 tttaaagcctcacaaccaattgaagtctccaatttataattaggtcatccgattttgacc -2099 -2098 gggtcaacaatttctcaaagagctctttttttttttaattcatctctcttaataaattat -2039 -2038 ttaattcatctctgttactatattcttttattcactgcgctctttaattttgaagctctc -1979 -1978 ttattccatcgaggtatttaattttagatttggtttacgattttgatcaattcaacgatt -1919 -1918 ttccaaatcaaccgacaacaattgacctataaaaacatatcaatcaatcgacatcactcg -1859 -1858 cacccgctaaaaaagaggtgtgaatatgtaatattgtagcatcaatatagaacatgcagc -1799 -1798 caccgatgaaatttttacacaatagtgtggattggttagcgaataactctgaatcaaacc -1739 -1738 gcgaaggcccatcgaacacgctgcattataaatagagaaacacactccatcgcccccacc -1679 -1678 cccccacccctcgccaaaccaaatactcactcggttttaagatataaggtgtattaaatt -1619 -1618 tttaaaaagtataatatctttaactttaatcaagttcagagccaaaaatatttacattca -1559 -1558 caatactaaatcaataaaaataaaaaatcattccatgatgaatcattattattgattagtattattagtattattagtattattagtattattagtattagattattagtattacattattagtattacattattagtattacattattagattacatg tgatacaagatttttttatatgagaatcaaacaacaacga -1379 -1378 tggcatagtaaagcgtgtccaacccttctagtgtagaagaacctaccaacaactctattt -1319 -1318 tcatgactacttagacaactactataaatctctgaatcttgtgaagaagtatagcatgga -1259 -1258 gcatattatcaaggggaaagatgtcatcttatgtgcacaccgagtaaaaattacaaacac -1199 -1198 taaccatgctccatctaagcattggcctccaccaccgacaggatgggtggcattctctgt -1139 -1138 ggacggatctttctctgctcaggacggccgtgcgtcggccgggacggtgctacggaggga -1079 -1078 gaatggtttgttgatatttgccgcgtataggtatatcttcaactgtaacgacgccttgga -1019 -1080 agcagagactcatgccttaatgcaaggtatggcactagctttgcatcattcggatatgcc -959 -958 cgtcattgtccagtcagattcttcaaacgctttggccaccattgaggacgatgcttggtc -899 -898 taggtcggtctatagacacttagctgaggagattaaaactcttatggttatggttgatag -839 -838 agagtttattcctttaaaaattagtagagatcagaatagggtagcacatcagctcgctca-779 -778 acaaaataccaggattgctgcaggtaccacggattccacaagatataa -539 -538 accagagaggccgagtaaaaaaaagttgcagagccgcagtgatatcatccaaagtttgga -479 -478 tgtcgacaatgttcctgtaatatacttcctctgtatttaaatataagaccttttaaagat -419 -418 ttcattacaagactatatacgaaacaaaatgagtgaatctatactataaaatatgtctat -359 -358 gtacattcatatgtagtttatagtgtaatttttaaaaggtcttatatttaagaacgggag -299 -298 agtaattcctagtaccccacacaagaaacaataatacctagtacggcggctcatgtcccg -239 -238 ccaccgcaaatgccaaacatgaatagtggcagattctttttctagcgagggctccacggt -179 -178 aatttggcccggatggagtggttatcttggttgacggagtgatggcaccgttcatgcccc -119 -118 tcgaccggcttataacaagtgaccccaatcatcactttccccacacacaaaggcaacaca -59 -58 gtagagcagagcagaggaagcagctagttccagcttcaggttcagcttctccatcgcaat 2 3 ggctggcactggcagtacctggatcctggtgtgtttcctcgcctctccaacttaatttcc 62 63 ttgtttcctactccgtcttcgttttcctcctccctctttgcacattttttgcttcttcac 122 123 ctgctgtatcgatgcgatctatgcaattcatattagaagaactggtttcccctttgctca 182 183 actccattcggag ggagcgagcgagcgagcgagcgagcagggagcagggagcagggaggagcagggagagcaggg tactccttcggcggcgagttcacc 302 303 ccgcgcctgcccgtggacaacaccatgtacgccttcgacctcaaggcgcagtcctggtcc 362 363 gccctcgacgcggccggcgaggtgcccccgccgcgcgtcggcgtcaccatggcctccgtc 422 423 ggcggcacggtgttcgtgttcggcggccgcgacaaggaccacacggagctcaacgagctc 482 483 tactccttcgacacggccaccagcacctggaccctgctgtcctccggcgacgacggcccg 542 543 ccgcaccggagctaccactccatggtggccgacggcgaggggagccgcgtgtacgtcttt 602 603 ggcgggtgcggcaacgccggcaggctgaacgacctgtgggcctacgacgtcgccgccggg 662 663 cgctgggaggagctgccttcgcccggggcggcgtgccctccccgcggcgggcccgggctg 722 723 gccttcgccgacgggaaagtgtgggtggtatacgggttctccggggacgcggagctcgac 782 783 gacgtgcactcctacgacccggccaccggcgagtgggctgtggtagataccaccggcgac 842 843 aagcccaccccgcggagcgtgctctgcgccgccggggtagggaagcacgtggtggtgttc 902 903 ggcggcgaggtggaccccagcgatctcggccacctaggcgccggcaaattctccgccgag 962 963 gccttcgtgctggacaccgacaccggcgcgtgggccaggctggatgacgccgggtctggt 1022 1023 caccaccccggtcctcggggttggtgcgcgttctcggcgggggcgctcgacggccggcga 1082 1083 ggcatgcttgtctacggcggcaactcgccgaccaacgaccggcttggcgacatgttcctc 1142 1143 ttcactccgcttctagcttgagtcagcacgacagctaggcggtgcccgcacctctgtgtg 1202 1203 caattggagtggtctgtgaggaactagctgctttgttaatgttgtgtccaattgtgttta 1262 1263 tgttgtgttatgttgtgtatgtaattaatgaagaataattgtactagtagtaatgatgaa 1322 1323 ttgtgtactttaaattcctccgcgaccaagttctcatggtcgtaatagaagtatcataaa 1382 1383 tgataatatgaatgccaattaaacttttttgatgatgtggcatatcattaaataagaaaa 1442 1443 aagtggatgtgagatcgagtcgacggtatcgataagcttgatatcgaattcctgcagccc 1502 1503 gggggatccactagttctagagcggccgccaccgcggtggagctccagcttttgttccct 1562 1563 ttagtgagggttaattgcgcgcttggcgtaatcatggtcatagctgtttcctgtgtgaaa 1622 1623 ttgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctg 1682 1683 gggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttcca 1742 1743 gtcgggaaacctgtcgt

[Brief description of the drawings]

FIG. 1 shows the biosynthetic pathway of mugineic acids in roots of grasses.

FIG. 2 shows the cD of the 36 kDa protein of the present invention.
This shows the base sequence of NA. The part indicated by * indicates the PCR fragment obtained first, and the arrows indicate the parts of primer A and primer B.

FIG. 3 shows the amino acid sequence of a rice homologous EST clone. The same amino acids as in the 36 kDa protein of the present invention are indicated by.

FIG. 4 shows the amino acid sequence of a homologous clone of Arabidopsis thaliana. The same amino acids as in the 36 kDa protein of the present invention are indicated by. Blue characters (lightly shaded portions in the figure) indicate portions that are conserved in all the sequences.

FIG. 5 shows' W found in 33 proteins.
-FGG-W 'shows a repeated sequence.

FIG. 6 shows the barley genome as EcoRI and Bam.
It is a photograph replacing a drawing which shows the result of genomic southern hybridization analysis which cut | disconnected each by HI and HindIII, and used a 1.3-kb cDNA clone as a probe.

FIG. 7 shows a restriction map of a barley genomic clone encoding a 36 kDa protein of the present invention. Black portions indicate coding regions.

FIG. 8 shows the nucleotide sequence of the barley genome encoding the 36 kDa protein of the present invention and the corresponding amino acids. This is the first of the two sheets shown in FIG.

FIG. 9 shows the nucleotide sequence of the barley genome encoding the 36 kDa protein of the present invention and the corresponding amino acids. This is the second of the two sheets shown in FIG.

FIG. 10 shows a barley cDNA as a probe.
Using clones, barley root (Leaf)
5 is a photograph replacing a drawing, showing the results of Northern hybridization in which was examined. In FIG. 10, -Fe indicates an iron deficiency condition, and + Fe indicates a control.

FIG. 11 shows the predicted secondary structure of the 36 kDa protein of the present invention.

Continued on front page (72) Inventor Hirotaka Yamaguchi 5-21-4 Hongo, Bunkyo-ku, Tokyo Sankei House 1E F-term (reference) 2B030 AA02 AB03 AD20 CA06 CA14 CB03 4B024 AA08 BA80 CA03 CA04 4B065 AA88X AA88Y AB01 AC14 BA02 CA24 CA53 4H011 AB03 DG06 4H045 AA10 AA30 BA10 CA32 EA05 FA72 FA74

Claims (13)

[Claims] 1. An agent for improving iron absorption of grasses comprising a 36 kDa protein derived from iron-deficient barley root. 2. The iron absorption improver according to claim 1, wherein the 36 kDa protein has the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence in which a part of the amino acid is deleted, added, or substituted. . 3. A DNA encoding an iron-deficient barley root-derived 36 kDa protein having the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence in which a part of the amino acid is deleted, added, or substituted. 4. A DNA comprising the nucleotide sequence of SEQ ID NO: 2,
4. The DNA according to claim 3, wherein the DNA has a base sequence in which some bases are deleted, added, or substituted. 5. The DNA according to claim 3, wherein the DNA is a genome. 6. The DNA according to claim 5, wherein the genome has the nucleotide sequence of SEQ ID NO: 3 or a nucleotide sequence obtained by deleting, adding, or substituting a part of the nucleotides. 7. The D according to claim 3, which has a Kelch motif.
NA. 8. Iron absorption of a grass family consisting of a 36 kDa protein derived from an iron-deficient barley root having an amino acid sequence in which the amino acid sequence of SEQ ID NO: 1 or a part of the amino acid is deleted, added or substituted. A transcriptional regulator of a gene of a protein involved in the protein 9. The DNA according to any one of claims 3 to 7,
A transcriptional regulator of a gene of a protein involved in iron absorption in a gramineous plant comprising: 10. The DN according to any one of claims 3 to 7.
The transfer control agent according to claim 9, wherein A is introduced. 11. The DN according to any one of claims 3 to 7.
A plant into which A has been introduced. 12. The plant according to claim 11, wherein the plant is a gramineous plant. 13. The plant according to claim 11, wherein the DNA is derived from a genome.