IL270342A - A method for determining bacterial susceptibility to antibiotics - Google Patents

Description

A METHOD FOR DETERMINING BACTERIAL SUSCEPTIBILITY TO ANTIBIOTICS TECHNOLOGICAL FIELD This invention relates to methods for rapidly identifying and quantifying the efficiency of antimicrobial agents.

BACKGROUND ART References considered to be relevant as background to the presently disclosed subject matter are listed below: Aloni-Grinstein, R., Shifman, O., Lazar, S., Stienberger-Levy, 1., Maoz, S., and Ber, R. (2015). A rapid real-time quantitiative PCR assay to determine the minimal inhibitory extracellular concentration of antibiotics against and intracellular Francisella tularensis Live Vaccine Strain. Front Microbiol 6, doi: .3389/fmicb.2015.01213.

Ben-Gurion, R., and Shafferman, A. (1981). Essential virulence determinants of different Yersinia species are carried on a common plasmid. Plasmid 5, 183-187.

Boisset, S., Caspar, Y., Sutera, V., and Maurin, M. (2014). New therapeutic approaches for treatment of tularemia: a review. Frontiers in Cellular and Infection Microbiology 4, 1-8.

CLSI (2015). Methods for Antimicrobial Dilution and Disk Susceptibility Testing of lnfrequently Isolated or fastidious Bacteria 3rd ed. CLSI document M45 —A2 Wayne, PA Clinical and Laboratory Standards Institute CLSI (2018). MO7 Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically 11th edition.

Cohen, S., Mendelson, 1., Altboum, Z., Kobiler, D., Elhanany, E., Bino, T., et al. (2000). Attenuated nontoxinogenic and nonencapsulated recombinant Bacillus anthracis spore vaccines protect against anthrax. Infect Immun 68, 4549-4558.

Galimand, M., Carniel, E., and Courvalin, P. (2006). Resistance of Yersinia pestis to antimicrobial agents. Antimicrob Agents Chemother 50, 3233-3236.

Gill, V., l, and Cunha, B.A. (1997). Tularemia pneumonia. Semin Respir Infect 12, 61-67.

Inglesby, T.V., Dennis, D.T., Henderson, D.A., Bartlett, J .G., Ascher, M.S., Eitzen, E., et al. (2000). Plague as a biological weapon. Medical and public health management. JAMA 283, 2281-2290.

Janse, 1., Mass, M., Rijks, J.M., Koene, M., 1, van der Plaats, R.Q., Engelsma, M., et al. (2017). Environmental surveillance during outbreak of tularemia in hares, the Netherlands, 2015. Euro Sarveill 22.

Klindworth A, Pruesse E, Schweer T, et al. Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next—generation sequencing—based diversity studies. Nucleic Acids Res. 2013;41(1):e1.

Larson, C.L., Wicht, W., and Jellison, W.L. (1955). A new organism resembling P. talarensis isolated from water. Public Health Rep 70, 53-58.

Parker, R.R., Steinhaus, E.A., Kohls, G.M., and Jellison, W.L. (1951). Contamination of natural waters and mud with Psteurella tularensis and tularemia in beavers and muskrates in the northwestern United States. Ball Natl Inst Health 193.

Pechous, R.D., Sivaraman, V., Stasuli, N.M., and Goldman, W.E. (2016). Pneumonic Plague: The Darker Side of Yersinia pestis. Trends in Microbiology 24, 190-197.

Petersen, J Carlson, J ., Yockey, B., Pillai, S., Kuske, C., Garbalena, G., et al. (2009). Direct isolation of F rancisella spp. from environmental samples. Letters in Applied Microbiology 48, 663-667.

Pomerantsev, A.P., shishkova, N.A., and Marinin, 1.1. (1992). Comparision of therapeutic effects of antibiotics of the teteracycline group in the treatment of anthrax caused by a strain inheriting tet-gene of plasmid pBC16. Antibiot Khimioter 37, 31- 34.

Steinberger-Levy, 1., shifman, O., Zvi, A., Ariel, N., Beth-Din, A., Israeli, O., et al. (2016). A rapid molecular test for deternining Yersinia pestis susceptibility to ciprofloxacin by the quantification of differntially expressed marker genes. Front Microbiol 7:763.

Stepanov, A.V., Marinin, I.I., Pomerantsev, A.P., and Staritsin, N.A. (1996).

Development of novel vaccines against anthrax in man. J Biotechnol 44, 155-160.

Sutera, V., Levert, M., Burmeister, W.P., Schneider, D., and Maurin, M. (2014).

Evolution towards high-level fluoroquinolone resistance in Francisella species. J Antimicrob Chemother 69, 101-110.

Versage, J .L., Severin, D.D., Chu, M.C., and Petersen, J .M. (2003). Development of a multitarget real-time TaqMan PCR assay for enhanced detection of Francisella talarensis in complex specimens. . J Clin Microbiol 41, 5492-5499.

Wielinga, P.R., Hamidjaja, R.A., Agren, J ., Knutsson, R., Segerman, B., Fricker, M., et al. (2011). A multiplex real-time PCR for identification and differntiating B. anthracis virulent types. International journal of Food Microbiology 145, 137-144.

Yoshida et al, 1997 Antimicrobial Agents and Chemotherapy, p. 1349-1351 Vol. 41, No. 6/ Zhang et al Microbiol. Insights 2016; 9:21-28.

Acknowledgement of the above references herein is not to be inferred as meaning that these are in any way relevant to the patentability of the presently disclosed subject matter.

BACKGROUND Antibiotic resistance is one of the major threats to global health and leads to 700,000 deaths yearly worldwide. Experts predict that by 2050 this number can rise to 10 million.

For example, Bacillus anthracis and the fastidiously growing bacteria Yersinia pestis and F rancisella tularensis are all Tier 1 agents causing anthrax, plague and tularen1ia respectively. As no safe and efficient vaccines are currently available for tularen1ia (Boisset et al., 2014) or plague (Pechous et al., 2016) these diseases are treated by antibiotics. Furthermore, the treatment for anthrax cannot be solely dependent on the proper vaccine, rather, antibiotics should be administered as well, to combat the bacteria until sufficient anti—anthrax antibody titer is developed. Although antibiotics are the first choice treatment one should bear in mind that high level fluoroquinolone—resistant mutants of F. tularensis can be easily and quickly obtained (Sutera et al., 2014) and some may even share cross—resistance to other clinically relevant antibiotic classes. Likewise, strains engineered for resistance to tetracycline or multidrug resistance have been generated for B. anthracis (Pomerantsev et al., 1992; Stepanov et al., 1996). Moreover, plasmid—mediated single and multiple drug—resistant strains of Y. pestis have been isolated from patients (Galimand et al., 2006). Rapid identification of the bacterial agent and prompt determination of adequate treatment is mandatory for the handling of potential exposure and constrained management. Proper treatment to all of these three diseases should rely on antimicrobial susceptibility testing (AST) of the infecting bacteria rather than on a priori decision. Anthrax progression is fairly rapid and causes death if proper treatment is not initiated within 24h of symptom onset (Woods, 2005). Similarly, inhalation of Y. pestis bacteria results in a rapidly progressing disease that is transmittable from person to person. If treatment does not start within 18 to 24 h after symptoms onset high mortality rates are observed (Inglesby et al., 2000). In pneumonic tularen1ia symptoms develop 3 to 5 days post exposure and mortality rates may reach 60% (Gill and Cunha, 1997). It should be noted that the need for prompt susceptibility determination is relevant to all clinical bacteria in order to provide efficient treatment and to avoid generation of resistant bacteria.

The conditions for performing AST are defined by standard guidelines such as the ones published by the CLSI and EUCAST. According to these guidelines a defined concentration of a homogenous bacterial suspension is a prerequisite. Taking in account the time required to isolate and enrich the bacteria, together with the time required to perform an AST (~40 h for B. anthracis, ~48 h for Y. pestis and ~96 h for F. tularensis) with respect to disease progression to death, there is a clear need for the development of novel rapid ASTs for these bioterror agents as well as for other clinically relevant bacteria.

Pathogens can be found in various clinical specimens. For example, B. anthracis, Y. pestis and F. tularensis can be found in blood, urine, CSF, lymph nodes and more. As bacterial concentrations in these specimens may vary considerably and be too low, especially in the early stages of the disease, culturing is required for bacterial enrichment, in order to perform an AST. Furthermore, clinical samples contain various assay inhibitors such as human cells, mucus, non—relevant bacteria, chemical substances and more, therefore direct transfer of the specimen to AST is not feasible. Moreover, ASTs require a defined initial concentration of bacteria, however, optical quantification of the bacteria within the clinical specimen is not feasible.

Altogether, this procedure can take between a day and a half and up to a few days, depending on the bacteria and the source of specimen tested. During this waiting period the patient continues to receive a broad—range antibiotic treatment, increasing the chance for development of antibiotic resistance and decreasing the chance of healing in case the antibiotic is not relevant.

Thus, there is a great need to develop novel, rapid antibiotic susceptibility tests that can be performed directly from the clinical samples. Such an AST will reduce the time to obtain a proper antibiotic treatment recommendation. This will decrease the use of broad range and/or irrelevant antibiotics which contribute to the increase of global antibiotic resistance.

GENERAL DESCRIPTION In a first of its aspects, the present invention provides a method for determining antimicrobial susceptibility of a microorganism, comprising: (a) Incubating a sample on a solid growth substrate containing at least one antimicrobial agent at varying concentrations; (b) recovering the microorganism growing on the solid growth substrate surface; and (c) determining the microorganism quantity using a method selected from the group consisting of: a nucleic acid—based method, an immunological method, a metabolism—based method, mass spectrometry, and a combination thereof, wherein a difference in the microorganism quantity between samples grown in the presence or absence of an antimicrobial agent indicates antimicrobial susceptibility of the microorganism to the tested antimicrobial agent.

In one embodiment, the method further comprises determining the Minimal Inhibitory Concentration (MIC) value of said antimicrobial agent and/or determining susceptibility categories.

In one embodiment, said microorganism is a bacterial strain selected from the group consisting of B. anthracis, Y. pestis, and F. tularensis.

In one embodiment, said microorganism is a bacteria or fungus causing a nosocomial infection.

In one embodiment, said microorganism is selected from the group consisting of: Clostridium diflicile, carbapenem—resistant Enterobacteriaceae (CRE), Neisseria gonorrhoeae, Multidrug—resistant Acinetobacter, Drug—resistant Campylobacter, F luconazole—resistant Candida, Extended spectrum ,6—lactamase producing Enterobacteriaceae (ESBLS), Vancomycin—resistant Enterococcus (VRE), Multidrug— resistant Pseudomonas aeruginosa, Drug—resistant non—typhoidal Salmonella, Drug- resistant Salmonella Typhi, Drug—resistant Shigella, Methicillin—resistant Staphylococcus aureus (MRSA), Drug—resistant Streptococcus pneumoniae, Drug—resistant tuberculosis, Vancomycin—resistant Staphylococcus aureus (VRSA), and Drug—resistant Group A and B Streptococci.

In one embodiment, said sample is a biological sample obtained from a subject, or an environmental sample.

In one embodiment, said biological sample is selected from a group consisting of blood, plasma, serum, lymph nodes, urine, feces, saliva, cerebrospinal fluid, lung aspirate, peritoneal lavage, sperm, nasopharyngeal swabs and a tissue biopsy.

In one embodiment, said blood sample is a whole blood sample or a fractionated blood sample.

In one embodiment, said subject is a human subject.

In one embodiment, said environmental sample is collected from roads, sidewalks, grass, ponds, floors, appliances, air, water or soil.

In one embodiment, said solid growth substrate is selected from the group consisting of agar, polyacrylan1ide hydrogel, gelatin, paper and membrane.

In one embodiment, said solid growth substrate is Cystine Heart Agar (CHA), or Muller- Hinton agar (MHA).

In one embodiment, said solid growth substrate further comprises additional nutrients.

In one embodiment, said incubation step (a) is performed at a temperature of between about 28°C and about 37°C.

In one embodiment, said antimicrobial agent is an antibiotic agent selected from the group consisting of tetracyclines (e.g. doxycycline), fluoroquinolones (e.g. ciprofloxacin), penicillin (e.g. ampicillin), cephalosporin (e.g. ceftriaxone), macrolides (e.g. erythromycin, azithromycin), an1inoglycosides (e.g. gentamycin), monobactams (e.g. aztreonam), carbapenems (e.g. in1ipenem), metronidazole, chloramphenicol, Vancomycin, and rifampin.

In one embodiment, said sample was not diluted prior to incubation step (a).

In one embodiment, said sample was not subjected to a culturing step, and/or an enrichment step, and/or a separation step, prior to incubation step (a).

In one embodiment, bacterial concentration in the sample is not determined prior to incubation step (a).

In one embodiment, said sample contains between about 5x103 to about 108 colony forming units (cfu)/ml.

In one embodiment, said incubating step (a) is performed in a multi—well plate comprising said solid support substrate.

In one embodiment, no prior identification of the bacterial strain is performed.

In one embodiment, the determination of bacterial quantity is performed using a qPCR reaction.

In one embodiment, the qPCR reaction is performed using bacteria—specific primers or using universal primers.

BRIEF DESCRIPTION OF THE DRAWINGS In order to better understand the subject matter that is disclosed herein and to exemplify how it may be carried out in practice, embodiments will now be described, by way of non-lin1iting example only, with reference to the accompanying drawings, in which: Fig. 1 is a schematic representation showing ACt obtained by qPCR, following 12-h treatment with ciprofloxacin (A) or doxycycline (B) on bacterial samples of F. tularensis, ranging in concentrations from 104-108 cfu/ml (lE4-1E8/ml). The MIC values were defined as the lowest antibiotic concentration where ACt>3.3 (threshold dashed line).

Fig. 2 is a schematic representation showing ACt obtained by qPCR, following 8- h treatment with ciprofloxacin (A) or doxycycline (B) on bacterial samples of Y. pestis, ranging in concentration from 104-107 cfu/ml (lE4—lE7/ml). The MIC values were defined as the lowest antibiotic concentration where ACt>3.3 (threshold dashed line).

Fig. 3 is a schematic representation showing ACt obtained by qPCR, following 4- h treatment of ciprofloxacin (A) or doxycycline (B) on bacterial samples of B. anthracis, ranging in concentration from 104-107 cfu/ml (lE4—lE7/ml). The MIC values were defined as the lowest antibiotic concentration where ACt>3.3 (threshold dashed line).

Fig. 4 is a schematic representation showing ACt obtained by qPCR, following 16-h treatment of increasing concentrations of ciprofloxacin or doxycycline on 1.4x105 cfu/ml F. tularensis—spiked blood cultures.

DETAILED DESCRIPTION OF EMBODIMENTS The inventors of the present invention developed a new and rapid antibiotic susceptibility test (AST), which decreases greatly the time needed to reach an adequate clinical answer, i.e. results can be obtained within a few hours in contrast with conventional methods which require several days. This provides great advantage at a clinical setting allowing antibiotic susceptibility determination in clinical relevant timing.

The method of the invention, also termed herein MAPt (micro agar PCR test), combines an agar dilution step with a quantitative PCR (qPCR) step for determining growth.

This novel and advantageous combination gives significantly added value providing in one-step enrichment, isolation and antibiotic susceptibility testing.

One of the main drawbacks of the current AST such as classical agar dilution, broth n1icrodilution or disk diffusion based ASTs is the need for a defined concentration of the target bacteria. This prerequisite defines the need for an isolation step prior to quantification of the tested sample. In case of a diluted sample there is a need to wait for adequate growth (enrichment step), a process that is time consuming especially in slow- growing bacteria.

Using the method of the invention, the determination of antibiotic susceptibility and scoring of MIC values is independent of bacterial concentration. The use of bacteria- specific primers in the qPCR step provides sensitivity and specificity and allows quantification of relatively low amounts of bacteria (e.g. as low as ~l03 colony forming units (cfu/ml). Due to this high sensitivity the MAPt can be performed with samples comprising relatively low concentrations of bacteria, which is not applicable with the standard ASTs (e.g. the broth n1icrodilution—based assay). Moreover, due to the high dynamic range of the qPCR quantification, the invention is applicable at varying and also at high concentrations of bacterial samples. In a specific embodiment, the concentration of the original tested sample may be as high as 4x109 cfu/ml, way beyond any clinical relevant sample.

Due to the use of bacteria specific primers combined with the use of solid surface (such as an agar culture media) non—homogenous clinical samples (e.g. urine, stool, nasopharyngeal swabs and more) as well as environmental samples may be processed without prior isolation.

It has been suggested that analysis of environmental samples of natural outbreaks (Janse et al., 2017) or bio—terror attacks holds great advantage for early medical care (prophylaxis) of the suspected infected individuals. However, isolation of the pathogen from the environmental samples relies on the growth on selective agar and is time consuming. For example, isolation of F. mlarensis using selective agar, reduced environmental contaminations, but was time consuming and required 2 to 3 days prior to the 48 hours AST (Petersen et al., 2009). Moreover, the sensitivity and specificity of the method of the invention allows to identify the bacteria and to perform an AST in one step.

In cases where there is no indication for the identity of the pathogen the MAPt can be used with broad—range (universal) primers to determine the susceptibility of the bacteria to the tested antibiotic.

As will be demonstrated in the Examples below, MAPt was applied on blood cultures and blood samples spiked with various concentrations of B. anthracis, Y. pestis and F. tularensis, and environmental samples spiked with F. tularensis and showed adequate MIC determination within remarkable time schedules even at low bacterial concentration (~1()3cfu/ml).

These three bacterial models were used as representatives of gram—negative and gram—positive bacteria and represent a scale of different growth rates.

Without wishing to be bound by theory, some of the main advantages of the MAPt method of the invention are: 1. A broad dynamic bacterial concentration range allowing to perform concomitantly isolation, enrichment and quantification steps of the assay thus enabling AST determination: 1.1. In shorter times. 1.2. Varying bacterial concentrations, including very low and very high concentrations. 1.3. Directly from clinical and environmental samples. 2. During bacterial growth on the agar, the agar can absorb inhibitory particles that may be present in the samples (such as in blood or in blood culture media). Accordingly, this can reduce the need for purification steps prior to incubation of the sample on the agar or prior to the qPCR reaction. 3. The use of specific PCR primers allows: 3.1. AST determination of the target bacteria even in the presence of contaminating bacteria allowing antibiotic susceptibility determination of heterogeneous samples. 3.2. Identification and antibiotic susceptibility determination within one step. 4. The use of broad range primers allows the determination of bacterial susceptibility without prior indication of the pathogen involved.

. The use of the MAPt on environmental samples can provide the clinician with the ability to choose proper prophylaxis treatment before signs of morbidity.

The MAPt is applicable on a wide range of bacterial concentrations, different bacteria and different antibiotics. In the same MAPt assay different samples may be examined or different antibiotics may be explored for the same sample. Moreover, the MAPt allows bacterial identification and AST determination in one step using different bacteria—specific primers.

The MAPt is a rapid AST method, applicable on a wide—range of bacterial concentrations thus there is no need for bacterial quantification. Moreover, there is no need for an external isolation or an enrichment step and it can be applied directly on clinical samples such as blood culture and even directly on whole blood.

In one aspect, the present invention provides method for determining antimicrobial susceptibility of a microorganism, comprising: (a) Incubating a sample on a solid growth substrate containing at least one antimicrobial agent at varying concentrations; (b) recovering the microorganism growing on the solid growth substrate surface; and (c) determining bacterial quantity using a method selected from the group consisting of: a nucleic acid—based method, an immunological method, a metabolism—based method, mass spectrometry, and a combination thereof, wherein a difference in bacterial quantity between samples grown in the presence or absence of an antimicrobial agent indicate antimicrobial susceptibility of the bacterial strain to the tested antimicrobial agent.

As used herein the term "microorganism" refers to unicellular organisms including, but not limited to, bacteria and fungi.

It would be appreciated by a person skilled in the art that the method of the invention is applicable to any microorganism (e.g. bacterial strain or fungus) capable of growing on a solid surface. In one embodiment the bacterial strain is selected from the group consisting of F. tularensis, Y. pestis, and B. anthracis. In another embodiment the microorganism that is responsible for nosocon1ial infections such as, Clostridium diflicile, carbapenem—resistant Enterobacteriaceae (CRE), Neisseria gonorrhoeae, Multidrug— resistant Acinetobacter, Drug—resistant Campylobacter, Fluconazole—resistant Candida, Extended spectrum B—lactamase producing Enterobacteriaceae (ESBLs), Vancomycin— resistant Enterococcus (VRE), Multidrug—resistant Pseudomonas aeruginosa, Drug- resistant non—typhoidal Salmonella, Drug—resistant Salmonella Typhi, Drug—resistant Shigella, Methicillin—resistant Staphylococcus aureus (MRSA), Drug—resistant Streptococcus pneumoniae, Drug—resistant tuberculosis, Vancomycin—resistant Staphylococcus aureus (VRSA), Drug—resistant Group A and B Streptococci. In yet other embodiments the bacterial strain is a bacteria responsible for animal infections, including but not limited to antibiotic resistant Salmonella. Antibiotic susceptibility determination of such bacteria is important for veterinary applications.

As used herein a "solid growth substrate" refers to any solid substrate that can be used for growing a microorganism, e.g. bacteria. In one embodiment the solid growth substrate is selected from the group consisting of agar, polyacrylamide hydrogel, gelatin, paper and membrane. In specific embodiments the solid growth substrate is selected from the group consisting of Muller—Hinton agar (MHA), and Cysteine heart agar (CHA).

In one embodiment the solid support substrate is supplemented with nutrients or growth supplements, e. g. hemoglobin, gelatin, IsoVitalex, blood, blood constituents, amino acids, nucleotides, vitamins, NAD, sugars.

It would be appreciated by a person skilled in the art that the incubation is performed in the optimum temperature range for the tested microorganism, e. g. at about 28°C or about 37°C depending on the type of microorganism tested. In certain embodiments, such as in the case of a biological sample obtained from a patient the incubation is performed at a temperature of 37°C.

In certain embodiments, the method of the invention further comprises determining the Minimal Inhibitory Concentration (MIC) value of said antimicrobial agent and/or determining susceptibility categories. Examples of susceptibility categories include but are not lin1ited to Susceptible, Intermediate or Resistant.

In one embodiment the sample is a biological sample (also referred to herein as a clinical specimen) obtained from a subject, said biological sample selected from the group consisting of blood, plasma, lymph nodes, urine, cerebrospinal fluid, saliva, semen, feces.

In one embodiment the blood sample is a whole blood sample. In another embodiment, the blood sample is a fractionated blood sample, e.g. plasma or serum.

Blood can be fractionated for example by SST (serum separation tubes) (Vacutte Z serum Sep. Clot activator #456005) to obtain the plasma fraction. For this purpose the sample can be loaded into SSTs and centrifuged for example for 10 minutes at l700g at °C. The upper fraction may be discarded and the bacteria lying on the gel matrix can be recovered with PBS.

As used herein the term "subject" encompasses any kind of animal, for example, but not limited to, mammalian subjects, avian subjects, reptiles or fish. The mammalian subject may for example be a livestock animal, e.g. a cow. In one embodiment said subject is a human subject.

In one embodiment the sample is an environmental sample obtained for example from roads, sidewalks, grass, ponds, floors, appliances, air, water or soil.

It would be appreciated by a person skilled in the art that the method of the invention is suitable for testing any antibiotics (also referred to herein as an antimicrobial agent). Non limiting examples include tetracyclines (e.g. doxycycline), fluoroquinolones (e.g. ciprofloxacin), penicillin (e.g. ampicillin), cephalosporin (e.g. ceftriaxone), macrolides (e.g. erythromycin, azithromycin), an1inoglycosides (e.g. gentamycin), monobactams (e.g. aztreonam), carbapenems (e.g. imipenem), metronidazole, chloramphenicol, vancomycin, and rifampin. In specific embodiments the antibiotic is doxycycline or ciprofloxacin.

In some embodiments, the method of the invention can be performed without having any purification, separation or enrichment steps (e.g. by dialysis or immuno- separation, precipitation, centrifugation, filtration, sorting) prior to the incubation of the sample on the solid growth substrate. For example, if the sample is a blood sample, it may be incubated on the solid growth substrate without prior fractionation by SST (serum fractionation tube), or FACS (fluorescence activated cell sorter).

In accordance with the method of the invention, the period of time to determine antimicrobial susceptibility or MIC is largely reduced. While using the methods known in the art the determination of antimicrobial susceptibility and MIC requires several days (e.g. 5 days for F. tularensis), using the method of the invention reduces this time period to several hours.

For example, according to the method of the invention, the period of time to determine antimicrobial susceptibility or MIC in blood, blood cultures or environmental samples of F. tularensis is between about 12 hours and 16 hours; of Y. pestis between about 10 hours and 12 hours, and of B. anthracis is between about 6 hours and 8 hours.

These time periods may even be shorter when the antimicrobial susceptibility or MIC are tested from a pure bacterial culture (e.g. 8 hours for Y. pestis, and 4 hours for B. anthracis).

In accordance with the invention, the recovery step (b) (also referred to herein as the extraction step) refers to the removal of the microorganism from the solid growth substrate. This step can be performed using any suitable solution. Non—limiting examples include PBS, saline, Tris buffer (e.g. Tris EDTA), water or ethanol.

The recovery step can also be performed by liquidizing the solid substrate (e.g. the agar or the gel) and recovering the bacteria from the liquidized substrate.

After recovery, the sample is optionally heated (e. g. for 30 n1inutes) for sterilization.

The bacterial sample recovered from the substrate may optionally be subjected to a lysis step. The lysis may be performed using any method known in the art, for example using a detergent, by sonication, or bead beater.

The quantification step is performed using a method selected from the group consisting of a nucleic acid—based method, an immunological method, a metabolism- based method, mass spectrometry, and any combination thereof.

The term "nucleic acid—based method" refers to any method known in the art in which the quantification of the microorganism is based on measuring a microorganism‘s nucleic acid. Non lin1iting examples include standard PCR, TaqMan and SYBR based PCR, digital PCR (dPCR), RT—PCR, Nucleic acid sequence based amplification (NASBA), Ligation chain reaction (LCR), next generation sequencing (NGS), sequencing, and loop—mediated isothermal amplification (LAMP).

The term "immunological method" refers to any method known in the art in which the quantification of the microorganism is performed using antibodies. Non limiting examples include ELISA and FACS.

The term "metabolism-based method" refers to any method known in the art in which the quantification of the microorganism is performed using measurements of cell metabolism. Non limiting examples include measurement of cell respiratory cycles, or any measurable biochemical change that reflects the viability of the microorganism.

The term "mass spectrometry "refers to an analytical technique that measures the mass—to—charge ratio of components in the sample, and is used to elucidate the identity of masses of molecules.

In one specific embodiment the quantification is performed using qPCR reaction.

The qPCR reaction can be performed using bacteria—specific or fungal specific primers, or using universal primers. d+# v9Iuz+ Bfinthracis ° X_fiMQ M W# 1111 I ° X_rWQdJ W#E1 7 I qPr0_ denoted\byvyK> 2-KL M " # E125 U_ PI Yifrestis °Xvsis cap; wqvxa ve;#1H capXw+Q 65 vs';# 131 ’ aqZ‘IapX\Es\den0ted byxfiz K> ZFQQJ ‘M132 6U_2PI F ifitlarensis fopK; WQM \5 f0pKXWQ 65 W # E1 fOpK' \ms\denoted\byV82 ; K> ZFQ § 6 U_ 2P1 PR3, d+# 1+° 0+ e+> w HKKH\M(’1WK’ ’NVWKWK’ KWKW K’ ’H’ ’ ’ Z iefinga QPPI ;K> 2KKHKW’ KHW’ ’ ’ 1HKH’ NVWKWHKKKK’ }H(K261U_2P WWK’ ’KHWK’H’H’HWWK’W’WK KVRHHWWKHKWKHWKK’ KKH’ ’ H 2+teinberger2 32;K>2"W\7V\M{\7VKHH’H’KI(H’}IHI(’VVKK’K”HH26U_2I’ °°VY‘“°“'“’ C)P3I K’ H’ KVKHKWW’ HKKVRHKKHKWW’ W HKKHKH’ ’MH’ ’NVKKHK’ ’ ’ H’ KWK’ K 21 ersagewtwlqw Q)xIw 32; K> 2HKKKH’ ’ m ’ HHHKK26 U_ 21> ZK10ni2 \MinsteinWtwl(IW QPVI Kxpersonwrkilledxiznwhewrtubfithewnventionwvouldxbexfamiliarwvithxprimersxszuitablew forxquantificationwfwariousxbactefial\>3trains()déwon2lirr1iting\isirstw'fw11itab1exprimersxiw providexinviz ab1e\R6 Table.r " +uitab1e\primers\£o1'\testingxfimgalxstrainsxm(g()dvIandidaIwre\1rzI1own\in\17l1e\a21‘t(\£orw examp1e\®v£aI1g Zimtingvxmnp1e ardwmnervw WHKKW” HK’ HKWH’ ’ VKHW” ’ vp+(L\i\} \5{I# EsR)*I(\and\Mn0n2lirr1iting\cxamp1e\£or\aw reVerse\primerwsv’vV\HW” ’ H’ ’ HK’ HWK’ VKHVKKWI-(L\izI \i{/# BRPIO Ksvsvsed\hzerein\1\he\1serrn\2¢x1r1iVersa1\primersAmfers\1v\ibroadxapectrurnxprimersw directedxtowequencesvshatwppearwnwxbroadxxangewfibacteriawndxthereforewuchxprimersw camirndicatewhexpresenccw)fibacteriaxevenxifithewpecificwpecieswswot\irdentifiedw:r\known0 Such primers include for example the 16S forward primer CCTACGGGNGGCWGCAG (SEQ ID NO:12) and the 16S reverse primer GACTACHVGGGTATCTAATCC (SEQ ID NO:13) (Klindworth et al., 2013).

Examples Materials and Methods Bacterial strains: The F. mlarensis live vaccine strain (LVS) (ATCC 29684) was grown on CHA agar (Difco, 5.1% cystine heart agar, 1% hemoglobin) or in cation adjusted Mueller- Hinton broth (CAMHB) (BBL, 212322), supplemented with 2% defined growth supplement (IsoVitaleX Enrichment; BBL 211876) and 3uM hematin (Sigma 3281) (termed HLMHI) at 37°C. The Y. pestis vaccine strain EV76 (Ben—Gurion and Shafferman, 1981) was grown on Brain Heart Infusion agar (BHI—A) (BD Difco 241830) plates at 28°C. Bacillus anthracis A14185 (Cohen et al., 2000) was grown on BHI—A at 37°C. Colony forming units (cfu) counts were determined by platting 100 pl of serial ten- fold dilutions in sterile phosphate—buffered saline (PBS, Biological Industries, Beth Haemek, Israel) on CHA for F. tularensis and BHI—A plates for B. anthracis and Y. pestis, respectively. The antimicrobial susceptibility testing (AST)s were performed using Mueller Hinton Agar (MHA) for B. anthracis and Y. pestis and Cystine Heart Agar (CHA) for F. tularensis.

Blood cultures ml of human blood spiked with bacteria at defined concentrations were incubated in BACTEC Plus+aerobic/F vials (BD 442192). The blood cultures were shaken at 180 rpm at 37°C in a New Brunswick Scientific C76 water bath for various time periods.

Environmental sampling An area of 20x20 cm2 was sampled using 2 PBS damped cotton swabs and one dry swab. The 3 swabs were placed in a 50ml tube containing 5 ml PBS and vigorously vortexed. The sample was left for 5 n1inutes to allow for large particles sedimentation.

For further purification the sample was filtered through a 1.2 pm filter. _ 16 _ Antibiotics Doxycycline (Sigma D—9891) and ciprofloxacin (Teva).

Preparation of MAPt plates Agar media (a different medium was used for each type of bacteria, as indicated above) were prepared according to the manufacturer's instructions. Following autoclaving the agar was chilled to 50°C and 40 ml were aliquoted to a 50 ml tubes where the tested antibiotic was added. 200 pl of the antibiotic—supplemented agar was divided into 96 wells plate in serial dilutions.

MAPt assay Ten microliter of the tested sample were placed in the appropriate well in the MAPt plates. The MAPt plates were incubated at the appropriate temperature (28°C for Y. pestis and 37°C for B. anthracis and F. tularensis) for the time period required for each bacteria and source of sample (bacterial culture, clinical sample or environmental sample) — as described in the Examples below.

Extraction of bacteria from MAPt plates At the end of the incubation period 150 pl of PBS were added to each well to recover the bacteria growing on the agar surface. 100 pl of the recovered bacteria were added to 100 pl of Triton buffer (20% Triton—X—l00 in TE (Sigma)) and the sample was heated for 30 minutes in order to sterilize the sample. A sample of 5 pl was further processed by a qPCR reaction using a 7500 Real—Time PCR system (Applied Biosystems). qPCR reaction 12.5 pl SensiFAST Probe lo—ROX Mix (Bioline BIO84005) 3 pl Primer F (5 pmol/pl) 3 pl primer R (5 pmol/pl) 1.5 pl Probe (5 pmol/pl) Primer list (see Table 1) Real time PCR program: 95°C 3 min. _ 17 _ 40 cycles of 95°C 15 seconds and 60°C 35 seconds Determination of MIC Value Bacterial quantification by qPCR was determined by the Ct values which were extracted by the 7500 real—time PCR system Sequence Detection Software. The Ct value is the PCR cycle at which the sample’s reaction curve intersects the threshold line, which represents the level of fluorescent intensity that is above background levels. The relative difference in bacterial counts between growth control and tested antibiotic concentration was determined by the ACt, where ACt is the difference between the Ct of sampled bacteria in the antibiotic well compared to the Ct of the sampled bacteria in the growth control. As l—log difference between the antibiotic treated group to the untreated sample is reflected by a ACt of log21O=3.3, a ACt greater than 3.3 were considered as growth inhibited samples.

Example 1: MAPt is applicable at a wide range of bacterial concentrations MIC determination by MAPt was applied to three representative bacteria: Bacillus anthracis a fast growing gram + bacteria, Y. pestis a gram — bacteria which is slow growing in—vitr0 and fast growing in—viv0, and the fastidious F. tularensis, a gram — bacteria which is slow growing both in vitro and in vivo.

Francisella tularensis F. mlarensis MIC determination from clinical or environmental samples using standard procedures for isolation, enrichment and AST requires at least 6 days.

A range of F. tularensis LVS bacterial concentrations was applied to MAPt and the MIC was determined after 16 h by using qPCR (at this time period a 2—log change in growth is expected in the untreated bacteria, based on the bacteria generation time). As can be seen in Figure 1, at all bacterial concentrations tested, the MIC values obtained by MAPt were similar to the MIC values obtained by the classical microdilution test (ciprofloxacin 0.008—0.031 pg/ml, doxycycline O.125—O.5 pg/ml) which requires a defined recommended bacterial concentration. In sum, MAPt is applicable on a wide range of F. tularensis bacterial concentrations, thus determination of bacterial concentration is superfluous. Notably, correct MIC values were obtain even at sub—standard concentrations of F tularensis, i.e. 104 cfu/ml, omitting the need for bacterial enrichment 1:01‘ [hOS€ concentrations. _ 18 _ Y. pestis Y. pestis grows rapidly within the host, yet, is slow growing in vitro. As a result a conventional AST for this bacteria requires approximately 2 days and thus may not meet clinical relevance.

In contrast, using the method of the invention, similar MIC values for ciprofloxacin and doxycycline were obtained for a wide range of bacterial concentrations (Figure 2A, 2B) after 8 hours of incubation. Thus obviating the need for lengthy culturing of the bacteria in order to reach a minimal concentration, as required for the conventional assays.

B. anthracis Next, the MAPt assay was examined with the fast—growing bacteria B. anthracis.

Four—log concentrations of B. anthracis were subjected to MAPt and MIC values were determined within 4 hours of incubation, following a qPCR reaction. The MIC values obtained by MAPt (Figure 3), were similar to the ones obtained by microdilution (ciprofloxacin :0.03l—0.063 pg/ml and doxycycline :0.03l—0.063 pg/ml) at a wide range of B. anthracis concentrations (from 104 cfu/ml up to l()7cfu/ml).

These results show that MAPt is a bacterial concentration—independent AST for both gram—negative as well as gram—positive bacteria and for fast—growing as well as for slow—growing bacteria.

Example 2: Application of MAPt on spiked blood culture samples Blood cultures are a major enrichment source for clinical bacterial isolation. Thus, the MAPt assay was applied on blood culture samples spiked with various concentrations of F. tularensis LVS. The spiked blood was transferred into BACTECTM Plus Aerobic/F Culture vials and incubated at 37°C to allow for bacterial growth. The blood cultures were harvested at various time points to allow growth to different bacterial concentrations. Ten microliters of the harvested samples were plated in the appropriate wells of a MAPt plate (prepared as described in materials and methods above). The MAPt plate was incubated for 16 hours at 37°C. Following, the samples were processed as described in materials and methods. As can be seen in Table 2, a proper MIC of 0.008—0.0l 6 pg/ml was obtained for ciprofloxacin at all bacterial concentrations tested. The MIC values obtained for P/‘:7 doxycyclinewverexa/(PCXQ) (I\/Wginlfldvhesewalueswrewlwhewangewfwhewalueswbtainedw byvshexstandardxmicrodilutionwssayfigvigurexfixiswxschematicxxepresentationwfinnewfwhew b1o0dwu1ture\samples0 Table.d" MIC.values.of.F.8'ularensis.LVS.spiked.blood.cultures.obtained.by.MAPt Bacterial MIC.1figsmlu concentratiommfusmlu Ciprofloxacin Doxycycline FWRP) X ) 0 ) 9 ) (PCV WXP) X ) 0 ) 9 ) (PCV P0V5 P(8xP)F )()P3 )(PCV GFXP) F ) () P3 ) (PCV P(FxP) V ) () ) 9 ) (PCV CXP) 8 ) () P3 ) W -W IncubationWime4 \P3h -w > IHwa1ues\1vyxmicrodi1utionBicIiprofloxacin\)z() ) 92) () xP\Agin1(vIIoXycyc1ine\)/(PCXQ) UWV "gin10 +imi1ar1y(\X8S1estiswpiked\b1oodvwasxtransferredxjntoxfiKH’ QHTM\3v1us\Kerobici w Hu1turew2ia1s\and\isncubated\atvv8°H\1so\a»11owvEor\kracteria1\g2rowth0\kzrocessingxvfvshesew bloodwulturesvwasxdronewsxforxiifitlarensisxlvloodwultureswxceptxthatvshew K‘ txplatesw were\incubatedwt\£Z9°Hwsee\materia1swI1d\methodsI0\5sheW IHwa1uesvEo1wiprofloXacinw obtainedxbyw K' twvere\3'() P32) 0 XCv|aginlwnd\)'W\1aginl\Jbr\d0Xycyc1ine(wtwllxbacterialw concentrationsxtestedw’ ablewlwvhesewaluesxsorrespondw)xthexiv IHwa1ueswbtainedxibyw thexnlassica1\microdi1ution\narethod0\3vhesevesultsxuonfirrnxflaatvvK‘ txmnxbexusedxlsow determineworrectw IHw2a1uesvfitomxbloodwulturesxsamplesxinvwvemarkablyxnapidxtimew comparedxtoxthewlassica1\microdilution\method0 Table.h" MIC.values.of.Yifaestis.spiked.blood.cultures.obtained.by.MAPtp Bacterial MIC.1pgsmlu concentratiommfusmlu Ciprofloxacin Doxycycline FXP) F ) () xC ) UV / (BXP) V ) () P3 ) W FxP)3 )()P3 )0v FXP) 8 ) O XC ) W -W IncubationWime4 \P3h -w > IHVxa1ues\hy\m'icrodi1utionE\Hiprofloxacin\)x© ) 92) () xP\p»gin1(\Js/oxycycline ) (CV2P\pgin1 Example.h".Application.of.MAPt.on.spiked.whole.blood.samples 6 loodwultureswewmeansvfiorwnrichmentwfiwparsexlsvloodwamplesfisivhexnesultsw obtained\fm\Qxamp1e\€7\sh0w\1shat\7V IH\deterrnination\i8\fv:asib1ewzvenxatxiviwxbacterialw concentrationsOdvherefore(xirnvshexfollowingwxamplevshexmethodvwasxperformedvwithoutw thexazrichmentxscepvsfxtransferringxklzoodxsarmplesximoxkloodxwlunexbattlesfisidzew enrichmentxsfcepvshroughxibloodwulturexbottlesxisxtimewonsuxningxandwlayxtakexhoursxtow daysvshusxitswlimination\i2swdvantage0us0 ’ 0vh>is\z1ard(\wh01e\1mInan\kl'oodvwasxspikedvwithxiiifilarensisxatzwariousw conc entrations Ovbenvnicrolitersxufxtllexspike dxbioodwerexwbj ectedxmxfla evxppropriatew wellswfiaw K‘ t\p1ate\fio11owing\R8\houIswf\&ncubationwtw8°Hwnd\fiu.rtherxprocessingwsw previouslyxdcscribedfldwtblexfixsummarizes\1\he\>VIHvxalues\nbtained\hyx>VK' tvuvhichw correspondw0\thewneswxpected0 Table.0 ".N[IC.values.of.F3§'ularensis.spiked.whole.blood -W IncubationWime4 \P3\h -w > IHVxa1ues\hyvxricrodi1utionE\HiprofloXacin\)x© ) 92) () xP\pg5n1(\Jvoxycyc1inew ) (PCXQ) Wxpginl +irni1ari1y(\humanvuvho1e\h}oodvuvasxspikedwith\i(i$’estis\and\B'3.fi1thracis\atw variousxarmcentrations0\5seI1\rnzi'cro1itervs‘§\the\sp&ked\k1ood\was\subj ectedxtvxthcw appropriatevwellswfww K‘ t\p1ate\£o11owing\R3\houIs\vfimcubationwt\Q9°H\for\¥3$estisw andv1t\xz8°H\fiar\B'i€'nthracis\£ollowedxhyxfiartherxprocessingvssxpreviouslyvicscribedfiw ’ ablexfixwmmarizesvshexia IHWa1ueswbtained\1vyver K‘ t\£orvE3$estis\a2ndv’vable\32\£o1'\B3N anthracisvwhichworrespondxtoxthewneswxpected\bywtandard\K+’ s0 Table.v".MIC.values. of. Y3§1estis.spiked.whole.blood Bacterial MIC.1pgsmlu concentratiommfusmlu Ciprofloxacin Doxycycline FXP) X ) () P3 P P03T1‘P)F )()P3 )w 2\(zC\£I xxP)F )()P3 P P(FxP)V )()P3 P W3 P(kxP)3 )()P3 )w P(FxP)9 )())9 P -W Incubation\time4 \P3h -w > IHvxa1ues\hyvnicrodi1utionE\Hiprofloxacinxfl)) 92) () xP\p»gin1(\Jvoxycyc1ine\)\kLV2Pw pginl Table.y".MIC.values.of.B3§nthracis.spiked.whole.blood Bacterial MIC.1pgsmlu concentratiommfusmlu Ciprofloxacin Doxycycline xxP) 8M ) (PCV ) 0 XP xxP) 3M ) () xP ) () xP xxP) \/M ) 0 XP ) 0 XP PW“ )0xP )0xP WM )0xP )0xP -w Mncubationwime4 8h\Nk>IncubationwimeEP3h -w > IHvxa1uesxhyvnicrodilutionlisfliprofloxacinxéxf) XP2) (PCV\pgin1(\Jv0xycyc1ine\).(') P3 )0 3X‘1’Sg5I11 ’ hesewzsultsxindicatexthatw K‘ txiswpplicablexfinwvhole\b1oodwamp1es0 Example.0’EApplication.of.MAPt.on.environmental.samples Invyantrastxuxxhkoodxsarnples(vwvllichxavexhomogenous\tV\the\tested\1sacteria(w environmentalxsampleswedweterogenousxandwontainxmanyxspecieswfinlicroorganismsw zbacteriavwidxfimgusxfvnaxampleI0\hr\fl:{eVwventiona1\Kz+’ sfithexpresencexafxtxhesew contaminatorsxiinwuscstedxzsamplexmaywltervshexier IHwa1uewvfxthe\mrget\bacteria0W K‘ tw waswapablewfidetennmingwwonectw IHwalue(\£or\ciprofloxacinwndxdoxycycline(wvenw inwhexpresencewf\contarr1inators(ws\n7achxbacterialxgrowthxmwhevwellvwaswontainedwiuew towhexuhortxizncubationwimewndwhewlsewofxawolidwurfacelwswpposedxtowhewnixedxgrowthw inxiiaqujdxmediafidvhevspecificxprimersxufizmxflnexisargetxisacteria\proVidedvw3pecific\Kz+’ w focousingwnlywmthexxargetxbacteria0 Gig, ’ hexexperimentvwasxperforrnedwvith\i3fialarensis3i/his\ibacteria\&zswwl0w2growingw bacteria(Vshereforewhewontarrlinatonbacteriavwithinwhewnvironmentalwamplewrewsuallyw muchxfasterxgrrowing\1shan\i47i?alarensis1\and\mayxisakexvverxdruringvslrlexfi/9Zaxisncubationw periodfiishusvshexier IHwa1uewbtainedx1vy\the\s7candard\K+’ sxdoeswotwepresenmhatwfxijv tularensisizlluringxthew K‘ twssay(vwhich\isw1uch\shorter\xP3xhourslfithewontaminatorsw havextcsswimewoxtakewventliewultmefiiv oreoVer(ws\bacteria\growthwnwgarwswontainedw withinwwo1ony(\n/ontaminatingxlsvacteriawannotvsakewver(\andwach\bacteriaxisxtcstedwnw itswwn0\6'ywsingxfijiflalarensis2specific\primers(xthesewontarninatorsxarewotxscoredwndw thewbtainedw IHworesponds\M11y\1so\iiWalarenis3dvable\8>w1mmerizes\1s}1e\ieIIHwaluesw obtainedvwithxiifialarensiswpikedwnviromentalwamples0 Table.“/‘.Adequate.N[IC .values.of.F.i‘Iularenis-obtained.from.spiked.enviromentalw samplesp Geographic Concentration - of Concentration - of NIIC source - of- the F S tularensis contaminators Ihgsmlu sampe Infusmlu Infusmlu Ciprofloxacin Doxycycline Xehovot P(BxP) s 80‘/XP) s ) () ) s ) (POM (CV N iryatw alachi F0‘/XP) s P)3 ) Q) s )(POE) (IN N asfina X0 XP) s F0‘/KP) s ) () ) s2) () P3 ) (PCV junction Xishomfl ezion F0‘/XP) s P(I3;P) F ) () ) s ) (CV Xishonv?/ezion P(M(P) s P) V )() ) s2) () P3 )(I3@ W Xamla 3xP) 8 XXP) 3 )0 P3 ) (IN Xamla 3xP) 8 P(I3(P) 8 )0 P3 )(PCV %rusa.lem x(BxP) 8 P(PxP) V ) () P3 ) (IN %rusa.lem P(PxP) s P) F ) Q) s ) (IN %rusa.lem SCBXP) 8 O essxthanxfl) F ) Q) s ) (IN +adg‘Iuncti0n XXP) s F0./RP) C )() ) s2) () P3 )(PGE) (IN Xeyimxjunction C0‘/KP) s / P ) () ) s2) () P3 ) (POE) (IN "irim C0‘/kP)s xxP)x )())s2)()P3 )(POE)(IN Aaffo (3;P)s 3xP)M )())s )(I3V Aaffo C(PxP)s FxP)C )())s2)()P3 )W ’ elzaviv P0»/RP) s P(FxP) 3 ) () P3 )W -\Ia1ua:bationWime4 (Ih Example.v".Application.of.MAPt.for.antifungal.susceptibility.testing MICs are determined by the MAPt method using solidified RPMI—1640 medium (Gibco BRL, Grand Island, N.Y.) as described by Yoshida et al, 1997 (Antimicrobial Agents and Chemotherapy, p. 1349-1351 Vol. 41, No. 6) for agar dilution testing. A double concentration of RPMI—1640 is prepared with 0.3 M morpholinepropanesulfonic acid buffer (pH 7.0), sterilized by filtration through a membrane filter (pore size, 0.45 mm), and mixed with equal volume of 3.0% agar which is autoclaved at 121°C for 15 min and kept at 55°C. The agar medium is then poured into microtiter plates containing serial dilutions of antifungal agents dissolved in dimethyl sulfoxide and is solidified.

Fungal samples are then placed in each well of the MAPt fungal plates and incubated for the time required for 2 orders of magnitude in growth.

Extraction of bacteria from the MAPt plates At the end of the incubation period 150 pl of PBS are added to each well to recover the fungi growing on the agar surface. 100 pl of the recovered fungi are added to 100 pl of Triton buffer (20% Triton—X—100 in TE (Sigma) and the sample is heated (100°C) for 30 minutes in order to sterilize the sample. A sample of 5 pl is further processed by a qPCR reaction using a 7500 Real—Time PCR system (Applied Biosystems). gPCR reaction: 12.5 pl SensiFAST SYBR Lo—ROX Mix (Bioline BIO—94005) 3 pl Primer F (5 pmol/pl) 3 pl primer R (5 pmol/pl) 1.5 pl H20 Primer list: Suitable primers for testing Candida are known in the art, for example in Zhang et al Microbiol. Insights 2016; 9:21-28. A non—limiting example for a forward primer is GCAAGTCATCAGCTTGCGTT (SEQ ID NO: 10), and a non- limiting example for a reverse primer is TGCGTTCTTCATCGATGCGA (SEQ ID NO: 11).

Real time PCR program: 95°C 3 n1in. 40 cycles of 95°C 15 seconds and 60°C 35 seconds Determination of MIC value Fungal quantification by qPCR is determined by the Ct values which are extracted by the 7500 real—time PCR system Sequence Detection Software. The Ct value is the PCR cycle at which the sample’s reaction curve intersects the threshold line, which represents the level of fluorescent intensity that is above background levels. The relative difference in fungal counts between growth control and tested antibiotic concentration is determined by the ACt, where ACt is the difference between the Ct of sampled fungi in the antibiotic well compared to the Ct of the sampled fungi in the growth control. As l—log difference between the antibiotic treated group to the untreated sample is reflected by a ACt of log2l()=3.3, a ACt greater than 3.3 is considered as a growth inhibited sample.

Claims (23)

CLAIMS:

1. A method for determining antimicrobial susceptibility of a microorganism, comprising: (a) Incubating a sample on a solid growth substrate containing at least one antimicrobial agent at Varying concentrations; (b) recovering the microorganism growing on the solid growth substrate surface; and (c) determining the microorganism quantity using a method selected from the group consisting of: a nucleic acid—based method, an immunological method, a metabolism—based method, mass spectrometry, and a combination thereof wherein a difference in the microorganism quantity between samples grown in the presence or absence of an antimicrobial agent indicates antimicrobial susceptibility of the microorganism to the tested antimicrobial agent.

2. The method of claim 1 further comprising determining the Minimal Inhibitory Concentration (MIC) Value of said antimicrobial agent and/or determining susceptibility categories.

3. The method of claim 1 or claim 2 wherein said microorganism is a bacterial strain selected from the group consisting of B. anthracis, Y. pestis, and F. tularensis.

4. The method of claim 1 or claim 2 wherein said microorganism is a bacteria or fungus causing a nosocon1ial infection.

5. The method of claim 1 or claim 2 wherein said microorganism is selected from the group consisting of: Clostridium diflicile, carbapenem—resistant Enterobacteriaceae (CRE), Neisseria gonorrhoeae, Multidrug—resistant Acinetobacter, Drug—resistant Campylobacter, F luconazole—resistant Candida, Extended spectrum ,6—lactamase producing Enterobacteriaceae (ESBLs), Vancomycin—resistant Enterococcus (VRE), M ultidrug—resistant Pseudomonas aeruginosa, Drug—resistant non—typhoidal Salmonella, Drug—resistant Salmonella Typhi, Drug-resistant Shigella, Methicillin—resistant Staphylococcus aureus (MRSA), Drug—resistant Streptococcus pneumoniae, Drug- resistant tuberculosis, Vancomycin—resistant Staphylococcus aureus (VRSA), and Drug- resistant Group A and B Streptococci.

6. The method of any one of the preceding claims wherein said sample is a biological sample obtained from a subject, or an environmental sample. -27-

7. The method of claim 6 wherein said biological sample is selected from a group consisting of blood, plasma, serum, lymph nodes, urine, feces, saliva, cerebrospinal fluid, lung aspirate, peritoneal lavage, sperm, nasopharyngeal swabs and a tissue biopsy.

8. The method of claim 7 wherein said blood sample is a whole blood sample or a fractionated blood sample.

9. The method of any one of claims 6 to 8 wherein said subject is a human subject.

10. The method of claim 6 wherein said environmental sample is collected from roads, sidewalks, grass, ponds, floors, appliances, air, water or soil.

11. The method of any one of the preceding claims wherein said solid growth substrate is selected from the group consisting of agar, polyacrylamide hydrogel, gelatin, paper and membrane.

12. The method of claim 11 wherein said solid growth substrate is Cystine Heart Agar (CHA) or Muller—Hinton agar (MHA).

13. The method of any one of the preceding claims wherein said solid growth substrate further comprises additional nutrients.

14. The method of any one of the preceding claims wherein said incubation step (a) is performed at a temperature of between about 28°C and about 37°C.

15. The method of any one of the preceding claims wherein said antimicrobial agent is an antibiotic agent selected from the group consisting of tetracyclines (e.g. doxycycline), fluoroquinolones (e.g. ciprofloxacin), penicillin (e.g. ampicillin), cephalosporin (e.g. ceftriaxone), macrolides (e.g. erythromycin, azithromycin), aminoglycosides (e.g. gentamycin), monobactams (e.g. aztreonam), carbapenems (e.g. in1ipenem), metronidazole, chloramphenicol, vancomycin, and rifampin.

16. The method of any one of the preceding claims wherein said sample was not diluted prior to incubation step (a).

17. The method of any one of claims 1 to 15 wherein said sample was not subjected to a culturing step, and/or an enrichment step, and/or a separation step, prior to incubation step (a).

18. The method of any one of the preceding claims wherein bacterial concentration in the sample is not determined prior to incubation step (a).

19. The method of any one of the preceding claims wherein said sample contains between about 5x103 to about 108 colony forming units (cfu)/ml. -28-

20. The method of any one of the preceding claims wherein said incubating step (a) is performed in a multi—well plate comprising said solid support substrate.

21. The method of any one of the preceding claims wherein no prior identification of the bacterial strain is performed.

22. The method of any one of the preceding claims wherein the determination of bacterial quantity is performed using a qPCR reaction.

23. The method of claim 22 wherein the qPCR reaction is performed using bacteria- specific primers or using universal primers. Figure 1: I 1E4/ml I 1E5/ml 2 1E6/ml 2 1E7/ml Z 1E8/ml 1/2 Act 15 10 K 1E4/ml I 1E5/ml 2 1E6/ml I 1E7/ml Z 1E8/ml Act 0.004 0.008 0.016 0.031 Ciprofloxacin (pg/ml) Figure 2: 1E4 1E5 1E6 1E7 Ciprofloxacin conc. (pg/ml) 0.063 0.125 0.0625 ¢°c° 9'8) 9“? 6°“) 5"?’ 19° 0.125 0.25 0.5 1 2 Doxycycline (pglml) Q 6 § 6‘ Q‘ Q Q’ 6?) 9 Doxycyclin conc. (pg/ml) 2/2 Figure 3: ‘b 6 N '5 6 6 ‘Z: 6 N '5 6 Q Q B Q 6 § '\ '5 Q) 5'} "3 Q N 65 Q9) 5'} Q2? 9§ QB 99 £39 §-° $7’ 09 ¢~° Q9 9 9’ ¢?’ N9 ¢-° e9 w 9- 9 Q N '1; ta- Ciprofloxacin (pglml) Doxycycline (p.g/ml) Fig u re 4: 15- — Doxycycline f Ciprofloxacin o'1'o°‘o"’~°rb"65'ff"13’§’ " '1’ °‘ Antibiotic conc. (pg/ml)