WO2021084539A1 - A method for determining bacterial susceptibility to antibiotics - Google Patents

A method for determining bacterial susceptibility to antibiotics Download PDF

Info

Publication number
WO2021084539A1
WO2021084539A1 PCT/IL2020/051129 IL2020051129W WO2021084539A1 WO 2021084539 A1 WO2021084539 A1 WO 2021084539A1 IL 2020051129 W IL2020051129 W IL 2020051129W WO 2021084539 A1 WO2021084539 A1 WO 2021084539A1
Authority
WO
WIPO (PCT)
Prior art keywords
microorganism
sample
resistant
bacteria
bacterial
Prior art date
Application number
PCT/IL2020/051129
Other languages
French (fr)
Inventor
Ronit ALONI-GRINSTEIN
Ohad SHIFMAN
Moshe Mois AFTALION
Shahar Rotem
David Gur
Original Assignee
The Israel Institute of Biological Research (IIBR)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Israel Institute of Biological Research (IIBR) filed Critical The Israel Institute of Biological Research (IIBR)
Publication of WO2021084539A1 publication Critical patent/WO2021084539A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
    • C12Q1/045—Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
    • C12Q1/06—Quantitative determination
    • C12Q1/08—Quantitative determination using multifield media
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/18—Testing for antimicrobial activity of a material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2500/00—Analytical methods involving nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • This invention relates to methods for rapidly identifying and quantifying the efficiency of antimicrobial agents.
  • Antibiotic resistance is one of the major threats to global health and leads to 700,000 deaths yearly worldwide. Experts predict that by 2050 this number can rise to 10 million.
  • Bacillus anthracis and the fastidiously growing bacteria Yersinia pestis and Francisella tularensis are all Tier 1 agents causing anthrax, plague and tularemia respectively.
  • tularemia Boisset et al., 2014
  • plague Pieris et al., 2016
  • antibiotics should be administered as well, to combat the bacteria until sufficient anti-anthrax antibody titer is developed.
  • antibiotics are the first choice treatment one should bear in mind that high level fluoroquinolone-resistant mutants of F.
  • tularensis can be easily and quickly obtained (Sutera et al., 2014) and some may even share cross-resistance to other clinically relevant antibiotic classes. Fikewise, strains engineered for resistance to tetracycline or multidrug resistance have been generated for B. anthracis (Pomerantsev et al., 1992; Stepanov et al., 1996). Moreover, plasmid-mediated single and multiple drug-resistant strains of Y. pestis have been isolated from patients (Galimand et al., 2006). Rapid identification of the bacterial agent and prompt determination of adequate treatment is mandatory for the handling of potential exposure and constrained management.
  • AST antimicrobial susceptibility testing
  • Anthrax progression is fairly rapid and causes death if proper treatment is not initiated within 24h of symptom onset (Woods, 2005).
  • inhalation of Y. pestis bacteria results in a rapidly progressing disease that is transmittable from person to person. If treatment does not start within 18 to 24 hours after symptoms onset high mortality rates are observed (Inglesby et al., 2000). In pneumonic tularemia symptoms develop 3 to 5 days post exposure and mortality rates may reach 60% (Gill and Cunha, 1997). It should be noted that the need for prompt susceptibility determination is relevant to all clinical bacteria, in order to provide efficient treatment and to avoid generation of resistant bacteria.
  • the conditions for performing AST are defined by standard guidelines, such as the ones published by the CLSI and EUCAST. According to these guidelines a defined concentration of a homogenous bacterial suspension is a prerequisite. Taking in account the time required to isolate and enrich the bacteria, together with the time required to perform an AST (approximately 40 hours for B. anthracis, approximately 48 hours for Y. pestis and about 96 hours for F. tularensis ) with respect to disease progression to death, there is a clear need for the development of novel rapid ASTs for these bioterror agents as well as for other clinically relevant bacteria.
  • Pathogens can be found in various clinical specimens.
  • B. anthracis, Y. pestis and F. tularensis can be found in blood, urine, CSF, lymph nodes and more.
  • bacterial concentrations in these specimens may vary considerably and be too low, especially in the early stages of the disease, culturing is required for bacterial enrichment, in order to perform an AST.
  • clinical samples contain various assay inhibitors such as human cells, mucus, non-relevant bacteria, chemical substances and more, therefore direct transfer of the specimen to AST is not feasible.
  • ASTs require a defined initial concentration of bacteria, however, optical quantification of the bacteria within the clinical specimen is not feasible.
  • this procedure can take between a day and a half and up to a few days, depending on the type of bacteria and the source of specimen tested.
  • the patient continues to receive a broad-range antibiotic treatment, increasing the chance for development of antibiotic resistance and decreasing the chance of healing in case the antibiotic is not relevant.
  • Such an AST will reduce the time to obtain a proper antibiotic treatment recommendation. This will decrease the use of broad range and/or irrelevant antibiotics which contribute to the increase of global antibiotic resistance.
  • the present invention provides a method for determining antimicrobial susceptibility of a microorganism, comprising:
  • determining the microorganism quantity using a method selected from the group consisting of: a nucleic acid-based method, an immunological method, a metabolism-based method, mass spectrometry, and a combination thereof, wherein a difference in the microorganism quantity between samples grown in the presence or absence of an antimicrobial agent indicates antimicrobial susceptibility of the microorganism to the tested antimicrobial agent.
  • said recovery step (b) is performed before the microorganism can be visualized on the solid growth substrate.
  • said recovery step (b) is performed at a predetermined time point.
  • the method further comprises determining the Minimal Inhibitory Concentration (MIC) value of said antimicrobial agent and/or determining susceptibility categories.
  • MIC Minimal Inhibitory Concentration
  • said microorganism is a bacterial strain selected from the group consisting of B. anthracis, Y. pestis, and F. tularensis.
  • said microorganism is a bacteria or fungus causing a nosocomial infection.
  • said microorganism is selected from the group consisting of: Clostridium difficile, carbapenem-resistant Enterobacteriaceae (CRE), Neisseria gonorrhoeae, Multidrug-resistant Acinetobacter, Drug-resistant Campylobacter, Fluconazole-resistant Candida, Extended spectrum b-lactamase producing Enterobacteriaceae (ESBLs), Vancomycin-resistant Enterococcus (VRE), Multidrug- resistant Pseudomonas aeruginosa, Drug-resistant non-typhoidal Salmonella, Drug- resistant Salmonella Typhi, Drug-resistant Shigella, Methicillin-resistant Staphylococcus aureus (MRSA), Drug-resistant Streptococcus pneumoniae, Drug-resistant tuberculosis, Vancomycin-resistant Staphylococcus aureus (VRSA ), and Drug-resistant Group A and B Streptococci.
  • CRE carbapenem-resistant Enterobacteriaceae
  • said sample is a biological sample obtained from a subject, or an environmental sample.
  • said biological sample is selected from a group consisting of blood, plasma, serum, lymph nodes, urine, feces, saliva, cerebrospinal fluid, lung aspirate, peritoneal lavage, sperm, nasopharyngeal swabs and a tissue biopsy.
  • said blood sample is a whole blood sample or a fractionated blood sample.
  • said subject is a human subject.
  • said environmental sample is collected from roads, sidewalks, grass, ponds, floors, appliances, air, water or soil.
  • said solid growth substrate is selected from the group consisting of agar, polyacrylamide hydrogel, gelatin, paper and membrane.
  • said solid growth substrate is Cystine Heart Agar (CHA), or Muller- Hinton agar (MHA).
  • said solid growth substrate further comprises additional nutrients.
  • said incubation step (a) is performed at a temperature of between about 28°C and about 37°C.
  • said antimicrobial agent is an antibiotic agent selected from the group consisting of tetracyclines (e.g. doxycycline), fluoroquinolones (e.g. ciprofloxacin), penicillin (e.g. ampicillin), cephalosporin (e.g. ceftriaxone), macrolides (e.g. erythromycin, azithromycin), aminoglycosides (e.g. gentamycin), monobactams (e.g. aztreonam), carbapenems (e.g. imipenem), metronidazole, chloramphenicol, vancomycin, and rifampin.
  • tetracyclines e.g. doxycycline
  • fluoroquinolones e.g. ciprofloxacin
  • penicillin e.g. ampicillin
  • cephalosporin e.g. ceftriaxone
  • macrolides e.g. erythromycin, azithromycin
  • said sample was not diluted prior to incubation step (a).
  • said sample was not subjected to a culturing step, and/or an enrichment step, and/or a separation step, prior to incubation step (a).
  • bacterial concentration in the sample is not determined prior to incubation step (a).
  • said sample contains between about 5xl0 3 to about 10 8 colony forming units (cfu)/ml.
  • said incubating step (a) is performed in a multi-well plate comprising said solid support substrate.
  • no prior identification of the bacterial strain is performed.
  • the determination of bacterial quantity is performed using a qPCR reaction.
  • the qPCR reaction is performed using bacteria-specific primers or using universal primers.
  • the present invention provides a kit comprising:
  • At least one multiple well plate comprising at least one solid growth substrate containing at least one antimicrobial agent at varying concentrations
  • the present invention provides a kit for use in the methods of the invention, wherein said kit comprises:
  • At least one multiple well plate comprising at least one solid growth substrate containing at least one antimicrobial agent at varying concentrations
  • said at least one detectably-labelled microorganism-specific probe is a TaqMan probe (e.g. FAM-Seq ID:3-BHQ1, FAM-Seq ID:6-BF1Q1, FAM-Seq ID:9-BHQ1).
  • said at least one detectable identification agent is a non-specific intercalating dye (e.g. SYBR green).
  • Fig. 1 is a schematic representation showing ACt obtained by qPCR, following 12-h treatment with ciprofloxacin (Fig. 1A) or doxycycline (Fig. IB) on bacterial samples of F. tularensis, ranging in concentrations from 10 4 -10 8 cfu/ml (lE4-lE8/ml). The MIC values were defined as the lowest antibiotic concentration where ACt >3.3 (threshold dashed line).
  • Fig. 2 is a schematic representation showing ACt obtained by qPCR, following 8- h treatment with ciprofloxacin (Fig. 2A) or doxycycline (Fig. 2B) on bacterial samples of Y. pestis, ranging in concentration from 10 4 -10 7 cfu/ml (lE4-lE7/ml).
  • the MIC values were defined as the lowest antibiotic concentration where ACt>3.3 (threshold dashed line).
  • Fig. 3 is a schematic representation showing ACt obtained by qPCR, following 4- h treatment of ciprofloxacin (Fig. 3A) or doxycycline (Fig. 3B) on bacterial samples of B. anthracis, ranging in concentration from 10 4 -10 7 cfu/ml (lE4-lE7/ml).
  • the MIC values were defined as the lowest antibiotic concentration where ACt>3.3 (threshold dashed line).
  • Fig. 4 is a schematic representation showing ACt obtained by qPCR, following 16-hours treatment of increasing concentrations of ciprofloxacin or doxycycline on 1.4xl0 5 cfu/ml F. tularensis- spiked blood cultures.
  • Fig. 5 is a schematic representation showing ACt obtained by qPCR using universal 16S primers or the F. tularensis- specific primers for thefopA gene , following 16-hours treatment with increasing concentrations of doxycycline (Fig. 5A) or ciprofloxacin (Fig. 5B) on 3.6 x 10 6 CFU/ml (Fig. 5A) or 7 x 10 6 CFU/ml (Fig. 5B) F. tularensis- spiked human blood samples. ACt values were calculated by subtracting the growth control Ct values from the Cts of the samples from the antibiotic-containing wells. DETAILED DESCRIPTION OF EMBODIMENTS
  • the inventors of the present invention developed a new and rapid antibiotic susceptibility test (AST), which decreases greatly the time needed to reach an adequate clinical answer, i.e. results can be obtained within a few hours in contrast with conventional methods which require several days. This provides great advantage at a clinical setting allowing antibiotic susceptibility determination in a clinically relevant timing.
  • AST antibiotic susceptibility test
  • the method of the invention is a quantitative method which measures the microorganism's growth using a quantitative means (e.g. by quantitative PCR, qPCR) but also comprises an initial step in which the microorganism is grown in a solid substrate.
  • the initial step in which the microorganism is grown on a solid substrate is not used for visually assessing growth (as is the case in conventional agar dilution assays).
  • the microorganisms are recovered from the solid substrate to liquid phase, at a predetermined time point and subjected to the quantitative measurement (e.g.
  • the method of the invention is termed herein micro agar PCR test (MAPt).
  • This novel and advantageous method gives significantly added value providing in one step enrichment, isolation and antibiotic susceptibility testing.
  • One of the main drawbacks of the current AST such as classical agar dilution, broth microdilution or disk diffusion-based ASTs is the need for a defined concentration of the target bacteria. This prerequisite defines the need for an isolation step prior to quantification of the tested sample. In case of a diluted sample there is a need to wait for adequate growth (enrichment step), a process that is time consuming especially in slow- growing bacteria.
  • the determination of antibiotic susceptibility and scoring of MIC values is independent of bacterial concentration.
  • the use of bacteria-specific primers in the qPCR step provides sensitivity and specificity and allows quantification of relatively low amounts of bacteria (e.g. as low as ⁇ 10 3 colony forming units (cfu/ml). Due to this high sensitivity the method of the invention (e.g. the MAPt) can be performed with samples comprising relatively low concentrations of bacteria, which is not applicable with the standard ASTs (e.g. the broth microdilution- based assay). Moreover, due to the high dynamic range of the qPCR quantification, the invention is applicable at varying and also at high concentrations of bacterial samples. In a specific embodiment, the concentration of the original tested sample may be as high as 4xl0 9 cfu/ml, way beyond any clinical relevant sample.
  • non-homogenous clinical samples e.g. urine, stool, nasopharyngeal swabs and more
  • environmental samples e.g. urine, stool, nasopharyngeal swabs and more
  • the method of the invention for example the MAPt, can be used with broad-range (universal) primers to determine the susceptibility of the bacteria to the tested antibiotic.
  • MAPt was applied on blood cultures and blood samples spiked with various concentrations of B. anthracis, Y. pestis and F. tularensis, and environmental samples spiked with F. tularensis and showed adequate MIC determination within remarkable time schedules even at low bacterial concentration ( ⁇ 10 3 cfu/ml).
  • a broad dynamic bacterial concentration range allowing to perform concomitantly isolation, enrichment and quantification steps of the assay thus enabling AST determination: 1.1. In shorter times.
  • the agar can absorb inhibitory particles that may be present in the samples (such as in blood or in blood culture media). Accordingly, this can reduce the need for purification steps prior to incubation of the sample on the agar or prior to the qPCR reaction.
  • the use of the method of the invention e.g. MAPt
  • environmental samples can provide the clinician with the ability to choose proper prophylaxis treatment before signs of morbidity.
  • the method of the invention (e.g. MAPt) is applicable on a wide range of bacterial concentrations, different bacteria, and different antibiotics. For example, in the same MAPt assay different samples may be examined or different antibiotics may be explored for the same sample. Moreover, the MAPt for example allows bacterial identification and AST determination in one step using different bacteria-specific primers.
  • the method of the invention is a rapid AST method, applicable on a wide range of bacterial concentrations thus there is no need for bacterial quantification. Moreover, there is no need for an external isolation, or an enrichment step and it can be applied directly on clinical samples such as blood culture and even directly on whole blood.
  • the present invention provides method for determining antimicrobial susceptibility of a microorganism, comprising:
  • microorganism refers to unicellular organisms including, but not limited to, bacteria and fungi.
  • the method of the invention is applicable to any microorganism (e.g. bacterial strain or fungus) capable of growing on a solid surface.
  • the bacterial strain is selected from the group consisting of F. tularensis, Y. pestis, and B. anthracis.
  • the microorganism that is responsible for nosocomial infections such as, Clostridium difficile, carbapenem-resistant Enterobacteriaceae (CRE), Neisseria gonorrhoeae, Multidrug- resistant Acinetobacter, Drug-resistant Campylobacter, Fluconazole-resistant Candida, Extended spectrum b-lactamase producing Enterobacteriaceae (ESBLs), Vancomycin- resistant Enterococcus (VRE), Multidrug-resistant Pseudomonas aeruginosa, Drug- resistant non-typhoidal Salmonella, Drug-resistant Salmonella Typhi, Drug-resistant Shigella, Methicillin-resistant Staphylococcus aureus (MRSA), Drug-resistant Streptococcus pneumoniae, Drug-resistant tuberculosis, Vancomycin-resistant Staphylococcus aureus (VRSA), Drug-resistant Group A and B Streptococci.
  • the bacterial strain is a bacterium responsible for
  • solid growth substrate refers to any solid substrate that can be used for growing a microorganism, e.g. bacteria.
  • the solid growth substrate is selected from the group consisting of agar, polyacrylamide hydrogel, gelatin, paper, and membrane.
  • the solid growth substrate is selected from the group consisting of Muller-Hinton agar (MHA), and Cysteine heart agar (CHA).
  • the solid support substrate is supplemented with nutrients or growth supplements, e.g. hemoglobin, gelatin, IsoVitalex, blood, blood constituents, amino acids, nucleotides, vitamins, NAD, sugars.
  • nutrients or growth supplements e.g. hemoglobin, gelatin, IsoVitalex, blood, blood constituents, amino acids, nucleotides, vitamins, NAD, sugars.
  • the incubation is performed in the optimum temperature range for the tested microorganism, e.g. at about 28°C or about 37°C depending on the type of microorganism tested. In certain embodiments, such as in the case of a biological sample obtained from a patient the incubation is performed at a temperature of 37°C.
  • the method of the invention further comprises determining the Minimal Inhibitory Concentration (MIC) value of said antimicrobial agent and/or determining susceptibility categories.
  • MIC Minimal Inhibitory Concentration
  • susceptibility categories include but are not limited to Susceptible, Intermediate or Resistant.
  • the sample is a biological sample (also referred to herein as a clinical specimen) obtained from a subject, said biological sample selected from the group consisting of blood, plasma, lymph nodes, urine, cerebrospinal fluid, saliva, semen, feces.
  • the blood sample is a whole blood sample.
  • the blood sample is a fractionated blood sample, e.g. plasma or serum.
  • Blood can be fractionated for example by SST (serum separation tubes) (Vacutte Z serum Sep. Clot activator #456005) to obtain the plasma fraction.
  • SST serum separation tubes
  • the sample can be loaded into SSTs and centrifuged for example for 10 minutes at 1700g at 20°C. The upper fraction may be discarded and the bacteria lying on the gel matrix can be recovered with PBS.
  • the term "subject” encompasses any kind of animal, for example, but not limited to, mammalian subjects, avian subjects, reptiles, or fish.
  • the mammalian subject may for example be a livestock animal, e.g. a cow.
  • said subject is a human subject.
  • the sample is an environmental sample obtained for example from roads (including asphalt), sidewalks, grass, ponds, floors, walls, stairs, air condition airways, door knobs, appliances (for example, a computer key board), air, water, wastewater, sewage, or soil.
  • the method of the invention is suitable for testing any antibiotics (also referred to herein as an antimicrobial agent).
  • antibiotics also referred to herein as an antimicrobial agent.
  • Non limiting examples include tetracyclines (e.g. doxycycline), fluoroquinolones (e.g. ciprofloxacin), penicillin (e.g. ampicillin), cephalosporin (e.g. ceftriaxone), macrolides (e.g. erythromycin, azithromycin), aminoglycosides (e.g. gentamycin), monobactams (e.g. aztreonam), carbapenems (e.g. imipenem), metronidazole, chloramphenicol, vancomycin, and rifampin.
  • the antibiotic is doxycycline or ciprofloxacin.
  • the method of the invention can be performed without having any purification, separation or enrichment steps (e.g. by dialysis or immuno- separation, precipitation, centrifugation, filtration, sorting) prior to the incubation of the sample on the solid growth substrate.
  • purification, separation or enrichment steps e.g. by dialysis or immuno- separation, precipitation, centrifugation, filtration, sorting
  • the sample may be incubated on the solid growth substrate without prior fractionation by SST (serum fractionation tube), or FACS (fluorescence activated cell sorter).
  • the time required to determine antimicrobial susceptibility or MIC is largely reduced. While using the methods known in the art the determination of antimicrobial susceptibility and MIC requires several days (e.g. 5 days for F. tularensis), using the method of the invention the time required to determine antimicrobial susceptibility or MIC is reduced to several hours.
  • the period of time to determine antimicrobial susceptibility or MIC in blood, blood cultures or environmental samples of F. tularensis is between about 12 hours and 16 hours; of Y. pestis between about 10 hours and 12 hours, and of B. anthracis is between about 6 hours and 8 hours.
  • These time periods may even be shorter when the antimicrobial susceptibility or MIC are tested from a pure bacterial culture (e.g. 8 hours for Y. pestis, and 4 hours for B. anthracis ).
  • step b The recovery of the microorganism growing on the solid growth substrate surface (step b) may be performed before or after it can be visualized by conventional means.
  • the recovery of the microorganism growing on the solid growth substrate surface (step b) is performed even before the microorganism may be visualized by a conventional means, e.g. by the naked eye or by spectroscopy.
  • a conventional means e.g. by the naked eye or by spectroscopy.
  • the incubation periods before the bacteria can be visualized vary from strain to strain.
  • Non-limiting examples of incubation times are e.g. as described above, namely for F. tularensis between about 12 hours and 16 hours; for Y. pestis between about 10 hours and 12 hours, and for B. anthracis between about 6 hours and 8 hours.
  • said recovery step (b) is performed at a predetermined time point irrespective of visual verification of the microorganism's presence and/or concentration in the solid growth substrate.
  • the predetermined time point varies with different strains of bacteria, as described above.
  • Non-limiting examples of predetermined time points include for F. tularensis between about 12 hours and 16 hours; for Y. pestis between about 10 hours and 12 hours, and for B. anthracis between about 6 hours and 8 hours.
  • the recovery of the microorganism from the substrate may be performed at two separate time points.
  • the first time point is after about 4-8 hours, preferably 6 hours, of incubation on the solid substrate as required for a fast growing microorganism
  • the second time point is after about 14-18 hours, preferably 16 hours, of incubation on the solid substrate as required for a slow growing microorganism.
  • the recovery step (b) refers to the removal of the microorganism from the solid growth substrate.
  • This step can be performed using any suitable solution.
  • Non-limiting examples include PBS, saline, Tris buffer (e.g. Tris EDTA), water or ethanol.
  • the recovery step can also be performed by liquidizing the solid substrate (e.g. the agar or the gel) and recovering the bacteria from the liquidized substrate.
  • the solid substrate e.g. the agar or the gel
  • the sample is optionally heated (e.g. for 30 minutes) for sterilization.
  • the bacterial sample recovered from the substrate may optionally be subjected to a lysis step.
  • the lysis may be performed using any method known in the art, for example using a detergent, by sonication, or bead beater.
  • the quantification step is performed using a method selected from the group consisting of a nucleic acid-based method, an immunological method, a metabolism- based method, mass spectrometry, and any combination thereof.
  • nucleic acid-based method refers to any method known in the art in which the quantification of the microorganism is based on measuring a microorganism's nucleic acid.
  • Non limiting examples include standard PCR, TaqMan and SYBR based PCR, digital PCR (dPCR), RT-PCR, Nucleic acid sequence based amplification (NASBA), Ligation chain reaction (LCR), next generation sequencing (NGS), sequencing, and loop-mediated isothermal amplification (LAMP).
  • immunological method refers to any method known in the art in which the quantification of the microorganism is performed using antibodies.
  • Non limiting examples include ELISA and LACS.
  • metabolism-based method refers to any method known in the art in which the quantification of the microorganism is performed using measurements of cell metabolism. Non limiting examples include measurement of cell respiratory cycles, or any measurable biochemical change that reflects the viability of the microorganism.
  • mass spectrometry refers to an analytical technique that measures the mass-to-charge ratio of components in the sample and is used to elucidate the identity of masses of molecules.
  • the quantification is performed using qPCR reaction.
  • the qPCR reaction can be performed using microorganism-specific primers (for example bacteria-specific primers or fungal specific primers) or using universal primers.
  • microorganism-specific primers for example bacteria-specific primers or fungal specific primers
  • universal primers for example bacteria-specific primers or fungal specific primers
  • Table 1 List of primers suitable for quantification of various bacterial strains
  • Suitable primers for testing fungal strains are known in the art, for example in Zhang et al.
  • a non-limiting example for a forward primer is GCAAGTCATCAGCTTGCGTT (SEQ ID NO: 10)
  • a non-limiting example for a reverse primer is TGCGTTCTTCATCGATGCGA (SEQ ID NO: 11).
  • a "microorganism-specific primer” may be suitable for the identification of one or more similar microorganisms which share partial genetic similarities.
  • a single primer may be used for detecting Enterobacteriaceae.
  • the term "universal primers” refers to broad spectrum primers directed to sequences that appear in a broad range of bacteria and therefore such primers can indicate the presence of bacteria even if the specific species is not identified or known.
  • Such primers include for example the 16S forward primer CCTACGGGNGGCWGCAG (SEQ ID NO: 12) and the 16S reverse primer GACT ACH V GGGTATCT A ATCC (SEQ ID NO: 13) (Klindworth et al., 2013).
  • the qPCR amplification product is then quantified, preferably by a fluorescent signal.
  • the fluorescent signal may be generated by using a detectably labelled microorganism-specific probe or by using a non-specific detectable identification agent.
  • detectably labelled microorganism-specific probe refers to an oligonucleotide probe which is suitable for the identification of one or more similar microorganisms which share partial genetic similarities. For example, a single probe may be used for detecting Enterobacteriaceae.
  • said at least one detectably-labelled microorganism-specific probe is a TaqMan probe (e.g. FAM-Seq ID:3-BHQ1, FAM-Seq ID:6-BHQ1, FAM-Seq ID:9-BHQ1).
  • TaqMan probe e.g. FAM-Seq ID:3-BHQ1, FAM-Seq ID:6-BHQ1, FAM-Seq ID:9-BHQ1.
  • a detectable identification agent is used to quantify the qPCR amplification product.
  • the term “detectable identification agent” refers to any agent capable of interacting with the qPCR product and be visually detected, for example, but not limited to fluorescent interlacing or intercalating dyes, such as SYBR green.
  • the present disclosure provides a kit comprising:
  • At least one multiple well plate comprising at least one solid growth substrate containing at least one antimicrobial agent at varying concentrations
  • the solid growth substrate containing at least one antimicrobial agent at varying concentrations may be prepared according to methods well known in the art, for example as exemplified by the inventors below.
  • the kit according to the present disclosure comprises at least one primer set and at least one detectably labelled microorganism specific probe and/or a detectable identification agent.
  • a person skilled in the art of the invention would be familiar with primers and probes suitable for quantification of various bacterial strains, for example a non-limiting list of suitable primers is provided in Table 1 above.
  • at least one in the context of the kit according to the present disclosure it is meant to refer to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more multiple well plates, primers, probes detecting agents and/or antimicrobial agents.
  • kit of the present disclosure may further include container means for containing separate kit components.
  • kit of the present disclosure further includes at least one solvent or buffer known in the art for recovering the microorganism growing on the solid growth substrate, for example as such exemplified herein below.
  • the present disclosure provides a kit according to the present disclosure for use in the method as herein defined.
  • the method of the invention can be performed with freshly- made plates and/or plates that were stored at 4°C for up to two months, comprising the solid substrate and at least one antibiotics (e.g. freshly made MAPt plates) or with frozen- plates comprising the solid substrate and the at least one antibiotics that were stored at a temperature of below 0°C, preferably -70°C.
  • the MAPt plates are frozen at -70°C for at least one month, at least two months, at least three months, at least four months, at least five months, at least six months, at least seven months, at least eight months, at least nine months, at least ten months, or more.
  • the F. tularensis live vaccine strain (ATCC 29684) was grown on CHA agar (Difco, 5.1% cystine heart agar, 1% hemoglobin) or in cation adjusted Mueller- Hinton broth (CAMHB) (BBL, 212322), supplemented with 2% defined growth supplement (IsoVitaleX Enrichment; BBL 211876) and 3mM hematin (Sigma 3281) (termed HLMHI) at 37°C.
  • the Y. pestis vaccine strain EV76 (Ben-Gurion and Shafferman, 1981) was grown on Brain Heart Infusion agar (BHI-A) (BD Difco 241830) plates at 28°C.
  • Bacillus anthracis D14185 (Cohen et al., 2000) was grown on BHI-A at 37°C. Colony forming units (cfu) counts were determined by platting 100 m ⁇ of serial ten fold dilutions in sterile phosphate-buffered saline (PBS, Biological Industries, Beth Haemek, Israel) on CHA for F. tularensis and BHI-A plates for B. anthracis and Y. pestis, respectively.
  • the antimicrobial susceptibility testing (ASTs) were performed using Mueller Hinton Agar (MHA) for B. anthracis and Y. pestis and Cystine Heart Agar (CHA) for F. tularensis.
  • Human blood (10 ml) spiked with bacteria at defined concentrations were incubated in BACTEC Plus+aerobic/F vials (BD 442192). The blood cultures were shaken at 180 revolutions per minute (rpm) at 37°C in a New Brunswick Scientific C76 water bath for various time periods.
  • a soil area of 20x20 cm 2 was sampled using 2 phosphate buffered saline (PBS) damped cotton swabs and one dry swab.
  • PBS phosphate buffered saline
  • the 3 swabs were placed in a 50 ml tube containing 5 ml PBS and vigorously vortexed. The sample was left for 5 minutes to allow for large particles sedimentation. For further purification, the sample was filtered through a 1.2 pm filter.
  • Agar media (a different medium was used for each type of bacteria, as indicated above) were prepared according to the manufacturer's instructions. Following autoclaving the agar was chilled to 50°C and 40 ml were aliquoted to a 50 ml tubes where the tested antibiotic was added. 200 pi of the antibiotic-supplemented agar was divided into 96 wells plate in serial dilutions.
  • MAPt plates Ten (10) microliter of the tested sample were placed in the appropriate well in the MAPt plates.
  • the MAPt plates were incubated at the appropriate temperature (28 °C for Y. pestis and 37 °C for B. anthracis and F. tularensis ) for the time period required for each bacteria and source of sample (bacterial culture, clinical sample or environmental sample) - as described in the Examples below.
  • Bacterial quantification by qPCR was determined by the cycle threshold (Ct) values which were extracted by the 7500 real-time PCR system Sequence Detection Software.
  • the Ct value is the PCR cycle at which the sample’s reaction curve intersects the threshold line, which represents the level of fluorescent intensity that is above background levels.
  • the relative difference in bacterial counts between growth control and tested antibiotic concentration was determined by the ACt, where ACt is the difference between the Ct of sampled bacteria in the antibiotic well compared to the Ct of the sampled bacteria in the growth control.
  • ACT cycle threshold
  • Example 1 MAPt is applicable at a wide range of bacterial concentrations
  • MIC Minimum inhibitory concentration determination by MAPt was applied to three representative bacteria: Bacillus anthracis, a fast growing gram positive (+) bacteria, Y. pestis, a gram negative (-) bacteria, which is slow growing in-vitro and fast growing in-vivo, and fastidious F. tularensis, a gram negative (-) bacteria, which is slow growing both in vitro and in vivo.
  • F. tularensis MIC determination from clinical or environmental samples using standard procedures for isolation, enrichment and AST requires at least 6 days.
  • MAPt A range of F. tularensis LVS bacterial concentrations was applied to MAPt as detailed above and the MIC was determined after 16 hours by using qPCR (at this time period a 2-log change in growth is expected in the untreated bacteria, based on the bacteria generation time).
  • the MIC values obtained by MAPt were similar to the MIC values obtained by the classical microdilution test (namely ciprofloxacin 0.008-0.031 pg/ml, doxycycline 0.125-0.5 pg/ml) which requires a defined recommended bacterial concentration.
  • MAPt is applicable on a wide range of F.
  • Y. pestis grows rapidly within the host yet is slow growing in vitro.
  • a conventional AST for this type of bacteria requires approximately 2 days and thus may not meet clinical relevance.
  • MAPt assay was examined with the fast-growing bacteria B. anthracis.
  • Four-log concentrations of B. anthracis were subjected to MAPt and MIC values were determined within 4 hours of incubation, following a qPCR reaction.
  • the MIC values obtained by MAPt ( Figure 3) were similar to the ones obtained by microdilution (namely ciprofloxacin: 0.031-0.063 pg/ml and doxycycline: 0.031-0.063 pg/ml) at a wide range of B. anthracis concentrations (from 10 4 cfu/ml up to 10 7 cfu/ml).
  • MAPt is a bacterial concentration-independent AST applicable for both gram-negative as well as gram-positive bacteria and for fast-growing as well as for slow-growing bacteria.
  • Example 2 Application of MAPt on spiked blood culture samples
  • MAPt assay was applied on blood culture samples spiked with various concentrations of F. tularensis LVS.
  • the spiked blood was transferred into BACTECTM Plus Aerobic/F Culture vials and incubated at 37°C to allow for bacterial growth.
  • the blood cultures were harvested at various time points to allow growth to different bacterial concentrations.
  • Ten (10) microliters of the harvested samples were plated in the appropriate wells of a MAPt plate (prepared as described in the materials and methods section above). The MAPt plate was incubated for 16 hours at 37°C. Following, the samples were processed as described in materials and methods.
  • FIG. 4 is a schematic representation of one of the blood culture samples tested.
  • Table 2 MIC values of F. tularemis LVS spiked blood cultures obtained by MAPt
  • Y. pestis spiked blood was transferred into BACTECTM Plus Aerobic/F Culture vials and incubated at 37°C to allow for bacterial growth. Processing of these blood cultures was done as for F. tularensis blood cultures except that the MAPt plates were incubated at 28°C (see materials and methods).
  • the MIC values for ciprofloxacin obtained by MAPt were 0.016-0.032 pg/ml and 0.5 pg/ml for doxycycline, at all bacterial concentrations tested (Table 3). These values correspond to the MIC values obtained by the classical microdilution method.
  • Table 3 MIC values of Y. pestis spiked blood cultures obtained by MAPt.
  • Example 3 Application of MAPt on spiked whole blood samples
  • Blood cultures are a means for enrichment of sparse blood samples.
  • the results obtained in Example 2 above show that MIC determination is feasible even at low bacterial concentrations. Therefore, in the following example the method was performed without the enrichment step of transferring blood samples into blood culture bottles.
  • the enrichment step through blood culture bottles is time consuming and may take hours to days thus elimination thereof is advantageous.
  • Table 4 MIC values of F. tularemis spiked whole blood
  • Table 5 MIC values of Y. pestis spiked whole blood
  • MAPt was capable of determining a correct MIC value, for ciprofloxacin and doxycycline, even in the presence of contaminators, as each bacterial growth in the well was contained (due to the short incubation time and the use of a solid surface) as opposed to the mixed growth in liquid media.
  • the specific primers for the target bacteria provided a specific AST focousing only on the target bacteria.
  • Table 7 MIC values of F. tularenis obtained from spiked enviromental samples.
  • the MIC value was examined in environmental samples spiked with B. anthracis spores without any prior isolation steps. Diverse environmental samples were collected, outdoors and indoors, from different locations at various weather conditions thus maximizing the potential of sampling a variety of contaminants. Table 8 describes the various environmental samples, the load of contaminants versus the concentration of the spiked B. anthracis spores and the MIC values obtained by MAPt. Spiked samples varied from as low as 2xl0 5 up to 2.4xl0 8 cfu/ml B. anthracis. Adequate MIC values, for both ciprofloxacin and doxycycline, were obtained for all environmental samples tested. Similar MIC values were obtained, by broth microdilution, for this strain of B.
  • soil samples were chosen as representatives since these samples are the most challenging ones as they contain the highest number of contaminating microorganisms.
  • the soil samples contained high amounts of naturally occurring Bacillus spp. phylogenetically close to B. anthracis such as B. cereus, B. megaterium, B. thuringensis and B. subtilis (identified by MALDI- TOF), at ratios as low as 1:2 to the spiked B. anthracis spores, and yet, due to specificity of the assay, owing to the primers and probe set used for the PCR which recognize only B.
  • anthracis (SEQ ID NO:l-3) adequate MIC values were obtained without the need for any time-consuming isolation/purification steps. All in all, MAPt was shown to be a rapid and reliable AST method for environmental samples containing B. anthracis spores within a remarkably short time frame, without the need for any prior isolation steps.
  • Table 8 MIC values obtained by MAPt for B. anthracis- spiked environmental samples
  • MAPt plates were incubated for 5 hours at 37°C.
  • Table 9 describes the various environmental samples, the load of contaminants versus the concentration of the spiked Y. pestis and the MIC values obtained by MAPt for each sample.
  • Spiked samples varied from as low as 2xl0 5 up to 2xl0 7 cfu/ml Y. pestis.
  • the ratio of contaminants to Y. pestis was as low as 1:3.
  • MAPt MIC values of 0.5-1 pg/ml for doxycycline and 0.016-0.064 pg/ml for ciprofloxacin were obtained, similar to the ones obtained, by broth microdilution, for the tested bacteria prior to spiking into the environmental sample.
  • soil samples at the ratio of 1:3 contaminants to Y. pestis contained Bacillus and other spp. known to exhibit higher growth rates than Y. pestis. Nevertheless, these contaminants did not interfere with the MAPt assay due to the relatively short incubation time needed for the MAPt assay (lOh).
  • Table 9 MIC values obtained by MAPt for Y. pevi/v-spiked environmental samples
  • Example 5 Application of MAPt for antifungal susceptibility testing
  • MAPt method is also applied for antifungal susceptibility testing.
  • MICs are determined by the MAPt method using solidified RPMI-1640 medium (Gibco BRL, Grand Island, N.Y.) as described by Yoshida etal., 1997 (Antimicrobial Agents and Chemotherapy, p. 1349-1351 Vol. 41, No. 6) for agar dilution testing.
  • a double concentration of RPMI-1640 is prepared with 0.3 M morpholinepropanesulfonic acid buffer (pH 7.0), sterilized by filtration through a membrane filter (pore size, 0.45 mm), and mixed with equal volume of 3.0% agar which is autoclaved at 121°C for 15 minutes and kept at 55°C.
  • the agar medium is then poured into microtiter plates containing serial dilutions of antifungal agents dissolved in dimethyl sulfoxide and is solidified.
  • qPCR reaction mixture composition 100 pi of PBS are added to each well to recover the fungi growing on the agar surface.
  • the recovered fungi (100 m ⁇ ) are added to 100 m ⁇ of Triton buffer (20% Triton-X-100 in TE (Sigma) and the sample is heated (100°C) for 30 minutes in order to sterilize the sample.
  • a sample of 5 m ⁇ is further processed by a qPCR reaction using a 7500 Real-Time PCR system (Applied Biosystems). qPCR reaction mixture composition:
  • Suitable primers for testing Candida are known in the art, for example in Zhang et al Microbiol. Insights 2016; 9:21-28.
  • a non-limiting example for a forward primer is GCAAGTCATCAGCTTGCGTT (SEQ ID NO: 10)
  • a non limiting example for a reverse primer is TGCGTTCTTCATCGATGCGA (SEQ ID NO: 11).
  • fungal quantification by qPCR is determined by the Ct values which are extracted by the 7500 real-time PCR system Sequence Detection Software.
  • the Ct value is the PCR cycle at which the sample’s reaction curve intersects the threshold line, which represents the level of fluorescent intensity that is above background levels.
  • the relative difference in fungal counts between growth control and tested antibiotic concentration is determined by the ACt, where ACt is the difference between the Ct of sampled fungi in the antibiotic well compared to the Ct of the sampled fungi in the growth control.
  • a ACt greater than 3.3 is considered as a growth inhibited sample.
  • AST antimicrobial susceptibility testing
  • 16S forward primer CCTACGGGNGGCWGCAG SEQ ID NO: 12
  • 16S reverse primer G ACT ACH V GGGT ATCTAATCC SEQ ID NO: 13
  • tularensis LVS were spiked into human blood and incubated at 37°C for 5 hours with agitation.
  • the bacteria were then plated in a 96-well CHA plate containing binary dilutions of doxycycline (Fig. 5 A) or ciprofloxacin (Fig. 5B). Following a 16-hours incubation, the bacteria were suspended in 150 pi PBS and 100 m ⁇ were transferred to a new 96-well PCR plate containing 100 m ⁇ of 20% triton buffer. Following a 30-min heating at 95°C, 5 m ⁇ were subjected to qPCR with the F.
  • tularensis-specific primers and probe for the fop A gene namely primers and probe having sequences denoted herein by SEQ ID NOs: 7-9
  • SYBR-based qPCR using the universal 16S primers namely primers having sequences denoted herein by SEQ ID NOs: 12-13.
  • PCR were performed on a QuantStudio 5 Real-Time PCR system using the following PCR program: 95°C 3 min, 35 cycles of 95°C 30 sec, 54°C 30 sec, 72°C 30 sec and 78°C 5 sec. Ct values were extracted by the software based on the optical data that was collected at the 78°C step.
  • the ACt values obtained for the 16S primers were essentially similar to the ACt values obtained for the fopA gene primers when the test was conducted in the presence of doxycycline (Fig. 5 A) and ciprofloxacin (Fig. 5B), indicating that both sets of primers may be used. Furthermore, the MIC values thereby obtained are similar to those described above and to those obtained by the classical microdilution test.
  • Example 7 MAPt may be successfully performed in plates stored for at least 10 months at -70°C
  • agar plates supplemented with antibiotics are valid for up to 2 months under regulated conditions (e.g., 4°C).
  • regulated conditions e.g. 4°C.
  • the performance of 10 months frozen MAPt plates was checked and compared to the performance obtained for a fresh MAPt plate and MIC values thereby obtained were compared to a standard AST procedure.
  • the table below summarizes the results tested on B. anthracis.
  • Table 8 MIC values for Ciprofloxacin and Doxycycline on B. anthracis obtained by the MAPt assay
  • the MIC values on B. anthracis obtained by standard microdilution AST procedure are 0.016-0.063 pg/ml for ciprofloxacin and 0.008-0.031 pg/ml for doxycycline.

Abstract

The invention concerns methods for determining antimicrobial susceptibility of a microorganism (e.g. bacteria, fungi), comprising incubating a biological or environmental sample on a solid growth substrate containing at least one antimicrobial agent at varying concentrations for a relatively short period of time; recovering the microorganism growing on the solid growth substrate surface; and determining the microorganism quantity using a quantitative method, e.g. qPCR, and comparing the quantity to that of a sample grown on a solid substrate without antimicrobial agent. The method is particularly useful for Yersinia pestis, Bacillus anthracis and Francisella tularensis.

Description

A METHOD FOR DETERMINING BACTERIAL SUSCEPTIBILITY TO
ANTIBIOTICS
TECHNOLOGICAL FIELD
This invention relates to methods for rapidly identifying and quantifying the efficiency of antimicrobial agents.
BACKGROUND ART
References considered to be relevant as background to the presently disclosed subject matter are listed below:
Aloni-Grinstein, R., Shifman, O., Lazar, S., Stienberger-Levy, L, Maoz, S., and Ber, R. (2015). A rapid real-time quantitiative PCR assay to determine the minimal inhibitory extracellular concentration of antibiotics against and intracellular Francisella tularensis Live Vaccine Strain. Front Microbiol 6, doi: 10.3389/fmicb.2015.01213.
Ben-Gurion, R., and Shafferman, A. (1981). Essential vimlence determinants of different Yersinia species are carried on a common plasmid. Plasmid 5, 183-187. Boisset, S., Caspar, Y., Sutera, V., and Maurin, M. (2014). New therapeutic approaches for treatment of tularemia: a review. Frontiers in Cellular and Infection Microbiology 4, 1-8.
CLSI (2015). Methods for Antimicrobial Dilution and Disk Susceptibility Testing of Infrequently Isolated or fastidious Bacteria 3rd ed. CLSI document M45-A2 Wayne, PA Clinical and Laboratory Standards Institute
CLSI (2018). M07 Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically 11th edition.
Cohen, S., Mendelson, L, Altboum, Z., Kobiler, D., Elhanany, E., Bino, T., et al. (2000). Attenuated nontoxinogenic and nonencapsulated recombinant Bacillus anthracis spore vaccines protect against anthrax. Infect Immun 68, 4549-4558. Galimand, M., Carniel, E., and Courvalin, P. (2006). Resistance of Yersinia pestis to antimicrobial agents. Antimicrob Agents Chemother 50, 3233-3236. Gill, V., 1, and Cunha, B.A. (1997). Tularemia pneumonia. Semin Respir Infect 12, 61-67.
Inglesby, T.V., Dennis, D.T., Henderson, D.A., Bartlett, J.G., Ascher, M.S., Eitzen, E., et al. (2000). Plague as a biological weapon. Medical and public health management. JAMA 283, 2281-2290.
Janse, L, Mass, M., Rijks, J.M., Koene, M., 1, van der Plaats, R.Q., Engelsma, M., et al. (2017). Environmental surveillance during outbreak of tularemia in hares, the Netherlands, 2015. Euro Surveill 22.
Klindworth A, Pruesse E, Schweer T, et al. Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies. Nucleic Acids Res. 2013;41(l):el.
Larson, C.L., Wicht, W., and Jellison, W.L. (1955). A new organism resembling P. tularensis isolated from water. Public Health Rep 70, 53-58.
Parker, R.R., Steinhaus, E.A., Kohls, G.M., and Jellison, W.L. (1951). Contamination of natural waters and mud with Psteurella tularensis and tularemia in beavers and muskrates in the northwestern United States. Bull Natl Inst Health 193.
Pechous, R.D., Sivaraman, V., Stasuli, N.M., and Goldman, W.E. (2016). Pneumonic Plague: The Darker Side of Yersinia pestis. Trends in Microbiology 24, 190-197. Petersen, J.M., Carlson, J., Yockey, B., Pillai, S., Kuske, C., Garbalena, G., et al. (2009). Direct isolation of Francisella spp. from environmental samples. Letters in Applied Microbiology 48, 663-667.
Pomerantsev, A.P., shishkova, N.A., and Marinin, I.I. (1992). Comparision of therapeutic effects of antibiotics of the teteracycline group in the treatment of anthrax caused by a strain inheriting tet-gene of plasmid pBC16. Antibiot Khimioter 37, 31- 34.
Steinberger-Levy, L, shifman, O., Zvi, A., Ariel, N., Beth-Din, A., Israeli, O., et al. (2016). A rapid molecular test for deternining Yersinia pestis susceptibility to ciprofloxacin by the quantification of differntially expressed marker genes. Front Microbiol 7:763.
Stepanov, A.V., Marinin, I.I., Pomerantsev, A.P., and Staritsin, N.A. (1996). Development of novel vaccines against anthrax in man. J Biotechnol 44, 155-160. Sutera, V., Levert, M., Burmeister, W.P., Schneider, D., and Maurin, M. (2014). Evolution towards high-level fluoroquinolone resistance in Francisella species. J Antimicrob Chemother 69, 101-110. Versage, J.L., Severin, D.D., Chu, M.C., and Petersen, J.M. (2003). Development of a multitarget real-time TaqMan PCR assay for enhanced detection of Francisella tularensis in complex specimens. . J Clin Microbiol 41, 5492-5499.
Wielinga, P.R., Hamidjaja, R.A., Agren, J., Knutsson, R., Segerman, B., Fricker, M., et al. (2011). A multiplex real-time PCR for identification and differntiating B. anthracis vimlent types. International journal of Food Microbiology 145, 137-144. Yoshida et al, 1997 Antimicrobial Agents and Chemotherapy, p. 1349-1351 Vol. 41, No. 6/
Zhang et al Microbiol. Insights 2016; 9:21-28.
Acknowledgement of the above references herein is not to be inferred as meaning that these are in any way relevant to the patentability of the presently disclosed subject matter.
BACKGROUND
Antibiotic resistance is one of the major threats to global health and leads to 700,000 deaths yearly worldwide. Experts predict that by 2050 this number can rise to 10 million.
For example, Bacillus anthracis and the fastidiously growing bacteria Yersinia pestis and Francisella tularensis are all Tier 1 agents causing anthrax, plague and tularemia respectively. As no safe and efficient vaccines are currently available for tularemia (Boisset et al., 2014) or plague (Pechous et al., 2016) these diseases are treated by antibiotics. Furthermore, the treatment for anthrax cannot be solely dependent on the proper vaccine, rather, antibiotics should be administered as well, to combat the bacteria until sufficient anti-anthrax antibody titer is developed. Although antibiotics are the first choice treatment one should bear in mind that high level fluoroquinolone-resistant mutants of F. tularensis can be easily and quickly obtained (Sutera et al., 2014) and some may even share cross-resistance to other clinically relevant antibiotic classes. Fikewise, strains engineered for resistance to tetracycline or multidrug resistance have been generated for B. anthracis (Pomerantsev et al., 1992; Stepanov et al., 1996). Moreover, plasmid-mediated single and multiple drug-resistant strains of Y. pestis have been isolated from patients (Galimand et al., 2006). Rapid identification of the bacterial agent and prompt determination of adequate treatment is mandatory for the handling of potential exposure and constrained management. Proper treatment to all of these three diseases should rely on antimicrobial susceptibility testing (AST) of the infecting bacteria rather than on a priori decision. Anthrax progression is fairly rapid and causes death if proper treatment is not initiated within 24h of symptom onset (Woods, 2005). Similarly, inhalation of Y. pestis bacteria results in a rapidly progressing disease that is transmittable from person to person. If treatment does not start within 18 to 24 hours after symptoms onset high mortality rates are observed (Inglesby et al., 2000). In pneumonic tularemia symptoms develop 3 to 5 days post exposure and mortality rates may reach 60% (Gill and Cunha, 1997). It should be noted that the need for prompt susceptibility determination is relevant to all clinical bacteria, in order to provide efficient treatment and to avoid generation of resistant bacteria.
The conditions for performing AST are defined by standard guidelines, such as the ones published by the CLSI and EUCAST. According to these guidelines a defined concentration of a homogenous bacterial suspension is a prerequisite. Taking in account the time required to isolate and enrich the bacteria, together with the time required to perform an AST (approximately 40 hours for B. anthracis, approximately 48 hours for Y. pestis and about 96 hours for F. tularensis ) with respect to disease progression to death, there is a clear need for the development of novel rapid ASTs for these bioterror agents as well as for other clinically relevant bacteria.
Pathogens can be found in various clinical specimens. For example, B. anthracis, Y. pestis and F. tularensis can be found in blood, urine, CSF, lymph nodes and more. As bacterial concentrations in these specimens may vary considerably and be too low, especially in the early stages of the disease, culturing is required for bacterial enrichment, in order to perform an AST. Furthermore, clinical samples contain various assay inhibitors such as human cells, mucus, non-relevant bacteria, chemical substances and more, therefore direct transfer of the specimen to AST is not feasible. Moreover, ASTs require a defined initial concentration of bacteria, however, optical quantification of the bacteria within the clinical specimen is not feasible.
Altogether, this procedure can take between a day and a half and up to a few days, depending on the type of bacteria and the source of specimen tested. During this waiting period the patient continues to receive a broad-range antibiotic treatment, increasing the chance for development of antibiotic resistance and decreasing the chance of healing in case the antibiotic is not relevant. Thus, there is a great need to develop novel, rapid antibiotic susceptibility tests that can be performed directly from the clinical samples. Such an AST will reduce the time to obtain a proper antibiotic treatment recommendation. This will decrease the use of broad range and/or irrelevant antibiotics which contribute to the increase of global antibiotic resistance.
GENERAL DESCRIPTION
In a first of its aspects, the present invention provides a method for determining antimicrobial susceptibility of a microorganism, comprising:
(a) Incubating a sample on a solid growth substrate containing at least one antimicrobial agent at varying concentrations;
(b) Recovering the microorganism growing on the solid growth substrate surface,; and
(c) determining the microorganism quantity using a method selected from the group consisting of: a nucleic acid-based method, an immunological method, a metabolism-based method, mass spectrometry, and a combination thereof, wherein a difference in the microorganism quantity between samples grown in the presence or absence of an antimicrobial agent indicates antimicrobial susceptibility of the microorganism to the tested antimicrobial agent.
In one embodiment, said recovery step (b) is performed before the microorganism can be visualized on the solid growth substrate.
In one embodiment, said recovery step (b) is performed at a predetermined time point.
In one embodiment, the method further comprises determining the Minimal Inhibitory Concentration (MIC) value of said antimicrobial agent and/or determining susceptibility categories.
In one embodiment, said microorganism is a bacterial strain selected from the group consisting of B. anthracis, Y. pestis, and F. tularensis.
In one embodiment, said microorganism is a bacteria or fungus causing a nosocomial infection.
In one embodiment, said microorganism is selected from the group consisting of: Clostridium difficile, carbapenem-resistant Enterobacteriaceae (CRE), Neisseria gonorrhoeae, Multidrug-resistant Acinetobacter, Drug-resistant Campylobacter, Fluconazole-resistant Candida, Extended spectrum b-lactamase producing Enterobacteriaceae (ESBLs), Vancomycin-resistant Enterococcus (VRE), Multidrug- resistant Pseudomonas aeruginosa, Drug-resistant non-typhoidal Salmonella, Drug- resistant Salmonella Typhi, Drug-resistant Shigella, Methicillin-resistant Staphylococcus aureus (MRSA), Drug-resistant Streptococcus pneumoniae, Drug-resistant tuberculosis, Vancomycin-resistant Staphylococcus aureus (VRSA ), and Drug-resistant Group A and B Streptococci.
In one embodiment, said sample is a biological sample obtained from a subject, or an environmental sample.
In one embodiment, said biological sample is selected from a group consisting of blood, plasma, serum, lymph nodes, urine, feces, saliva, cerebrospinal fluid, lung aspirate, peritoneal lavage, sperm, nasopharyngeal swabs and a tissue biopsy.
In one embodiment, said blood sample is a whole blood sample or a fractionated blood sample.
In one embodiment, said subject is a human subject.
In one embodiment, said environmental sample is collected from roads, sidewalks, grass, ponds, floors, appliances, air, water or soil.
In one embodiment, said solid growth substrate is selected from the group consisting of agar, polyacrylamide hydrogel, gelatin, paper and membrane.
In one embodiment, said solid growth substrate is Cystine Heart Agar (CHA), or Muller- Hinton agar (MHA).
In one embodiment, said solid growth substrate further comprises additional nutrients.
In one embodiment, said incubation step (a) is performed at a temperature of between about 28°C and about 37°C.
In one embodiment, said antimicrobial agent is an antibiotic agent selected from the group consisting of tetracyclines (e.g. doxycycline), fluoroquinolones (e.g. ciprofloxacin), penicillin (e.g. ampicillin), cephalosporin (e.g. ceftriaxone), macrolides (e.g. erythromycin, azithromycin), aminoglycosides (e.g. gentamycin), monobactams (e.g. aztreonam), carbapenems (e.g. imipenem), metronidazole, chloramphenicol, vancomycin, and rifampin.
In one embodiment, said sample was not diluted prior to incubation step (a).
In one embodiment, said sample was not subjected to a culturing step, and/or an enrichment step, and/or a separation step, prior to incubation step (a). In one embodiment, bacterial concentration in the sample is not determined prior to incubation step (a). In one embodiment, said sample contains between about 5xl03 to about 108 colony forming units (cfu)/ml.
In one embodiment, said incubating step (a) is performed in a multi-well plate comprising said solid support substrate.
In one embodiment, no prior identification of the bacterial strain is performed.
In one embodiment, the determination of bacterial quantity is performed using a qPCR reaction.
In one embodiment, the qPCR reaction is performed using bacteria-specific primers or using universal primers.
In another aspect, the present invention provides a kit comprising:
(a) At least one multiple well plate comprising at least one solid growth substrate containing at least one antimicrobial agent at varying concentrations;
(b) And optionally at least one microorganism-specific primer set and/or at least one universal primer set;
(c) And optionally at least one detectably-labelled microorganism-specific probe and/or at least one detectable identification agent; and
(d) instructions for use in determining antimicrobial susceptibility of a microorganism according to the methods of the invention.
In another aspect, the present invention provides a kit for use in the methods of the invention, wherein said kit comprises:
(a) At least one multiple well plate comprising at least one solid growth substrate containing at least one antimicrobial agent at varying concentrations;
(b) And optionally at least one microorganism-specific primer set and/or at least one universal primer set;
(c) And optionally at least one detectably-labelled microorganism-specific probe and/or at least one detectable identification agent; and
(d) instructions for use.
In one embodiment, said at least one detectably-labelled microorganism-specific probe is a TaqMan probe (e.g. FAM-Seq ID:3-BHQ1, FAM-Seq ID:6-BF1Q1, FAM-Seq ID:9-BHQ1). In one embodiment, said at least one detectable identification agent is a non-specific intercalating dye (e.g. SYBR green).
BRIEF DESCRIPTION OF THE DRAWINGS
In order to better understand the subject matter that is disclosed herein and to exemplify how it may be carried out in practice, embodiments will now be described, by way of non-limiting example only, with reference to the accompanying drawings, in which:
Fig. 1 is a schematic representation showing ACt obtained by qPCR, following 12-h treatment with ciprofloxacin (Fig. 1A) or doxycycline (Fig. IB) on bacterial samples of F. tularensis, ranging in concentrations from 104-108 cfu/ml (lE4-lE8/ml). The MIC values were defined as the lowest antibiotic concentration where ACt >3.3 (threshold dashed line).
Fig. 2 is a schematic representation showing ACt obtained by qPCR, following 8- h treatment with ciprofloxacin (Fig. 2A) or doxycycline (Fig. 2B) on bacterial samples of Y. pestis, ranging in concentration from 104-107 cfu/ml (lE4-lE7/ml). The MIC values were defined as the lowest antibiotic concentration where ACt>3.3 (threshold dashed line).
Fig. 3 is a schematic representation showing ACt obtained by qPCR, following 4- h treatment of ciprofloxacin (Fig. 3A) or doxycycline (Fig. 3B) on bacterial samples of B. anthracis, ranging in concentration from 104-107 cfu/ml (lE4-lE7/ml). The MIC values were defined as the lowest antibiotic concentration where ACt>3.3 (threshold dashed line).
Fig. 4 is a schematic representation showing ACt obtained by qPCR, following 16-hours treatment of increasing concentrations of ciprofloxacin or doxycycline on 1.4xl05 cfu/ml F. tularensis- spiked blood cultures.
Fig. 5 is a schematic representation showing ACt obtained by qPCR using universal 16S primers or the F. tularensis- specific primers for thefopA gene , following 16-hours treatment with increasing concentrations of doxycycline (Fig. 5A) or ciprofloxacin (Fig. 5B) on 3.6 x 106 CFU/ml (Fig. 5A) or 7 x 106 CFU/ml (Fig. 5B) F. tularensis- spiked human blood samples. ACt values were calculated by subtracting the growth control Ct values from the Cts of the samples from the antibiotic-containing wells. DETAILED DESCRIPTION OF EMBODIMENTS
The inventors of the present invention developed a new and rapid antibiotic susceptibility test (AST), which decreases greatly the time needed to reach an adequate clinical answer, i.e. results can be obtained within a few hours in contrast with conventional methods which require several days. This provides great advantage at a clinical setting allowing antibiotic susceptibility determination in a clinically relevant timing.
The method of the invention is a quantitative method which measures the microorganism's growth using a quantitative means (e.g. by quantitative PCR, qPCR) but also comprises an initial step in which the microorganism is grown in a solid substrate. The initial step in which the microorganism is grown on a solid substrate is not used for visually assessing growth (as is the case in conventional agar dilution assays). On the contrary, the microorganisms are recovered from the solid substrate to liquid phase, at a predetermined time point and subjected to the quantitative measurement (e.g. by qPCR) at a very early stage even before they can be visualized on the solid substrate either by the naked eye or using spectroscopy, namely before any standard phenotypic microorganism quantitation is feasible. The initial step in which the bacteria are grown on a solid substrate provides several other advantages as will be described below.
Therefore, in a specific embodiment, the method of the invention is termed herein micro agar PCR test (MAPt).
This novel and advantageous method gives significantly added value providing in one step enrichment, isolation and antibiotic susceptibility testing.
One of the main drawbacks of the current AST such as classical agar dilution, broth microdilution or disk diffusion-based ASTs is the need for a defined concentration of the target bacteria. This prerequisite defines the need for an isolation step prior to quantification of the tested sample. In case of a diluted sample there is a need to wait for adequate growth (enrichment step), a process that is time consuming especially in slow- growing bacteria.
Using the method of the invention, the determination of antibiotic susceptibility and scoring of MIC values is independent of bacterial concentration. For example, the use of bacteria-specific primers in the qPCR step provides sensitivity and specificity and allows quantification of relatively low amounts of bacteria (e.g. as low as ~103 colony forming units (cfu/ml). Due to this high sensitivity the method of the invention (e.g. the MAPt) can be performed with samples comprising relatively low concentrations of bacteria, which is not applicable with the standard ASTs (e.g. the broth microdilution- based assay). Moreover, due to the high dynamic range of the qPCR quantification, the invention is applicable at varying and also at high concentrations of bacterial samples. In a specific embodiment, the concentration of the original tested sample may be as high as 4xl09 cfu/ml, way beyond any clinical relevant sample.
Due to the use of bacteria specific primers combined with the use of solid surface (such as an agar culture media) non-homogenous clinical samples (e.g. urine, stool, nasopharyngeal swabs and more) as well as environmental samples may be processed without prior isolation.
It has been suggested that analysis of environmental samples of natural outbreaks (Janse et al., 2017) or bio-terror attacks holds great advantage for early medical care (prophylaxis) of the suspected infected individuals. However, isolation of the pathogen from the environmental samples relies on the growth on selective agar and is time consuming. For example, isolation of F. tularensis using selective agar, reduced environmental contaminations, but was time consuming and required 2 to 3 days prior to the 48 hours AST (Petersen et al., 2009). Moreover, the sensitivity and specificity of the method of the invention allows to identify the bacteria and to perform an AST in one step.
In cases where there is no indication for the identity of the pathogen the method of the invention, for example the MAPt, can be used with broad-range (universal) primers to determine the susceptibility of the bacteria to the tested antibiotic.
As will be demonstrated in the Examples below, MAPt was applied on blood cultures and blood samples spiked with various concentrations of B. anthracis, Y. pestis and F. tularensis, and environmental samples spiked with F. tularensis and showed adequate MIC determination within remarkable time schedules even at low bacterial concentration (~103 cfu/ml).
These three bacterial models were used as representatives of gram-negative and gram-positive bacteria and represent a scale of different growth rates.
Without wishing to be bound by theory, some of the main advantages of the method of the invention are:
1. A broad dynamic bacterial concentration range allowing to perform concomitantly isolation, enrichment and quantification steps of the assay thus enabling AST determination: 1.1. In shorter times.
1.2. Varying bacterial concentrations, including very low and very high concentrations.
1.3. Directly from clinical and environmental samples.
2. During bacterial growth on the agar, the agar can absorb inhibitory particles that may be present in the samples (such as in blood or in blood culture media). Accordingly, this can reduce the need for purification steps prior to incubation of the sample on the agar or prior to the qPCR reaction.
3. The use of specific PCR primers allows:
3.1. AST determination of the target bacteria even in the presence of contaminating bacteria allowing antibiotic susceptibility determination of heterogeneous samples.
3.2. Identification and antibiotic susceptibility determination within one step.
4. The use of broad range primers allows the determination of bacterial susceptibility without prior indication of the pathogen involved.
5. The use of the method of the invention (e.g. MAPt) on environmental samples can provide the clinician with the ability to choose proper prophylaxis treatment before signs of morbidity.
The method of the invention (e.g. MAPt) is applicable on a wide range of bacterial concentrations, different bacteria, and different antibiotics. For example, in the same MAPt assay different samples may be examined or different antibiotics may be explored for the same sample. Moreover, the MAPt for example allows bacterial identification and AST determination in one step using different bacteria-specific primers.
Taken together, the method of the invention is a rapid AST method, applicable on a wide range of bacterial concentrations thus there is no need for bacterial quantification. Moreover, there is no need for an external isolation, or an enrichment step and it can be applied directly on clinical samples such as blood culture and even directly on whole blood.
In one aspect, the present invention provides method for determining antimicrobial susceptibility of a microorganism, comprising:
(a) Incubating a sample on a solid growth substrate containing at least one antimicrobial agent at varying concentrations;
(b) recovering the microorganism growing on the solid growth substrate surface; and
(c) determining bacterial quantity using a method selected from the group consisting of: a nucleic acid-based method, an immunological method, a metabolism-based method, mass spectrometry, and a combination thereof, wherein a difference in bacterial quantity between samples grown in the presence or absence of an antimicrobial agent indicate antimicrobial susceptibility of the bacterial strain to the tested antimicrobial agent.
As used herein the term "microorganism" refers to unicellular organisms including, but not limited to, bacteria and fungi.
It would be appreciated by a person skilled in the art that the method of the invention is applicable to any microorganism (e.g. bacterial strain or fungus) capable of growing on a solid surface. In one embodiment the bacterial strain is selected from the group consisting of F. tularensis, Y. pestis, and B. anthracis. In another embodiment the microorganism that is responsible for nosocomial infections such as, Clostridium difficile, carbapenem-resistant Enterobacteriaceae (CRE), Neisseria gonorrhoeae, Multidrug- resistant Acinetobacter, Drug-resistant Campylobacter, Fluconazole-resistant Candida, Extended spectrum b-lactamase producing Enterobacteriaceae (ESBLs), Vancomycin- resistant Enterococcus (VRE), Multidrug-resistant Pseudomonas aeruginosa, Drug- resistant non-typhoidal Salmonella, Drug-resistant Salmonella Typhi, Drug-resistant Shigella, Methicillin-resistant Staphylococcus aureus (MRSA), Drug-resistant Streptococcus pneumoniae, Drug-resistant tuberculosis, Vancomycin-resistant Staphylococcus aureus (VRSA), Drug-resistant Group A and B Streptococci. In yet other embodiments the bacterial strain is a bacterium responsible for animal infections, including but not limited to antibiotic resistant Salmonella. Antibiotic susceptibility determination of such bacteria is important for veterinary applications.
As used herein a "solid growth substrate" refers to any solid substrate that can be used for growing a microorganism, e.g. bacteria. In one embodiment the solid growth substrate is selected from the group consisting of agar, polyacrylamide hydrogel, gelatin, paper, and membrane. In specific embodiments the solid growth substrate is selected from the group consisting of Muller-Hinton agar (MHA), and Cysteine heart agar (CHA).
In one embodiment the solid support substrate is supplemented with nutrients or growth supplements, e.g. hemoglobin, gelatin, IsoVitalex, blood, blood constituents, amino acids, nucleotides, vitamins, NAD, sugars. It would be appreciated by a person skilled in the art that the incubation is performed in the optimum temperature range for the tested microorganism, e.g. at about 28°C or about 37°C depending on the type of microorganism tested. In certain embodiments, such as in the case of a biological sample obtained from a patient the incubation is performed at a temperature of 37°C.
In certain embodiments, the method of the invention further comprises determining the Minimal Inhibitory Concentration (MIC) value of said antimicrobial agent and/or determining susceptibility categories. Examples of susceptibility categories include but are not limited to Susceptible, Intermediate or Resistant.
In one embodiment the sample is a biological sample (also referred to herein as a clinical specimen) obtained from a subject, said biological sample selected from the group consisting of blood, plasma, lymph nodes, urine, cerebrospinal fluid, saliva, semen, feces. In one embodiment the blood sample is a whole blood sample. In another embodiment, the blood sample is a fractionated blood sample, e.g. plasma or serum.
Blood can be fractionated for example by SST (serum separation tubes) (Vacutte Z serum Sep. Clot activator #456005) to obtain the plasma fraction. For this purpose, the sample can be loaded into SSTs and centrifuged for example for 10 minutes at 1700g at 20°C. The upper fraction may be discarded and the bacteria lying on the gel matrix can be recovered with PBS.
As used herein the term "subject" encompasses any kind of animal, for example, but not limited to, mammalian subjects, avian subjects, reptiles, or fish. The mammalian subject may for example be a livestock animal, e.g. a cow. In one embodiment said subject is a human subject.
In one embodiment the sample is an environmental sample obtained for example from roads (including asphalt), sidewalks, grass, ponds, floors, walls, stairs, air condition airways, door knobs, appliances (for example, a computer key board), air, water, wastewater, sewage, or soil.
It would be appreciated by a person skilled in the art that the method of the invention is suitable for testing any antibiotics (also referred to herein as an antimicrobial agent). Non limiting examples include tetracyclines (e.g. doxycycline), fluoroquinolones (e.g. ciprofloxacin), penicillin (e.g. ampicillin), cephalosporin (e.g. ceftriaxone), macrolides (e.g. erythromycin, azithromycin), aminoglycosides (e.g. gentamycin), monobactams (e.g. aztreonam), carbapenems (e.g. imipenem), metronidazole, chloramphenicol, vancomycin, and rifampin. In specific embodiments the antibiotic is doxycycline or ciprofloxacin.
In some embodiments, the method of the invention can be performed without having any purification, separation or enrichment steps (e.g. by dialysis or immuno- separation, precipitation, centrifugation, filtration, sorting) prior to the incubation of the sample on the solid growth substrate. For example, if the sample is a blood sample, it may be incubated on the solid growth substrate without prior fractionation by SST (serum fractionation tube), or FACS (fluorescence activated cell sorter).
In accordance with the method of the invention, the time required to determine antimicrobial susceptibility or MIC is largely reduced. While using the methods known in the art the determination of antimicrobial susceptibility and MIC requires several days (e.g. 5 days for F. tularensis), using the method of the invention the time required to determine antimicrobial susceptibility or MIC is reduced to several hours.
For example, according to the method of the invention, the period of time to determine antimicrobial susceptibility or MIC in blood, blood cultures or environmental samples of F. tularensis is between about 12 hours and 16 hours; of Y. pestis between about 10 hours and 12 hours, and of B. anthracis is between about 6 hours and 8 hours. These time periods may even be shorter when the antimicrobial susceptibility or MIC are tested from a pure bacterial culture (e.g. 8 hours for Y. pestis, and 4 hours for B. anthracis ).
The recovery of the microorganism growing on the solid growth substrate surface (step b) may be performed before or after it can be visualized by conventional means.
In a preferred embodiment, the recovery of the microorganism growing on the solid growth substrate surface (step b) is performed even before the microorganism may be visualized by a conventional means, e.g. by the naked eye or by spectroscopy. Evidently, since different strains of bacteria have different growth rates the incubation periods before the bacteria can be visualized vary from strain to strain. Non-limiting examples of incubation times are e.g. as described above, namely for F. tularensis between about 12 hours and 16 hours; for Y. pestis between about 10 hours and 12 hours, and for B. anthracis between about 6 hours and 8 hours.
Accordingly, in one embodiment, said recovery step (b) is performed at a predetermined time point irrespective of visual verification of the microorganism's presence and/or concentration in the solid growth substrate. The predetermined time point varies with different strains of bacteria, as described above. Non-limiting examples of predetermined time points include for F. tularensis between about 12 hours and 16 hours; for Y. pestis between about 10 hours and 12 hours, and for B. anthracis between about 6 hours and 8 hours.
In cases where there is no indication for the identity of the pathogen, the recovery of the microorganism from the substrate may be performed at two separate time points. In one embodiment, the first time point is after about 4-8 hours, preferably 6 hours, of incubation on the solid substrate as required for a fast growing microorganism, and the second time point is after about 14-18 hours, preferably 16 hours, of incubation on the solid substrate as required for a slow growing microorganism.
In accordance with the invention, the recovery step (b) (also referred to herein as the extraction step) refers to the removal of the microorganism from the solid growth substrate. This step can be performed using any suitable solution. Non-limiting examples include PBS, saline, Tris buffer (e.g. Tris EDTA), water or ethanol.
The recovery step can also be performed by liquidizing the solid substrate (e.g. the agar or the gel) and recovering the bacteria from the liquidized substrate.
After recovery, the sample is optionally heated (e.g. for 30 minutes) for sterilization.
The bacterial sample recovered from the substrate may optionally be subjected to a lysis step. The lysis may be performed using any method known in the art, for example using a detergent, by sonication, or bead beater.
The quantification step is performed using a method selected from the group consisting of a nucleic acid-based method, an immunological method, a metabolism- based method, mass spectrometry, and any combination thereof.
The term "nucleic acid-based method" refers to any method known in the art in which the quantification of the microorganism is based on measuring a microorganism's nucleic acid. Non limiting examples include standard PCR, TaqMan and SYBR based PCR, digital PCR (dPCR), RT-PCR, Nucleic acid sequence based amplification (NASBA), Ligation chain reaction (LCR), next generation sequencing (NGS), sequencing, and loop-mediated isothermal amplification (LAMP).
The term "immunological method" refers to any method known in the art in which the quantification of the microorganism is performed using antibodies. Non limiting examples include ELISA and LACS. The term "metabolism-based method" refers to any method known in the art in which the quantification of the microorganism is performed using measurements of cell metabolism. Non limiting examples include measurement of cell respiratory cycles, or any measurable biochemical change that reflects the viability of the microorganism.
The term "mass spectrometry” refers to an analytical technique that measures the mass-to-charge ratio of components in the sample and is used to elucidate the identity of masses of molecules.
In one specific embodiment the quantification is performed using qPCR reaction.
The qPCR reaction can be performed using microorganism- specific primers (for example bacteria-specific primers or fungal specific primers) or using universal primers.
A person skilled in the art of the invention would be familiar with primers suitable for quantification of various bacterial strains. A non-limiting list of suitable primers is provided in Table 1.
Table 1: List of primers suitable for quantification of various bacterial strains
Figure imgf000018_0001
Figure imgf000019_0001
Suitable primers for testing fungal strains (e.g. Candida) are known in the art, for example in Zhang et al. A non-limiting example for a forward primer is GCAAGTCATCAGCTTGCGTT (SEQ ID NO: 10), and a non-limiting example for a reverse primer is TGCGTTCTTCATCGATGCGA (SEQ ID NO: 11).
In accordance with the invention, a "microorganism-specific primer" may be suitable for the identification of one or more similar microorganisms which share partial genetic similarities. For example, a single primer may be used for detecting Enterobacteriaceae.
As used herein the term "universal primers" refers to broad spectrum primers directed to sequences that appear in a broad range of bacteria and therefore such primers can indicate the presence of bacteria even if the specific species is not identified or known. Such primers include for example the 16S forward primer CCTACGGGNGGCWGCAG (SEQ ID NO: 12) and the 16S reverse primer GACT ACH V GGGTATCT A ATCC (SEQ ID NO: 13) (Klindworth et al., 2013).
The qPCR amplification product is then quantified, preferably by a fluorescent signal. The fluorescent signal may be generated by using a detectably labelled microorganism-specific probe or by using a non-specific detectable identification agent.
As used herein the term "detectably labelled microorganism-specific probe" refers to an oligonucleotide probe which is suitable for the identification of one or more similar microorganisms which share partial genetic similarities. For example, a single probe may be used for detecting Enterobacteriaceae.
In one embodiment, said at least one detectably-labelled microorganism-specific probe is a TaqMan probe (e.g. FAM-Seq ID:3-BHQ1, FAM-Seq ID:6-BHQ1, FAM-Seq ID:9-BHQ1).
In another embodiment of the invention a detectable identification agent is used to quantify the qPCR amplification product.
As used herein the term "detectable identification agent " refers to any agent capable of interacting with the qPCR product and be visually detected, for example, but not limited to fluorescent interlacing or intercalating dyes, such as SYBR green. By a further aspect thereof the present disclosure provides a kit comprising:
(a) at least one multiple well plate comprising at least one solid growth substrate containing at least one antimicrobial agent at varying concentrations;
(b) optionally, at least one microorganism-specific primer set or at least one universal primer set;
(c) optionally, at least one detectably -labelled microorganism-specific probe or at least one detectable identification agent; and
(d) instructions for use in determining antimicrobial susceptibility of a microorganism according to the methods of the invention.
Multiple well plates are commercially available and well known to a skilled artisan. The solid growth substrate containing at least one antimicrobial agent at varying concentrations may be prepared according to methods well known in the art, for example as exemplified by the inventors below.
As detailed above, the kit according to the present disclosure comprises at least one primer set and at least one detectably labelled microorganism specific probe and/or a detectable identification agent. As detailed above, a person skilled in the art of the invention would be familiar with primers and probes suitable for quantification of various bacterial strains, for example a non-limiting list of suitable primers is provided in Table 1 above. By the term “at least one” in the context of the kit according to the present disclosure it is meant to refer to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more multiple well plates, primers, probes detecting agents and/or antimicrobial agents.
The kit of the present disclosure may further include container means for containing separate kit components. In some embodiments the kit of the present disclosure further includes at least one solvent or buffer known in the art for recovering the microorganism growing on the solid growth substrate, for example as such exemplified herein below.
By still another aspect thereof the present disclosure provides a kit according to the present disclosure for use in the method as herein defined.
As exemplified below the method of the invention can be performed with freshly- made plates and/or plates that were stored at 4°C for up to two months, comprising the solid substrate and at least one antibiotics (e.g. freshly made MAPt plates) or with frozen- plates comprising the solid substrate and the at least one antibiotics that were stored at a temperature of below 0°C, preferably -70°C. In one embodiment the MAPt plates are frozen at -70°C for at least one month, at least two months, at least three months, at least four months, at least five months, at least six months, at least seven months, at least eight months, at least nine months, at least ten months, or more.
Examples
Materials and Methods
Bacterial strains:
The F. tularensis live vaccine strain (LVS) (ATCC 29684) was grown on CHA agar (Difco, 5.1% cystine heart agar, 1% hemoglobin) or in cation adjusted Mueller- Hinton broth (CAMHB) (BBL, 212322), supplemented with 2% defined growth supplement (IsoVitaleX Enrichment; BBL 211876) and 3mM hematin (Sigma 3281) (termed HLMHI) at 37°C. The Y. pestis vaccine strain EV76 (Ben-Gurion and Shafferman, 1981) was grown on Brain Heart Infusion agar (BHI-A) (BD Difco 241830) plates at 28°C. Bacillus anthracis D14185 (Cohen et al., 2000) was grown on BHI-A at 37°C. Colony forming units (cfu) counts were determined by platting 100 mΐ of serial ten fold dilutions in sterile phosphate-buffered saline (PBS, Biological Industries, Beth Haemek, Israel) on CHA for F. tularensis and BHI-A plates for B. anthracis and Y. pestis, respectively. The antimicrobial susceptibility testing (ASTs) were performed using Mueller Hinton Agar (MHA) for B. anthracis and Y. pestis and Cystine Heart Agar (CHA) for F. tularensis.
Blood cultures
Human blood (10 ml) spiked with bacteria at defined concentrations were incubated in BACTEC Plus+aerobic/F vials (BD 442192). The blood cultures were shaken at 180 revolutions per minute (rpm) at 37°C in a New Brunswick Scientific C76 water bath for various time periods.
Environmental sampling
A soil area of 20x20 cm2 was sampled using 2 phosphate buffered saline (PBS) damped cotton swabs and one dry swab. The 3 swabs were placed in a 50 ml tube containing 5 ml PBS and vigorously vortexed. The sample was left for 5 minutes to allow for large particles sedimentation. For further purification, the sample was filtered through a 1.2 pm filter.
Antibiotics
Doxycycline (Sigma D-9891) and ciprofloxacin (Teva).
Preparation of MAPt plates
Agar media (a different medium was used for each type of bacteria, as indicated above) were prepared according to the manufacturer's instructions. Following autoclaving the agar was chilled to 50°C and 40 ml were aliquoted to a 50 ml tubes where the tested antibiotic was added. 200 pi of the antibiotic-supplemented agar was divided into 96 wells plate in serial dilutions.
MAPt assay
Ten (10) microliter of the tested sample were placed in the appropriate well in the MAPt plates. The MAPt plates were incubated at the appropriate temperature (28 °C for Y. pestis and 37 °C for B. anthracis and F. tularensis ) for the time period required for each bacteria and source of sample (bacterial culture, clinical sample or environmental sample) - as described in the Examples below.
Extraction of bacteria from MAPt plates
At the end of the incubation period, 150 pi of PBS were added to each well to recover the bacteria growing on the agar surface. 100 pi of the recovered bacteria were added to 100 pi of Triton buffer (20% Triton-X-100 in TE (Sigma)) and the sample was heated for 30 minutes, in order to sterilize the sample. A sample of 5 pi was further processed by a qPCR reaction using a 7500 Real-Time PCR system (Applied Biosystems). qPCR reaction mixture composition
12.5 pi SensiFAST Probe lo-ROX Mix (Bioline BI084005)
3 pi Primer F (5 pmol/pl)
3 pi primer R (5 pmol/pl)
1.5 pi Probe (5 pmol/pl)
Primer list (see Table 1)
Real time PCR program:
95°C 3 min.
40 cycles of 95 °C 15 seconds and 60°C 35 seconds Determination of MIC value
Bacterial quantification by qPCR was determined by the cycle threshold (Ct) values which were extracted by the 7500 real-time PCR system Sequence Detection Software. The Ct value is the PCR cycle at which the sample’s reaction curve intersects the threshold line, which represents the level of fluorescent intensity that is above background levels. The relative difference in bacterial counts between growth control and tested antibiotic concentration was determined by the ACt, where ACt is the difference between the Ct of sampled bacteria in the antibiotic well compared to the Ct of the sampled bacteria in the growth control. As 1-log difference between the antibiotic treated group to the untreated sample is reflected by a ACT of Iog2l0=3.3, a ACT greater than 3.3 were considered as growth inhibited samples.
Example 1: MAPt is applicable at a wide range of bacterial concentrations
Minimum inhibitory concentration (MIC) determination by MAPt was applied to three representative bacteria: Bacillus anthracis, a fast growing gram positive (+) bacteria, Y. pestis, a gram negative (-) bacteria, which is slow growing in-vitro and fast growing in-vivo, and fastidious F. tularensis, a gram negative (-) bacteria, which is slow growing both in vitro and in vivo.
Francisella tularensis
F. tularensis MIC determination from clinical or environmental samples using standard procedures for isolation, enrichment and AST requires at least 6 days.
A range of F. tularensis LVS bacterial concentrations was applied to MAPt as detailed above and the MIC was determined after 16 hours by using qPCR (at this time period a 2-log change in growth is expected in the untreated bacteria, based on the bacteria generation time). As can be seen in Figure 1, at all bacterial concentrations tested, the MIC values obtained by MAPt were similar to the MIC values obtained by the classical microdilution test (namely ciprofloxacin 0.008-0.031 pg/ml, doxycycline 0.125-0.5 pg/ml) which requires a defined recommended bacterial concentration. In summary, MAPt is applicable on a wide range of F. tularensis bacterial concentrations, thus determination of bacterial concentration is superfluous. Notably, correct MIC values were obtained even at sub-standard concentrations of F. tularensis, i.e. 104 cfu/ml, omitting the need for bacterial enrichment for those concentrations. Y. pestis
Y. pestis grows rapidly within the host yet is slow growing in vitro. As a result, a conventional AST for this type of bacteria requires approximately 2 days and thus may not meet clinical relevance.
In contrast, using the method of the invention, MIC values similar to those obtained by other classical tests for ciprofloxacin and doxycycline were obtained for a wide range of bacterial concentrations (Figure 2A, 2B) after 8 hours of incubation. Thereby obviating the need for lengthy culturing of the bacteria in order to reach a minimal concentration, as required for the conventional assays.
B. anthracis
Next, the MAPt assay was examined with the fast-growing bacteria B. anthracis. Four-log concentrations of B. anthracis were subjected to MAPt and MIC values were determined within 4 hours of incubation, following a qPCR reaction. The MIC values obtained by MAPt (Figure 3) were similar to the ones obtained by microdilution (namely ciprofloxacin: 0.031-0.063 pg/ml and doxycycline: 0.031-0.063 pg/ml) at a wide range of B. anthracis concentrations (from 104 cfu/ml up to 107cfu/ml).
These results show that MAPt is a bacterial concentration-independent AST applicable for both gram-negative as well as gram-positive bacteria and for fast-growing as well as for slow-growing bacteria.
Example 2: Application of MAPt on spiked blood culture samples
Blood cultures are a major enrichment source for clinical bacterial isolation. Thus, the MAPt assay was applied on blood culture samples spiked with various concentrations of F. tularensis LVS. The spiked blood was transferred into BACTEC™ Plus Aerobic/F Culture vials and incubated at 37°C to allow for bacterial growth. The blood cultures were harvested at various time points to allow growth to different bacterial concentrations. Ten (10) microliters of the harvested samples were plated in the appropriate wells of a MAPt plate (prepared as described in the materials and methods section above). The MAPt plate was incubated for 16 hours at 37°C. Following, the samples were processed as described in materials and methods. As can be seen in Table 2 below, a proper MIC of 0.008-0.016 pg/ml was obtained for ciprofloxacin at all bacterial concentrations tested. The MIC values obtained for doxycycline were 0.125-0.5 pg/ml. These values are in the range of the values obtained by the standard microdilution assay. Figure 4 is a schematic representation of one of the blood culture samples tested.
Table 2: MIC values of F. tularemis LVS spiked blood cultures obtained by MAPt
Figure imgf000025_0001
• Incubation time= 16 hours
• MIC values by microdilution: Ciprofloxacin 0.008-0.031 pg/ml, Doxycycline 0.125-0.5 pg/ml.
Similarly, Y. pestis spiked blood was transferred into BACTEC™ Plus Aerobic/F Culture vials and incubated at 37°C to allow for bacterial growth. Processing of these blood cultures was done as for F. tularensis blood cultures except that the MAPt plates were incubated at 28°C (see materials and methods). The MIC values for ciprofloxacin obtained by MAPt were 0.016-0.032 pg/ml and 0.5 pg/ml for doxycycline, at all bacterial concentrations tested (Table 3). These values correspond to the MIC values obtained by the classical microdilution method. These results confirm that MAPt can be used to correctly determine MIC values from blood cultures samples in a remarkably rapid time compared to the classical microdilution method.
Table 3: MIC values of Y. pestis spiked blood cultures obtained by MAPt.
Figure imgf000026_0001
• Incubation time= 16 hours
• MIC values by microdilution: Ciprofloxacin 0.008-0.031 pg/ml, Doxycycline
0.25-1 pg/ml
Example 3: Application of MAPt on spiked whole blood samples
Blood cultures are a means for enrichment of sparse blood samples. The results obtained in Example 2 above show that MIC determination is feasible even at low bacterial concentrations. Therefore, in the following example the method was performed without the enrichment step of transferring blood samples into blood culture bottles. The enrichment step through blood culture bottles is time consuming and may take hours to days thus elimination thereof is advantageous.
To this end, whole human blood was spiked with F. tularensis at various concentrations. Ten microliters of the spiked blood were subjected to the appropriate wells of a MAPt plate following 16 hours of incubation at 37°C and further processing as previously described. Table 4 summarizes the MIC values obtained by MAPt which correspond to the ones expected based on standard ASTs.
Table 4: MIC values of F. tularemis spiked whole blood
Figure imgf000027_0001
• Incubation time= 16 hours
• MIC values by microdilution: Ciprofloxacin 0.008-0.031 pg/ml, Doxycycline 0.125-0.5 pg/ml
Similarily, human whole blood was spiked with Y. pestis and B. anthracis at various concentrations. Ten microliters of the spiked blood were subjected to the appropriate wells of a MAPt plate following 16 hours of incubation at 28°C for Y. pestis and at 37 °C for B. anthracis followed by further processing as previously described. Table 5 summarizes the MIC values obtained by MAPt for Y. pestis and Table 6 for B. anthracis which correspond to the ones expected by standard ASTs.
Table 5: MIC values of Y. pestis spiked whole blood
Figure imgf000027_0002
• Incubation time=16h
• MIC values by microdilution: Ciprofloxacin 0.008-0.031 pg/ml, Doxycycline 0.25-1 pg/ml Table 6: MIC values of B. anthracis spiked whole blood
Figure imgf000028_0001
• * Incubation time=7 hours **Incubation time: 16 hours
• MIC values by microdilution: Ciprofloxacin 0.031-0.125 pg/ml, Doxycycline 0.016- 0.063 pg/ml
These results indicate that MAPt is applicable for whole blood samples.
Example 4: Application of MAPt on environmental samples
In contrast to blood samples, which are homogenous to the tested bacteria, environmental samples are heterogenous and contain many species of microorganisms (bacteria and fungus, for example). In the coventional ASTs, the presence of these contaminators in a tested sample may alter the MIC value of the target bacteria. As detailed below, MAPt was capable of determining a correct MIC value, for ciprofloxacin and doxycycline, even in the presence of contaminators, as each bacterial growth in the well was contained (due to the short incubation time and the use of a solid surface) as opposed to the mixed growth in liquid media. The specific primers for the target bacteria provided a specific AST focousing only on the target bacteria.
F. tularensis- spiked environmental samples.
This bacteria is a slow-growing bacteria, therefore the contaminator bacteria within the environmental sample are usually much faster growing than F. tularensis, and may take over during the 48-hours incubation period, thus the MIC value obtained by the standard ASTs does not represent that of F. tularensis. During the MAPt assay, which is much shorter (16 hours), the contaminators have less time to take over the culture. Moreover, as bacteria growth on agar is contained within a colony, contaminating bacteria cannot take over, and each bacteria is tested on its own. By using F. tularensis- specific primers, these contaminators are not scored and the obtained MIC coresponds only to F. tularenis. Table 7 below summerizes the MIC values obtained with F. tularensis spiked enviromental samples.
Table 7: MIC values of F. tularenis obtained from spiked enviromental samples.
Figure imgf000029_0001
Asphalt roads and soil samples were taken from different locations. MAPt plates were incubated for 16 hours at 37°C. B. anthracis- spiked environmental samples
Next, the MIC value was examined in environmental samples spiked with B. anthracis spores without any prior isolation steps. Diverse environmental samples were collected, outdoors and indoors, from different locations at various weather conditions thus maximizing the potential of sampling a variety of contaminants. Table 8 describes the various environmental samples, the load of contaminants versus the concentration of the spiked B. anthracis spores and the MIC values obtained by MAPt. Spiked samples varied from as low as 2xl05 up to 2.4xl08 cfu/ml B. anthracis. Adequate MIC values, for both ciprofloxacin and doxycycline, were obtained for all environmental samples tested. Similar MIC values were obtained, by broth microdilution, for this strain of B. anthracis, prior to spiking into the environmental samples. Soil samples were chosen as representatives since these samples are the most challenging ones as they contain the highest number of contaminating microorganisms. Notably, the soil samples contained high amounts of naturally occurring Bacillus spp. phylogenetically close to B. anthracis such as B. cereus, B. megaterium, B. thuringensis and B. subtilis (identified by MALDI- TOF), at ratios as low as 1:2 to the spiked B. anthracis spores, and yet, due to specificity of the assay, owing to the primers and probe set used for the PCR which recognize only B. anthracis (SEQ ID NO:l-3) adequate MIC values were obtained without the need for any time-consuming isolation/purification steps. All in all, MAPt was shown to be a rapid and reliable AST method for environmental samples containing B. anthracis spores within a remarkably short time frame, without the need for any prior isolation steps.
Table 8: MIC values obtained by MAPt for B. anthracis- spiked environmental samples
Figure imgf000031_0001
Figure imgf000032_0002
Asphalt road and soil samples were taken from different locations.
MAPt plates were incubated for 5 hours at 37°C.
Y. push's -spiked environmental samples
Diverse outdoors as well as indoor environmental samples were collected and subjected to MAPt testing. Table 9 describes the various environmental samples, the load of contaminants versus the concentration of the spiked Y. pestis and the MIC values obtained by MAPt for each sample. Spiked samples varied from as low as 2xl05 up to 2xl07 cfu/ml Y. pestis. The ratio of contaminants to Y. pestis was as low as 1:3. MAPt MIC values of 0.5-1 pg/ml for doxycycline and 0.016-0.064 pg/ml for ciprofloxacin were obtained, similar to the ones obtained, by broth microdilution, for the tested bacteria prior to spiking into the environmental sample. Notably, soil samples at the ratio of 1:3 contaminants to Y. pestis, contained Bacillus and other spp. known to exhibit higher growth rates than Y. pestis. Nevertheless, these contaminants did not interfere with the MAPt assay due to the relatively short incubation time needed for the MAPt assay (lOh).
Table 9: MIC values obtained by MAPt for Y. pevi/v-spiked environmental samples
Figure imgf000032_0001
Figure imgf000033_0001
Example 5: Application of MAPt for antifungal susceptibility testing
The MAPt method is also applied for antifungal susceptibility testing. To this end, MICs are determined by the MAPt method using solidified RPMI-1640 medium (Gibco BRL, Grand Island, N.Y.) as described by Yoshida etal., 1997 (Antimicrobial Agents and Chemotherapy, p. 1349-1351 Vol. 41, No. 6) for agar dilution testing. A double concentration of RPMI-1640 is prepared with 0.3 M morpholinepropanesulfonic acid buffer (pH 7.0), sterilized by filtration through a membrane filter (pore size, 0.45 mm), and mixed with equal volume of 3.0% agar which is autoclaved at 121°C for 15 minutes and kept at 55°C. The agar medium is then poured into microtiter plates containing serial dilutions of antifungal agents dissolved in dimethyl sulfoxide and is solidified.
Fungal samples are then placed in each well of the MAPt fungal plates and incubated for the time required for two (2) orders of magnitude in growth.
Extraction of fungi from the MAPt plates
At the end of the incubation period, 150 pi of PBS are added to each well to recover the fungi growing on the agar surface. The recovered fungi (100 mΐ) are added to 100 mΐ of Triton buffer (20% Triton-X-100 in TE (Sigma) and the sample is heated (100°C) for 30 minutes in order to sterilize the sample. A sample of 5 mΐ is further processed by a qPCR reaction using a 7500 Real-Time PCR system (Applied Biosystems). qPCR reaction mixture composition:
12.5 mΐ SensiFAST SYBR Lo-ROX Mix (Bioline BIO-94005)
3 mΐ Primer F (5 pmol/m I)
3 mΐ primer R (5 pmol/mΐ)
1.5 m1 ¾0
Pri er list: Suitable primers for testing Candida are known in the art, for example in Zhang et al Microbiol. Insights 2016; 9:21-28. A non-limiting example for a forward primer is GCAAGTCATCAGCTTGCGTT (SEQ ID NO: 10), and a non limiting example for a reverse primer is TGCGTTCTTCATCGATGCGA (SEQ ID NO: 11).
Real time PCR program:
95 °C 3 min.
40 cycles of 95°C 15 seconds and 60°C 35 seconds
Determination of MIC value
As detailed above with respect to bacteria quantification by qPCR, fungal quantification by qPCR is determined by the Ct values which are extracted by the 7500 real-time PCR system Sequence Detection Software. The Ct value is the PCR cycle at which the sample’s reaction curve intersects the threshold line, which represents the level of fluorescent intensity that is above background levels. The relative difference in fungal counts between growth control and tested antibiotic concentration is determined by the ACt, where ACt is the difference between the Ct of sampled fungi in the antibiotic well compared to the Ct of the sampled fungi in the growth control. As 1-log difference between the antibiotic treated group to the untreated sample is reflected by a ACt of Iog2l0=3.3, a ACt greater than 3.3 is considered as a growth inhibited sample.
Example 6: Application of MAPt on an unidentified pathogen
Performing an antimicrobial susceptibility testing (AST) without prior knowledge of the microorganism identity is very advantageous. For example, universal PCR primers, which can detect a wide range of bacteria, have been previously described, such as the 16S forward primer CCTACGGGNGGCWGCAG (SEQ ID NO: 12) and the 16S reverse primer G ACT ACH V GGGT ATCTAATCC (SEQ ID NO: 13) (Klindworth et al., 2013). As a proof of concept for an AST determination of an unknown bacteria, these primers were used in a MAPt assay on blood culture samples spiked with F. tularensis LVS as described previously for MAPt using F. tularensis- specific primers. F. tularensis LVS were spiked into human blood and incubated at 37°C for 5 hours with agitation. The bacteria were then plated in a 96-well CHA plate containing binary dilutions of doxycycline (Fig. 5 A) or ciprofloxacin (Fig. 5B). Following a 16-hours incubation, the bacteria were suspended in 150 pi PBS and 100 mΐ were transferred to a new 96-well PCR plate containing 100 mΐ of 20% triton buffer. Following a 30-min heating at 95°C, 5 mΐ were subjected to qPCR with the F. tularensis- specific primers and probe for the fop A gene (namely primers and probe having sequences denoted herein by SEQ ID NOs: 7-9) or SYBR-based qPCR using the universal 16S primers (namely primers having sequences denoted herein by SEQ ID NOs: 12-13).
Next, ACt values were calculated by subtracting the growth control Ct values from the Cts of the samples from the antibiotic-containing wells. qPCR reactions for the fop A gene are described above. The qPCR conditions for the universal 16S primers were as follows: The qPCR reactions were performed in 25-m1 volumes consisting of 12.5 mΐ SensiFAST™ SYBR Lo-ROX mix (BIOLINE, Cat#B 10-94005), 2 mΐ each from the 16S forward and reverse primers (SEQ ID NOs: 12 and 13) at 5 mM, 3.5 mΐ molecular-grade water and 5 mΐ of the samples. The PCR were performed on a QuantStudio 5 Real-Time PCR system using the following PCR program: 95°C 3 min, 35 cycles of 95°C 30 sec, 54°C 30 sec, 72°C 30 sec and 78°C 5 sec. Ct values were extracted by the software based on the optical data that was collected at the 78°C step.
As shown in Fig. 5, the ACt values obtained for the 16S primers were essentially similar to the ACt values obtained for the fopA gene primers when the test was conducted in the presence of doxycycline (Fig. 5 A) and ciprofloxacin (Fig. 5B), indicating that both sets of primers may be used. Furthermore, the MIC values thereby obtained are similar to those described above and to those obtained by the classical microdilution test.
Example 7: MAPt may be successfully performed in plates stored for at least 10 months at -70°C
Generally, agar plates supplemented with antibiotics are valid for up to 2 months under regulated conditions (e.g., 4°C). The option of storing a stock of MAPt plates, ready for use, for months, holds great value and advantage. To this end, the performance of 10 months frozen MAPt plates was checked and compared to the performance obtained for a fresh MAPt plate and MIC values thereby obtained were compared to a standard AST procedure. The table below summarizes the results tested on B. anthracis.
Table 8: MIC values for Ciprofloxacin and Doxycycline on B. anthracis obtained by the MAPt assay
Figure imgf000036_0001
The MIC values on B. anthracis obtained by standard microdilution AST procedure are 0.016-0.063 pg/ml for ciprofloxacin and 0.008-0.031 pg/ml for doxycycline.

Claims

CLAIMS:
1. A method for determining antimicrobial susceptibility of a microorganism, comprising:
(a) incubating a sample on a solid growth substrate containing at least one antimicrobial agent at varying concentrations;
(b) recovering the microorganism growing on the solid growth substrate surface; and
(c) determining the microorganism quantity using a method selected from the group consisting of: a nucleic acid-based method, an immunological method, a metabolism-based method, mass spectrometry, and a combination thereof, wherein a difference in the microorganism quantity between samples grown in the presence or absence of an antimicrobial agent indicates antimicrobial susceptibility of the microorganism to the tested antimicrobial agent.
2. The method of claim 1 wherein said recovery step (b) is performed before the microorganism can be visualized on the solid growth substrate.
3. The method of claim 1 or claim 2 wherein said recovery step (b) is performed at a predetermined time point.
4. The method of any one of the preceding claims further comprising determining the Minimal Inhibitory Concentration (MIC) value of said antimicrobial agent and/or determining susceptibility categories.
5. The method of any one of the preceding claims wherein said microorganism is a bacterial strain selected from the group consisting of B. anthracis, Y. pestis, and F. tularensis.
6. The method of any one of claims 1 to 4 wherein said microorganism is a bacteria or fungus causing a nosocomial infection.
7. The method of any one of claims 1 to 4 wherein said microorganism is selected from the group consisting of: Clostridium difficile, carbapenem-resistant Enterobacteriaceae (CRE), Neisseria gonorrhoeae, Multidrug-resistant Acinetobacter, Drug-resistant Campylobacter, Fluconazole-resistant Candida, Extended spectrum b- lactamase producing Enterobacteriaceae (ESBLs), Vancomycin-resistant Enterococcus (VRE), Multidrug-resistant Pseudomonas aeruginosa, Drug-resistant non-typhoidal Salmonella, Drug-resistant Salmonella Typhi, Drug-resistant Shigella, Methicillin- resistant Staphylococcus aureus (MRSA), Drug-resistant Streptococcus pneumoniae, Drug-resistant tuberculosis, Vancomycin-resistant Staphylococcus aureus (VRSA), and Drug-resistant Group A and B Streptococci.
8. The method of any one of the preceding claims wherein said sample is a biological sample obtained from a subject, or an environmental sample.
9. The method of claim 8 wherein said biological sample is selected from a group consisting of blood, plasma, serum, lymph nodes, urine, feces, saliva, cerebrospinal fluid, lung aspirate, peritoneal lavage, sperm, nasopharyngeal swabs and a tissue biopsy.
10. The method of claim 9 wherein said blood sample is a whole blood sample or a fractionated blood sample.
11. The method of any one of claims 8 to 10 wherein said subject is a human subject.
12. The method of claim 8 wherein said environmental sample is collected from roads, sidewalks, grass, ponds, floors, appliances, air, water or soil.
13. The method of any one of the preceding cl aims wherein said solid growth substrate is selected from the group consisting of agar, polyacrylamide hydrogel, gelatin, paper and membrane.
14. The method of claim 13 wherein said solid growth substrate is Cystine Heart Agar (CHA) or Muller-Hinton agar (MHA).
15. The method of any one of the preceding cl aims wherein said solid growth substrate further comprises additional nutrients.
16. The method of any one of the preceding claims wherein said incubation step (a) is performed at a temperature of between about 28°C and about 37°C.
17. The method of any one of the preceding claims wherein said antimicrobial agent is an antibiotic agent selected from the group consisting of tetracyclines (e.g. doxycycline), fluoroquinolones (e.g. ciprofloxacin), penicillin (e.g. ampicillin), cephalosporin (e.g. ceftriaxone), macrolides (e.g. erythromycin, azithromycin), aminoglycosides (e.g. gentamycin), monobactams (e.g. aztreonam), carbapenems (e.g. imipenem), metronidazole, chloramphenicol, vancomycin, and rifampin.
18. The method of any one of the preceding claims wherein said sample was not diluted prior to incubation step (a).
19. The method of any one of claims 1 to 17 wherein said sample was not subjected to a culturing step, and/or an enrichment step, and/or a separation step, prior to incubation step (a).
20. The method of any one of the preceding claims wherein bacterial concentration in the sample is not determined prior to incubation step (a).
21. The method of any one of the preceding claims wherein said sample contains between about 5xl03 to about 108 colony forming units (cfu)/ml.
22. The method of any one of the preceding claims wherein said incubating step (a) is performed in a multi-well plate comprising said solid support substrate.
23. The method of any one of the preceding claims wherein no prior identification of the bacterial strain is performed.
24. The method of any one of the preceding claims wherein the determination of bacterial quantity is performed using a qPCR reaction.
25. The method of claim 24 wherein the qPCR reaction is performed using bacteria- specific primers or using universal primers.
26. A kit comprising:
(a) At least one multiple well plate comprising at least one solid growth substrate containing at least one antimicrobial agent at varying concentrations; and optionally
(b) at least one microorganism-specific primer set and/or at least one universal primer set; and optionally
(c) at least one microorganism-specific detectably labelled probe and/or at least one detectable identification agent; and
(d) instructions for use in determining antimicrobial susceptibility of a microorganism according to the methods of any one of claims 1-25.
27. A kit according to claim 26 for use in the method of any one of claims 1-25.
PCT/IL2020/051129 2019-10-31 2020-10-29 A method for determining bacterial susceptibility to antibiotics WO2021084539A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
IL270342A IL270342B (en) 2019-10-31 2019-10-31 A method for determining bacterial susceptibility to antibiotics
IL270342 2019-10-31

Publications (1)

Publication Number Publication Date
WO2021084539A1 true WO2021084539A1 (en) 2021-05-06

Family

ID=75715816

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL2020/051129 WO2021084539A1 (en) 2019-10-31 2020-10-29 A method for determining bacterial susceptibility to antibiotics

Country Status (2)

Country Link
IL (1) IL270342B (en)
WO (1) WO2021084539A1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090317859A1 (en) * 2005-07-22 2009-12-24 Daniels Alma U Calorimetric assessment of microorganisms and use thereof
WO2011152899A1 (en) * 2010-06-02 2011-12-08 Johns Hopkins University System and methods for determining drug resistance in microorganisms
WO2015189390A1 (en) * 2014-06-13 2015-12-17 Q-Linea Ab Method for detecting and characterising a microorganism
WO2017127727A1 (en) * 2016-01-21 2017-07-27 T2 Biosystems, Inc. Rapid antimicrobial susceptibility testing using high-sensitivity direct detection methods

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090317859A1 (en) * 2005-07-22 2009-12-24 Daniels Alma U Calorimetric assessment of microorganisms and use thereof
WO2011152899A1 (en) * 2010-06-02 2011-12-08 Johns Hopkins University System and methods for determining drug resistance in microorganisms
WO2015189390A1 (en) * 2014-06-13 2015-12-17 Q-Linea Ab Method for detecting and characterising a microorganism
WO2017127727A1 (en) * 2016-01-21 2017-07-27 T2 Biosystems, Inc. Rapid antimicrobial susceptibility testing using high-sensitivity direct detection methods

Non-Patent Citations (25)

* Cited by examiner, † Cited by third party
Title
BEN-GURION, R.SHAFFERMAN, A.: "Essential virulence determinants of different Yersinia species are carried on a common plasmid", PLASMID, vol. 5, 1981, pages 183 - 187, XP024799511, DOI: 10.1016/0147-619X(81)90019-6
BOISSET, S.CASPAR, Y.SUTERA, V.MAURIN, M.: "New therapeutic approaches for treatment of tularemia: a review", FRONTIERS IN CELLULAR AND INFECTION MICROBIOLOGY, vol. 4, 2014, pages 1 - 8
CLSI: "M07 Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically", 2018
CLSI: "Methods for Antimicrobial Dilution and Disk Susceptibility Testing of Infrequently Isolated or fastidious Bacteria", 2015, PA CLINICAL AND LABORATORY STANDARDS INSTITUTE
COHEN, S.MENDELSON, I.ALTBOUM, Z.KOBILER, D.ELHANANY, E.BINO, T. ET AL.: "Attenuated nontoxinogenic and nonencapsulated recombinant Bacillus anthracis spore vaccines protect against anthrax", INFECT IMMUN, vol. 68, 2000, pages 4549 - 4558, XP002942521, DOI: 10.1128/IAI.68.8.4549-4558.2000
GALIMAND, M.CARNIEL, E.COURVALIN, P.: "Resistance of Yersinia pestis to antimicrobial agents", ANTIMICROB AGENTS CHEMOTHER, vol. 50, 2006, pages 3233 - 3236
GILL, V.CUNHA, B.A.: "Tularemia pneumonia", SEMIN RESPIR INFECT, vol. 12, 1997, pages 61 - 67
IDA STEINBERGER-LEVY ET AL: "A Rapid Molecular Test for Determining Yersinia pestis Susceptibility to Ciprofloxacin by the Quantification of Differentially Expressed Marker Genes", FRONTIERS IN MICROBIOLOGY, vol. 7, 19 May 2016 (2016-05-19), Lausanne, XP055764276, ISSN: 1664-302X, DOI: 10.3389/fmicb.2016.00763 *
INGLESBY, T.V.DENNIS, D.T.HENDERSON, D.A.BARTLETT, J.G.ASCHER, M.S.EITZEN, E. ET AL.: "Plague as a biological weapon. Medical and public health management", JAMA, vol. 283, 2000, pages 2281 - 2290
J. M. ROLAIN: "Real-time PCR for universal antibiotic susceptibility testing", JOURNAL OF ANTIMICROBIAL CHEMOTHERAPY, vol. 54, no. 2, 1 July 2004 (2004-07-01), pages 538 - 541, XP055261813, DOI: 10.1093/jac/dkh324 *
JANSE, I.MASS, M.RIJKS, J.M.KOENE, M.VAN DER PLAATS, R.Q.ENGELSMA, M. ET AL.: "Environmental surveillance during outbreak of tularemia in hares, the Netherlands, 2015", EURO SURVEILL, vol. 22, 2017
JUDITH BEUVING ET AL: "Antibiotic Susceptibility Testing of Grown Blood Cultures by Combining Culture and Real-Time Polymerase Chain Reaction Is Rapid and Effective", PLOS ONE, vol. 6, no. 12, 14 December 2011 (2011-12-14), pages e27689, XP055709538, DOI: 10.1371/journal.pone.0027689 *
KLINDWORTH APRUESSE ESCHWEER T ET AL.: "Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies", NUCLEIC ACIDS RES, vol. 41, no. 1, 2013, pages e1, XP055253067, DOI: 10.1093/nar/gks808
LARSON, C.L.WICHT, W.JELLISON, W.L.: "A new organism resembling P. tularensis isolated from water", PUBLIC HEALTH REP, vol. 70, 1955, pages 53 - 58
PARKER, R.R.STEINHAUS, E.A.KOHLS, G.M.JELLISON, W.L.: "Contamination of natural waters and mud with Psteurella tularensis and tularemia in beavers and muskrates in the northwestern United States", BULL NATL INST HEALTH, vol. 193, 1951
PECHOUS, R.D.SIVARAMAN, V.STASULI, N.M.GOLDMAN, W.E.: "Pneumonic Plague: The Darker Side of Yersinia pestis", TRENDS IN MICROBIOLOGY, vol. 24, 2016, pages 190 - 197, XP029439859, DOI: 10.1016/j.tim.2015.11.008
PETERSEN, J.M.CARLSON, J.YOCKEY, B.PILLAI, S.KUSKE, C.GARBALENA, G. ET AL.: "Direct isolation of Francisella spp. from environmental samples", LETTERS IN APPLIED MICROBIOLOGY, vol. 48, 2009, pages 663 - 667
POMERANTSEV, A.P.SHISHKOVA, N.A.MARININ, I.I.: "Comparision of therapeutic effects of antibiotics of the teteracycline group in the treatment of anthrax caused by a strain inheriting tet-gene of plasmid pBC16", ANTIBIOT KHIMIOTER, vol. 37, 1992, pages 31 - 34
STEINBERGER-LEVY, I.SHIFMAN, O.ZVI, A.ARIEL, N.BETH-DIN, A. ET AL.: "A rapid molecular test for deternining Yersinia pestis susceptibility to ciprofloxacin by the quantification of differntially expressed marker genes", FRONT MICROBIOL, vol. 7, 2016, pages 763
STEPANOV, A.V.MARININ, I.I.POMERANTSEV, A.P.STARITSIN, N.A.: "Development of novel vaccines against anthrax in man", J BIOTECHNOL, vol. 44, 1996, pages 155 - 160, XP004036861, DOI: 10.1016/0168-1656(95)00092-5
SUTERA, V.LEVERT, M.BURMEISTER, W.P.SCHNEIDER, D.MAURIN, M.: "Evolution towards high-level fluoroquinolone resistance in Francisella species", J ANTIMICROB CHEMOTHER, vol. 69, 2014, pages 101 - 110
VERSAGE, J.L.SEVERIN, D.D.CHU, M.C.PETERSEN, J.M.: "Development of a multitarget real-time TaqMan PCR assay for enhanced detection of Francisella tularensis in complex specimens.", J CLIN MICROBIOL, vol. 41, 2003, pages 5492 - 5499, XP002422952, DOI: 10.1128/JCM.41.12.5492-5499.2003
WIELINGA, P.R.HAMIDJAJA, R.A.AGREN, J.KNUTSSON, R.SEGERMAN, B.FRICKER, M. ET AL.: "A multiplex real-time PCR for identification and differntiating B. anthracis virulent types", INTERNATIONAL JOURNAL OF FOOD MICROBIOLOGY, vol. 145, 2011, pages 137 - 144
YOSHIDA ET AL., ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, vol. 41, no. 6, 1997, pages 1349 - 1351
ZHANG ET AL., MICROBIOL. INSIGHTS, vol. 9, 2016, pages 21 - 28

Also Published As

Publication number Publication date
IL270342A (en) 2021-05-31
IL270342B (en) 2021-06-30

Similar Documents

Publication Publication Date Title
US11505835B2 (en) Method for determining the identity and antimicrobial susceptibility of a microorganism
Kaleta et al. Use of PCR coupled with electrospray ionization mass spectrometry for rapid identification of bacterial and yeast bloodstream pathogens from blood culture bottles
US20230416671A1 (en) Composition And Method For Stabilizing And Maintaining The Viability Of Hardy Microorganisms
CN102482712B (en) Method and kit for detecting antibiotic-resistant bacteria
RU2420595C2 (en) METHOD OF QUANTITATIVE ANALYSIS OF CELL NUMBER OF ALIVE BACTERIUM OF INTEREST WITH APPLYING rRNA AS TARGET
US20180135108A1 (en) Method for detecting bacterial and fungal pathogens
WO2010048511A1 (en) Antibiotic susceptibility profiling methods
JP2022504269A (en) Cell detection and analysis
Sousa et al. A prospect of current microbial diagnosis methods
Miller et al. Globicatella sanguinis osteomyelitis and bacteremia: review of an emerging human pathogen with an expanding spectrum of disease
US20110200984A1 (en) Using nucleic acids for clinical microbiology testing
McCann et al. Evaluation of MolYsis™ Complete5 DNA extraction method for detecting Staphylococcus aureus DNA from whole blood in a sepsis model using PCR/pyrosequencing
Hockman et al. Comparison of multiplex PCR hybridization-based and singleplex real-time PCR-based assays for detection of low prevalence pathogens in spiked samples
KR101520931B1 (en) Composition for diagnosing sepsis and method thereof
WO2021084539A1 (en) A method for determining bacterial susceptibility to antibiotics
Frickmann et al. Rapid identification of Acinetobacter spp. by fluorescence in situ hybridization (FISH) from colony and blood culture material
Ismail et al. Routine Use of 16S rRNA Gene Sequencing for Diagnosis of Culture-Negative Bacterial Infections in Body Fluids Other than Blood: Benefits in a Limited Resource Hospital
Goldenberg Molecular-based diagnostics, including future trends
US20220315976A1 (en) Method for antibiotic susceptibility testing of blood samples
Galeb et al. Diagnostic Value of Multiplex Polymerase Chain Reaction in Detection of Acinetobacter baumannii, Pseudomonas aeruginosa, and Stenotrophomonas maltophilia from Sepsis in Pediatrics
Rotem et al. Beating the Bio-Terror Threat with Rapid Antimicrobial Susceptibility Testing. Microorganisms 2021, 9, 1535
Lindsay et al. Alternative Methods of Bacterial Pathogen Detection: Culture, GoldenGate®, Universal

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20811113

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20811113

Country of ref document: EP

Kind code of ref document: A1