IE920562A1 - Aptamer specific for biomolecules and method of making - Google Patents

Abstract

A method for identifying oligomer sequences which specifically bind target molecules such as serum proteins, kinins, eicosanoids and extracellular proteins is described. The method is used to generate aptamers that bind to serum Factor X, thrombin, bradykinin, PGF2 alpha and cell surface molecules. The technique involves complexation of the target molecule with a mixture of oligonucleotides containing random sequences and sequences which serve as primer for PCR under conditions wherein a complex is formed with the specifically binding sequences, but not with the other members of the oligonucleotide mixture. The complex is then separated from uncomplexed oligonucleotides and the complexed members of the oligonucleotide mixture are recovered from the separated complex using the polymerase chain reaction. The recovered oligonucleotides may be sequenced, and successive rounds of selection using complexation, separation, amplification and recovery can be employed. The oligonucleotides can be used for therapeutic and diagnostic purposes.

Description

The present Invention ie directed to a method for identifying oligonucleotide sequences which specifically hind blomolecules, including peptides, hydrpphobic molecules, and target features on call surfaces, in particular extracellular proteins, and the use of these sequerices to detect and/or isolate the target molecules and the resulting compositions, ihe instant invention is exemplified hy obtaining compositions, through the use of disclosed methods, that comprise oligonucleotide sequences which bind to Factor X, thrombin, kinins, sicosanoids and extracellular proteins.

The invention is also directed to improvements in methods to identify specific binding sequences for target substances and methods of use of such specific binding eequences. More specifically, it concerns: (1) the use of oligonucleotides containing modified monomer residues to expand the repertoire of candidate oligomer sequences; (2) ths use of identifying and amplifying oligonucleotides without attached flanking regions or structural constraints, but which nevertheless are capable of specific binding to desired targets; and (3) the design and use of conjugates designed to bind specific target cells aad induce an immune rssponee to the target cells. -2Background and Related Art Specifically Binding Oligonucleotides. Conventional methods of therapeutic treatment based on binding and inhibition of therapeutic target molecules as «ell as detection and isolation of proteins and other molecules have employed email molecules, antibodies and the like which specifically bind such substances. Recently, however, the de novo design of specifically binding oligonucleotides for non-oligonucleotide targets has been described. See, e.g., Blackwell et al., Science (1990) 252:1104-1110; Blackwell et al., Science (1990) 252:1149-1151; Tuerk, C., and Gold, L., Science (1990) 212:505-510; Ellington et al.. Nature (1990) 2l£:8l8822. Such oligonucleotides have been termed aptamers* herein. The Tuerk reference describes the use of an In vitro selection and enrichment procedure to obtain RNA molecules that bind to an RNA binding protein. Zn this method, a pool of RNA· that are completely randomized at specific positions is subjected to selection for binding to a desired protein. The selected RNAs are then amplified as double-stranded DNA that is competent for subsequent in vitro transcription. Ths newly transcribed RNA is then enriched for better binding sequences and recycled through this procedure. The amplified selected sequences are subjected to sequence determination using dideoxy sequencing. Tuerk and Gold applied this procedure to determination of RNA molecules which are bound by T4 DNA polymerase. The method utilizes the polymerase chain reaction (PCR) technique, as described by Saiki, R.X., et al., Science (1988) 222:487-491, to amplify the selected RNAs.

Rinsler, K.W., et al., Nucleic Acids Res (1989) 12:3645-3653, describes the use of PCR to identify dna sequences that are bound by proteins that regulate gene expression. In the reported work, total genomic DNA ie -3first converted to a form that ie suitable for amplification by PCR and the DNA sequences of interest are selected by binding to the target regulatory protein. The recovered bound sequences art then as^lified by PCR.

The selection and amplification process are repeated as needed. The process as described was applied to identify DNA sequences which bind to the Renopue laevie transcription factor 3A. The same authors (Kinzler et al.) in a later paper, Mol Cell Biol (1990) 1^:634-642, applied this technique to identify the portion of the human genome which is bound by the OLI gene product produced as a recombinant fusion protein. The GDI gene is amplified in a subset of human tumors.

Riling ton, A.D., et al., Nature (1990) M£:81815 822, describe the production of a large number of random sequence RNA molecules and identification of those which bind specifically to selected molecules, for instance, organic dyes such as Cibacron blue. Randomly synthesised DNA yielding approximately 1019 individual sequences was amplified by PCR and transcribed into RNA. It was thought that the complexity of the pool was reduced in the amplification/transcription steps to approximately 1013 different sequences. The pool was then applied to an affinity column containing the dye and the bound sequences subsequently eluted, treated with reverse transcriptase and amplified by PCR. The results showed that about one in 1010 random sequence RNA molecules folds in such a way as to bind specifically to the ligand.

Thiesen, R.-J., and Bach, C., Nucleic Acids Res (1990) 11:3203-3208, describe what they call a target detection assay (IDA) to detezmine DNA binding sites for putative DNA binding proteins. In their approach, a purified functionally active DNA binding protein and a pool of genomic double-stranded oligonucleotides which -4contain PCR primer ait·· at each and ware incubated with the protein. Tha resulting DNA complexes with the protein (in their case, the SPl regulatory protein) were separated from the unbound oligomer· in the mixture by band-shift electrophoresis and ths coaplax oligonucleotides were rescued by PCR and cloned, and then sequenced using double-stranded mini-prep DNA sequencing.

None of the above reference!, however, describes the identification of oligonucleotides which specifically bind molecules that are not known to interact with oligonucleotides. Xn particular, theae references do not describe the identification of oligonucleotides which specifically bind peptide molecules such as eerum proteins, kinine, hydrophobic molecules such as eicosanoide, or extracellular proteins.

Xn addition, the art has not demonstrated (i) in vivo therapeutic (mamnalian or primate) efficacy of selected oligonucleotides for any clinical Indication, (ii) binding of oligonucleotides to molecules that do not ordinarily bind to nucleic acid as part of their normal function, (iii) interference with the function of a target molecule by bound a oligonucleotide or aptamer, (iv) target molecule binding mediated by single-stranded DNA and (v) target-specific binding of short oligonucleotides or oligonucleotide analogs that are derived from a larger full-length parent oligonucleotide (aptamer) molecule.

Targets. Kinins are peptides which are formed in biological fluids by the activation of klninogens.

Kinins have been shown to exert numerous physiological and pathological actions such as exhibiting hypotensive effects, causing pain, mediating reactive hyperaemia in exocrine glands, playing a role in vascular and cellular events that accompany the inflammatory processes, controlling blood pressure, and possibly acting aa -5· protective agents against hypertension, in pathological states, kinin· have been implicatsd in aethma, inflammatory disease· euoh as rheumatoid arthritis and other forme of arthritis, vascular changes occurring in migraine, myocardial infarction, cardiovascular failure, carcinoid and postgastrectomy dunping syndromes, hyperbradykininism syndrome, hemorrhagic and endotoxic shock, as well as other pathological conditions. For a review of kinins, see Regoli, D., and Barabe, J., Pharmacological Review (1980) 22:1-46.

Bicosanoida are a family of fatty acid derivatives which include the various prostaglandins, thromboxanes, leukotrienes and prostacyclin. Bicosanoida are widespread and produce a remarkably broad spectrum of effects embracing nearly every biological function. For example, eicosanoids have been shown to affect the cardiovascular system, blood, smooth muscle, kidney and urine formation, the central nervous system, inflammatory and immune responses, afferent nerves and pain, as well as several metabolic functions. For a general review of eicosanoids and their biological significance, see Moncada, S., et al., in The Pharmacological Basis of Therapeutics. Oilman, A.O., et al., eds. (MacMillan Publishing Company, New York), 7th Edition, pages 66025 671.

Many of theae molecules are so ubiquitous that antibody production in laboratory animals against the native molecule· ie difficult unites they are chemically modified to beeome antigenic. Labeled kinins with sufficient specific activity are not available and bradykinin antibodies tend to crose-react with kinlnogen. Therefore, conventional imnunodlagnostie and isolation techniques are not easily available with respect to these substances. It would therefore be desirable to develop alternative methods for working with these agents. -6Additlonally, there ere numerous difficulties related to collecting biological samples while avoiding the formation or the inactivation of kinins. Thus, previous assay methods have focused on measuring the particular klninogene rather than the activation peptidee thereof. For a review of the problems associated with the uee of conventional diagnostic techniquee and kinins, see Ooodfriend, T.L., and Odya, C.B., in Methods of Hormone RadlolmminoaBsays, B.N. Jaffee and H.R. Behrman, eds. {Academic Press, New York), 1979, pages 909-923; and Talamo, R.C., and Ooodfriend, T.L., Handbook Bxn. Pharmacol. (1979) 25. (Suppl.) :301-309. It would therefore be desirable to develop alternative methods for working with these agents.

Extracellular proteins ars well known proteins portions of which often extend through the cell membrane. Particular cells can be characterised by the presence of particular extracellular proteins on their surface.

These proteins can serve a variety of functions including providing binding cites for other biomolsculss and/or virus receptors. It is also known that it is possible to differentiate normal cslle of a given type from abnormal cells by the type and/or amount of extracellular protein on the celle’ surface. Since it is known that it is possible to differentiate different types of cells by the extracellular proteins present on their surface, different methodologies have been developed in attempts to characterise cells by the ability of certain molecules to bind to the extracellular proteins on those cells.

Ths present inventors postulated that oligonucleotides could bs used to bind to extracellular proteine. Although such binding does occur, it is not highly specific, i.e., a given oligonucleotide may bind to cellular proteins on two very different types of cell lines. Purther, even if a particular oligonucleotide ie -7found to be specific to a particular extracellular protein, it ia difficult to isolate the desired oligonucleotide and produce it in sufficient amounts so as to allow it to be useful as a probe to identify particular cell lines having particular extracellular proteins thereon.

The invention herein provides an approach and utilizes a binding selection method combined with PCR or other amplification methods to develop aptamera that bind peptide molecules such as factor X, kinins, hydrophobic molecules such as eicosanoide, and extracellular proteins. In this method, selected and simplified aptamers that specifically bind to theae targets are obtained starting from a pool of randomized oligonucleotides. flvnthetlc Methods. The above references on specifically-binding oligonucleotides do not suggest that oligomers can be synthesized in the candidate mixture containing analogous forms of purines and pyrimidines, as well as modifications in the sugar moieties and the phoaphodisster linkages. This inclusion is significant, since those oligomers containing modifications may have superior binding qualities which are attributable to the modifications per ae and this Inclusion thus expands the repertoire of candidates subjected to the Initial screen. The present Invention is related in part to an improvement in the above-described methods wherein oligomers containing modifications not found in native sequences can be included among the candidates for specific binding.

Furthermore, although PCR has mads possible the isolation and analysis of specific nucleic acid fragments from a wide variety of sources, application of PCR to isolate and analyse a particular nucleic acid region heretofore has required knowledge of the nucleic acid -Isequences either flanking or within the region of interest. The requirement of prior knowledge of the flanking region is particularly troublesome when trying to identify aptamere. Flanking primer sequences impose limits on aptamer structural diversity 1 either the ability to bind is affected by the primers, thereby eliminating from consideration a class of binding agents, or occasionally, the primers actually participate in or facilitate binding by conferring structure. Flanking sequence thus may impose constraints which make aptamers so identified euboptlmal for drug development. These problems with ths processes of selection for truly optimal binding agents or aptamere have severely limited drug development.

Clearly, it would be advantageous to devise methods which permit the identification of optimal aptamere. Methods such as those described by Blllngton, A.D. et al., Nature (1990) li£:818-822, estimate that 1 in 1010 aptamere bind in that system. The novel methods herein described and claimed may revise this ratio downward to 1 in 109 or 1 in 10*. With regard to drug development, many scientists have failed to recognise the problem that flanking primer sequences represent with respect to selection for truly optimal binding agents.

Furthermore, none of the cited references describe the identification of aptamere capable of binding to proteins such as thrombin, nor is the use of single stranded DNA suggested as an appropriate material for generating aptamers. The use of DNA aptamere according to this invention has several advantages over RNA including increased nuclease stability and ease of amplification by PCR or other methods. RNA generally ie converted to DNA prior to amplification using reverse transcriptase, a process that is not equally efficient -9with all sequence·, resulting la loss of some aptamers from s selected pool.

Modified Bases in-Polymerization Reactions, λ large number of modifications which behave in a known manner in polymerase reactions is known. Otvos, L., et al., Nucleic Acids Res (1987) 1763-1777, report the enzyme catalysed incorporation of 5- (1-alksayl) -2' deoxyuridines into DNA. As reported in this paper, 5-vinyl-dUP behaved in the DNA polymerase 1 reaction catalyzed by the Klenow fragment in a manner similar to dTTP; (1)-5- (1-heptsnyl) and (B)-5-(l-octenyl) -dUDPs wars poor substrates,* however, all of these residues are read aa thymidine in the polymerization.

Allen, D.J., et al., Biochemistry (1989) ££:4601-4607, report the incorporation of 5-(propylamino) uridine into oligomers and its labeling, using the propylamine function, with mansyl chloride. This complex was used to study interaction with DNA polymerase I (Klenow fragment) and was shown to interact with the ensyme. This bass residue ia also recognised as thymidine.

Langer, p.r., et al., free Natl. Acad flcl.Hfll (1981) 2ft:6633*6637, described the synthesis of DNA and RNA using dOTP and DTP residues labeled with biotin through a linker at the C5 position, These labeled forms of dUTP and dtp were utilised by a nusdOer of DNA and RNA polymerases and are recognized by these enzymes when Included in the oligomer template as thymidine or uridine.

Gebyehu, a., et al., Nucleic Addi Rei (1987) .:4513, reported biotin-label ing of dATP and dCTP nucleotide analogs through the 6-position of adenine and 4-position of cytosine. They were incorporated into dna probes lay standard nick translation protocola and probes labeled with biotin derivatives of these nucleotides were -10effectively hybridized to target DNA sequences. Thue, the modified forma of dATP and dCTP, when incorporated into oligomers are recognized as A and C, respectively. Similarly, 0111am, I.C., et al., Anal Biochem (1986) 1995 207, described the incorporation of N4-(6-aminohexyl) cytidlne and deoxycytidine nucleotides into DNA enzymatically.

Trainor, G.L., et al., Nucleic Acids Res (1988) 16:11846. describe the ability of succinyl-fluorescein10 labeled dldeoxynucleoside triphosphates as substrates for terminal deoxynucleotidyl transferase and their use in the preparation of 3'-fluorescence-tagged DNA.

Mlzusawa, 8., et al., Nucleic Acids Res (1986) 14, described the replacement of dGTP in polymerase reactions by deoxy-7-deazaguanidine triphosphate; this is also described in the context of a PCR reaction by Innis, M.A., in 'PCR Protocols: A Guide to Methods and Applications” (1990) Academic Press Inc.

The incorporation of 5-azido-dUTP appears to substitute for dTTP in polymerase reactions as reported by Rvans, R.X., et al., filfifihfiffiilLCX (1987) 2£>269-2?6; Proc Natl Acad Sci U8A (1986) 41:5382-5386.

Oligonucleotides whieh contain covalentlybound mercury at specific base residues was described by Dale, R.M.X., et al., Proc Natl Acad Sci USA (1973) 14:2238-2242.

Finally, a terminal fluorescence residue using purines linked to fluorescing moieties is described by Prober. J.M., et al., flclanoa 214:336.

Further, as set forth in the foregoing publications, not only is the modified base specifically recognized as such in a template sequence; nucleotide triphosphates utilizing the modified base are also capable of incorporation into the newly synthesized strand by polymerase enzymes. -11Inrnune Recognition Mechanisms. This invention is also related to the use of specific binding oligomers in immune recognition mechanisms. Various immune recognition mechanisms exist which permit recognition and immune destruction of malignant or infected calls in an organism. Malignant cells often express antigens that are not found in normal cells; some of these antigens are found at the surface of the cell. Similarly, pathogeninfected cells often express pathogen-encoded antigens at the cell surface. Zn both cases, the surface antigen represents a potential target for a CTL (cytotoxic Tcell) immune response.

Unfortunately, immune responses against unwanted cells are not always effective; moreover, such IS responses can, in sone instances, be suppressed, a variety of mechanisms may play a role in tha reduction or suppression of immune responses to pathologic cells. For example, tumors are associated with a decreased level of the histocompatibility antigens that may play a role in eliciting a CTL response. Viruses have also been able to mask viral antigens at the cell surface. In the case of HIV, heavy glycosylation of the envelope protein (normally found at tha cell surface) may play a role in preventing an effective immune response against infected cells. The propensity of pathologic cells to reduce or eecape effective CTL response· probably plays a role in tha progression of various infections and disorders.

While some vaccines in current use consist of only portions of a pathogen (such as a viral envelope protein in the case of HBV virus), immune response· against an intact pathogen, such as a virus or bacterium, are often more effective that responses against individual components of the pathogen. Attenuated virus vaccines, for example, are ueed in same cases in order to expose the immune system to antigens that present •12epitopes In as natural a fox» aa possible. The resulting immune response appears in general to result in more effective protection against the pathogen than the corresponding response to only e portion of the pathogen.

Many CTL responses appear to be baaed upon specific contacts between a plurality of surface antigens serving as signals for both self and non-self cells. Normal immune function ls believed to involve a combined response to this plurality of surface antigens. Hence, it is reasonable to expect that a modified immune response would result if one or more of these surface features were somehow modified or masked.

Zn addition to tha use of antibodies specific for one or more of the subject surface features, considerable attention has also been directed recently to the use of oligonucleotides of similar specificity.

De novo recovery of specifically binding oligonucleotides ia possible with respect to non-oligonucleotide targets, as discussed above.

It would clearly be advantageous to devise methods which permit the modulation of immune response to natural antigens in a manner such that optimum immune protection against a pathogen or malignant cell may be obtained, or such that aa undeslred cooponent of tha response may be eliminated. Zn particular, it would ba desirable to take advantage of the involvement of a plurality of epitopes la the normal immune response by developing immunomodulatory agents which target one or more specific epitopes Involved in generating the immune response.

Disclosure of the Invention The Invention described herein provides specifically binding oligonucleotides or aptamers that are stable, versatile, and highly specific for their -13intsndsd targets. Furthermore, the aptamers of ths invention may be determined as well as synthesised using modified nucleotides and internucleotide linkages. In addition, these aptamers may be obtained from mixtures of candidate oligomers with completely unpredetermined sequences, without the necessity for Inclusion of PCR primer sequences in the candidate pool. The efficiency of the method to determine suitable aptamers is further enhanced by separation of the complex containing successful candidate oligonucleotides bound to target from uncomplexed oligonucleotides and elution of ths complex from solid support.

Ths aptamers of ths present invention find a variety of utilities including therapeutic and diagnostic utilities as well as functioning as laboratory and industrial reagents. Ths aptamers of the invention can be coupled to various auxiliary substances euch as label or solid support.

Thus, in one aspect, the invention ie directed to an aptamer containing at least one binding region capable of binding specifically to a target molecule wherein the aptamer is a single*stranded DNA. Such single-stranded DNA aptamers can ba constructed to bind specifically to a wide variety of target substances including proteins, peptides, glycoproteins, lipids, glynoUpIds. carbohydrates, and various small molecules. Such single-stranded DNA aptamere are advantageously stable as compared to RNA counterparts.

In another aspect, the invention ie directed to aptamere that have relatively short specific binding regions of less than 14 nucleotide residues and which may, themselves, bs relatively small molecules containing lees than 15 nucleotide residues. The limited length of these aptamers is advantageous in facilitating administration and synthesis. Further, in still other -14aspects, the invention ie directed to aptamere with very low dissociation constants with respect to their target molecules of less than 10’9; and with high specificity for their targoto of at least 100-feld differential ia binding affinity as compered to coopeting substances. These enhanced specificities and binding affinities are clearly advantageous ia the applications for which the aptamers of the invention are useful.

Zn another aspect, the invention is directed to 10 aptamere that bind to a wide variety of target molecules, especially those selected from the group consisting of aptamers in specifically binding even small and hydrophobic molecules expands ths rang· of their utility.

Zn other aspects, the invention is directed to coaplsxes of the target molecules and the aptamers of the invention and to methods to obtain and to use the aptamers of the invention.

Zn still other aspects, the invention is directed to improved methods to obtain aptamere in general. These improved methods Include the ability to utilise in a candidate pool of oligonucleotides cooplstsly undetermined sequences; to incorporate modified oligonucleotides in tho candidate pool and to include modified nucleotides in the amplifying step of the method; to enhance the efficiency of the method by isolating ths complex between the successful members of ths candidate pool and the target molecule; and to obtain aptamers that bind cell surface factors using a subtraction technique.

Zn still another aspect of the invention, aptamers may be used as specific binding agents in conjugates designed to modulate the Immune system. -15Brief Description ot the Figure· Figure 1 is a chart depicting thrombin aptamer consensus-related sequences.

Figure 2 le a plot of Xq xIxq thrombin inhibition obtained from primates ueing a 15-mer aptamer.

Modes of Carrying Out tha Invention The practice of the present invention will employ, unless otherwise Indicated, conventional techniques of chemistry, molecular biology, biochemistry, protein chemistry, and recombinant DNA technology, which ere within the skill of the art. Such techniques are explained fully in the literature, fififl, e.g.. Oligonucleotide synthesis (m.j. Gait ed. 1980; Nnclaic Acid Hybridisation (B.D. Bamee & S.J. Higgins eds. 1984); Sambrook, Fritsch & Maniatis, Molecular cloning?_A Laboratory Manual. Second Edition (1989); and the series Methods in Hnsymoloqv (s. Colowick and N. Kaplan eds., Academic Press, Inc.}.

The invention le directed to a method which permits the recovery and deduction of aptamera which bind specifically to deeired targets including those illustrated hereinbelow such ae factor X, kinins (including bradykinin) ae well as other email peptide hormonsa euch ae the vasoconstrictor endothelin (a 21mer peptide), email hydrophobic molecules such ae eicosanoids (including POF2a), and extracellular proteins, such ae thrombin, ee well ae molecules that are contained at the cell surface euch as IL-i receptor and CD4. as a result of application of this method, aptamers which contain the specif ically binding sequences can be prepared and used in oligonucleotide-based therapy, in the detection and isolation of the target substance, as well as in other applications. -1 For application in such various uses, the aptamers of ths invention may bs coupled to auxiliary substances chat enhance or complement the function of the aptamer. Such auxiliary substances include, for example, labels such as radioisotopes, fluorescent labels, enzyme labels and ths like; specific binding reagents such as antibodies, additional aptamer sequence, cell surface receptor ligands, receptors per se and ths like; toxins such as diphtheria toxin, tetanus toxin or ricin; drugs such as antiinflammatory, antibiotic, or metabolic regulator pharmaceuticals, solid supports such as chromatographic or electrophoretic supports, and ths like. Suitable techniques for coupling of aptamere to desired auxiliary substances are generally known for a variety of such auxiliary substances, and ths specific nature of the coupling procedure will depend on the nature of the auxiliary substance chosen. Coupling may be direct covalent coupling or may involve the use of synthetic linkers such as those marketed by Pierce Chemical Co., Rockford, IL.

Thue, the aptamere of ths invention may be used alone in therapeutic applications or may be used as targeting agents to deliver pharmaceuticals or toxins to -17desired targets. The aptamers may be used ia diagnostic procedures and advantageously in this application Include label. They may be uaed aa reagente to separate target molecules from contaminants in samples containing the target molecules in which application they are advantageously coupled to solid support. A particularly advantageous application of the aptamera of the invention includes their use in an immune recruitment procedure as targeting agente for the immunomodulating substance uaed in thia procedure, aa further deecribed below.

As used in the disclosure and claims, the following terms are defined as follows. All references cited are incorporated by reference.

As used herein, a target” or target molecule 15 refers to a biomolecule that could be the focus of a therapeutic drug strategy or diagnoatic aaaay, including, without limitation, proteins or portions thereof, enzymes, peptides, enzyme inhibitors, hormones, carbohydrates, glycoproteins, lipids, phospholipids, nucleic acids, and generally, any biomolecule capable of turning a biochemical pathway on or off or modulating it, or which is involved in a predictable biological response. As used herein, a nucleic acid target may be either single stranded or double stranded and may include sequences (which may or may not be amplified) in addition to the biomolecule or portion thereof. Targets may be free in solution, like thrombin, or associated with cells or viruses, as in receptors or envelope proteins.

Zt should be noted that excluded from target molecules are substances to which DNA sequences normally bind auch as nucleases, substrates wherein binding is effected by Watson-Crick base pairing modes of binding to nucleic acids, specific triple helix binding to nucleic acid sequences, and the like. Thue, excluded from target molecules are those substances which natively bind the -ΐβspecific form of aptamer at issue. Thus, excluded therefore are nucleases that attack single-stranded DNA, restriction endonucleases that attack double-stranded DNA with respect to single-stranded DNA and double-stranded DNA, respectively.

A wide variety of materials can serve as targets. These materials include proteins, peptides, glycoproteins, carbohydrates, including glycosaminoglycane, lipida, and certain oligonucleotides.

A representative list of targets for which the aptamers of the invention may be prepared is set forth herein in Table 1 which follows ths examples in the herein specification.

Some of the useful targets are peptides such as kinins and small low molecular weight carbohydrates such as prostaglandins. These targets have particular features as follows: By kinin” is meant any of the peptide components enzymatically released by the activation of the various kininogens (hormogens). Thus, tha term kinin” includes the mammalian kinins such as, but not limited to, bradykinln (BK), bys-BK, Met-Dys-BK, leukokinins, colostrokinin, neurokinin; the various nonmammalian kinins; and metabolites of the above.

Kinins are small peptides having, on the average, 9-11 amino acids. As described above, there are several inherent problems associated with the use of conventional immunotechniquis for working with kinins. Thus, the preeent invention provides an efficient method for the detection and isolation of these inportant substances.

For a review of kinins and their significance, aes Regoli, d., and Barab·, j., Pharmacological Bsvlcyfl (1980) 12:1-46, incorporated herein by reference in its entirety. -19The subject Inventlcn ls also useful for ths detection and/or isolation of low molecular weight hydrophobic molecules. By hydrophobic is meant a compound having non-polar groupe such that the compound as a whole has a relatively low affinity for water and other polar solvents. Ths hydrophobic molecules of the instant invention lack large numbers of groups that may participate in establishing noncovalent binding interactions with aptamers. Such interactions include base stacking via aromatic rings in ths target, polar and ionic interactions, and hydrogen bonding.

The invention is particularly useful with fatty acid derivatives such as eicosanolds. By eicosanoid* is meant any of the eeveral members of ths family of substances derived from 20-carbon essential fatty aeide that contain three, four or five double bonds: 8,11,14eicosatrienoic acid (dihomo·a-1inolsnic acid)j 5,8,11,14eicosatetraenoie acid (arachidonic acid) and 5,8,11,14,17-eicosapentaenoic acid. Such substances encompass ths various prostaglandins, including but not limited to PGA, PGB, PGC, POD, PGB, POB1, PGB2, PGB2«, POP, PGPlGa, PGF2tt, POO, POQ2, ΡΟΗ, PGH2; the thromboxanes such as but not limited to TXA2 and TXB2; prostacyclin (PGI2) and 6-keto-PGFlaj leukotrienes and precursors thereof euch as LTB4 (a 5,12-dihydroxy compound), LTC4 (a 5-hydroxy derivative that is conjugated with glutathione), LTA4 (a 5,6-epoxide), LTD4 (synthesized by the removal of glutamic acid from LTC4), LTB4 (resulting from the subsequent cleavage of glycine), LTP4 (an α-glutamyl, cysteinyl derivative), SUS-Α (a mixture of LTC4 and XZRD4 known as ths slow-reacting substance of anaphylaxis), MPBTS (hydroperoxyeicosatetraenoic acid) and HBTB (monohydroxyeicosatetraenoic add). Bicosanoids are also intended to include synthetic eicosanoid analogs such as -2016-methoxy-16-methyl-POF2« and 15-methyl-PGP2e (Guxzi, et al., J. Med. Chem. (1986) 29:1826-1832; Cheng, et al., Acta Acad...Mad, Shanghai (1990) 12:378-381) or in vlyg generated eicoeanold metabolites (Morrow, et al.. Prop Natl. Acad, 8cl (USA) (1990) £2:9383-9387). Sicosanoids are relatively low molecular weight compounds which ere generally hydrophobic in nature. These substances normally have molecular weights under 400, but some naturally occurring variants ars conjugated to one or several amino acids and these will have higher molecular weights. These variants are also encompassed by the subject invention. As described above, several eicosanoids have not heretofore been easily detectable or isolstable using standard lmmunotechniquse due to their ubiquitous nature. Thus, the present Invention provides an efficient method for the detection and isolation of these important substances. For a review of eicosanoids and their eignifieance, see Moncada, 8., et al., in The Pharmacological-Basis of Therapeutics. Gilman, A.G., et al., eds. (MacMillan Publishing Company, New York), 7th Edition, pages 660-671, incorporated herein by reference in its entirety.

Ths above small molecule and hydrophobic targets have not heretofore been considered to be potential target molecules for aptamer selection as oligonucleotides are very hydrophilic and highly hydrated. Previous methods for obtaining oligonucleotides that bind to targets utilised protein targets that normally bind to nucleic acids, or in the work described by Bllington, et al., Nature (1990) £££:818-822, target molecules with many possible hydrogen-bond donor and acceptor groups as well as planar surfaces for stacking interactions. Zn ths case of nucleic acid binding proteins, binding to nucleic acid oligonucleotides is aided by the Inherent binding -21properties of th· protein·. Zn th· case of molecules used by Blllngton et al., numerous chemical structures are present that can participate in noncovalent binding interactions including planar aromatic rings that may interact with nucleic acid· via base stacking interactions, zn contrast, many eicosanoids such as PGF2a have relatively little structural diversity. Zt is thus unexpected that fatty acid-like molecules may serve as binding targets for single stranded DNA. One representative eicoeanoid, PGF2a, as used in the present invention, has only 3 hydroxyl groups, two double bond· between adjacent methylene groups, a carboxylic acid group (which, ae used herein, is present ae an amide linkage for covalent attachment to a solid support) and a cyclopentyl ring. By comparison with almost all other classes of potential biological target molecules, the eicosanoids are extremely deficient in groups that may participate in noncovalent binding interactions.

As used herein, specifically binding oligonucleotides or aptamers refers to oligonucleotides having specific binding regions which are capable of forming conqplexes with an Intended target molecule in an environment wherein other substances in the same environment are not complexed to the oligonucleotide. The specificity of the binding is defined in terms of the comparative dissociation constants of the aptamer for target as compared to the dissociation constant with respect to the aptamer and other material· in th· environment or unrelated molecule· in general. Typically, the kd for the aptamer with respect to the target will be 10-fold le·· than kd with respect to target and the unrelated material or accompanying material in the environment. Preferably the kd will be 50-fold less, more preferably 100-fold lees, and more preferably 200-fold leee. -22λβ apecificity ie defined, in terms of kd ae et forth above, excluded from the categories of unrelated materials and materials accompanying the target in the target's environment ere those materials which are sufficiently related to the target to be imnunologically crossreactive therewith, and materials which natively bind oligonucleotides of particular sequences such as nucleases, restriction ensymee, and the like. By lmmunologically crossreactive ia meant that antibodies raised with respect to the target croaareact under standard assay conditions with the candidate material. Generally, for antibodies to crossreact in standard assays, the binding affinities of the antibodies for crossreactive materials should be in the range of 1015 fold.

Thus, aptamera which contain specific binding regions are specific with respect to unrelated materials and with respect to materials which do not normally bind such oligonucleotides such as nucleases and restriction enzymes. Zn general, a minimum of approximately 5 nucleotides, preferably 10, and more preferably 14 nucleotides, are necessary to effect specific binding.

The only apparent limitations on the binding specificity of the target/oligonucleotlde couples of the Invention concern sufficient sequence to be distinctive in the binding oligonucleotide and sufficient binding capacity of tha target subetanee to obtain the necessary interaction. Oligonucleotides of sequences shorter than 10, e.g., 6 mere, are feasible if the appropriate Interaction can be obtained in the context of the environment in which the target is placed. Thus, if there are few interferences by other materials, less specificity and lass strength of binding may be required.

As used herein, aptamer* refer· in general to either an oligonucleotide of a single defined sequence or -31a mixture of said oligonucleotide·, wherein the mixture retain· the properties of binding specifically to the target molecule. Thu·, as used herein aptamer” denotes both singular and plural sequences of oligonucleotidee, as defined hereinabove.

Structurally, the aptamere of the Invention are specifically binding oligonucleotidee, wherein oligonucleotide” is ae defined herein. As set forth herein, oligonucleotidee include not only thoee with conventional bases, sugar residuee and intemucleotide linkages, but also those which contain modifications of any or all of these three moieties.

Oligomers or oligonucleotidee include RNA or DNA sequences of more than one nucleotide in either single chain or duplex form and specifically includes short sequences such as dimers and trlmers, in either single chain or duplex form, which may be intermediate! in the production of the specif ically binding oligonucleotidee.

Oligonucleotide or oligomer is generic to polydeoxyrlbonucleotides (containing 2* ·deoxy-D- ribose or modified forms thereof), i.e., DNA, to polyribonucleotides (containing D-ribose or modified forms thereof), i.e., RNA, and to any other type of polynucleotide which is an N-glycoeide or C-glycoside of a purine or pyrimidine base, or modified purine or pyrimidine base.

The oligomer· of the invention may be formed using conventional phosphodiester-linked nucleotides and synthesized using standard solid phase (or solution phase) oligonucleotide synthesis techniques, which are now commercially available. However, the oligomers of the invention may also contain one or more substitute” linkages as is generally underftood in tbe art. Some of these substitute linkages are non-polar and contribute to the desired ability of the oligomer to diffuse across -24membranes. These substitute· linkages ere defined herein es conventional alternative linkages such as phosphorothioate or phosphoramidate, are synthesised as described in the generally available literature.

Alternative linking groupe include, but are not limited to embodiments wherein a moiety of the formula P(O)S, (thloate), P(8)8 (dithioate), P(0)NR’3, P(O)R', P(O)OR6, CO, or cotot'g, wherein R* is H (or a salt) or alkyl (1*120 and R® ie alkyl (1-90 is joined to adjacent nucleotides through -0- or -8-. Dithioate linkages are diecloeed and claimed in commonly owned U.S. application no. 248,517. Substitute linkages that may be used in the oligomers disclosed herein also Include nonphoephoroue-based internucleotide linkages such as the 3»-thioformacetal (-S-CH3-0-), formacetal (-O-CK^-O-) and 3'-amine (-NH-CH^-CHj-) Internucleotide linkages disclosed and claimed in commonly owned pending U.8. patent application serial nos. 890,786 and 763,130, both incorporated herein by reference. One or more substitute linkages may be utilized in the oligomers in order to further facilitate binding with complementary target nucleic acid sequences or to increase the stability of tha oligomers toward nucleates, as well as to confer permeation ability. (Not all such linkages in the same oligomer need be identical.) The term nucleoside or nucleotide is similarly generic to ribonucleosides or ribonucleotides, deoxyribonucleosides or deoxyribonucleotides, or to any other nucleoside which is aa M-glycoside or C-glycoslde of a purine or pyrimidine base, or modified purine or pyrimidine baee. Thue, the stereochemistry of the sugar carbons may be other than that of D-rlboee in one or more residues. Also included are analogs where the ribose or deoxyribose moiety is replaced by an alternate structure such as the 6-membered morpholino ring described in U.S.

-JSpatent number 5,034,506 or where an acyclic structure servei ae a scaffold that positions the base analogs described herein in a manner that permits efficient binding to target nucleic acid sequences or other targets, elements ordinarily found in oligomers, such as the furanose ring or the phosphodiester linkage may be replaced with any suitable functionally equivalent element. As the a anomer binds to duplexes in a manner similar to that for the ft anomers, one or more nucleotides may contain this linkage or a domain thereof. (Praseuth, D., et al., Prop Natl Acad flci (USA) (1988) £2:1349-1353). Modifications in the sugar moiety, for example, wherein one or more of the hydroxyl groups are replaced with halogen, aliphatic groups, or functionalized as ethers, amines, and the like, are also included.

Nucleoside” and nucleotide include those moieties which contain not only ths natively found purine and pyrimidine bases A, T, C, 0 and u, but also modified or analogous forms thereof. Modifications include alkylated purines or pyrimidines, acylated purines or pyrimidines, or other heterocydes. Such «analogous purines and analogous pyrimidines are those generally known in the art, many of which are used as chemotherapeutic agents. An exemplary but not exhaustive list includes pseudoisocytoslne, N^iN^-sthanocytosins, 8* hydroxy *N*-methyladsnine, 4-acety Icy toe ine, *5(carboxyhydroxyImethyl) uracil, 5-fluorouracil, -bromouracil, 5 - carboxymethylamlnomethyl -2 - thiouracil, -carboxymethylamlnomethyl uracil, dihydrouracil, inosine, Ne-isopentenyl-adenine, 1-methyladenine, l-methylpseudouracil, l-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3methylcytoeine, 5-methyIcytoein·, Ne-methyladenine, 735 methylguanine, 5-methylaminomethyl uracil, 5-methoxy -26aminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'methoxycarbonylmethyluracll, 5-methoxyuracil, 2mAr.hy1r,h1ft-N6-lRnpentenyladenine, uracil-5-nxyafiiM· 1c ndrt methyl ester, pseudouracil, 2-thiocytosine, 5-methyl-25 thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, N-uracil-5-oxyacetic add methylester, uracil-5-oxyacetic add, queosine, 2-thiocytoeiae, and 2,6-diaminopurine.

In addition to the modified bases above, nucleotide residues which are devoid of a purine or a pyrimidine base may also be included in the aptamers of ths invention and in the methods for their obtention.

The sugar residues in the oligonucleotides of ths invention may also be other than conventional ribose and deoxyribose residues. In particular, substitution at the 2'-position of ths furanose residue is particularly important.

Aptamer oligonucleotides may contain analogous forms of ribose or deoxyribose sugars that ars generally known in the art. An exemplary, but not exhaustive list Includes 2' substituted sugars such as 2' -O-msthyl·, 2' 0-allyl, 2*-fluoro- or 2'-azido-ribose, carbocyclic sugar analoge, α-anomeric sugars, epimeric sugars such as arabinose, xyloses or lyxoses, pyranose sugars, furanose eugars, eedoheptuloses, acyclic analogs and abasic nucleoside analogs such as methyl riboside.

Although the conventional sugars and bases will bs used in applying ths method of the invention, substitution of analogous forms of eugars, purines and pyrimidines can bs advantageous in designing the final product. Additional techniques, such as methods of synthesis of 2'-modified eugars or carbocyclic sugar analoge, ars described in Sproat, B.8. et al., NUc Acid £fil (1991) 12:733-738; Cotten, M. et al., Nuc Acid Res (1991) 12:2629-2635; Hobbs, J. et al., BlPChMBistnr -27(1973) 12:5138-5145; and Perboet, M. et al.f Biochem Biophve Baa Conn (1989) 1££:742-747 (carbocyclics).

Aa uaed herein, primer refers to a sequence which is capable of serving as an initiator molecule for a DNA polymerase when bound to complementary DNA which ia usually between 3-25 nucleotides in length.

Aa uaed herein, a type II restriction enzyme site refers to a site possessed by the class of restriction enzymes which cleaves one or both DNA strands at Internucleotide linkages that are located outside of those associated with bases in the recognition sequence. This term ie also meant herein to refer to a raatriction enzyme auch as Beg I (New Bngland Biolabs, catalog no. 545L) that makes two double stranded DNA cute outside of its recognition sequence.

The methods and aptamera of tha preaent invention can also be directed to extracellular proteins. To prepare theae aptamers, a pool of oligonucleotides is brought into contact with a first known cell line which is known to express a particular extracellular protein which ia uniquely identified with that call line and sufficient time ie allowed for the oligonucleotides to bind to the extracellular protein on the cell surfaces. Tha cells are isolated with oligonucleotides bound thereto and the oligonucleotides are removed. Thia procedure ia referred to herein as positive screening. Thereafter, the removed oligonucleotides are brought into contact with a second cell line which ls identical to tha flrat cell line, except that the second cell line does not express the particular identifying extracellular protein; binding is allowed to occur and any oligonucleotides which bind to the second cell line are isolated and discarded. This procedure is referred to es negative screening*. The positive* and negative* screening steps can be repeated a multiplicity of times >26in order to obtain oligonucleotidee which are highly specific for the extracellular proteine being expressed on the first cell line. The highly specific oligonucleotidee may then be amplified and sequenced.

S λ preferred variation for selection of aptamere that bind to surface antigen· involves a procedure wherein negative selection ie firet carried out followed by a positive selection. Zn accordance with this procedure, a pool of random oligonucleotides is combined with a tissue culture medium. The oligonucleotidee are allowed to remain in contact with the cell cultures for a sufficient period of time to allow binding between oligonucleotides and cell surfaces which lack the target molecule. When this binding occurs, a negative selection process has been carried out, 1.·., oligonucleotides which are not the desired aptamere can be eliminated by their binding to nontarget surfacee. Poliowing thia negative selection, a positive selection step is carried out. Thia is done by combining the oligonucleotides which did not bind to the surfaces with no target molecules thereon with a cell culture containing the target molecule on their surface. Such a negativepositive selection protocol can be carried out in a medium containing human or bovine serum in order to select aptamers under simulated physiological conditions. It is desirable to replicate physiological conditions as closely as possible when carrying out the selection processes in that one endeavors to find oligonucleotidee (aptamers) which bind to the target molecules under physiological conditions so that euch aptamera can later be ueed ifi vivo· One of the objects of the invention is to identify aptamers useful as drug· per se or useful in drug development. Toward this end, selection criteria for targets and aptamers lnoludei -291. The aptamer should selectively hind to the desired target, thereby inhibiting a biochemical pathway or generating a specific response (e.g., modulating an israune response or disrupting binding interactions between a receptor and its ligand); 2. The aptamer selected for use in diagnostic applications should have specificity for analyte (ligand) binding in those cases where the aptamer will be immobilized to a support; 3. The biochemical pathway that ls inhibited or the biological response generated should be related to a pathological disease state in such a way that inhibition of that pathway or the biological response generated in a patient is therapeutic; 4. Desirably, the aptamer is specific so that it does not appreciably inhibit other pathways or generate additional unwanted biological responses; . Preferred aptamers have or are capable of being adapted to have the pharmacokinetic characteristics of a practical drug (i.e., they must be absorbed, must penetrate to the sits of action and must have a reasonably predictable dose response relationship and duration of action); 6. Desirably, ths aptamer has an acceptable toxicological profile in animals and ths results of human clinical trials must demonstrate aa appropriate therapeutic use.

Methods to Prepare the Invention Aptamers In general, the method for preparing the aptamers of the Invention involves incubating a desired target molecule with a mixture of oligonucleotides under conditions wherein some but not all of the members of the oligonucleotide mixture form complexes with the target molecules. The resulting complexes are then separated -JOfrom eh· uncomplexed member· of the oligonucleotide mixture and the complexed member· which constitute an aptamer (at thie stage the aptamer generally being a population of a multiplicity of oligonucleotide sequence·) ie recovered from the complex and amplified. The resulting aptamer (mixture) may then be substituted for the starting mixture in repeated iterations of this series of steps. When satisfactory specificity le obtained, the aptamer may be used as a obtained or may be sequenced and synthetic forms of the aptamer prepared.

In this most generalised form of the method, the oligonuoleotidee ueed ae members of the starting mixture may be single-etranded or double-stranded DNA or RNA, or modified forms thereof. However, single-stranded DNA is preferred. The use of DNA eliminates the need for conversion of SNA aptamers to DNA by reverse transcriptase prior to PCR amplification. Furthermore, DNA is less susceptible to nuclease degradation than RNA.

The starting mixture of oligonucleotide may be of undetermined sequence or may preferably contain a randomized portion, generally including from about 3 to about <00 nucleotides, more preferably 10 to 100 nucleotide·. The randomisation may be complete, or there may be a preponderance of certain sequences in the mixture, or a preponderance of certain residuee at particular positions. Although, ae described hereinbelow, it is not essential, the randomised sequence is preferably flanked by primer sequences which permit the application of the polymerase chain reaction directly to the recovered oligonucleotide from the complex, ihe flanking sequences may also contain other convenient features, such ae restriction sites which permit the cloning of the simplified sequence. These primer hybridisation regions generally contain 10 to 30, mors -31preferably 15 to 25, aad moat preferably 18 to 20, base* of known sequence.

The oligonucleotides of the starting mixture may be conventional oligonucleotides, most preferably single-stranded DNA, or may be modified forms of these conventional oligomers aa described hereinabove. For oligonucleotide· containing conventional phoephodiester linkages or closely related forms thereof, standard oligonucleotide synthesis techniques may bs employed.

Such techniques are well known in the art, such methods being described, for example, in Froehler, B., et al., Nucleic Acids Research (1986) 1£: 5399 -5467; Nlifilfiifi-Afiidfl Research (1988) lfi‘4831-4839; NuClfiOflidSl and NUClOPtldOB (1987) £:287-291, Froehler, B., Tet Lett (1986) 22:557515 5578. Oligonucleotides may also be synthesised using solution phase methods such as trlester synthesis, known in the art. The nature of the mixture is determined by the manner of the conduct of synthesis. Randomisation can be achieved, if deeired, by eupplying mixtures of nucleotides for ths positions at which randomisation is desired. Any proportion of nucleotides and any deaired number of such nucleotides can be supplied at any particular step. Thua, any degree of randomisation may be employed. Some politicos may be randomised by mixtures of only two or three bases rather than the conventional four. Randomized position· may alternate with those which have been specified, zt may be helpful if some port Iona of the candidate randomized eequence are in fact known.

In one embodiment of the method of the invention, the starting mixture of oligonucleotides subjected to the invention method will have a binding affinity for the target characterized by a kd of 1 μΜ or greater. Binding affinities of the original mixture for target may range frcm about 100 μΜ to 1 μΜ but, of -33course, the smaller the value of the dissociation constant, the more initial affinity there is in the starting material for the target. This may or may not bs advantageous as specificity may bs sacrificed by starting ths procedure with materials with high binding affinity.

By application of ths method of the invention as described herein, improvements in the binding affinity over one or several iterations of the above steps of at least s factor of 50, preferably of a factor of 100, and more preferably of a factor of 200 may be achieved. Aa defined herein, a ratio of binding affinity reflects the ratio of kds of the cooperative complexes. Even more preferred in the conduct of the method of the invention ie the achievement of an enhancement of an affinity of a factor of 500 or mors.

Thus, the method of the invention can be conducted to obtain the invention aptamere wherein the aptamers are characterised by consisting of einglsstrended DNA, by having a binding affinity represented by a Xp of 10*’ or lese, by having a specificity representing by a factor of at least 10 with respect to unrelated molecules, by having a binding region of less than 14 nucleotide residues or a total else of less than 15 nucleotide residues, or by binding to particular target molecules. The invention processes are also characterised by accommodating starting mixtures of oligonucleotides having a binding affinity for target characterised by a kd of 1 μΧ or more by an enhancement of binding affinity of 50 or more, and by being conducted under physiological conditions. As used herein, physiological conditions means the salt concentration and ionic strength in an aqueous solution which characterise fluids found in human metabolism commonly referred to as physiological buffer or physiological saline. In general, these are represented by sn intracellular pH of J end ai •33· M < .1 ’LL and eelt concentrations iutial olxtui include oligie nucleotide rei 2S IS thf · Nf j K *, 3mH H l-l a R, 6#/-2mA) c/*e //OmM. * _ l extracellular pB ef 7/ aad salt concentrations · ttofiS·)?a^j K*· /¥0mAf. : *j·» Μ.Ί, &.**, m. nt itodlfUd el r*f9nM, m'ane esfcodlment of the invention method, tha a of candidate oligonucleotides will era which contain-at least one modified idue or linking group.

Tf (narts in specific modifications are included in tha aspll|ication process as «all, advantage can be taken of additional properties of any modified nucleotides, isueh as ths presence of specific affinity agents in the purification of the desired naterials, In'order for the modified oligomer to yield useful results, the modification auet result ia a residue which le ’re^d· in a known way by the polymerising enzyme need in the Amplification procedure. It ie not neceeeary that the modified residue he incorporated into the oligomers in'the amplification process, as long it is possible to discern fro· the nucleotide incorporated at the corresponding position tha nature of the modification contained ini the candidate, end provided only one round ot coqplexatian/aapllf ication is'needed. However, many of the modified residues of the invention are alec susceptible |o eaiyaatic iacocposation into oligonucleotides hy the canooly used polymerase enzymes end the resulting oligomers will then directly read cm the nature o| the candidate actually contained in the initial complex. It Should bo noted that if more than one round of ieosplexatlen is needed, tha amplified sequence nue^ include the modified residue, unless the entire pool ie eequesead end resyntheslsed to include the modified residue.

Certain modification! can be meds to .the bass residues in a oligonucleotide sequence without impairing -j«the function of polymerizing enzymes to recognize the modified base in the template or to Incorporate the modified residue. These modifications include alkylation of the 5-position of uridine, deoxyuridine, cytidine and deoxycytidine; the N*-position of cytidine and deoxycytidine; the N6-position of adenine and deoxyadenine; the 7-position of deazaguanlne, deazadeoxyguanine, deazaadenine and deazadeoxyadenlne.

As long as the nature of the recognition ie known, the modified base may be Included in the oligomeric mixtures useful in the method of the invention.

The nature of the auger moiety may aleo be modified without affecting the capacity of the sequence to be usable as a specific teng>late in the synthesis of new DNA or RNA.

The efficacy of tha process of selection and amplification depends on the ability of the PCR reaction faithfully to reproduce the sequence actually complexed to the target substance. Thus, if the target substance contains modified forms of cytosine (C*), the PCR reaction must recognize this ae a modified cytosine and yield an oligomer in the cloned and sequenced product which reflect this characterization, if the modified form of cytosine (C·) le Included in the PCR reaction ae dC*TP, the resulting mixture will contain C* at positions represented by this residue in the original member of the candidate mixture. (It ie seen that the PCR reaction cannot distinguish between various locations of C* in the original candidate; all C residue locations will appear as C*.) Conversely, dCTP could be ueed ia the PCR reaction and it would be understood that one or more of the positions now occupied by C was occupied in the original candidate mixture by C*, provided only one round of coeqplexation/ampllfIcation is needed. If the -3Samplified mixture ie used in a second round, this new mixture must contain the modification.

Of course, if the selected aptamer is sequenced and resynthesized, modified oligonucleotides and linking groups may arbitrarily by used in the synthesized form of the aptamer.

Inclusion of modified oligonucleotide! in the methods and aptamers of the invention provides a cool for expansion of the repertoire of candidates to include large numbers of additional oligonucleotide sequences. 8uch expansion of ths candidate pool may bs especially important as the demonstration of binding to proteins, for example, in the prior art is limited to those proteine known to have the capability to bind DNA.

Modifications of ths oligonucleotide may bs necessary to include all desired substances among those targets for which specific binding can be achieved.

Thue, one preferred method compriees incubating the target with a mixture of oligonucleotides, wherein these oligonucleotides contain at least one modified nucleotide residue or linkage, under conditions wherein complexation occurs with some but not all members of ths mixture; separating the complexed from uncomplexed oligonucleotides, recovering and amplifying the complexed oligonucleotides and optionally determining the sequence of the recovered nucleotides. In an additional preferred embodiment, amplification is also conducted in ths prsssnes of modified nucleotides.

Paa of Starting QHgenucltQtlflt.Miatogii.gg Phprsdstarmined aagaanca In another embodiment, a method for making aptamere is provided, based on the discovery that the presence of flanking sequences (usually primer binding sequences) on ths oligonucleotides of ths candidate -36mixture may limit aptamer structural diversity and/or inhibit binding, thereby resulting in less than the full range of structural variation that is possible in a given pool of aptamers. This embodiment may use mixtures of unbiased oligonucleotide pools, and provides ths ability to then engineer appropriate means for amplifying the desired oligonucleotides (putative aptamers).

Once single stranded aptamers are generated, linkers may be added to both ends as described herein (much in the same manner as a sticky end ligation).

Preferably the linkers are partially double stranded and have some overhang to and at both ends to facilitate cloning into a standard cloning vector. One of the overhangs should be a random sequence to provide couple15 mentarity to permit binding to the aptamer. The other overhang may provide necessary bases for sticky end ligation.

In one embodiment the method comprises: (a) providing a mixture of oligonucleotides of unknown, non-predstsrmined or substantially nonpredetermined, said mixture comprising a quantity of oligonucleotides sufficiently reflective of the structural complexity of said target as to statistically ensure the presence of at least one oligonucleotide capable of binding said target; (b) Incubating said mixture of oligonucleotides with said target under conditions wherein complexation occurs between some oligonucleotides and said target, said complexed oligonucleotides defining an aptamer population; (c) recovering said aptamers in substantially single stranded form; (d) attaching a known nucleotide sequence to at least one end of said aptamers; (e) amplifying said aptamers; and -37(f) removing said known nucleotide sequence from said aptamere.

In the first step, the oligonucleotides comprising the mixture may be of completely unknown sequence. The oligonucleotides comprising the pool aleo may be of partially known sequence, but without flanking primer regions. Ths invention is not limited to first generation aptamers, but may be practiced to Identify second and third generation aptamers as well.

Oligonucleotides comprising the pool from which second and third generation aptamers may be identified, may have, for example, 40%-70% of their sequences known or predetermined.

One skilled in the art will recognise that the diversity of the oligonucleotide pool from which aptamere art identified may be reduced, either by using known sequences, or through the processes of retention and •election by which these aptamers are made. As pool size aad pool diversity is reduced, more aptamers capable of mors specific binding are recovered. Stated in another way, the quantity of oligonucleotides in the pool and the diversity and/or complexity of the pool are inversely related.

These aspects of the invention are elucidated in the following embodiment which adds additional steps to steps (a)-(f) listed above: (g) repeating etepe a-f using said first aptamere of step (f), or a portion thereof, to comprise a second pool of oligonucleotides for use in step (a), thereby generating a second aptamer population which may be used to repeat steps (a) - (f), vaA optionally (h) repeating etepe (a) - (f) using said second aptamers of step (g), or a portion thereof, a sufficient number of times so as to identify an optimal aptamer population from which at least one consensus region may -38identified in at leaet two of the aptamera from said optimal aptamer population, the presence of which may be correlated with aptamer to target binding or to aptamer structure.

This method includes methods for selectively attaching and removing flanking regions co aptamers, thereby permitting aptamer recovery in high yield. One such method compriees, after separating oligonucleotides in the method 10 above in substantially single stranded fora from the pool capable of binding target; attaching a 5* linker of known sequence to a first (tha 5') end of the oligonucleotides, the S' linker having a first type IZ restriction enzyme recognition site at ita 3' end, attaching a 3' linker of known eequence to a second (the 3') end of the oligonucleotides, tha 3' linker having a second type II restriction enzyme recognition site different from the site at tha 5' end; amplifying the oligonucleotides, thereby generating a duplex comprising a first (upper) strand, having a 5' linker complement portion, en oligonucleotide complement portion and a 3' linker complement portion, and a second (lower) strand, comprising a 5' linker portion, an oligonucleotide portion and a 3' linker portion; removing the 5' and the 3' linker portions from the oligonucleotides, and recovering the oligonucleotides in substantially single stranded form.

Another method of effecting amplification comprises, after recovering oligonucleotides from the above bound pool in substantially single stranded form; -39attaching a double etrended DNA linker of known eequence having at leaet 2-4 bases of random eequence present as a 3* overhang, said 2-4 bases capable of hybridizing to the 3' end of said oligonucleotides, the linker having a first type XI restriction enzyme recognition site; attaching a double stranded dna linker of known eequence having at leaet 2-4 baeee of random eequence present ae a 3' overhang, the 2-4 bases capable of hybridizing to the 5* end of the oligonucleotides, said linker having a second type XI restriction enzyme recognition site; amplifying said oligonucleotides, thereby generating duplexes comprising s first (upper) strand, having a 5' linker complement portion, an oligonucleotide complement portion and a 3' linker complement portion, and a second (lower) strand, comprising a 5' linker portion, an oligonucleotide portion and a 3* linker portion; removing the 3' linker portion from the oligonucleotide by attaching the product of step 4 above to a solid support, removing the 3' linker by digesting with a type IX restriction enzyme capable of recognizing said first type XX restriction enzyme binding sits, removing tha 5' linker complement and tha oligonucleotide complement by heat denaturation, annealing a 5' linker complement to the upper strand, and removing the 5' linker portion by digesting with a type XX restriction enzyme capable of recognising ths second type XX restriction enzyme sits; and recovering the oligonucleotides in substantially single stranded form.

Xn another approach, the method includes attaching a single RNA residue to the S' linker portion -4θ· and removing it after amplification by cleaving the RNA linkage.

A Subtraction Method for Aataaar Preparation 5 it ie often advantageous in enhancing the specificity of the aptamer obtained to remove members of ths starting oligonucleotide mixture which bind to a second substance from which the target molecule is to be distinguished. This method is partieularly useful in obtaining aptamers which bind to targets that reside on cell surfaces since a large number of contaminating material! will surround the desired target. In such subtraction methods, at least two rounds of selection and amplification will be conducted. In a positive/negative selection approach, the target will be Incubated with the starting mixture of oligonucleotides and, as usual, the complexes form separated from uncomplexed oligonucleotides. Ths complex oligonucleotides, which ars now an aptamer, are recovered and amplified from the complex. The recovered aptamer is then mixed with the second undesired substance from which the target is to be distinguished under conditions wherein members of ths aptsmer population which bind to said second substance can be cooplexed. This complex le then separated from the remaining oligonucleotides of the aptamer. The resulting second aptamer population is then recovered and amplified. The second aptamer population is highly specific for the target as coopered to the second substance.

In an alternative approach, the negative selection step may be conducted first, thus mixing the original oligonucleotide mixture with the undesired substance to coaplex away the members of the oligonucleotide mixture which bind to the second substance; the uncooplexed oligonucleotides are then -41recovered and amplified and incubated with the target under conditions wherein those members of the oligonucleotide mixture which bind targets are complexed. The resulting complexes then removed from the uncomplexed oligonucleotides and the bound aptamer population is recovered and amplified as usual.

When applied to the preparation of aptamers which bind specifically targets residing on cell surfaces, the positive round is conducted preferably with the target expressed at the surface of a cell, said expression typically occurring through recombinant transformation or by virtue of the native properties of the cell. The negative round of selection is conducted with similar cells which have similar surface materials associated with them, but which do not express the desired target.

Zn more detail, the oligonucleotide mixture is brought into contact with a first known cell line which is known to express a particular extracellular protein which le uniquely identified with that cell line. After allowing sufficient time for the oligonucleotides to bind to ths extracellular protein on the cell surfaces, procedures are carried out to isolate the cells with oligonucleotides bound thereto and the oligonucleotides are removed. This procedure is referred to nerem as positive screening.

After treatments with the candidate oligonucleotide mixtures, the cells containing the targeted surface protein may be extensively washed in buffered saline or in tissue culture medium to remove low affinity aptamers and uncomplexed ollgonucleotidee. Following washing, the cells era treated with one or more of a number of agents that permit recovery of bound aptamere. The cells may bs treated enzymatically with trypsin or other proteases to cleave the targets at the -*2· cell surface, thus releasing the bound aptamers. Alternatively, the cells containing bound aptamers may be washed in a detergent or high ionic strength solution in order to disrupt binding between the cells and aptamers.

The aptamers recovered at this point consist of a pool of different sequences that bind to different cell surface targets, including the target of interest.

Aptamers from the first tissue culture cells may be recovered from solution by precipitation or may be used directly if reagents used to remove aptamers do not significantly affect cells ln the second tissue culture.

The aptamer mixture is then Incubated with the second (null) cell culture under similar conditions. The mixture brought into contact with a second cell line which is identical to the first cell line, except that the second cell line does not express the particular identifying extracellular protein. Binding is allowed to occur and any oligonucleotides which bind to the second cell line are isolated and discarded. This procedure is referred to as negative screening. The positive* and negative screening steps can be repeated a multiplicity of times in order to obtain oligonucleotides which are highly specific for the extracellular proteins being expressed on the first cell line. When the highly specific oligonucleotides have been determined and isolated, they are subjected to BCR technology for amplification as above. The reeulting aptamers can bs labeled and thereafter effectively used to identify the presence of the first cell line expressing the particular extracellular protein.

This method identifies target features on cell surfaces such as extracellular proteins, especially hetero- or homodlmers or multimers. Selecting highaffinity ligands specific for such transmembrane proteins outside the natural cellular context has heretofore been -43exceedingly difficult, if not impossible. Many transmembrane proteins cannot be isolated from cells without loss of tbeir native structure and function.

This is due, in part, to a requirement for detergents to disrupt cellular membranes that anchor transmembrane proteine (Heleniue, A., et al., Blochlm. Biophys. Acta (1975) £14:27-79). Detergents that solubilise membranes aleo tend to denature proteine, leading to loss of function and alteration of native structure.

A preferred variation of this method involves a procedure wherein negative selection is first carried out followed by a positive selection. In accordance with this procedure, a pool of random oligonucleotidee ie combined with a tissue culture medium. The oligonucleotides are allowed to remain in contact with the cell cultures for a sufficient period of time to allow binding between oligonucleotides and cell surfaces which lack the target molecule. When this binding occurs, a negative selection process has been carried out, i.e., oligonucleotides which are not the desired aptamers can be eliminated by their binding to nontarget surfaces. Following this negative selection, a positive selection step le carried out. Thie ie done by combining the oligonucleotidee which did not bind to the surfaces with no target molecules thereon with a cell culture containing the target molecule on their surface. Such a negative-positive selection protocol can be carried out in a medium containing human or bovine serum in order to select aptamers under simulated physiological conditions. it is desirable to replicate physiological conditions as closely ae possible when carrying out the selection processes in that one endeavors to find oligonucleotides (aptamers) which bind to the target molecules under physiological conditions so that such aptamers can later be used in vivo. -44Apjtamers which are selected la the presence of serum may he. rendered nuclease-stable hy the uee of PCI primer· with modified latarnueleQtlde linkages that are nuclease-stable ae deecribed la cosaaonly assigned ncpendlng application Publication Jto. WO9O/1506S (incorporated herein hy reference).

An! alternative variation of the uaa of serum for aptamer selection la alao possible. In accordance with this alternative protocol, candidate aptamere are added to a tissue culture medium lacking serum. The serum-free medium is incubated with cells which lack the target molecules cm their surfsees. Following the incubation, | cell culture which contains the target molecules on-their aurfacee is combined with any oligonucleotides which did not bind to the first cell culture which did not have the target molecule tharaon. This step in j tha protocol provides for positive seise tlon. liter continuing the incubation foe the positive selection for 30-40 art nut-ms, serum le added in order to provide a final concentration in the range of about 84 to ^04 of tea», At this point, any oligonucleotidas which are not tightly complexed with the ease** meiewele h*fi» u* •aegee —,---------------— — present in tile added sen·. However, the oligonucleotides which ere tightly bound to the target aoleculee an;the calls are nuclease resistant ae they are inaccessible ’to the nucleases due to their physical association With ths target molecules. After exposure to tha nuoleaee^ for 10-30 minutes, the medium (i.e,, the eerum ooctaiijiag tha nucleases) le removed end tha cells are washed and caused to release the oligonucleotides or aptamere bound thereto by treatment of the celle with proteases andf/or detergents, any oligomers which are substantially degraded by the ancleeeee will not be amplified during amplification processing. -45In more detail, the present inventors have found that the nuclease activity present within the serum is primarily a 3' exonuclease activity. The presence of 3' exonucleaae activity during target binding may ba used with a candidate aptamer pool that has a short primer at the 3* end as a nuclease target. Accordingly, if tha 3' end, which Includes the primer, is degraded by the nuclease, the oligonucleotides attached to the degraded primers will not be amplified during nullification proeeaaing and will thereby be eliminated. A similar short primer eequence (6-10 bases) at the 5' end could also bs utilised in the same manner if 5* exonucleaaes are added to the medium during the selection protocol.

At various stages of the screening procese, advantage may be taken of PCR techniques for amplification of selected aptamer pools, while the material recovered after a single cycle of positive and negative selection may in tome instances be suitable after amplification for sequencing directly, it ia often advantageous to repeat the cycle until a lower dissociation constant (kp) ls obtained for binding of the single-stranded oligonucleotide speclea to the transfectant cells (the first tissue culture cells) relative to the parental cells (the second tissue culture cells). Usually, multiple rounds of selection and aptamer amplification will be necessary in order to provide multiple opportunities to enrich for aptamers that specifically bind to the target structure. Zn addition, it is clearly within the scope of the present Invention to amplify the selected pools of aptamer after each screening (positive or negative).

If an agonist or other substance already known to bind the desired target is available, competitive binding analyses can be performed using the selected oligonucleotide species and radiolabeled substance. -46Depending upon the results of such competitive analyses, it can be determined whether it would be desirable to proceed with additional positlve/negative screening cycles.

One could also determine whether the selected oligonucleotide species can inhibit the target protein la a functional assay. For example, oligonucleotides selected for binding to CD4, the human lymphocyte transmembrane protein, may be tested for their ability to inhibit HZV-i infection of human lymphocytes in culture.

Modified Method Wherein Target/Aptamer Complexes are Separated from Solid Support As set forth hereinabove, the original oligonucleotide mixture can be synthesized according to the desired contents of the mixture and can be separated by adding the oligonucleotide mixture to a column containing covalently attached target molecules (see, Illington, A.D., et al., Nature (1990) 111:818-822) or to the target agents in eolution (see Blackwell et al., Science (1990) 211:1104-1110; Blackwell at al., SclMCD (1990) 251 til49-ll5l; or to ths target agent bound to a filter (see Tuerk, C., and Gold, L., Science (1990) 211:505-510). Complexes between the aptamer and targeted agent are separated from uncomplexed aptamers using any suitable technique, depending on the method used for complexation. For example, if columns art used, nonbinding species ere simply washed from the column ueing an appropriate buffer. Specifically bound material can then be eluted.

If binding occurs in solution, the complexes can be separated from the uncomplexed oligonucleotides using, for example, ths mobility shift in electrophoresis technique (BMSA), described la Davie, R.L., et al., Cell (1990) 52:733. in this method, aptamer-target molecule -47complexes are run on a gel and aptamere removed from the region of the gel where the target molecule rune.

Unbound oligomers migrate outside these regions end ere separated away. Finally, if complexes are formed on filters, unbound aptamers are eluted using standard techniques and the desired aptamer recovered from the filters.

In a preferred method, separation of the complexes involves detachment of target-aptamer complexes frcm column matrices as follows. λ column or other support matrix having covalently or noncovalently coupled target molecules is synthesized. Any standard coupling reagent or procedure may be utilised, depending on the nature of the support and the target molecule. For example, covalent binding may include the formation of disulfide, ether, ester or amide linkages. Ths length of the linkers used may be varied by conventional means. Noncovalent linkages include antibody-antigen interactions, protein-sugar interactions, as between, for example, a lectin column and a naturally-occurring oligosaccharide unit on a peptide.

Lectine are proteins or glycoproteins that can bind to complex carbohydrates or oligosaccharide units on glycoproteins, and art well-described in The Lectins (I.B. Zilener et al., eds., Academic Frees 1986). Lectins are isolated from a wide variety of natural sources, including peas, beans, lentils, pokeweed and snails. Concanavalin A is a particularly useful lectin.

Other linking chemistries are also availsble.

For example, disulfide-derivatised biotin (Fierce) may be linked to a target molecule by coupling through an amine or other functional group. The resulting target-S-Sbiotin complex could then be used in combination with avidin-derivatlzed support. Oligonucleotide-target -4βcomplexes could then be recovered by disulfide bond cleavage. Alternatively, target aay be coupled via a cis-diol linker, and oligonucleotide-target complexee may be recovered by mild oxidation of the vicinal diol bond ueing MalO* or other appropriate reagents. Linking chemistries will be aelected on the basis of (1) condition· or reagents necessary for maintaining the structure or activity of the target molecule, and/or (li) chemical groups or moieties on the target molecule available for linking to the support.

The oligomer mixture is added to and Incubated with the support to permit oligonucleotide-target complexation. Complexes between the oligonucleotides and target molecule are separated from uncomplexed oligonucleotides by removing unbound oligomers from the support environment. For example, if columns are used, nonbinding apecisa are simply waehed from the column ueing an appropriate buffer.

Following removal of unbound oligomers, the target molecules are uncoupled from the support. The uncoupling procedure depends on the nature of the coupling, as described above. Targets bound through disulfide linkages, for example, may be removed by adding a sulfhydryl reagent such aa dithiothreitol or β25 mercaptoethanol, Targets bound to lectin supports may be removed by adding a complementary monosaccharide (e.g., α-methyl-mannoside or other saccharides for concanavalln A). Oligonucleotides specifically bound to the target can then be recovered by standard denaturation techniques euch ae phenol extraction.

The method of elution of target-oligonucleotide complex from a support has superior unexpected properties when compared with standard oligonucleotide elution techniques. This invention ie not dependent on the mechanism by which these superior properties occur. •49HnwnvAr, without wishing to be United by any one mechanism, the following explanation is offered as to how mors efficient elution is obtained. Certain support effects result from the binding of oligonucleotides to ths support, or the support in conjunction with oligonucleotide or target. Removing oligonucleotidetarget complexes enables the recovery of oligonucleotides specific to target only, while eliminating oligonucleotides binding to the support, or the support in conjunction with oligonucleotide or target. At each cycle of selection, this method may give up to 1,000fold enrichment for specifically binding species. Sslsction with targets remaining bound to support gives less enrichment per cycle, making it necessary to go through many more cyclea In order to get a good aptamer population.

Aptamer Pools of Varying Length Aptamers can also be selected in the above methods using a pool of oligonucleotides that vary in length as the starting material. Thus, several pools of oligonucleotides having random sequences are synthesised that vary in length from e.g. 50 to 60 bases for each pool and containing the earns flanking primer-binding sequences. Bqual molar amounts of each pool are mixed and the variable-length pool is then used to select for aptamers that bind to the desired target substance, ae described above. This protocol selects for the optimal species for target binding from the starting pool and does not limit aptamere to those of a given length.

Alternatively, several pools of mixed length aptamers can be used in parallel in separate selections and then combined and further selected to obtain the optimal binders from the else range Initially used. For example, three pools, A, B and C, can be used. Fool A -socan consist of oligonucleotide* having randan eequence· that vary in length from e.g. 30 to 40 bases, pool B can have sequences varying in length from s.g. 40 to 50 bases, and pool C can have sequences varying in length from 50 to 60 bases. Zt is to be understood that the lengths deecribed above are for illustrative purposes only. After selection to obtain binders from A, B, and C, all aptamers are mixed together. A number of round· of selection are done as deecribed above to obtain the best binders from the Initial species selected in the 30to 60-base range. Note that with this technique, not all poaaible species in some of the pools are used for selection, if the number of sites available for binding are increased, i.e., if a column ia used and the else of the column increased, more species can be Included for selection. Furthermore, this method allows for the selection of oligomers from the initial starting pool that ara of optimal length for binding the targeted agent.

The oligonucleotide· that bind to the target are separated from the rest of the mixture and recovered and amplified. Amplification may be conducted before or after separation from the target molecule. The oligonucleotides are conveniently amplified by PCR to give a pool of DNA sequences. The PCB method is well known in the art and described in, e.g., U.S. Patent Nos. 4,683,195 and 4,683,202 and Saiki, R.X., et al., Science (1988) 222:487-491, and European patent applications 86302298.4, 86302299.2 and 87300203.4, as well as Methods in Rngymoloov (1987) l££:335-350. If RNA is initially used, the amplified DNA sequences are transcribed into RNA. The recovered DMA or RNA, in the original single-stranded or duplex form, ie then used in another round of selection and amplification. After three to six rounds of selection/amplification, oligomers -SIthat bind with an affinity in tha mM to μΜ range can be obtained for moat target· and aff ini ties below the μΜ range are possible for some targets. PCR may also be performed in the presence of target.

Other methods of amplification may bs employed including standard cloning, ligase chain reaction, etc. (See e.g., Chu, et al., U.8. Patent No. 4,957,858). Por example, to practice this invention using cloning, ones the aptamer has been identified, linkers may be attached to each aide to facilitate cloning into standard vectors. Aptamers, either in single or double stranded form, may be cloned and recovered thereby providing an alternative amplification method.

Amplified eequences can bs applied to IS sequencing gels after any round to determine the nature of the aptamere being selected by target molecules. The entire process then may be repeated using ths recovered and amplified duplex if sufficient resolution is not obtained.

Amplified sequences can be cloned and individual oligonucleotides then sequenced. The entire process can then be repeated using the recovered and amplified oligomers as needed. Once an aptamer that binds specifically to a target has been selected, it may be recovered as DNA or RNA in single-stranded or duplex form using conventional techniques.

Similarly, a selected aptamer may be sequenced and resynthesised using one or more modified bases, sugars and linkages using conventional techniques. The specifically binding oligonucleotides need to contain the sequence-conferring specificity, but may be extended with flanking regions and otherwise derivatized. •53« DfiXlsatluUflB Αρμηοτβ containing the specific binding sequences dijioerned through the method of tne invention con also be derivatised in various ways. For exaaple, if the aptamer |s to be used for separation of the target eubatanae, conventionally tbs oligonucleotide will be derivatised fo a solid support to permit chromatographic operation, jlf the oligonucleotide ie to be used to label cellular cceponente or otherwise for attaching a detectable moiety to target, ths oligonucleotide will be derivatised io include a radionuclide, a fluorescent molecule, a Chromophore or the like. If the oligonucleotide ie to of ueea in epecmcnisaug assays, coupling to solid support or detectable label, and the like ere also desirable. If it le to be used in therapy, the oligonucleotide may be derivatised to include ligands which permit!easier transit of cellular barriers, toodo moieties whlih aid in the therapeutic effect, or ensymatlo acilvltiee which perform desired functions at ao the targeted jsite. The aptamer may also be included ln a suitable expression system to provide for in aitu generation of the desired eequence· • » uonaaaaua sequences WhAa a number of individual, distinct aptamer eequencee fof a single target nolecule have been obtained and sequence^, as daeeribed above,, the sequences aey be examined for jconsensus sequencesAs used herein, finrauwmue eAqnenne refers to e nucleotide eequence or >0 region (whidl may or eey ant be made up of oantlguoun nucleotides) < which is found im cos or aore regions of at least two aptamers, the pceeenoe of which may be correlated w^th eptamer-to-target-blnding or with aptamer structure. >8 -S3λ consensus sequence nay be ae abort ae three nucleotides long. It also nay be made up o£ one or more noncontiguous sequences with nucleotide sequences or polymers of hundreds of bases long interspersed between the consensus sequences. Consensus sequences may be identified by sequence comparisons between individual aptamer species, which conparisons may be aided by computer programs and other tools for modeling secondary and tertiary structure from sequence information.

Generally, the consensus sequence will contain at least about 3 to 20 nucleotides, more coomtonly from 6 to 10 nucleotides.

When a consensus sequence is identified, oligonucleotides that contain that sequence may be made by conventional eynthetic or recombinant means. These aptamers, termed secondary aptamers, may also function as target-specific aptamers of this invention. A secondary aptamer may conserve the entire nucleotide sequence of an isolated aptamer, or may contain one or mors additions, deletions or substitutions in the nucleotide sequence, as long as a consensus sequence is conserved. A mixture of secondary aptamere may also function ae target -specific aptamers, wherein the mixture is a set of aptamers with a portion or portions of their nucleotide sequence being random or varying, and a conserved region which contains the consensus sequence. Additionally, ssoondary aptamere may bo eynthesieed using one or more of the modified bases, sugars and linkages described herein using conventional techniques and those described herein.

InnuM Rccruitmsat The present Invention also provides a method whereby immune response is elicited in a desired manner through the use of agents which are directed to specific -54targets on cells Involved in a pathological condition of interest. In a particular embodiment of the invention, the known ability of various materials to elicit strong immune responses is exploited so as, in turn, to stimulate the immune response to target pathologic cells, which may themselves otherwise have the ability to reduce or escape effective CTL responses.

Pursuant to this method of the invention, in a first step a targeting agent is identified that specifically binds to a surface feature of the pathologic cells of interest. Once such a selective targeting agent has been identified, in a second step a conjugate is formed with a moiety known to act itself as an immunogen, for example as an antigen for eliciting a strong CTL response in the organism. By virtue of the selective binding of the targeting agent component of the conjugate to cells containing the target, these cells are in effect modified so as to exhibit the Immunologic character of the associated immunogenic component of the conjugate.

Thus, when the associated moiety is an antigen which elicits a strong CTL response, the cells are effectively marked for destruction by the antigen component of the conjugate.

Zn accordance with one preferred embodiment of the Invention, the targeting agent ie an oligonucleotide which binds to a specific target on a cell surface, and the immunomodulatory component of the conjugate le a polypeptide which elicits a strong CTL response. -55Utillty of tha Aptamer· The aptamers of ths invention are useful in diagnostic, research and therapeutic contexts. For diagnostic applications, aptamers are particularly well suited for binding to biomolecules that are identical or similar between different species. Classes of molecules such as kinine and eicosanoide generally do not serve ae good antigens because they are not easily recognised ae foreign by the immune systems of animals that can be used to generate antlbodiee. Antibodies ara generally used to bind analytes that are detected or quantitated in various diagnoatic assays. Aptamers represent a class of molecules that may be uaed in place of antibodies for diagnostic and purification purposes.

The aptamers of the invention are therefore particularly useful as diagnostic reagents to detect the presence or absence of the target substances to which they specifically bind. Such diagnostic taste ara conducted by contacting a «ample with the specifically binding oligonucleotide to obtain a complex which ia then detected by conventional means. For example, the aptamers may be labeled using radioactive, fluorescent, or chromogenic labels and the prasanca of label bound to solid support to which the target substance haa bean bound through a specific or nonspecific binding means detected. Alternatively, the specifically binding aptamers may ba uaad to effect Initial complexation to the support. Means for conducting assays using such oligomers as specific binding partners are generally known to track those for standard specific binding partner based assays.

This invention also permits the recovery and deduction of oligomeric sequences which bind specifically to extracellular proteins and specific portions thereof.

Therefor·, these oligonucleotide! can be used aa a -56•paration tool for retrieving the substances to which they specifically bind. By coupling the oligonucleotides containing ths specifically binding sequences to a solid support, for example, proteins or other cellular components to which they bind can be recovered in useful quantities. In addition, these oligonucleotides can be used in diagnosis by employing them in epecific binding aeeaye for the target substances. When suitably labeled using detectable moieties such as radioisotopes, ths specifically binding oligonuclaotidas can also be used for in vivo imaging or histological analysis.

It may be coomented that tha mechanism by which the specifically binding oligomers of the invention interfere with or inhibit the activity of a target eubstance is not always established, and is not a part of the invention. The oligomers of the Invention are characterized by their ability to target epecific eubetancae regardless of the mechanisms of targeting or tha mechanism of tha affect thereof. so For use in research, the specifically binding oligonucleotides of ths invention are especially helpful in effecting the isolation and purification of substances to which they bind. For ehie application, typically, the oligonucleotide containing the epecific binding sequences is conjugated to a eelid support and used ee an affinity ligand in chromatographic separation of the target •ubetance. Tha affinity ligand can also be used to recover previously unknown substances from sources which do not contain the target substance by virtue of binding similarity between the intended target and the unknown substances. Furthermore, as data accumulate with respect to the nature of the nonol igonucleotide/oligonucleotideepecific binding, insight may be gained as to the mechanisms for control of gene expression. .57la therapeutic applications, the aptamers of the invention can be formulated for a variety of modes of administration, including systemic end topical or localized administration. Techniques and formulations generally may be found in Remington's Pharmaceutical Sciences. Mack Publishing Co., Easton, pa, latest edition.

For systemic administration, injection ls preferred, including intramuscular, intravenous, intrapsritonsal, and subcutaneous. For injection, ths aptamers of ths invention are formulated in liquid solutions, preferably in physiologically compatible buffers such as Hank's solution or Ringer's solution. Xn addition, the aptamere may be formulated in solid form and redissolved or suspended immediately prior to use. Lyophilized forms ars also included.

Systemic administration can also bs by transmucosal or transdermal means, or ths oligomers can be administered orally. For transmucosal or transdermal administration, penetrants appropriate to ths barrier to be permeated are used in the formulation. 8ueh penetrants ars generally known in the art, and include, for example, for transmucosal administration bile salts and fusidic acid derivatives. Xn addition, detergents may ba used to facilitate permeation. Transmucosal administration may be through nasal sprays, for example, or using suppositories. Por oral administration, the oligomers are formulated into conventional oral administration forms such as capsules, tablets, and tonics.

For topical administration, the oligomers of the invention ars formulated into ointments, salves, gels, or creams, as is generally known in the art.

The oligonucleotides may also bs employed in expression systems, which are administered according to -96tachniques applicable, for instance, in applying gene therapy.

Immune Response Modulation S The present invention is also directed to a method whereby immune response is elicited in a desired manner through the use of agents which are directed to specific targets on cells involved in a pathological condition of interest.

Targeting Agents For use as targeting agents, any of a number of different materials which bind to cell surface antigens may bs employed. When available, antibodies to target cell surface antigens will generally exhibit the necessary specificity for the target. Similarly, ligands for any receptors on the surface of the pathologic cells of interest may suitably bs employed as targeting agent. Yet another class of potentially valuable targeting agents is oligonucleotides of the requisite binding selectivity.

Typically, for reaction with antigenie determinants on proteins, antibodlee raised against these proteins, either polyclonal or monoclonal, may be used.

Polyclonal anti-sera are prepared in conventional ways, for example by injecting a suitable mammal with antigen to which antibody is desired, assaying the antibody level in serum against the antigen, and preparing anti-sera when the titers are high. Monoclonal antibody preparations may also be prepared conventionally, such as by the method of Xoshlsr and Milstein using, e.g., peripheral blood lymphocytes or spleen cells from immunised animals and imnort all sing these cells either by viral infection, by fusion with myeloma·, or by other -5»conventional procedure· and screening for the production of the desired antibodies by isolated colonies.

In addition to antibodies, suitable immunoreactive fragments may also be employed, such ae the Fab, Fab', or P(ab*)2 fragments. Many antibodies suitable for use in forming the targeting mechanism are already available in the art. For example, ths uae of immunologically reactive fragments ae substitutes for whole antibodies is described by Spisgelberg, H.L., in immunoassays in the clinical Laboratory (1970) 3:1-23.

One known surface antigen to which antibodies can ba raised, for exasple, ls the extracellular domain of the HBR2/nu associated with breast tumors. As set forth by Fondly, B.M. et al. J Biol Reap Mod (1990) 2.:449-455, antibodies to KBR/nu can bs raised in alternate hosts (since the antigen is not foreign to the host-bearing tumor) and can be used in immunoconjugate· to bind specifically to the tumor. As applied in the method of the invention, the antibody or fragment thereof would be coupled not to a toxin, but to an immunomodulatory agent which would mount a CTL reeponse. in addition to iranunoreactlvlty, targeting can be effected by utilising receptor Uganda which target receptors at ths target cell surface, for example on the basis of ccnplementarity of contours or charge patterns between ths receptor and ligand. As used herein, the term receptor ligand* refers to any substance, natural or synthetic, which binds specifically to a cell surface receptor, protein or glycoprotein found at the surface of the desired target cell population. These receptor ligands include lymphokine factors, for example, ZL2 or viral or tumor antigens.

Oligonucleotides identified as binding to one or more surface antigen of the pathologic cells may also be used to form conjugates in a known manner, and are -60particularly preferred for use as targeting agents in accordance with the present invention.

Immunomodulatory Agents S An immunological response* as discussed herein generally refers to the dmmlopmenr, In a mammal of either a cell- or antibody-mediated immune response to an agent of interest. Typically, such a responee consists of the mammal producing antibodies and/or cytotoxic T-cells directed specifically to a particular agent. In the context of the present invention, however, an immunological responee different from that elicited by the pathologic cell itself in the absence of the conjugate* may constitute, e.g., the failure to produce antibodies or cytotoxic T-cells under circumstances (for example, in the presence of a particular antigen) which would normally result in the induction of a specific response. examples of moieties known to act as antigens for eliciting a strong CTL response Include a wide range of biologically active materials. Particularly suitable for use in this regard are short peptide sequences, such as those which may correspond to the antigenic determinants of known immunogenic proteins. For example, sequences derived from viral or bacterial pathogens may be useful in stimulating a strong CTL response in ths infected hoet organism.

Other immunomodulatory agents useful in the invention Include fragments of the HLA Class Z glycoproteins. The ability of such HLA Class Z glycoproteins or fragments thereof to stimulate a CTL response has been documented by Symington, F.w. et al., 2 Invest Dermatol (1990) 15»224-228. Also known to elicit CTL responses are short regions of viral antigens such as those of the influenza virus nucleoprotein (Rothbard, -«ιJ.B, et al., BMBQ J (1989) £,3331-2328) and sections of the murine minor histocompatibility antigens such as H25.3 cell surface antigen (Lal, P.K., Transplantation (1985) 22:638-643). Other known agents which expand CTL ae opposed to helper T-cells include interleukin-6 and cyclosporin A.

Technique· for Coupling Targeting Agents and Immunomodulatory Agents Coupling of the targeting agente with the immunomodulatory agents may be carried out ueing any of a variety of different techniques which are well known per se to those working in the field. The particular choice of coupling method depends on the chemical nature of the specific targeting and immunomodulatory agente.

Selection of the most appropriate method of coupling from among the variety of available alternative· for any given types of targeting and immunomodulatory aganta may in •ome instances require routine screening to determine esqpirically which conjugates provide the optimum combination of targeting specificity and daalred imnunomodulatory effect.

When at laaat one of the agente which constitute the conjugate is a polypeptide, well-known chemical methods for formation of chemical bonds with, e.g., functional groups on amino acid side-chains or preferably N- terminal amino or C-terminal carboxyl groups, may be employed. One common approach is the use of linkers which may be homobifunctional or heterobifunctional, and typically involve highly reactive functional groupa on the linker. Another approach is the use of dehydrating agente, such as carbodiimidaa, to effect the formation of new bonds by reaction of a carboxyl moiety on one member of the conjugate with a free amino group on the other. Particularly suitable -62methods involving the use of conjugation reagents (i.e., reagents which result in elimination of water to form a new covalent bond) are discussed in, e.g., U.S. Patent 4,843,147 to Levy et al., which is hereby Incorporated by reference. Additional techniques for formation of conjugates between polypeptides end various types of biologically active molecules have been described in the art with reepect to the formation of cytotoxic conjugates; for example, a variety of different conjugate-forming reactions are described in U.S. Patent 4,507,234 to Kato et al., which ie also hereby incorporated by reference.

Similarly, methods are known for attaching a variety of different species to oligonucleotides. For example, Asseline, 9. et al. (£cos Natl &SAd fifii ££, 3297-3301 (1984)} describes the covalent linking of an intercalating agent via a polymethylene linker through a 3'-phosphate group. Mori, X. et al. (FIBS Letters 249t2ia-2i8 (1989)) describes ths covalent attachment of groups via a methylene linker at the 5* -terminus of oligonucleotides. PCT application W089/05853 published June 29, 1989, ths entire disclosure of which is hereby incorporated by reference, describes a variety of methods for formation of conjugates between nucleotide sequences and chelating agents; the chelating agent ia joined to the nucleotides sequence by either s covalent bond or a linking unit derived from a polyvalent functional group. Other methods will of course bs readily apparent to those working ia the field. identification of Suitable Targets for tha Conjugate! Suitable targets for binding a targeting agent include cell surface antigens which are specific to the pathologic cella which it is desired to treat. For example, most tumor antigens (such as the -63carcinoembryonic antigen associated with several types of cancer) do not generally elicit an effective CTL response, The presence of the antigens on ths surface of tumor cells enables ths uss of appropriately tailored targeting agents to deliver conjugate specifically to those cello.

Zn addition to eliciting CTL type responses, other types of immunomodulatory effects may be achieved through the use of the inventive conjugates. For example, the conjugates of the invention may be useful in preventing the progression or the cure of autoimmune disease.

Diseases with an autoinnuns component, such as diabetes or arthritis, appear to involve reeponse to specific self antigens. By using conjugates of ths invention to elicit an immune response against those immune cells which mediate the attack on self tissues, a positive effect on the course of the disease may be achieved. Zn principle, a group of antigenically related immune cells that mediate the systemically inappropriate response could bs targeted using a single conjugate specific for that antigen. Destruction of this marked population by the immune system should lead to an amelioration of the disease condition.

Alternatively, the binding of appropriate conjugates to target antigens on cells could be employed as a means to mask recognition of those antigens or of the cell bearing the antigens. Thie could prevent the destruction of the cell carrying ths antigens, and thus result in stasis of autoluiune disease progression.

Further, an immune response stimulated by the Immunomodulatory portion of the conjugate may result in other desirable immunologic responses in ths organism.

Zn particular, by virtue of the cell death process Initiated in reeponee to the conjugate, a highly -«4desirable response to other unmarked cells of the seme type may result. Thus, by identifying a particular class of cells for recognition by various components of the immune system via the immunomodulatory portion of the conjugate, it may be possible to induce a particular category of response (e.g., CTL-mediated destruction) to that category of cells as a whole, regardless of whether or not the cells are marked by conjugate.

Target molecules that are not conventionally 10 considered to be biomolecules are also appropriate for the methods described herein. Bxamples of nonbiomolecule targets include intermediate· or endproducts generated by chemical synthesis of ccopounds used in therapeutic, manufacturing or cosmetic applications. Aptamer oligonucleotides may be used to specifically bind to meet organic compound· and ere suitably used for isolation or detection of such compounds.

The following examples are meant to illustrate, but not to limit the invention. gywpl·· l Selection of Aotemere that Bind to Bradvkinln A. Preparation of Bradykinln Column Bradykinln derivatised Toyopearl* (Toso Baas, Ine., Woburn, MA) support was used for all selections described. Bradykinln was coupled to the Toyopearl support through its amino termini according to the manufacturer's instructions. Bradykinln (NHj-arg-propro-gly-phe-sar-pro-phe-arg-COOH, acetate salt) was obtained from Bechem Feinchemikallen AS (Cat. No. H1970). Toyopearl AF-carboxyl 650 M wae converted to the NHS-eater by treatment with W-hydroxy succinimide (WHS) and diieopropyl earbodiimide in dioxane/DMF (1:1) for 24 -65houre. The support was washed with DMF, H^O, 200 mM NaHCOj and treated with a solution of bradykinin {20 mg of bradykinin/ml support) in 200 mM NaHCO^ for 3 days.

The support was then washed and the coupling yield was determined by HCl digestion of ths support (80C for 0 hours) and a ninhydrin assay using free brsdykinin as a etandard. The yield was found to bo 16 mg/ml eupport (16 pmole/ml eupport). The coupled eupport was then capped by treatment with acetic acid (NHS-seter) in dioxane/200 mM NaHCOj buffer (1:1).

An underlvatised capped support to bs used ae a control waa made by treating Toyopearl AF·carboxyl 650M with acetic acid (NHS-ester) in dioxane/200 mM NaHCO3 buffer (1:1), followed by washing.

B. Synthesis of Olloonucleotlds Pool DNA oligonucleotides containing a randomized eequence region were synthesised using standard solid phase techniques and phosphoramldits chemistry (Oligonucleotide Synthesis. Gait, M.J., ed. (IRL Press), 1984; Cocuzza, A., Tetrahedron Letters. (1989) 1ft:62876291.) A 1 fM small-scale synthesis yielded 60 nmole of HFLC-purified single-stranded randomized dna. Each strand consisted of specific 18-mer sequences st both ths * and 3' ends of tha strand and a random 60-mer sequence in the center of the oligomer to generate a pool of 96mers with the following sequence (N - G, A, T or C): ' HO-OGTAOGGTCGAOGCTAGCN60CAOGTGGAGCTCGGATCC-OH 3' DNA 18-mere with the following sequences were used as primers for PCR amplification of oligonucleotide sequences recovered from bradykinin columns. The 5' primer sequence was 5’ HO-CGTACGQTCGAOGCTAGC-OH 3' and the 3* primer eequence was 5' biotin-0IE 920562 -μGk3ATCCGAGCTCCACGT3-OH 3*. The biotin residue vas linked to the 5' and of the if prlaor ueing aemieveially available biotin phosphoramidite (New England Nuclear, Cat. No. NBF-707). The biotin phosphoramidite is incorporated into the strand during solid phase DNA synthesis ueing standard synthesis conditions.

C. Selection for Aptamers That Bind to an Immobilised Bradyklnla Cglmm 400 μΐ bradykinin-derivatized Toyopearl support was loaded on a 1.5 ml column housing. The column was washed with 3 ml of 20mM Tris-acetate buffer (pH 7.4) containing imM MgCl?, l mM CaClj, 5mM KCl and l40mM NaCl (the selection buffer). An identical column was prepared using the underivatized Toyopearl control support described in example 1-A.

An Initial oligonucleotide pool (0.5 nmole, 3 x 1014 unique sequences) of synthetic 96-mers prepared in example 2 was amplified approximately 30-fold by large20 scale FCR using known techniques. Assuming 10-20¾ readthrough of synthetic DNA and possible preferential amplification by the Taq polymerase, the estimated actual complexity was reduced to about 1 x 1013 unique sequences.

This amplified oligonucleotide pool (0.1 nmoles, about 6 copies of 1 x 1013 unique sequences), doped with 5'-32F-labeled species, was used ln the first selection round. The pool was heated to 94C for 3 minutes in selection buffer, allowed to cool to room temperature, applied to the control column in a volume of 100 μΐ, and allowed to equilibrate for approximately 10 minutes. Ths column was then eluted with selection buffer and the eluent collected in 200 μΐ fractions. The bulk of the counts (approximately 95¾) with little affinity for the matrix eluted in the first 2 or 3 -tifractions after the void volume. These fractions were combined, applied to the bradykinin-linked support (400 μΐ support, approximately 5 /jmole, washed with 3 ml of selection buffer), and eluted with selection buffer. The column was then eluted with selection buffer and the eluent collected in 300 μΐ fractions. Fractions were collected until the eluted counts in a fraction plateaued at less then ebout .05% total loaded counts. The column was then eluted with elution buffer (500 mM Tris*HCl (pH 8.3), 20 mM BDTA) et room temperature. Aptamere were eluted in the first 3 or 3 fractions after the void volume. These fractions were combined and precipitated using ethanol and glycogen as the carrier. The aptamer pellet was resuspended in 200 μΐ of ddX2O (deionized distilled water) and divided into two 0.5 ml siliconized Bppendorf tubes for PCR. All remaining counts on the column were removed by treatment with 0.1N NaOH (0.5 ml), although these species were not used in subsequent amplification and selections.

D. Amplification of Selected Antamers Two groups of selected aptamers were amplified by PCR using standard techniques and the following protocol.

A 200 μΐ PCR reaction consisted of the following: 100 μΐ template aptamer (approximately 2 pmole·) j 30 μΐ buffer (100 mM Trls*Cl (pH 8.3), 500 mM KCl, 20 mM MgClj); 32 μΐ NTP'S (5 mM cone total, 1.25 mM each ATP, CTP, GTP, and TTP) s 20 μΐ primer 1 (biotinylated 18-mer, 50 μΜ); 20 μΐ primer 2 (18-mer, 50 μΜ); 2 μΐ hot NTP’s (approximately 2 mCl); 6 μΐ ddH2O; and 2 μΐ Taq x Polymerase (10 unite). The reaction was sealed with 2 drops NUJOL mineral oil. A control reaction was also performed without template aptamer. -68Initial denaturation vaa at 94*C for 3 minutes, but subsequent denaturation aftor oaoh olongation reaction lasted 1 minute. Primer annealing occurred at 60 *C for 1 minute, and elongation of primed DNA strands using the Taq polymerase ran at 72 *C for 2 minutes. The final elongation reaction to completely fill in all strands ran for 10 minutes at 72*C, and the reaction was then held at 4*C.

Fifteen rounds of Taq polymerase elongation 10 were carried out in order to amplify the selected aptamer DNA. After the reactions ware completed, the NUJOL oil waa removed by chloroform extraction. The two reactions ware combined and chloroform extracted again. A 2 μΐ •ample was removed fiwut ««uh u£ Ute aptamer and control reaction for counting and an analytical gel. The rest of the amplified aptamer was run over four Nick columns (G50 Sephadex, washed with 3 ml Tl buffer (10 mM Trie*HCl (pH 7.6), 0.1 mM BDTA)) to remove unincorporated NTP'a, primer·, and salt. 100 μΐ of tha amplified aptamer pool (400 μΐ total) was applied to each Nick column. 400 μΐ of TB buffer was than added to each column and the eolumae ware eluted vith an additional 400 μΐ using 10 mM Tris-HCl, pH 7.6, 0.1 mM BDTA (1600 μί total). λ I Jil •ample waa removed from the combined eluents for counting and an analytical gel. The remaining eluent waa loaded on an avidin agarose column (Vector Laboratories, Cat.

No. A-2010) (600 μί settled support, washed with 3 x 800 μΐ TB buffer). Approximately 90% of tha loaded counts remained on the column. The column was washed with TB buffer (3 x 800 μΐ) and then the nonblotlnylated strand waa eluted with 0.15 N NaOH (400 μί fractions) More than 48% of the counts on the column were eluted in the first two fractions. These two fractions (βοο μΐ) were combined and neutralised with approximately 4 μί of glacial acetic acid. The neutralised fractions were -69reduced to 200 μί by speed vacuum or butanol extraction and then precipitated with It OH. The resultant pallet was dissolved in 103 μΐ selection buffer, heated at 94*C for 3 min, and cooled to room temperature, λ 2 μΐ sample was removed for counting and an analytical gel. b. Aptamer Recovery-Prof ilea, gram ths First. Two Rounds of Selection Aptamers slutsd iron ths first round of bradykinin-linked column selection were obtained in two 100 μΐ fractions that contained 0.074 of the total counts loaded. Recovery of three 100 μΐ fractions from ths second round selection yielded 0.264 of the total counts loaded therein, indicating that an increased proportion of the aptamers loaded onto ths column had bound to bradykinin. 7. Further Rounds of Aptamer Selection on Bradykinin Column· Additional rounds of selection and amplification were carried out in order to obtain a population of aptamers that conaieted of species that bound to bradykinin. Tha cycle of Sxamplss l-C and l-D was repeated 6 times until a significant portion of the oligonucleotide pool (as measured by cpm) remained on the column after washing with selection buffer. Under the selection and amplification conditions ueed, about 154 of input counts (0.5 nmols DMA, about 19 μ$) bound to ths bradykinin column in rounds 5 and 6. About 64 of the counts bound to ths control column. However, the proportion of counts that bound to ths bradykinin column waa higher, 404 of input cpm, when the initial amount of input DNA was reduced from 0.5 nmole to 0.1 nmole, under these conditions (0.1 nmols input DMA, about 3.5 μς) 194 of the counts bound to ths capped control column. Ths ·70· relatively high proportion of counts bound to the control column was due to overloading of the control column during the prebinding process prior to adding aptamer to bradyklnin columns at each round of selection. This high level of binding to the control column in the later round pools (rounds s and 6) can be reduced by reducing the molar ratio of input dna to column during the selection process. This protocol is described in Example 1-G below. This high affinity aptamer pool was eluted, amplified by PCR, cloned, and sequenced (about 20 to 40 clones). Prom these clones, several homologous batches of aptamers and/or individual donas ars prepared by solid phase DNA synthesis aad tested for bradyklnin binding affinity and specificity.

G. Aptamer Selection Osin? a Reduced Molar Ratio of Aptamer to Column An initial oligonucleotide pool (0.5 nmole, 3 x 1014 unique sequences) of synthetic 96-mer prepared as in Example 1-B is amplified approximately 30-fold by largescale PCR using known techniques. Assuming 10-20% readthrough of synthetic DNA and possible preferential amplification by the Taq polymerase, the estimated actual complexity is reduced to about 1 χ IO3,3 unique sequences.

This asvlified oligonucleotide pool (0.5 nmoles, about 30 copies of 1 x lO13 unique sequences) doped with 5*-32P-labeled species, is used in the first selection round. A bradyklnin-linked column and control support column are prepared as in Example 1-B. ttie pool is heated to 94C for 3 minutes in selection buffer, cooled to room temperature, then applied to 1 ml of control support washed with 3 ml of selection buffer, and allowed to equilibrate for about 10 minutes. Ths column is then slutsd with selection buffer and the eluent collected in 200 μΐ fractions. The bulk -71of the count· (approximately 908), with little affinity for the matrix ia eluted in the first 2 or 3 fractions after tha void volume. These fractions are combined, applied to the bradykinln-linked support (1 ml, approximately 10 to 15 pmole, washed with 3 ml of selection buffer), eluted with selection buffer, and the eluent collected in 200 pi fractions. Fractions are collected until the eluted counts in a fraction plateau at less than 0.058 of the total counts loaded on the column (approximately 12 fractions). The column is then eluted with elution buffer (.15 N NaOH, 50 mM BDTA). The aptamers are eluted in the first 2 or 3 fractions after the void volume. These fraccione are combined and precipitated using ethanol and glycogen as the carrier.

IS The aptamer pellet is taken up in 100 pi of dd Η?0 and transferred to a 0.5 ml ailiconiced eppendorf tube for PCR. One aptamer PCR reaction and one control (without template) reaction are then run aa described in Example 1-D.

The above procedure is then repeated, with the exception that the oligonucleotide pool used in subsequent selection cycles is reduced to 0.1 nmole and the control and bradykinln support volumes are reduced to about 330 pi (about 3 to 5 pmoles bradykinln). The procedure is repeated (-5-6 times) until a significant portion of oligonucleotide remain· on the column after washing with selsceloa buffer. This high-affinity aptamer pool ie eluted, converted to double stranded dna by PCR, and cloned. About 20 clones are eequenced. From these clones, several homologous batches of aptamers are prepared and tested for binding affinity and target specificity. High affinity aptamers are mutageniced using the techniques described in Bill ng ton et al., Nature (1990) 346:818-822 to yield a 158 mutation rate at -72each position and rsselected to determine those bases which ars involved in binding. gXMPlfl a Selection of Aptamers that Bind to PQF2a A. Preparation of ?QF2flt Linked to a Solid Support PGP2a derivatized Toyopearl* AF-amino 650M (Toeo Haas, Inc., Woburn, MA) eupport (charged with 10 pinoles P0F2a/ml matrix) was used for all selections described. The support was coupled through the free carboxyl group of PGF2a according to the manufacturer's instructions. PGF2« was purchased from Sigma Chemical Co. (Cat. Mo. P 3023) and tritiated PQF2a was purchased from New Sngland Nuclear. mg of PGF2or (Tris salt) was dissolved in ml HgO/methanol and converted to the sodium salt by passage over an ion exchange column, Ths column eluent was then evaporated, dissolved in dioxane and converted to the N-hydroxy-succinimide (NHS) eeter by treatment with NHS and diisopropyl carbodiimide for 24 hrs. This mixture was then added to 1 ml of ths settled eupport Toyopearl washed previously with 200 mM NaHCOj. The mixture was shaken for 24 hrs., and washed with a NaHCOj solution. To determine the amount of coupling, the above described procedure wae repeated except that a small amount of tritiated PGF2a was added. Ths coupling yield was determined by the amount of tritium associated with the eupport. The support was then capped by treatment with acetic acid (NHS•ester) in dioxane/200 bM NaHCOj buffer (id).

An underlvatised capped support was mads by treating Toyopearl AF-amino 650M with acetic acid (NHSeater) in dioxane/200 WM NaHCOj buffer (lil) to be used as a control. •73B. Selection for Aptamers That Bind to an Immobilized MMg Column 200 μί derivatized Toyopearl support containing S 2 jnnols of PQF2a ligand was loaded on a 1.5 ml column houaing. The column was washed with 3 ml of 20sM Trieacetate buffer (pH 7.4) containing lmM MgCl2, l mM CaCl2, 5mM KCI and 140nM NaCI (the selection buffer). An identical column was prepared using ths underivatized Toyopearl control support dsscrihsd in Bxasqple 2-A. 0.5 nmoles of ths oligonucleotide pool prepared j in Bxample 1-B (doped with tracer amount* of 5'· P-end1 tbe led species) was resuspended in 400 μί ot selection butter and heat denatured for 2 min at 95C. The denatured DNA was ismediately transferred to wet ice for 10 min. This material waa applied to the control support (underivatized Toyopearl), flow initiated, and eluent collected. Flow-through was reapplied three times. At ths end of the third application, the column was rinsed with 200 μΐ selection buffer (1 bed volume). The flowthrough was pooled and applied for a fourth time. A column profile was established using quantification via Cerenkov counting. Flow-through material waa then pooled for application to the PGF2a support.

Application of the flow-through pool to POF2οιder i vat ized Toyopearl was parforaad as described above. After ths third application, ths column was washed with 200 μί ot selection buffer and the material reapplied to establish a column profile. Ths support was washed with additional selection buffer until the eluting material decreased to low levels, less than 0.24 of initial input cpm. Ths support was then washed with 1ml of selection buffer containing IM NaCI. Bound oligonucleotides were slutsd with 20nM BDTA/604 acetonitrile. The solvent was removed under vacuum and -74the material chromatographed on a Nick column (Pharmacia, 0-50 Sephadex columns) as par the manufacturer's instructions using lOmM Tris (pH 7.5)/0.ImM BDTA/250mM NaCl. Ths 32P-containing fraction was then precipitated with 20pg of carrier glycogen and absolute ethanol (2.5 vol) on dry ice for 15 minute·. The ONA was pelleted for 15 minutes *L 4*C, waehwd with 70% ethanol, and dried under vacuum.

C. Amplification of Aptamere Obtained Af ten Selection on ft^-gfg^A.JglWTO The DNA selected ia Bxample 2-B above wae amplified via PCR using known techniques under the following conditions: 1 nmole of 5' and 3' primer IS (biotinylated), 250 μΜ dNTPs (containing 20 μθί each of dCTP, dOTP and dATP) in 200 μΐ of 10 mM Tris (pH 8.3) containing 50 mM KCl and 1.5 mM MgCl?. The reaction vessel was sealed with mineral oil, and tub jected to 25 cycles of amplification. The mineral oil was then removed, and 100 μΐ CHClj was added. The solution was then vortexed and separated via centrifugation. The aqueous layer was removed, concentrated via n-butanol extraction and brought to a final volume of 100 μΐ. The 32P labeled DNA was then passed over a Nick column equilibrated in 100 mM Tris (pH 7.5)/100 aM NaCl to remove unincorporated primer and dNTPs. The column eluent was then applied to 400 μΐ of avidin-agarose matrix (two applications resulted in more than 90% retention of the input). The matrix was extensively washed to remove contaminants and single-stranded aptamer eluted vith 800 μΐ washes of 0.15N NaOH (2X), yielding 40-48% recovery of input 32f u«a. ihe aptamer solution was brought to pH 6 with acetic acid and concentrated via n-butanol extraction to 40% of the initial volume. The material was precipitated with absolute ethanol (3 vole) •75on dry ice tor 15 minutes. The DNA was pelleted, waehed with 70% ethanol and dried under vacuum. The material was resuspended in selection buffer as described above. Subsequent rounds of sslsction were carried out using the same protocol: removal of aptamer by binding to the control support column; followed by binding to the PGF2a column. Bach round of selection resulted in a pool enriched in the aptamer that specifically bound to the PQP2# immobilized on the column. Asplified material was always obtained from ths PGF2a column by elution in 20 mM BDTA/60% acetonitrile.

D. Quantitation of Aptamer Recovery Prom PQF2ol Columns After 6 Rounds of Selection The total radioactivity (3aP) associated with each oligonucleotide pool used for PQF2a selection was dstsnnined prior to addition to underivatizod Toyopsarl columns. DNA from underivatized and PQF2cr-derivatized columns was recovered and total radioactivity determined and expressed as % recovery. Data for 32P recovered (in cpm) after column washes are shown in Table 2 for selection rounds l through 6. -76Table 2 % Total cpm Bluted Round of aelectlon by_CH3Qi/BDTA Wash * 6 0.37 2.31 7.96 16.97 17.34 'total cpm recovered after 2 column washes with ch3ch/bdta.

B. Characteriaatlon of Aptamers Bluted From the Round 6 Column (a) The recovery of specifically-binding oligonueleotldee in each amplified pool from round 4, 5 and 6 selections remained constant at about 17¾ of total input cpm. Aptamere obtained from the round 6 column washes orlor to addition of CHjCN/BDTA were recovered by ethanol precipitation, pooled, and subjected to selection on a new PGF2a column. The total cpm recovered from CK3CN/BDTA elution waa about 17¾.

This demonstrates that the aptamers eluted by CHjCN/EDTA in round 6 specifically bind to the MF2a ligand. The 17¾ recovery wae due only to the limited binding capacity of the BOF2a column. This mean· that 1 to 10¾ of linked WFJor is available for aptamer binding, giving a ligand:oligonucleotide loading ratio of about 40 to 400. Higher recovery values for round 4 through 6 selection· have been reported but result from a higher ligand:oligonucleotide ratio of about 10-30,000 (Bllington aad Ssostak, Mature (1990) 215:616-822).

Thus, the aptamers obtained after 6 rounds of FOF2« selection (the round 6 pool) were a pool of molecules -77that resulted Cron competition among aptamer species for a limited number of WF2a binding aitea. (b) The round 6 pool waa further characterized by adding 1 ml of a 2.4 mg/ml solution (5 pinole} of FOF2a in eelection buffer to an WF2« column (containing 2 pmole of matrix-bound FG72«). This result shows ligandspecific elution of the pool -- a claaaic property of affinity-selected ligands, fist Schott, H., Affinity Chromatography. (Marcel Dekker, Inc., New York), 1984. (c) The round 6 pool waa additionally characterized for FQF2a-binding apecificity by monitoring hydroxypropionlc acid (KF) -mediated elution (HF is chemically similar to FGF2o). 0.4 ml of selection buffer containing 1.0 mM HP waa added to a PGF2o column saturated with radiolabelled round 6 pool. The elution profile showed that leas than 1% of applied radiolabeled aptamer DNA was eluted by HF. This step was followed by application of 0.4 ml of selection buffer containing 1.0 mM FGF2a using the same column, and resulted in the elution of over 95% of radiolabelled aptamer DNA from the column. This result demonstrated that the round 6 pool was binding specifically to FQF2a and did not bind to a chemically similar molecule such a· HF. (d) To further characterize the round 6 pool, the pool waa incubated with 5 pmole of PSF2a in selection buffer for 30 minutes at room temperature and then added to a PGF2a column as deecribed above. Leas than 2% of the total cpm associated with the pool bound to the column. A FQF2a column loaded with tha round 6 pool in selection buffer adsorbs 75% of the input oligonucleotides (here 75% of the counts bound to the column because only 0.05 nmols of aptamer was added to the column). (e) Analysis of the selection and elution buffi*™ wa« carried out by incubating the round 6 pool -71wich a FGF2« column by suspending the pool in selection buffer containing 20 mM BDTA to remove Mg** ions by chelation. Less than 28 of the total cpm associated with the pool bound to the column, while a control column loaded with the round 6 pool in selection buffer bound as described above (758 of the counts bound to the column because only 0.05 nmole of oligonucleotides was added to the column, resulting in a 10-fold increase in the PGF2a:oligonucleotide molar ratio compared to the binding ratio used to generate the PGF2« aptamer pool). This indicated that specific binding of oligonucleotides involves structural features that required ths presence of Mg** ion. The use of BDTA in the elution buffer efficiently removes Mg** ion from solution and thus prohibits specific binding of oligonucleotides to the PGF2« matrix. (f) The following additional characterization method ie proposedi The round 6 pool ie characterized by determining the elution profile Obtained after washing a PGF2e column (200 pi support volume) saturated with the round 6 pool. The washes are carried out using 0.4 ml of selection buffer containing 1.0 bm solutions of a series of compounds that resemble FGF2 washes using chemically similar molecules are utilized for isolation of aptamera that bind to specific compound·, llution of a PGF2« column saturated with the round 6 pool using 1.0 mN e-iso-PGF2« (Cayman Chemical Company, catalog No. 16350, an isomer of PGF2a), followed -79by elution with selection buffer containing 1.0 mM PGP2a results in isolation of aptamers that preferentially bind to either PGF2a or the 8-lso-POF2a isomer.

Alternatively, columns made using equimolar amounts of S POF2a and 8-ieo-PGP2« are used to generate a pool of aptamers containing speciee that bind to one or the other isomer or both. Some of these aptamere presumably bind to regions of the POP2» structure that are unaffected by the isomerisation. Chemically modified eicosanoids ars used in a similar manner.

Bxaaple a Silectlan of Aptamer· Frea. Non-gredetendnid-gofili is a. Prspa£itlpn_flf_pflP2g..blaXsa to a Solid Support PQP2« derivatized Toyopsarl1” (Toyo Haas, Inc., Woburn, MA) support (charged with 10 pmoles PGF2a/mL matrix) was used for all selections described.

Selections were carried out according to ths manufacturer's Instructions. FGF2a was purchased from Sigma Chemical Co. (Cat. Wo. P 3023) and 3H-PGF2a was purchased from New England Nuclear.

POP2 a (salt) (10 mg) is dissolved la HaO/ methanol (1 ml) and converted to the sodium salt by passage over an ion exchange column. The eluent is evaporated, dissolved in dioxane and converted to the NHS-eater by treatment with N-hydroxy-succinimide (NHS) and diisopropyl carbodiimide for 24 hrs. This mixture is then added to s toyopearl AF-amino 650M (Toyo Haas, inc.) support (1 ml of settled support) which has been washed previously with 200 mM NaHCOj). Ths mixture is shaken for 24 hours and the support is washed with 200 mM NaHCOj solution. To determine the amount of loading the abovedescribed coupling procedure is repeated except that a small amount of tritiated PQF2a ia added and the coupling -βοyield is determined from the amount of 3H-label associated with the eupport.

After completed PGP2« coupling, the support is capped by treatment with acetic acid NHS-ester in dioxane/buffer 1:1. (The buffer is 200 mM NaHCOj). The all-capped support ls mads by treatment of toyopearl AF-amino 650M with acetic acid NHS-ester in the same manner as described above.

B. Selection of Aptamers of Substantially NonFredetermlned Sequence That Bind to PQP2ot Linked to fiolid Support A pool of aptamere consisting of 60 baeee of completely random eequence is synthesised by standard solid phase techniquee using phosphoramldits chemistry (Galt M.J., Oligonucleotide Synthesis. IRL Press, 1984; Cocuzza, A., Tetrahedron Lett. (1989) ift:6287-6291). 1.3 x io3€ different aptamer sequences are possible in a random 60-mer pool. A standard 1 fM seals synthesis followed by HPLC purification yields 60 nmoles of single stranded DNA. Assuming that each base residue has an average molecular weight of 350, the synthesis yields 1.26 mg of purified DNA. The aptamere are synthesized with a phosphate group at the 5' end. The biotin residue ls linked to primer using a commercially available biotin phosphoramldits conjugate (New Sngland NUclear, Catalog No. NBF-707) that is incorporated into ths strand after solid phase DNA synthesis using etandard synthesis conditions. The biotin label ia incorporated into PNA according to manufacturer's recommendations.

PGF2a derivatized support (charged with /imoles PGF2«/mL resin) is used for all selections described. 200 j*l (2 jxmole of PGF2« ligand) support is poured into a 1.5 mL column bousing. The support is washed with 3 mL of 20 bM Tris-Ac pH 7.4 containing 1 mM -81MgCla, 1 mM CaClj, 5 mM KCl and 140 mM NaCl (tha eelection buffer). Selection buffer mimics the ion and pH conditions found in the human circulatory system, λ control column containing identical support is prepared in the same manner.. This support is the parent matrix for attachment of selection ligand but has been capped as the acetamide to mimic the linkage used for attachment to PGP2a. nmole of aptamer (doped with tracer amounts 10 of 32p-labeled species) is resuspended in 400 μΐ of oolwUivu buff«x* and heat denatured fee a minutes at 95 C. Ths denatured DNA is immediately transferred to wet ice for 10 minutes. This material is applied to the control support. Flow is initiated and eluent collected.

Flow-through is reapplied up to three times. At the end of the third application ths column is rinsed with selection buffer. A column profile is established using 32P quantitation via Cerenkov counting. Flow through material (2 to 4 column volumes) is pooled for applica20 tion to the PGF2a support.

Application to PGF2cr matrix is identical to that described above. After application to the column, the matrix is washed with 200 pL of selection buffer and the material reapplied to establish a column profile.

The support is washed with additional selection buffer until the eluting 32p material reaches a constant low lsvsl (less than about 0.2% of input DNA per 200 pL of flow through). The support then is washed with 1 mL of selection buffer containing increased NaCl (IM) until counts per 200 pL oi wash are less than about 0.21 of input totals. Desired aptamer is eluted with a solution of 20 mM BDTA/60% acetonitrile (elution buffer). Specifically bound aptamere are recovered from the first 2 to 4 column volumes that are obtained after adding elution buffer. The solvent is removed la vacuo and the -62material ia chromatographed on a G50 Sephadax Nick column (Pharmacia, catalog no. 17*0655-02) aa per the manufacturer's instruction· using 10 mM Tris pH 7.5/0.1 mM HDTA/250 mM NaCI. The 32P fraction la then precipitated with 20 pg of carrier glycogen (Boehringer Mannheim) and 2.5 volume absolute ethanol (dry ice 15 minutee). The dna ia pelleted at 14R, 15 minutee · 4*C, washed with 704 ethanol and dried in vacuo.

C. Covalent-linkaca of linker· to aptamsrs vith saHplatBlx jMtfTO atgutacBB Linkers of known sequence that serve as primers for anpllfication of the aptamer by PCR or other methods are covalently attached to the DNA in the aptamer pool as follows. l.O pmole of aptamer obtained as described in 8ection 1 (about 21 ng of which corresponds to about 6.0 x 1014 molecules) is added to a solution containing l nmols of linker 1 which contains 40 nueleotide residues (about 14 pg) and 1 nmols of linker 2 (about 14 pg).

Linker i, which will be ligated to the 5' end of the aptamer and consists of a pool of 256 different species, has ths structure shown below. Pour random sequence residuee at the 5' end of strand A of linker 1 gives rise to the 256 different species. Pour random sequence residues at tha 3' end of strand C of linker 3 result in a pool of 256 linker 2 species. linker 1: 3* HO-ACQCCGCGaTACTTACGC-N-N-N-N-OH 5' strand A « biotia-T0CGGCCCCATQAAT0C0-0H 3' strand B -83Linker 2 has ths following structure, linker 2s » HO-AflCGGCCGCTCTTCTAOA-N-N-N-N-OK 3' strand C 3' H0-TCOCCQGCGAGAAGATCT-OPO3 5' strand D The linker 1 eequence: 5' GAATGC 3' CTTACG ia the recognition eequence for cutting by the restriction enzyme Bsm X, which cuts as follows ' GAATGCNX 3' CTTACxGN Positioning of ths BspMi site as shown ln linker l permits subsequent precise removal of the attached linker from the aptamer after anplification. The linker 2 sequence: S' CTCTTC 3’ 3' GAflAAfl 5' is the recognition sequence for cutting by the restriction enzyme Bar X, which cuts as follows (x denotes the cut site in each strand): ' CTCTTCNx 3' GAflAAQNNNNx Positioning of the Bar X site as shown in linker 2 permits subsequent precise removal of the attached linker from the aptamer after amplification.

Nucleotide residues labeled N are random K, T, G or C residues and serve to anneal with the terminal four bases at the 5' end, linker 1, and 3' end, linker 2, ot each aptamer. Perfect matches between the random linker bases and the terminal four random bases of the aptamer permit annealing and ligation of the linkers to the aptamer. The ligation reaction is carried out in a 300 μΐ volume using 1,000 units of T4 DNA ligase (New -(4England Biolabs, Catalog No. 202CL) in standard reaction buffer (50 mM tri·-HCl, pH 7.5 AT 20*C, 10 mM magnesium chloride, 20 mM dithiothreitol, 1 mM ATP, 50 pg/ml bovine serum albumin) at 12*C for 12 to 18 hours. The molar ratios of linker to matched aptamer end is approximately 1000:1, which drives the ligation reaction toward ligation of all aptamers in the pool. This ratio arises from input aptamer, 1 pmole, that haa 0.0039 pools of any given 4 base sequence at either end. 0.0039 nmole of either linker with a given 4 base overhang ia present resulting in the 1000:1 ratio. For aptamera that have an end which participates in aptamer structure and/or binding, later rounds of aelection and amplification will be enriched in species that have a nonrandom sequence at IS one or both ends. In thia case, the ratio of specifically matched linker and aptamer will decrease by ae much as 100 fold or more. Subsequent rounds of selection and amplification may then be carried out using linkers that reflect predominant aptamer end sequence· to raatora the ratio to a value near 1:1000. The conditions described generate aptamera with linkers covalently linked to each end. The ligation reaction generates two products. The first product is linker 1 ligated to the 5* end of the aptamer with linker 2 ligated to the 3' end of the aptamar. Th· second product i· linker 2 ligated to itaelf to give a dimer. The dimers are removed by adding aolid agarose-avidin support (Vector Labs, Inc. Catalog No. A2010), 2 mg of avidin per ml support with avidin linked to the support to the ligation reaction.

Biotin attached to linker 1 strand A binds to the avidin solid support, permitting separation of dimers from aptamer· with linkers covalently attached. The support is pelleted and washed three times in buffer (10 mN NaCl, 10 mM Tris-HCl, pH 7.5, 1 mM BDTA) to remove dimsra and unllgated linkers synthesized using linker strand C as a -85primer. The column ie heated to 95*C to melt off the aptamer complement.

The following method to eeparate linker dimer· from the aptamer pool alternatively may he utilized. For exaeple, 1. coli polymerase I (New Bngland Biolab·, Catalog Noe. 209L or 210L) ie used to synthesize aptamer and ztrand B complement, using strand C as the primer.

The resulting duplex aptamer-linker and complement ie then separated from linker dimers using an avidin column by washing at room temperature. The complement containing flanking linker is eluted by heating to 94 *C and washing.

Protocols for adding linkers to only one end of an aptamer and amplifying it follow. For example, in a preferred embodiment, a pool of a very long linkers (several hundred nucleotides of known double stranded sequence having one 3' overhang (4 bases long) of random sequence at the 3' end of aptamer) ia generated. Thia pool of linkers may ba used to drive 3' ligation to the aptamer pool. Chain extension from the 3' overhang generates the aptamer complement. Standard blunt end ligation may then be used to circularize the double stranded structure. The structure then is cut using a restriction site in the linker, preferably one with an 8 base recognition sequence (to reduce the percentage of aptamers cut). Aptamera are then amplified using PCR or other known methods. In this method, the primers obviously may be placed anywhere within the large linker region, pennitting amplification of only desired lengths of linker. Obviously, ths long linker described above could be a r epi icon and directly used to generate an aptamer clone bank by transforming a desired boat. For related protocols see FCR Technology, Frlnciplea and Applications for DNA Amplification. Chapter 10, p. 10535 ill (Henry A. Brllch, ed. 1989) Stockton Press. For -86another variation which nay be adapted aee Bun H-M, and Yoon, J-W., Blotechnlques (1989) 2:992-997. A less preferred (because yields are lower) embodiment for attaching a linker to a single stranded aptamer would be ligation of single stranded linker to single stranded aptamer.

D. PCR Amplification of Aptamers With Flanking Primer SequancM The selected DNA is amplified via PCR using ths following conditions: 1 nmole of each primer, 280 μΜ dNTPs (containing 20 μ& of dCTP, dOTP and dATP-total 60 μΟί) in 200 gL of 10 mM Tris pH 8.3 containing 90 mM KCI and 1.5 mM MgCl?. The reaction is sealed with mineral oil. This reaction is put through 15 cycles of amplification. One cycle of PCR amplification is carried out by bringing the temperature to 94 *C for 1 minute.

This time is extended to 2 minutes for ths initial denaturation step. The denaturation step ls 60 *C for 1 minute. Ths hybridisation step is 72°C for 1 minute and then back to 94*. After 15 cycles, ths temperature is left at 72*C for 2 minutes to completely fill in all primed single stranded regions. Upon completion, ths mineral oil is removed by extraction with CHClj. The solution is then vortexed and separated via centrifugation. The aqueous layer ls removed and concentrated via n-butanol extraction-final volume 100 μ],. The 33P labeled DNA ia then passed over a Sephadex 050 Nick column (Pharmacia) equilibrated in 100 mM Tris pH 7.5/100 mN NaCl to remove unincorporated prim·? aad dNTP'·. The slusnc is then applied to a 400 μΐι avidin-agarose matrix (two applications results in >90% retention of the input). The matrix is extensively washed to remove contaminants and the single strand aptamers are eluted with 2 600 μΐ* washes of 0.15N NaOH. -87The aptamer aolution la neutralized with acetic acid to pH 6 and concentrated via n-butanol extraction to 40% of tha initial volume. The material le precipitated with l μΐ of a 20 mg/ml glycogen aolution (Boehringer Mannheim) followed by adding 3 volume· of absolute ethanol and cooling on dry ice for 15 minutes. The DNA Is pelleted, washed with 70% ethanol and dried in vacuo. The material is resuspended in selection buffer as described above.

The procedure is repeated with aptamer pools from subsequent rounds of selection on PGP2« columns.

B. Removal of Primera From the Amplified Aptamer Pool Linker 2 is removed by digestion with Bar Z (Naw England Biolab·, Catalog No. 526L) under recomnended conditions using sxeess enzyme to insure couplets cutting by the enzyme. Following Bar X digestion, ths column is heated eo 95°C for 3 minutes to denature the aptamer complement-strand molecule followed by washing in TB buffer (10 mM Tris-Hcl, pH 7.5, 1 mM BDTA) to remove all unbound strands.

Ths aptamer is removed from linker 1 strand k, which is bound to tha agarose-avidin support, by suspending the support in 1 ml of Bsml restriction buffer (50 mM sodium chloride, 20 mM Trlo-HCl, pH 7.4 at 20*C, mM magnesium chloride, 10 mM 2-mercaptoethanol, Mg/ml bovine serum albumin) and then annealing linker 1 strand A, followed by digestion with 300 units of Bsml enzyme at 65*C for l hour. Bsml digestion rslsases the aptamer from linker 1 strand B which remains bound to the support by biotin-avidin binding. Ths resulting pool of sequences is referred to as round 1 aptamers because the pool has been selected once for aptamers that bind to the POF2« molecule. The aptamer pool le then radiolabeled by incorporation of 32p as described in Bxaaple 3-8.

Alternatively, aptamere are labeled using radiolabeled -ιβnucleotida triphoaphates during PCR amplification. The dna ie precipitated with ethanol aa deecribed in Example 3-D.

P. Chemical Linkage of Linker· to Aptamere with completely random sequences Linkers are covalently coupled to the 5' end of aptamere obtained from column selection as deecribed in Examples 3-A and 3-B. Aptamer DNA is synthesised with a free amine group at the 5* end. Amine phoephoramidite monomers are uaed to generate the 5' terminal aminenucleoside residue (using equal amounts of A, T, 0 and C monomer at the final coupling step).

After eelection and elution of DNA, ths aptamer DNA is coupled to primer sequences as follows. Linker is coupled to the 3' end using linker 2 described in Exasple 3-C. Linker (carrying biotin at tha 5' end) is attached to the aptamer free S* amine group by chemical coupling between primer oligomer DNA with a free 3' phosphate group. The reaction is carried out for 4 hours at room temperature in 0.1 M methyl imidazole, pH 7.0 and 0.1 N 1-(3-dimethylaminopropyl)-3-sthylcarbodiimide hydrochloride. The latter reagent acts as a water soluble condensing agent. The resulting aptamer eon25 tains ths linkage, 5' X-O-P-Oj-NH-CHj-Z 3', at ths aptamer-linker junction; X is the 3* terminal residue of the linker and Z is the 5' terminal aptamer residue.

Once linkers are attached at both ends of the aptamer, as described in the Examples above, PCR amplification ls carried out and the dna Is attached to an avidin column. Free aptamer carrying a amino group at the 5' end ie obtained by (1) digestion in excess Bar I enzyme, (ii) heat denaturing at 94*c, (ill) washing the column with TE, (iv) release of free aptamer after incubation of the column in 804 acetic acid for 4 hours at room -59temperature. The aptamere are then recovered by neutralizing with base and ethanol precipitation. 0. Linker· Containing a RNA Reel due at tha 5» Aptamar5 Primer Junction DNA oligomers containing even a single RNA nucleotide residue are sensitive to RNAses such as RNAse Tl or ϋχ· τι Ul •nzymee cleave specifically at guanine residues to yield two oligomers. One oligomer contains the RNA reaidus at ths 3' end the phosphate group linked at the 3' position and tha other oligomer contains a hydroxyl group at ths 5' end. Cleavage of such an oligomer at the RNA residue is also possible by incubation of tha oligomer ia 0.1 M NaOH for 30 minutee and yields essentially the same products as the Τχ or Ux enzymes. RNAse sensitivity of DNA-RNA oligomers may be applied to selection and amplif ication of aptamers. Incorporation of an RNA residue (G*) «I the 9' Lexwiual position of linker 1 strand B (5' biotin30 TOCOOCGCCATOAATGCO*-OR 3') will generate aptamer with a ribo-guanosine residue at the 5* end of the aptamer (i.e., at the primer 3' to 8' aptamer junction) when this oligomer is used to prims synthesis of aptamer using ths complementary strand template. DNA polymerases have the capacity to initiate DNA synthesis from a free 3* hydroxyl group on either dna or RNA oligomsre. rnacontaining oligomer is synthesised using support bound protected G* monomer (Milllgen/Blosearch, Catalog No. GEN 067570) that is used directly in a l pnole scale DNA synthesis using phosphoramidite chemistry according to manufacturer'a instructions.

Aptamer strands have the following structure.

O* denotes ths position of the guanine RNA residua. ' blotln-TGCGGCGCCATGAATGCG*NcoTCTAGAAGAGCGGCCGCT-OH 3' -90Aptamsr selection for PGF2a target would be carried out as deecribed in Examples 3-A through 3-D.

DNA primers (strands B and C as described in Example 3-C) are attached to aptamer DNA eluted from the column and amplification using strand B of linker 1 with a riboeyl G residue at the 3' end is used as primer for synthesis of the aptamer strand containing an RNA residue in amplification. Removal of tha linkers and recovery of aptamer would be accomplished by the following series of steps. The RNA containing strand has 5* biotin attached. 1. Bar I digestion to remove primer sequences at the 3' end of tha aptamer, 2. heating to 94*C for 2-3 minutes to denature the complementary strand, 3. washing the column to remove species released in etepa l and 2, 4. aptamer release from the avidin column by Τχ RNAse digestion, and . recovery of aptamer from the column by 20 washing and ethanol precipitation.

The aptamer thus obtained is then used in a subsequent round of selection on a PGF2o column. After recovery of aptamer from the column, DNA obtained in elution buffer washes is precipitated, and resuspended in buffer for kinase reaction and then ligated to flanking primer sequences as described. The kinase reaction prior to ligation of linkers ls necessary to replace the 5' terminal phosphate group that ia lost from the aptamer when Τχ digestion (or NaOH treatment) ie carried out. -91H. Selection of Aptamera With a 3' 2nd That Doe· Wot Partlcipateln Target Molecule Binding or in Maintaining Aptamer Structure Aptamera are obtained aa described in the Examples above, except that after two rounds of selection and amplification using aptamers without flanking primer sequences, alternate rounds of selection and amplification are carried out with linker left on the 3' end during a subsequent round of selection. The population of aptamers thus obtained bind to the PO72« target regardless of the presence of linker at the 3' end. This population is a subset of all aptamers that bind to P0P2«.

I. selection of Aptamera With Several Bases of Known Baee Seouence at On· Og Both Bads Aptamer DNA is synthesized as described ia Bxanple 3-B except that the 5' terminal four bases have a known sequence to generate a pool of aptamers with the following sequence 5' POj-AATTCNgg 3*. A linker similar to linker l with the following structure is ligated to the 5' end of the aptamer, 3' H0-X17CTTAAfl-0H 5* ' biotin-Xl7G-OH 3' and linker 2 of Example 3-C is ligated to tha 3' end of the aptamer pool after elution from target molecules. Ligation of this linker to the aptamer create· a EcoRI site and cutting of the aptamer with EcoRI releasee aptamer without addition or deletion of aay residues.

The use of restriction enzymes such as EcoRI are preferred in the 5' linker because cutting occurs on short double stranded regions that carry the recognition site (such as the double stranded region that occurs when aptamer is removed from the avidin column by restriction enzyme cutting after removal of the 3* linker and -ηcomplementary strand). Other restriction sites such as that for Hind III, or Xba I which leave a four base 5' overhang may be created and used at the 5' end to leave 5 bases of known sequence. Creation of a site for enzymes that leave either 2 (da T) nr fl (Pvu tt) base 4' overhangs, respectively, will generate aptamere with 4 or 3 bases of known sequence et the 5' end of the aptamer. Sites created and used in this manner at the 3' end require the use of enzymes that leave a 0 (Sma I), 2 (Pvu X) or 4 (Apa X) base 3' overhang after cutting to generate aptamers with 3, 4 or S bases respectively at the 3* end with known sequence. Xf both ends of the aptamere have known sequences that constitute part of a restriction enzyme site, then the sites at the ends must differ from eaoh other so that the linkers can be removed separately after amplification.

J. Selection of Aotamers Starting From a Pool of Aptsmers That Vary in Length Eleven pools of aptamere of random sequence are synthesized which vary in length from 50 to 60 bases for each pool. Bqual molar amounts of aach pool is mixed and the variable length pool is then used to select for aptamers that bind to PGF2« as described in Examples 3-B through 3-B or 3-X above.

Bvempls 4 Preparation..of Aptamer· Specific for Cell Surface Proteins λ. GDI The human lung fibroblast-like cell line, CCD18 LU (American Type Culture Collection No. CCL20S), is transfected with the human CD4 gene cloned into an expression vector. Cells stably expressing human CD4 -93protein at· obtained by standard methods for transfecting cells and obtaining clones (ess Molecular Cloning: A Laboratory Manual. Cold Springs Harbor, 1989). In this case, ths bacterial neomycin phosphotransferase is coexpreseed from the CD4 vector, permitting selection for cells carrying the vector in the antibiotic 0418 (Oibco). The resulting cell line expressing CD4 is called CD4*. A pool of aptamers consisting of 60 bases of random sequences flanked by 18 bass primer sequences is obtained by standard solid phase synthesis techniques (Oligonucleotide Synthesis - A Practical Approach, ed. M.J. Gait, IRL Press 1984). Next, 0.1 to 1 nmoles of aptamer are added to 6 ml of tissue culture medium [minimum Bsssntial medium (Sagle)] without fetsl bovine serum, o Two confluent 10 cm tissue culture plates of CCO18 LU cells ars washed twice in 5 ml medium lacking serum followed by addition of 3 ml of medium containing the aptamer pool. The plates are left at 37*C for 30 minutes. Medium from the two CCD-18LU plates is then recovered and pooled.

The recovered aptamer in medium is added to confluent plates of CD4* cells previously washed twice in 5 ml per wash of medium lacking strum. Ths plates are left at 37C for 30 min. After incubation, the plates are washed two times in medium and one time in saline using S ml per wash. The CD4* cells are then treated with trypsin (1.5 ml trypsin 0.01% solution in 10 oM BDTA) for 30 minutes at 37*C. The medium containing cells is briefly spun to pellet out the cells. The aptamers are recovered by ethanol precipitation and amplified. Ths procedure is repeated 3 to 6 times to enrich for aptamers that specifically bind to the CD4 cell surface protein. Binding to CD4 is monitored by measuring ths amount of radiolabeled aptamer that ia retained after binding to CD4* cells. Radiolabeled -94aptamers are obtained by a standard kinase reaction using a-32P-ATP to label the 5' end of aptamer after amplification. Alternatively, radiolabeled nucleoside triphosphates can be obtained by using PCR amplification to label the aptamer pool. The binding assay (positive selection) uses 0.1 nmole of labeled aptamer (approximately 3.4 pg) binding to one confluent plate of CD4* cells for 30 min at 37*C, followed by two washes in medium and one saline wash. The retained radioactivity is determined by scintillation counting of cells lysed in 1 ml of 1% sodium dodecyl sulfate, 10 mM Tris pH 7.2, 10 oM BDTA. 0.05 ml of lysate is counted in a scintillation counter using standard methods and reagents (Aquasol ve, New England Nuclear). Selection and amplification is continued until at least three rounds have been completed. After the third round and subsequent amplification rounds, 30-50 individual aptamers from the amplified pool are eloned and sequenced using a convenient vector such as pBluescript (Promega Biotech) and double-stranded dideoxy sequencing. Alternatively, pools of 10-20 individual cions sequences may be sequenced. When DNA sequencing reveals regions of conserved sequences, individual clones are synthesized and examined for their binding characteristics. The aptamers may be tested for their capacity to block the binding of HIV to T-cell lines such as SupTI or HUT-78 (Bvan·, L.A., st al., J. Immunol. (1987) 1W3415-3418) that are susceptible to infection.

Individual aptamer isolates or small poola consisting of 10 to 50 Individual aptamer species that reduce HIV infectivity are used to identify optimal species for blocking HIV infectivity by interfering with the binding interaction between gpl20 and CD4.

Dieruption of this interaction has been previously shown to reduce HIV infectivity (Clapham et al., Nature (1989) -95122(368-370). After identification of optimal CD4 aptamer specie·, further modifications such as inclusion of covalent crosalinking base analogs (such as asirldinylcytosine) or other substituents to enhance the efficacy of the aptamer are then tested in order to further isprove the aptamer for therapeutic or diagnostic uses. Lead aptamer specie· identified on the basis of blocking HIV infectivity are also then modified by inclusion of terminal internucleotide linkage modifications that rsndsr ths oligonucleotide substantially nuclaass resistant. Methods to stabilise oligonucleotides ars disclosed in publication number W090/15065, incorporated herein by reference.

IS B. flBBl HeLa celle stably transfected and expressing ths gens for the HBR2 oncogene referred to herein as the HSR2 cell line are grown to confluency and washed two times with phosphate-buffered saline. Single-stranded oligonucleotide is generated by ths random incorporation of 60 nucleotides between two primer binding sites using standard solid-phase synthesis techniques essentially as described in Oligonucleotide Synthesis--a Practical Approach (XRL Press 1984, ed. M.J. Gait). Approximately x 10® to l χ 107 cells are then incubated with 2 to 5 ml of tissue culture medium containing 0.1 to l nmoles of oligonucleotide at 37'C at a pH in the range ot 7.0 to 7.4 containing between l-5oM of divalent cations, such as magnesium or calcium. After 1-2 hours of incubation, oligonucleotides which have binding specificity for any cell surface proteins, and structure including ths target HSU glycoproteins, ars then released from the cell by cleavage with trypsin (or other protease which is capable ef cleaving, and thereby disaociaUiuy f&uui uwllw, th« protein target of interest) in buffered saline. (Bvans -96et al., J. Immunol. (1987) I2£i 3415-3418j Hoxie et al., Science (1986) 221:1133-1127).

Aptamera and call proteins released by protease cleavage are then digested for an additional 30 minutes at 37*C with protease to extensively degrade all cellular proteins. This process may be aided by a brief heat step (80*C for 3 minutes) followed by readdition of fraeh protease euch a pronase (Signs Chemical Company, catalog no. P4914). Alternatively, a protease from the thermo10 philic bacterium (sigma Chemical Company, catalog no.

P1512) may be used to aid recovery of aptamers from cell proteins. After digesting with ensymes, the aptamers recovered from binding to HBR2 cells are recovered by precipitation with ethanol using glycogen as a carrier.

The aptamers are then resuspended in medium (3 ml) and incubated with 5 x ιθδ HeLa cells for about 60 mlnutea. Cellular supernatants are recovered, and the oligonucleotides precipitated from the eerum-free culture medium after adding 200 to 800 pg glycogen (Boehringer Mannheim) followed by the addition of two volumes of ethanol.

Tha thus-recovered oligonucleotides, which form a reduced pool with cell surface protein binding specificity, are amplified using PCB techniques. The cycle is repeated 4-7 times followed by cloning of Individual aptamer species. The sequences of individual clones ara determined by standard methods, individual aptamers are then synthesised and tested for binding by tha method described in Example 4-C.

C. IL-1 The human BeL* cell line ls transfected with two different genes to generate two lines that express the inserted gene. The first gene is the human IL-1 receptor (8ime et al., Proc. Natl. Acad. Bel. (1989) ££:8946-8950), giving rise to the ZL-1B cell line and the -97second gene ia the IL-1 receptor that hae been genetically engineered by etandard technique· to expreee IL-iR that has been mutated in the extracellular domain, giving riee to the IL-lRm cell line. Transfected donee expreee ing each receptor are identified by iamunoprecipitation ueing polyclonal antibodies against the IL-iR protein.

Aptamere that specif ically bind to the IL-lRm molecule at the cell surface are obtained by selection using the IL-lRm cell line. The procedure starts with a pool of aptamers containing 60 random bases flanked by 18 base primer sequences as described above. Two confluent plates containing about 8,000,000 XL-iR cells are incubated with a total of 0.1 nmole of aptamer ln a total of 4 ml of tissue culture medium lacking serum. 0.1 nmole of aptamer pool is estimated to contain approximately 6 x 1013 different aptamer species, having a mass of approximately 3.4 jig. The estimates of molecule numbers is based on the estimated molecular weight of 33,600 for a 96-mer. lach base residue la the aptamer has an average molecular weight near 350 da.

The aptamer pool size may be reduced by ae much as 10fold if the initial DNA synthesis does not provide fully random sequences due to uncharacterised biases in the synthesis and purification steps.

The cells are washed three times ia medium lacking serum prior to adding the aptamer pool. The IL1R cells are incubated for 30 minutes at 37*C followed by recovery of the medium containing aptamere from the celle. The aptamere in eolution are then added to washed XL-lRm cells and incubated for 30 minutes at 37*C, followed by three washes in medium lacking serum followed by three waehee ln buffered saline. The cells ars then trypelnlsed for 30 minutee at 37*C and intact cells are pelleted by a brief spin. Aptamere are recovered from eh· supernatant after enzyme digestion or heating hy precipitation and amplified by standard PCR methods. The process is repeated using 0.1 nmole of amplified aptamer pools et the start of each round of selection.

Enrichment for aptamers that specifically bind to the IL-iRm protein ia monitored by measuring ths binding of selected aptamer poole to IL-IRra cells by the following method. Aptamers obtained after 6 rounds of selection and amplification are modified according to methods disclosed herein. Biotin is covalently attached at the 5' end via linkage to N-ethyl-diethanolamine linked to the 5' nucleotide of each aptamer in the amplified pool. Alternatively, aptamera labeled for chemiluminescent detection may ba synthesized and used for in situ detection of bound aptamers (Bronstein st al., Clin, Chem. (1989) 44:1856; Bronstein et al., Anal. Biochem. (1989) 144:95). Aptamers attached to target ILlRm molecules on IL-iRm cells are then assayed by standard protocols using avidin and biotinylated enzymes such as alkaline or acid phosphatases. Methods for detection of nucleic acids by enzymatic methods are generally described in numerous publications (Urdea et «1., MUclelc Acids Rea. (1988) 4fii4937-4956; Qillam, Tlbtach (1987) 4:332-334). Poole containing a significant proportion of aptamers that specifically bind to the IL-iRm target are detected by incubating a washed, confluent IL-iRm tissue culture plats containing about 5 x 106 cells with 0.01 nmole of labeled aptamer from the selected pool mixed with 0.1 nmole of unlabeled aptamer from the initial random pool for 30 minutes at 23*C.

After incubation, the plate ia washed three times in buffered saline and bound labeled IL-IRm aptamer is detected enzymatically. The presence of nitroblue tetrazolium dye (Gillam, Tibtech (1987) 4:332-334) indicates the presence of bound aptamer. Specific •99binding of selected aptamer is verified by coincubation of 0.01 nmole of labeled selected aptamer with 0.1 nmole of unlabeled aelected aptamer for 30 minutee at 37*C.

The unlabeled aptamer will compete with labeled aptamer and will reduce the ensyms generated dye production by about 70 to 954. λ control plate of IL-IR cells incubated with labeled selected aptamer alone and in mixture with the initial pool of unselected aptamer is included to demonstrate that binding is specific for the IL-IRm molecule. Little or no binding of selected aptamer is observed on control IL-IR cells.

After a pool of apeamera that efficiently binds to ths IL-IRm molecule is identified, individual clones art obtained and sequenced by standard protocols (Chen et al., SNA (1955) 1:165-170). Individual aptamers are than synthesized and tested for their capacity to bind to the XL-lftm molecule.

Aptamers that bind IL*lRm efficiently but that do not bind to IL-IR are binding to structures in IL-IRm that are present due to the mutation engineered into the parent ZL-iR molecule. This type of selection procedure can be adapted to naturally occurring mutations, such as translocations that are correlated with pathological conditions. Protein structures uniquely associated with a mutation may be used to generate aptamers that specifically bind to those structures. Such aptamers would be useful for both diagnostic and therapeutic applications.

D. flerum-Enhanced IL-1 Selection Aptamers which bind to ZL-IR can be obtained by following a protocol as described in Bxample IS above except that HeLa is used as the control cell line and tha target is the ZL-ix molecule on the ZL-iR cell line. -100Non rad ioactive methods can be used to detect bound aptamere.

In a variation of this protocol, aptamer recovered fron the HsLa control cells is incubated with IL-lR cells in serum-free medium for 15 minutes at 3?*C, than prewarmed calf serum is added to give a final concentration of 10% and incubate an additional 15 minutes. Ths serum contains enzymes that degrade aptamere that are not tightly bound to target molecules.

Ths serum will enhance selection for aptamers that ars not nuclease sensitive due to their tight association with IL-1R. After incubation, the cells ars washed twice in medium without serum and once in saline, and aptamers are recovered and amplified.

BXMlPl· -5 Selection of Aptamers that Bind to Factor X A. Synthesis of Oligonucleotide Pool ona oligonucleotides containing a randomised -101sequences recovered front selection columns. The 5' primer sequence was 5' TCTCCQOATCCAAOCTTAT 3' and the 3' primer sequence wae 5' biotin-O-TCTAflACTOQAOGAATTCG 3*. The biotin residue was linked to tha 5' end of the 3' primer using commercially available biotin phosphoramidite (New England Nuclear, Cat. No. NEP-707). The biotin phosphoramidite is incorporated into the strand during solid phase dna synthesis using standard synthesis condition·.

B. Isolation of Factor X Aptamers Using Factor X Immobilized on a Lectin Column A pool of aptamer DNA 68 baees in length wae eyntheelsed ae described in Bxample 5-A, and than PCX15 amplified to construct the initial pool. An aliquot of the enzymatically-synthesised DNA was further amplified in the presence of a-32P-dNTPs to generate labeled aptamer to permit quantitation from column fractions. a Factor X column wi· prmrtd by wishing l mb (58 nmols) agarose-bound concanavalin A (Con-A”) (Vector Laboratorlee, cat. no. AL-1003) with 20 mM Tris-acetate buffer (pH 7.4) containing 1 sM Mgci2, l mM CaCl2, 5 mM KCl and 140 mM NaCl (the selection buffer) (4 x 10 mf). I mf of settled support was then incubated overnight at 4c in 10 mL selection buffer containing 368 pg (6.24 nmole) Factor X (Haematologlc Technologies Inc, Cat No. HCXA-0060). After shaking overnight to permit Factor X binding to the Con-A beads, the mixture wae briefly centrifuged and the supernatant removed. The beads were resuspended ia fresh selection buffer and transferred to a column which was then washed with selection buffer (5 x mL). A column containing l mL of settled beads had a void volume of approximately 300 ph· A control Con-A column was prepared by adding 1 mb of settled support to •103· a ooluros followed by 5 washes of 1 mL of selection buffer.

Prior to application of the aptsmer DNA pool to Con-λ columns, the DMA was heated in eelection buffer at 95C for 3 minutes and then cooled to room temperature for 10 minutes. The pool, consisting of 100 pmole DNA in 0.5 mL selection buffer, was then pre-run on the control Con-λ column at room temperature to remove species that bound to the control support. Three additional 0.5 mL aliquots of selection buffer were added and column fractions 2, 3 and 4 (0*5 mL each) were pooled and then reapplied to the column twice. The DNA in 1.5 mL selection buffer was then recovered. Approximately 16% of total Input cpm were retained on the column.

The recovered DNA was then applied to a Coa-AFactor X column aa a 0.5 mL aliquot followed by a 1.0 mL aliquot. Flow-through was retained and reapplied to the column twice. DNA added to the column on the final application was left on the column for l hour at room temperature. The column was then eluted with 0.5 mL aliquots of selection buffer. 0.5 mL fractions were collected and radioactivity was determined in each fraction. Radioactivity in eluted fractions 7 through 12 were low and relatively constant. After recovery of fraction 12, the column was washed with 0.5 mL aliquots of 0.1 K «-methyl-mannoeide (Sigma Oat. aa. K 6892) ia election buffer to elute the bound Factor X along with Factor X-bound aptamer·. Fractions 14 aad 15 showed a significant peak of Factor X protein level, as determined spectrophotometrically by Bradford protein stain (BioRad, Cat No. 500-0006). 0.085% of the input DNA eluted in these two fraction·.

Aptamer DNA (Round l dna) wae recovered from the Factor x by phenol extraction (2 x 0.5 mL). The aqueous phase volume wae reduced to about 250 pL by nIE 920562 -101butanol extraction. Aptamer DNA was precipitated on dry ice using 3 volume· of ethanol and 20 pg of glycogen as a carrier. The DNA was pelleted, washed once in 704 ethanol and then dried.

C. Amplification of Factor X Selected Antamera Round 1 DNA from Bxaapls 5-B was resuspended in 100 ph of RjO and amplified by FCR. A 200 ph PCR reaction consisted of the following: 100 ph template 9610 mer DNA (approximately 0.01 pinoles); 20 ph 10X buffer (100 bM Trls'Cl (pH 8.3), 500 mM KCl, 20 mM MgClj); 32 ph dNTP'a (5 mM cone total, 1.25 mM each dATP, dCTP, dGTP, and dTTP); 20 ph pxia&* l (biotinylated 18-mer, 50 μΜ); ph pxiWAT 2 (18-mer, 50 μΜ) > 6 ph a-3aP-dNTP*s (approximately 60 pCi)t and 4 ph Taq I Polymerase (20 units). Ths reaction was covered with 2 drops NUJOL mineral oil. A control reaction was also performed without template aptamer.

Initial denaturation was at 94*C for 3 minutes, but subsequent denaturation after each elongation reaction lasted 1 minute. Primer annealing occurred at 56*C for 1 minute, and elongation of primed DNA strands using the Taq polymerase ran at 72*C for 2 minutes, with 5-second extensions added at each additional cycle. The final elongation reaction to completely fill in all strands ran for 10 minutes at 72 C, and ths reaction was then held at 4C. rounds of Taq polymerase elongation were carried out lzi order to amplify the selected aptamer dna.

After ths reactions were completed, ths aqueous layer was retrieved and any residual NUJOL oil was removed by nbutanol extraction, reducing the volume to 100 ph. A sample may be removed from each of the aptamer and control reaction for quantitation and analytical paob.

The amplified aptamer pool (100 ph) was fractionated over -104a Nick column (G-50 Sephadex, equilibrated with 3 mL TE buffer (10 sM TrirHCl (pH 7.6), 0.1 mK BDTA)) to remove unincorporated NTP's, primers, and salt. 400 pL of TB buffer was then added to the column and the DNA pool was eluted from the column with an additional 400 pL using TB buffer. (A sample may be removed from the eluent for quantitation and analytical PAGE.) The eluent (400 pL, was loaded on an avidin agaroae column (Vector Laboratories, Cat. No. A-2010) (500 pL settled support, washed with 3 x l mL Trie/NaCl buffer (0.1 N Tris, 0.1 M NaCl, pH 7.5)). Approximately 90* of the loaded radioactivity remained on the column. The column was washed with Tris/NaCl buffer (4 x 400 pL) and then the nonblotlnylated strand waa eluted with 0.15 N NaOH (3 x 300 pL fractions). More than 45* of the radioactivity on the column eluted in these three fractions. These fractions (900 pL) were combined and neutralised with approximately 5.5 pL of glacial acetic acid. The neutralised fractions were reduced to 250 pL by speed vacuum or butanol extract ion and the nucleic acids were precipitated with BtOH. The resultant pellet waa dissolved in 102 pL selection buffer. A 2 pL sample waa removed for quantitation and analytical PAGE. The resulting amplified Round 1 Pool was applied to a new Con·A·Factor z column as in Example 5·Β to obtain Round 2 aptamers.

D. Characterisation of Bound 1 Through Round 11 Factor X Aptamera Obtained frcm Selection on Lectin Columns Eleven rounds of Vector Z aptamer selection And amplification were carried out using Con-λ-Factor X columns aa in Examples 5-B and 5-C. As shown in Table 3, the α-methyl-mannoside eluate in fractions 14 and 15 contained a maximum of about 18* of input dna at selection round li using the described conditions. -105· Table 3 Round 4 DNA eluted by t α-methyl-mannoside 4 DNA bound to control support 1 0.085 14.0 2 1.400 37.0 3 14.000·* *· 27.0 4 1.800 21.0 5 1.100 18.0 6 1.500 10.5 7 .620 4.8 8 1.100 10.6 9 1.500 12.1 10 5.700 2.8 11 17.800 19.0 * 0.1 M α-methyl-mannoside in selection buffer was added beginning at fraction 13 in each elution, and 20 fractions 14 and 15 ware retained and the DNA amplified. Fraction 16 was also included in rounds 7*11. Dus to slow leeching of Factor X from the column, DNA bound to Factor X could also bs seen in earlier fractions is rounds 10 and 11. 2S *· A high proportion of DNA was bound in round 3 due to a low input ratio of DNA to thrombin.

After amplification, approximately 5 picomoles of radiolabeled round ll aptamer DNA was analysed for 30 specificity in a filter binding assay. Zn thia assay, nitrocellulose filters (1 cm diameter) pre·soaked in selection buffer overnight at 4»C and ONA in 100 jxL of selection buffer was incubated at room temperature for 10 minutes with: (1) An unselected 68-mer oligonucleotide -106DNA pool, (2) unselected DNA with Factor X (1 μΜ), (3) Round 11 aptamer DNA and Factor X (1 μΜ), and (4) Round 11 aptamer DNA alone. The filters were then washed 3 times with 3.0 mL of selsction buffer at 37® and radioactivity was counted to determine the amount of DNA that was retained as a Factor X complex. The results are shown in Table 4.

Table ..4 DNA I DNA Bound to Filter Unselected 68-mer 1.2 Unselected 68-mer ♦ Factor x 1.3 5 Round il aptamer ♦ Factor X 24.6 Round H aptamer 0.9 Unselected DNA did not show significant binding 20 to ths Factor X while selected aptamer DNA bound to Factor x. Binding results show specific Factor X binding. Based on the filter binding results in Table 10, a Kjj of approximately 2 μΜ can be estimated for the round 11 pool.

Sample 4 Aelectlon of Aptamere that Bind to Thrombin A. Synthesis of Oligonucleotide Pool 30 DNA oligonucleotides containing a randomized eequence region were synthesized using standard solid phase techniques and phosphoramidite chemistry (Oligonucleotide Synthesis. Gait, M.J., ed. (IRL Press), 1984; Cocussa, A., Tfltrahsdron Let Ur·, (1989) 15:628735 6291). A 1 μΜ small-scale synthesis yielded 60 nmole of -107HPLC-pur if led β ingle-«trended randomized DNA. Bach trend consisted of epecific 18-mer sequences et both the 5* end 3' ends of the strand and a random 60-mer sequence in the center of the oligomer to generate a pool of 96-mere with the following sequence (N - G, A, T or C) t S' HO-CGTACOOTCOACOCTAGCN^yCACGTGGAGCTMGlTCC-OH 3' DNA 18-mere with the following sequences were used as primers for PCR amplification of oligonucleotide sequences recovered from selection columns. Ths 5' primer sequence was 5' HO-CGTACGGTCGACOCTAGC-OH 3' and the 3’ primer sequence wae S' biotin-0GQATCCGAGCTCCACOTO-OH 3*. The biotin residue wae linked to tha 5' end of the 3' primer using commercially available biotin phosphoramidite (Naw Bngland Nuclear, Cat. No. NBP-707). The biotin phosphoramidite ie incorporated into the etrand during solid phase DNA synthesis using standard synthesis conditions.

Zn another, similar experiment, a pool of 98-mere with the following sequence wae synthesized: ' HO-AGJUVTACTCAAGCTTGCCG-NgQ-ACCTQAATTCGCCCTATAG-OH 3'.

DNA 19-mere with the following sequences can also be used as primers for PCB amplification of oligonucleotidea recovered from selection columns. The 3' primer sequence le ' biOtin-0-CTATAGGGCGAATTCAGGT-OH 3' and the 5' primer sequence le ' HO-AGAATACTCAAGCTTGCOG-OH 3'. -ιο·it will be noted that in all cases, the duplex form of the primer binding sites contain restriction enzyme sites.

B. Isolation of Thrombin Apfamtrs Using Thrombin Immobilized on a Lact in Column λ pool of aptamer DNA 96 bases in length was synthesized as described in Sxasple 6-A, and than PCRampliflsd to construct the initial pool. A small amount of ths enzymatically-synthesized DNA was further amplified in the presence of «-33P-dNTPs to generate labeled aptamer co permit quantitation from column fractions. a tnrombin column inis prepared by washing 1 at (58 nmole) agarose-bound concanavalin A (Con·A) (Vector Laboratories, cat. no. AL-1003) with 20 mM Tris-acetate buffer (pH 7.4) containing 1 mM MgCl?, 1 mM CaCl2, 5 mM KCI and 140 mM NaCl (the selection buffer) (4 x 10 ml). l ml of settled support was then incubated overnight at 4*C in 10 ml selection buffer containing 225 μ? (6.25 nmole) thrombin (Sigma, Cat. no. T-6759). After shaking overnight to permit thrombin binding to ths Con-λ beads, ths mixture was briefly centrifuged and the supernatant removed. The beads were resuspended in fresh selection buffer and transferred to a column which was then washed with sslsction buffer (5 x 1 ml). A column containing l ml of settled beads had a void volume of approximately 300 ιΛ. A control Con-λ column was prepared by adding 1 ml of settled support to a column followed by 5 washes of 1 ml of selection buffer.

Prior to application of the aptamer DNA pool to Con-λ columns, the DNA was heated in selection buffer at 95*C for 3 minutes and then cooled on ica for 10 minutes. Thw pvul, uvuvlvtiuy vf 100 pwulw ONA In 0.5 ml selection buffer, vas then pre-run on the control Con-A column at -109room temperature to remove species that bound to the control support. Three additional 0.5 mf aliquots of selection buffer were added and column fractions 2, 3 and 4 (0.5 mf each) were pooled and then reapplied to the column twice. The DNA in 1.5 mf selection buffer was then recovered. Approximately 1% of total input cpm were retained on the column.

The recovered DNA was then applied to a Con-Athrombin column as a 0.5 mf aliquot followed by a 1.0 mf aliquot. Flow-through was retained and reapplied to the column twice, dna added to the column on the final application was left on the column for l hour at room temperature. The column was then eluted with O.S mf aliquots of selection buffer. 0.5 mf fractions wars collected and radioactivity was determined in each fraction. Radioactivity in eluted fractions 7 through 12 were low and relatively constant. After recovery of fraction 12, the column was washed with 0.5 mf aliquots of 0.1 M a-methyl-mannoside (Sigma Cat. no. M-6062) in selection buffer to elute the bound thrombin along with thrombin-bound aptamers. Fractions 14 and 15 showed a significant peak of thrombin enxyme activity, as determined spec t r opho tome tr Ically by conversion of a chromogenic substrate (Kabl Diagnoetica, Cat. no. 8-2230). 0.01% of the input DNA eluted in these two fractions.

Aptamer DNA (Round 1 DNA) was recovered from the thrombin by phenol extraction (2 x 0.5 mf). Ihe aqueous phase volume was reduced to about 250 μΐ by n30 butanol extraction. Aptamer DMA was precipitated on dry ice using 3 volumes of ethanol and 20 pg of glycogen as a carrier. The DNA was pelleted, washed once in 70% ethanol and then dried. -110C. Amplification of Selected Thrombin Aptamera Round 1 DNA from Bxampls 6-B waa reeuepended In 100 pi of HjO and amplified hy PCR. A 200 pi PCR reaction consisted of the following: 100 pi template 96mer DNA (approximately 0.01 pmoles); 20 pi 10X buffer (100 mM Trifl'Cl (pH 8.3), 500 bM KC1, 20 sM MgCl2); 32 pi ao dNTP's (5 mM cone total, 1.25 mN each dATP, dCTP, dGTP, and dTTP); 20 pi primer 1 (biotinylated 18-mer, 50 pM); pi primer 2 (18-mer, 50 pM); 6pl «-32P-dNTP's (approximately 60 pCi); and 2 pi Taq I Polymerase (10 unite). Tha resat ion was covered with 2 drops NUJOL mineral oil. A control reaction was also performed without template aptamer.

Initial denaturation waa at 94 *C for 3 minutes, but subsequent denaturation after each elongation reaction lasted 1 minute. Primer annealing occurred at 60*C for 1 minute, and elongation of primed DNA etrande using ths Taq polymerase ran at ?2*C for 2 minutes, with 5-second extensions added at each additional cycle. The final elongation reaction to coepletely fill in all strands ran for 10 minutes at 72*C, and the reaction was than held at 4*C. rounds of Taq polymerase elongation were carried out in order to amplify tha selected aptamer DNA. After the reactions were completed, the aqueous layer was retrieved and any residual NUJOL oil was removed by nbutanol extraction, reducing the volume to 100 pL. A sample may be removed from each of the aptamer and control reaction for quantitation and analytical PAGB.

The amplified aptamer pool (100 pL) was run over a Nick column (G-50 Sephadex, washed with 3 mL TB buffer (10 mM Trls'RCl (pH 7.6), 0.1 mM BDTA)) to remove unincorporated NTP's, primers, and salt. 400 pL of Tl buffer was then added to the column and the DNA pool was sluted from the column with an additional 400 pL using TB buffer. (A -111aample may ba removed from the eluent for quantitation and analytical PAGE.) The eluent (400 gL) wae loaded on an avidin agarose column (Vector Laboratories, Cat. No.

A-2010) (500 pL settled support, washed with 3 x 1 mL Tris/NSCl buffer (0.1 M Tris, 0.1 M NaCl, pH 7.5)).

Approximately 904 of ths loaded radioactivity remained on the column. The column vas washed with Tris/NaCl buffer (4 x 400 gl, and then the nonbiotinylated strand was eluted with 0.15 N NaOH (3 x 300 gL fractions). Mors than 454 of the radioactivity on ths column eluted in these three fractions. These fractions (900 gl) were combined and neutralised with approximately 3.5 gl of glacial acetic acid. The neutralised fractions were reduced to 250 μΐ by speed vacuum or butanol extraction and the nucleic acids were precipitated with EtOH. The resultant pellet was dissolved in 102 gl selection buffer. A 2 gl sample wae removed for quantitation and analytical PAOB. The reeultlng amplified Round 1 Pool was applied to a new Con-A-thrombin column as in Example 22 to obtain Round 2 aptamers. d. Characterisation of Round 1 Through Round. 5 Thrombin Antamaf obtained from Selection on Lectin Columns Five rounds of thrombin aptsmer selection and 25 amplification were carried out using Con-A-thrombin columns as in Examples β-B and 6-C. As shown in Table 5, ths combined fractions 14 and IB contained a maximum of about 104 of input DNA using the daseribsd conditions. -112Tahla 5 Round 4 DNA eluted by t α-methyl -mannoside 4 DNA bound to control support 1 0.01 0.7 2 0.055 1.9 3 5.80 2.3 4 10.25 1.1 5 9.70 l.o * 0.1 M o-methyl-mannoside in selection buffer was added as fraction 13 in each elution, and fractions 14 and 15 were retained and the DMA amplified. Due to slow leeching of thrombin from the column, DNA bound to 15 thrombin could also be seen in earlier fractions in rounds 3-5.

After amplification, round 5 aptamer DNA was analyzed for specificity in a filter binding assay. Zn oo this assay, nitrocellulose filters (l cm diameter) prebound with salmon sperm DNA were used to bind eitherx (1) An unselected 96-mer oligonucleotide DNA pool, (2) unselected DNA with thrombin (60 pmole), (3) Round 5 aptamer DNA and thrombin (60 pinole), (4) Round 5 aptamer 35 DMA alone, or (5) Round 5 aptamer DNA and ovalbumin (60 pinole). In each cast 3.5 pmole of DNA vaa uaed and the incubation wae in 200 μΖι eelection buffer at room temperature for 1 hour. The filters were then washed 3 times with 3.0 ml of selection buffer and radioactivity 30 wae counted to determine the amount of DNA that was retained ae a thrombin complex. The results ars shown in Table 6.

DNA * DNA Bound to Filter -113Table 6 unselected 96-mer 0.08 Unselected 96-mer + thrombin 0.06 Round 5 aptamer * throobin 20.42 Round 9 aptamer 0.07 Round 5 aptamer ♦ ovalbumin 0.05 Unselected DNA did not show significant binding to ths thrombin while selected aptamer DNA bound to thrombin. Binding results show specific thrombin binding 15 vith no detectable ovalbumin binding.

Round 5 aptamer dna was then amplified using ths following 3' primer sequence: ' HO-TAATACGACTCACTATAOGGATCCOAGCTCCAOOTQ-OH 3' and ths S' 18-mer primer sequence shown in Example 21.

Ths 36-mer primer was used to generate internal BamHl restriction sites to aid in cloning. Ths amplified Round 5 Apr Alter ΠΝΑ was then cloned into pGEM 3Z (Promega). 32 2S of the resulting clones were then amplified directly using the following 5' primer eequence: ' H0-CTGCAGGTCGA00CTA9C-0H 3' jq and the 3' biotinylated 18-mer primer sequence shown in Example 21, and then sequenced.

Filter binding assays using aptamer DNA from 14 of the clones were used to determine the dissociation constants (Kg) for thranbin as follows: Thrombin concentrations between 10 pM and 1 nM wars incubated at -114room temperature ia selection buffer for 5 minutes in ths presence of 0.08 pmole of radiolabeled 96-mer derived from cloned Round 5 aptamer DNA. After incubation, the thrombin and aptamer mixture was applied to nitrocellulose filters (0.2 micron, 2.4 cm diameter) that were pretreated with salsion sperm DNA (l mg/ml DNA in selection buffer) and washed twice with l ml selection buffer. After application of thrombin mixture, the filters were waehed three times with 1 ml selection buffer Ihe radioactivity retained on the filters was then determined. Kjj values for tha individual clones ranged from 50 to >2000 nM.

Ths DNA sequence of ths 60-nuclsotids randomlygenerated region from 32 donee was determined in order to examine both ths heterogeneity of the selected population and to identify homologous sequences.

Sequence analysis showed each of the 32 clones to bs distinct. However, striking sequence conservation was found. The hexamer 5* OQTTOO 3' was found at a variable location within the random sequence in 31 of 32 clones, aad five ef the six nucleotides are strictly conserved iu all 32. Additionally, in 28 of ths 32 clones a second hexamer 5' OONTOO 3', where N is usually T and never C, ia observed within 2-5 nucleotides from the first hexamer. Thus, 28 clones contain the consensus sequence 5' aONTOO(N)aOONTOO 3* where s is an integer from 2 to 5. The remaining 4 donee contain a close variant sequence (a sequence differing by only a single base). A compilation of the homologous sequences are shown in Figure 1. Zt should bs noted that DMA sequencing of several clones from ths unselected DNA population or from a population of aptamers selected for binding to a different vergec reveaxea no namoxogy co cne cnromoinselectsd aptamers. From these data we conclude that thia consenaua sequence contains a sequence which is -115reaponsible either wholly or in part, for conferring thrombin affinity to the aptamere.

Clotting time for the throcnbin-catalyzed conversion of fibrinogen (2.0 mg/mb in selection buffer) to fibrin at 37*C was measured using a precision coagulation timer apparatus (Becton-Dickinson, Cat. nos. 64015, 64019, 64020). Thrombin (10 nM) incubated with fibrinogen alone clotted in 40 sec, thrombin incubated with fibrinogen and Pl nuclease (Boehringer-Mannheim, Indianapolis, IN) clotted in 39 sec, thrombin incubated with fibrinogen and aptamer clone *5 (200 nM) clotted in 115 sec, and thrombin incubated with fibrinogen, clone *5 (200 nM) and Pl nuclease clotted in 40 sec. All incubations were carried out at 37*C using reagents IS prewarmed to 37*C. Aptamer DNA or, when present, Pl nuclease, was added to the fibrinogen solution prior to addition of thrombin. These results demonstrated that (i) thrombin activity was inhibited epeclfically by intact aptamer DNA and (ii) that inhibitory activity by aptamer did not reguire a period of prebinding with thrombin prior to mixing with the fibrinogen substrate.

Inhibition of thrombin activity was studied using a consensus-related sequence 7-mer, 5' GGTTGGG 3', or a control 7-mer with the same base composition but different sequence (5' GGGGGTT 3'}. Clotting times were measured using the timer apparatus as above. The thrombin clotting time in this experiment was 24 see using thrombin a Inna (in nM), 26 sec with thrombin and ths control sequence at 20 μΜ and 38 sec with thrombin plus the consensus sequence at 20 μΜ, indicating specificity for thrombin inhibition at the level of the 7-mer.

The inhibitory aptamers were active at physiological teoperature under physiologic ion conditions and were able to bind to thrombin in the -116presence of the fibrinogen substrate, a key requirement for therapeutic efficacy.

KxttPlf 7 Modified Thrombin Aptamere Modified forme of the single-stranded, thrombin consensus sequence-containing deoxynucleotide 15-mer deecribed in Bxample 7, 5' GGTTGQTGTGGTTGG 3', and a closely related 17-mer, were synthesised using 10 conventional techniques. These aptamers for the most part contain ths identical nuolootido ooquonooo, bases, sugars and phosphodiester linkages as conventional nucleic acids, but substitute one or mors modified linking groupe (thloate or msa) , or modified bases 15 (uracil or 5- (1-pentynyl-2’ -deoxy)uracil). The aptamers containing 5- (1-psntynyl) -2' -dsoxyuridine were generated by replacing thymidine in the parent aptamers. Thrombin aptamers containing 5-(l-psntynyl)-2’-dsoxyuridine wars also obtained by selection as described in Examples 13 20 and 14 below.

Independent verification of the X4 for the nonmodified 15-mer was made by determining the extent of thrombin inhibition with varying DMA concentration. The data revealed 50% Inhibition of thrombin activity at approximately the same concentration as ths derived X£, strongly suggesting that each bound thrombin was largely, if not completely, inhibited, and that binding occurred with a 1:1 stoichiometry. -117- Table 7 Coepound X1 (nM) GGTTGGTGTGGTTGG 20 5 GGTTQGTGTGGTTOG*G*T 35 ggttgotgtggtt'g'g 40 g'gYt'g'oYgVo'oYtVg 280 GGTTGG (dU) G (dU) GGTTGG 15 10 GG (dU) TGGTGTGG (dU) TOG 80 GGTTQGTGTGGTU'GG 20 * indicates a thioate (i.e., * indicates a MBA linkage P(O)S) linkage U' indicate· 5-(l-pentynyl)uracil 15 gyr»mple 1 Incorporation ot 5-(l-pentynvl)-2'-deoxyuridlns Into Anfamar Candidate DMA S-(l-pentynyl)-2* -deoxyuridine wae synthesised 20 and converted to the triphosphate as described in Otvos, L., et al., Nucleic Adda Res (1987) 1763-1777. The pentynyl compound was obtained by reacting 5-iodo-2*deoxyuridine with 1-pentyne ln the presence ot palladium catalyst. 5- (l-pentynyl) -2· -deoxyuridine triphosphate 2S was then ueed ae a replacement tor thymidine triphosphate in the etandard PCR reaction.

A pool ot 96-mer single-etranded dna was synthesised, each strand consisting of specific 18-mer PCR primer sequences at both ths 5' and 3' ends and a random 60-mer sequence in the center of the oligomer.

Details of synthesis of the pool of single-etranded DNA is disclosed in Bxamplee 1-6 above. PCR conditions were the same ae thoee described above, with the following changes. dATP, dGTP and dCTP were all used at a -ΐΐβconcentration of 200 μΜ. The optimal concentration for synthesis of full-length 96-mer dna via PCR using 5-(1pentynyl) *2’-deoxyuridine was 800 μΜ. Generation of PCRamplified fragments demonstrated that the Taq polymerase S both read and Incorporated the base aa a thymidine analog. Thue, the analog acted as both substrate and template for the polymerase. Amplification was detected by the presence of a 96-mer band on an itBr-stained polyacrylamide gel.

Bxample 9 Incorporation of Other Base Analogs into Candidate Aptamer DNA Bthyl, propyl and butyl derivatives at tha -position of uridine, deoxyuridine, and at tha N*-position of cytidlne and deoxycyt idine are synthesized using methods described above. Bach compound is converted to the triphosphate fora and tested in the PCR assay described in Bxample 1 using an appropriate mixture of three normal deoxytriphosphates or ribotriphosphates along with a single modified base analog.

This procedure may also be performed with N9-position alkylated analogs of adenine and deoxyadenine, and the 7-position alkylated analogs of deasaguanine, deazadeoxyguanine, deaiaadenine and deazadeoxyadenine, synthesised using methods described la the specification.

WMBiplA io Throttbin Apfcnmer Containing Substitute Intemucleotlde Linkage· Modified forms of the 15-mer thrombin aptamer, 5' GGTTQGT9TGGTTGG 3' containing one or two foraacetal Internucleotide linkages (O-CSj-O) in place of the phosphodiester linkage (O-PO(O’)-O) were synthesized and -119aseayed for thrombin inhibition aa described above. The H-phosphonate dimer synthon was synthesized as described in Matteucci, M.D., Tet, Lett. (1990) £1:2385-2387. The formacetal dimer, 5' T-O-CH^-O-T 3', was then used in solid phase synthesis of aptamer DNA. Control unmodified aptamer DNA vas used as a positive control.

The results that were obtained are shown in Table 8.

JhblUl Compound clot time (sec) 100 nM 20 nM 0 : GGT TGOTGTGGTTGG 105 51 V · GGTTQGTOTGGT TGG 117 48 • · GGT TGGTGTGGT TOG 84 60 « · GGTTGGTGTQGTTGG 125 49 • · NO DNA CONTROL a · 25 indicates a formacetal linkage fcctmpla 11 Tbrapbin AptMwr Containing Abailc Nucleotide Railduti Modified forms of ths 15-msr thrombin aptamer, * GGTTQGTGTQGTTOQ 3' containing one abaslc residue at each position in the aptamer were synthesized and aazayed for thrombin inhibition as described above. The abasic residue, l,4-anhydro-2-deoxy-D-ribitol was prepared as described in Brltja, R., et el, Nucleosides and NUcleotidaa (1987) £:803-814. Ths M,M»diisoprQpylamino cyanosthylphosphoramldits synthon was prepared by standard methods as described in Caruthers, M.R. Accounts Chem. Ra·, (1991) ££:278-284, and the derivatlsed COP support was prepared by the procedures described in Dahma, M.J., et al, Nucleic Acids Res. (1990) 12:3813. -120The abaslc residue was singly substituted into each of the 15 positions of the 15-mer. Control unmodified aptamer dna was used as a positive control. The results that were obtained are shown in Table 9.

Table 9 Compound clot time (sec) 100 nM 0 nM αοτταοτατααττβχ 27 GGTTGGTGTGGTTXQ 27 GGTTGGTGTGGTXGG 27 GGTTGGTGTQGXTGG 56 GGTTGGTGTGXTTGG 27 15 (WTTCGTGTXflTTQQ 29 9 αατταοταχΜτταο 43 GGTTGGTXTGGTTGG 51 GGTTGGXGTGGTTGG 161 GGTTGXTGTQGTTQG 27 20 GGTTXGTGTGGTTQG 27 GOTXGGTQTOGTTGG 27 OGXTGGTGTGGTTGO 62 GXTTGGTGTGGTTGO 27 XGTTGGTOTGGTTaO 25 25 GGTTGGTGTGGTTGG 136 NO DNA CONTROL 26 X - indicates an abaslc residue Example U Thrombin Antamara Containing S(1 - Propvnvl) - 2' -daoxyurldlna NUclaotida Raalduaa Modification of the 15-mer thrombin aptamer, 5' GGTTGGTGTGGTTGG 3' to contain 5-(1-propynyl) -2* 35 deoxyuridine nucleotide analogs at the indicated -Impositions in the aptamer was effected by the synthesis of thsss aptamers. They were assayed for thrombin inhibition as described above. The aptamer and the H-phosphonate were prepared as described in DeClercq, B., et al, J. Med.Chem. (1983) 2£t661-666; Froehler, B.C., et al, Nucleosides and Nucleotides (1987) £<287-291; and Froehler, B.C., et al, Tet. Lett. (1986) 22:469. This analog residue was substituted at the indicated positions and the aptamer assayed for Inhibition of thrombin. The results that were obtained are shown in Table 10.

Tlhli IQ Compound clot time (sac) 100 nM 0 nM GOTTOGTGTGGTZGO 147 GG7TGGTGTGGZTGG 129 GGTTGGTGZGGTTQG 120 GGTTGGZGTQOTTGG 118 20 GGTZGGTGTGGTTQG 187 GGZTGGTGTGGTTGO 138 GGTTOGTGTGGTFGO 125 NO DNA CONTROL • 23 25 Z - indicates a 5-propynyl-2* - 'deoxyuridine residue Bwwift ia incorpontioB of s-fl-pentyayllrZ^daoxyuridiaa Into Aptamer Candidate DNA -(l-pentynyl)-2'-deoxyuridine was synthesised and converted to the triphosphate as described in Otvos, L., et al., Nucleic Acide Bee (1987) 1763-1777. The pentynyl compound was obtained by reacting 5-iodo-2'dsoxyuridine with l-pentyne in the presence of a palladium catalyst. 5-(1-pentynyl)-2*-deoxyuridine -122triphosphate was than uaad as a replacement for thymidine triphosphate in the standard PCR reaction. λ pool of 60-mer single-stranded DNA was synthesised, each strand consisting of specific 18-mer PCR primer sequences at both ths 5* and 3' ends and a random 20-mer sequence in the center of the oligomer. Details of synthesis of the pool of single-stranded DNA is disclosed in Bxample 1.

Because of the poor substrate activity of 10 pentynyl dUTP when used with TAQ polymerase, VBNT* thermostable polymerase, (New Bngland Biolabs, Cat. No. 254) was employed. Amplification was performed as per the manufacturers instructions. Pentynyl dUTP vas included in ths reaction as a substitute for dTTP. The single-stranded 60-mer was isolated by a modification of standard procedures. Ths 200 μΙ> PCR amplification reaction was divided into two sanples which were applied to two NICK* columns equilibrated (5 mL) aa described.

The eluent was collected, pooled and applied to avidin· agarose as described. This column was washed with buffer followed by elution of single-stranded 60-mer DNA with 0.15 N NaOH, pooled and neutralised with glacial acetic acid. Single-etranded 60-mer DNA was desalted on a NAPS column equilibrated la 20 mM Tris OAc (pH 7.4). 10X selection buffer salts wars added to ths sample, heated to 95°C for 3 minutes, aad transferred to wat ice for 10 minutes.

Ifrsmpll 14 Iaolatlon of Thrombi APtffff*r· DNA Containing 5-(1-Pentynyl)-2'-daoxvurIdins Ths pool of aptamer DNA 60 basts in length was used essentially as described in Bxample 13. The aptamer pool sequence was -1235* TAGAATACTCAAGCTTCGAOO-Njq-AGTTTOGATCCCCGGGTAC 3', while the 5' primer eequence wae 5'TAGAATACTCAAGCTTCGACG 3' and the 3' biotin-linked primer wae ’ QTACXCGGGGATCCAAACT 3’.

Thrombin immobilised on a Con-A lectin column served as ths target as described.

After five rounds of selection, aptamer DNA was recovered and amplified using thymidine triphosphate (dTTP) in place of 5-(1-pentynyl)-2’-deoxyuridine in order to facilitate subsequent cloning and replication of aptamer DNA in L. coll. At this stage, the presence of a thymidine nucleotide at a given location in an aptamer corresponded to the location of a 5-(1-pentynyl)-2'· deoxyuridine nucleotide in each original round five aptamer. Thus, dTTP served to mark the location of 5(1-pentynyl)-2'-deoxyuridine residues in the original selected DNA pools.

The round five amplified DNA containing dTTP was digested with BamHI and Hindin and cloned into ths corresponding sites of pGBM 32 (Promega Biotech) and transformed into 1. coli. DNA from 21 clones was analysed by didsoxy sequencing. Three of ths clones contained aptamer sequences that were identical. Only one of ths 21 clones contained a sequence that closely resembled the original 5' GOTTOQ 3' binding motif obtained using thymine in ths selection protocol. 0ns of these two clones (#17) and the original unselected pool was analysed for thrombin binding by nitrocellulose filter assay described above using DMA labeled with 33P to permit analysis of thrombin binding characteristics. The labeled DMA was synthesised by PCX and contained 5-(l-pentynyl)-2'-deoxyuridine in order to retain the original selected DNA structures. Ths DNA was Incubated with thrombin at various concentrations between -124 nM and 10 μΜ to obtain the Kg values for thrombin binding. The Kp of the unselected pool was >10 μΜ while the Xp of clone 17 was 300 nM.

Radiolabeled clone 17 DMA was synthesized using thymidine ia place of 5-(l-pentynyl)-2'-deoxyuridine and the reeulting dna had a Xg of >10 μΜ, demonstrating that the 5-(l-pentynyl)-2'-deoxyuracil heterocycle could not be replaced by thymine in the selected aptamer without loss of binding affinity.

Representative sequences that were obtained are as follows.

' TAOTATOTATTATOTOTAG 3' ' ATAGAGTATATATGCTGTCT 3' ' GTATATAGTATAGTATTGGC 3* ' AflGATATATGATATGATTCGa 3' ' TACTATCATGTATATTACCC 3' ' CATTAAACGCGAGCTTTTTO 3' ' CTCCCATAATGCCCTAGCOG 3' ' GACGCACCGTACCCOGT 3' ' CACCAAAOGCATTGCATTCC 3' ' GTACATTCAGGCTGCCTGCC 3' ' TACCATCCCGTGGACGTAAC 3' ' QACTAAACGCATTGTGCCCC 3' ' AACGAAGGGCACGCCGGCTO 3' ' ACGGATGGTCTGGCTGGACA 3' Isolation Of Thrombin Aptamers Palno 30 DNA Containing B-Mathyl-2' -deoxy cyt idine -methyl-2' -deoxycyt idine triphosphate was obtained coemercially (Pharmacia, Cat. No. 27-4225-01) and used to syntheeize DNA containing random eequence· 60 base· in length flanked by primers 19 bases in length.

The pool of aptamer DNA 95 bases in length was used -125essentially as described In example 6. Thrombin immobilised on a Con-λ lectin column served as ths target as described.

Briefly, a 200 μί PCR reaction was set up 5 using: 10 mM Trls-KCl, pH 8.3 at 25° C, 1.5 mM MgClj, 80 mM NaCl and 200 μΜ of each of dATP, dOTP, dTTP and 5methyl-2'-deoxycytidine triphosphate. 20 μ& each of a33P-dATP and dOTP were added to label the DNA. 1 nmole of 5* and 3’ primer were added followed by addition of 0.2 pmole of 98-mer template pool DNA. Amplification wae initiated by addition of 2 μ& (10 U) of Tag polymerase followed by sealing of the reaction with a mineral oil overlay. About 16 cycles of amplification were performed followed by a 10 minute final extension to complete all duplex synthesis.

Amplified DNA wae recovered (100 μΣι aqueous phase), n-butanol extracted (650 μΧ>) and applied to a Nick column prewashed with I mL of buffo? containing 100 nM Tris-HCl pH 7.5 and 100 sM NaCl. Blutsd DNA was applied to λ 0.5 mL avidin agarose column prswashsd in ths same buffer and waehed until DNA loss from the column was < 1000 cpm. Single stranded DNA was eluted from ths avidin column by washing with 0.15 N NaCl and the eluate was neutralised to pH 7.0 using glacial acetic acid. Ihe 98-mer DNA was exchanged into aelectlon buffer on a second Nick column and, after heat denaturation for 3 min at 95° C followed by cooling on ice for 10 min, used in aptamer selection on thrombin lectin columns. 1 mL thrombin columns were equilibrated in selection buffer prior to addition of single-stranded DNA. Ihe singlestranded DNA was recirculated for three complete passes. Upon completion of the third pass the peak radioactive element was then applied to a 1 mL ConA/throobin column (charged with 3 nmoles of thrombin). Radioactive single35 stranded 98-mer was applied three times to thia matrix. •136· At the third application, the column wae stoppered and allowed to stand for 1 hr. The column was then washed with selection buffer and 0.S mL· aliquot fractions collected. A total wash volume of 6 mb was employed. At this time, 0.1 M α-methyl-mannoeide in selection buffer was then added, followed by a 4 mL· total volume wash. Thrombin enzymatic activity was detected via chromogenic substrate monitored by absorbance at 405 nm. Peak thrombin fractions were pooled, extracted with phenol, and the volume reduced by nfiuOB extraction. 20 μς glycogen was added, the single-stranded 98-mer precipitated via ethanol addition and pelleted via centrifugation. The pelleted DNA was resuspended in water and used as a template for PCR amplification. This protocol was repeated to obtain a pool of DNA that resulted from 5 rounds of select ion on thrombin columns.

Double-stranded DNA was digested with BcoRI and HinDlil and cloned into pGHM3S. Aptamers were then transformed into >. coll and analyzed by dideoxy aequencing. Round five aptamer pool dna bound to thrombin with a Xg of approximately 300 nM.

BBBpit 18 Demonstration of Aptamer Specificity for Binding 25 to and Inhibition, of Thronbin The specificity of aptamer binding was demonstrated using 33P radiolabeled DNA and a series of proteins. To determine the binding specificity of the thrombin aptamer, 96-mer done 829, having tha partial sequence 5'CQGGeAGAGGTTQGTGT9GTT9GCAATGGCTAGA0TA0TQAC GTTTTCGCGGTGAGGTCC 3' was used. The consensus sequence is shown underlined. Zn addition, a 21-mer aptamer, ' eGTTOGGCTOOTTGGGTTWJG 3' was tested for inhibition of another fibrinogen-cleaving enzyme ancrod, whieh was obtained commercially (Sigma, Cat. No. A-5043). The -12731-mer had a of Kz for throobin of about 100 nM and its Kp waa about 350 nM. Clone *39 had a Kp of about 200 nM for thrombin.

Ths aptamer was shown to specifically bind to 5 throobin by a filter binding assay. Briefly, radiolabeled aptamer DNA at about a concentration of about 1 nN was IncubAtsd with ths indicated protein for several minutee at room temperature, followed by filtration of the aptamer-protein mixture through a nitrocellulose filter. The filter was waehed with 3 mL of selection buffer and then radioactivity bound to the filters vas determined as a I of input radioactivity. Results obtained are shown in Table ll. Binding data is shown for both unselected 96-mer DNA and for two separate IS experiments with cions *29 96-mer. All proteins were tested at a ΙμΜ concentration except human serum albumin which was used ae 100 iM, The resulte that were obtained demonstrated that the 96-mer specifically bound to thrombin and had little affinity for moat of the other proteins tested. -128OUali 11 Protein input cpm Bound CEM % Bound Uaieloctod PMA Control Thrombin Prothrombin Albumin Chyaotrypsin 75573 74706 75366 76560 75566 230 6732 183 1851 225 0 9.0 <0.5 2.0 <0.5 10 Trypsin 73993 306 <0.5 Kallikrein 76066 122 <0.5 Plasmin 74513 3994 5.0 15 Clone 25.BMA Control 81280 126 0 Thrombin 81753 48160 59.0 Prothrombin 81580 8849 11.0 Albumin (100 μΜ) 85873 1778 2.0 Chymotrypsin 82953 207 <0.5 20 Trypsin 75673 318 <0.5 Kallikrein 84013 143 <0.5 Plasmin 82633 13323 15.0 TPA 81960 192 <0.5 25 ClflM 22, DMA Control 81886 917 0 Thrombin 82940 48796 59.0 Prothrombin 91760 8719 9.5 Albumin 92473 234 <0.5 30 Chymotrypsin 97060 186 <0.5 Trypsin 97846 429 <0.5 Kallikrein 95053 1275 <0.5 Plasmin 66565 9704 15.0 TPA 98166 644 «0.5 -129The thrombin 21-mer ancrod assay was conducted as follows. Ancrod was suspended in sterile water at a concentration of 44 U/mL. 10 gL ancrod solution was added to 95 ph of selection buffer prewarmed to 37*C. 100 ph of this mixture was transferred to the coagulation cup of the fibroma ter described above, followed by addition of 200 ph of fibrinogen and 20 ph of 21-mer dna (both prewarmed to 37C). TB buffer pH 7.0 was used as a control lacking DNA. Ths control clot time wae 25 seconds while the clot time in the presence of 500 nM 21mer was 24 seconds and was 26 seconds in the presence of 33 pH 2l»ner. This result demonstrated the specificity on inhibition of fibrinogen cleavage was limited to thrombin; ancrod was not affected.

Bxagpll 17 Thrombin Aptamer Pharmacokinetic Studies A 15-msr single-stranded deoxynucleotide, ' GGTTGOTOTOGTTGG 3*. Identified as a consensus sequence from 30 thrombin aptamer clones as described in Bxample 6 above, was used. Young adult rats of mixed gender and strain ware used. Ths animals wars anaesthetized and a diet ter of the 15-msr was injected through a catheter in 200 pi volumes (in 20 mM phosphate buffer, pH 7.4, 0.15 M NaCl) at two concentrations, so that the final concentration of 15-mer in the blood was about 0.5 and 5.0 pH respectively, although the exact concentration depends on the volume of distribution (which is unknown for this oligonucleotide). These values ars 10 to 100 time· greater than the human in vitro Kd value. No heparin vas used for catheterisation.

At 0, 5, 20 and 60 minutes, blood was withdrawn from the animals (approx. 500 pi aliquots), transferred into tubes containing 0.1 volume citrate buffer, and centrifuged. Rat plasma was removed and tested in a -130throobin clotting-time aseay. six animals wars used at each concentration, and three animals were injected with the control carrier solution containing no 15-msr, A prolonged clotting time was Observed at the 5 5 minute time point at both concentrations, with ths most significant prolongation occurring at ths higher dose concentration. Little or no activity was observed at 20 minutee. Thus, ths 15-mer in blood withdrawn from rats 5 minutes post-Inject ion was able to inhibit exogenously added human thrombin. A separate APTT test at the 5 minute time point showed that the 15-mer also inhibited rat blood coagulation, presumably by inhibiting rat thrombin to a significant degree. Ths half-life of the 15-mer in rata appears to bs about 5 minutes or leas.

Ifraapla IS Thrombin Antamar Primate Studies Two thrombin aptamers were administered to adult male cynomologous monkeys, uniubetltuted 15-mer DNA with the sequence 5' GGTTGGTOTGGTTQQ 3* and aa analog, S' QGTTGOTGTGOTtVg 3', containing thioate internucleotide linkages at ths indicated positions (·), were used. Aptamer was delivered as an Intravenous bolus or infusion and then blood samples were withdrawn at various times after delivery of ths bolus or during and after infusion. Ths catheter was hsparinissd after ths 10 minute timepoint. The animals were not systematically hsparinissd.

Thrombin inhibition was measured by a prothrombin time test (PT) using a commercially available kit, reagents and protocol (Sigma Diagnostics, St. Louis, catalog No·. T 0363 and 670-3). inhibition of thrombin was indicated by an increased clot time compared to the control in the PT test. Clot times were obtained by withdrawing a eaxqpls of blood, spinning out red cells and -131using the plate* In the PT teat. Control thrombin PT clot time valuta were obtained several minutes prior to administration of aptamer. Briefly, the PT assay was conducted using 0.1 mL of monkey plasma prevented to 37° c and 0.2 mL of a Xsi mixture of thromboplastin (used according to manufacturers instructions) and CaCla (25 mM), also prevented to 37®C. Thrombin clot times were measured with a fibrometer as described above.

Tha animal a wara at least two years old and 10 varied in weight from 4 to 6 kg. Doses of aptamer were adjusted for body weight. Aptamer DNA was dissolved in sterile 20 mM phosphate buffer [$A 7.4) at a concentration of 31.8 to 33.2 mg/mL and diluted in sterile physiological saline prior to delivery. Bolus Injections were administered to give a final concentration of 22*5 ag/Xg (1 animal) of the diester aptamer or 11.25 mg/Xg (1 animal) of the dleetar aptamer, infusions were administered over a 1 hour period to three groups of animals: (1) 0.5 mg/kg/min of diester 15-mer (4 animals), (ii) 0.1 mg/kg/min of diester 15-mer (2 animals) aad (iii) 0.5 mg/kg/min of thioate analog 15mer (2 animals).

PT assay results from the bolus injections showed thrombin inhibition times of 7.8, 3.3 aad 1.35 times control at 2.5, 5.0 and 10.0 min respectively after delivery of the aptamer for the high dose animal. Inhibition times of 5.6, 2.2 and 1.2 times control were obtained from the low dose animal at tha same time points.

Pigurs 2 shows s plot of ths PT times from the animals that received the high dose diester infusion oompared to pretreatmemt control values. Tbs data points show ths PT clot time as an average value obtained from the 4 animals in the group. The arrows Indicate time pointe at the beginning and end of the Infusion period. -132· Thrombin inhibition peaked at about 10 to 20 min after the infusion was Initiated and remained level until the infusion period waa terminated. Inhibitory activity decreased rapidly after ths infusion of aptamer terminated.

High doss diester and high dose thioate animals showed comparable inhibition of thrombin-mediated clotting, with ths high dose thioate giving a sustained clot time of 2.5 to 2.7 times the control value during the courae of tha infusion. The low dose diester compound gave a clot time of 1.4 to 1.5 times the control value. These results demonstrated the efficacy of the native and thioate analog aptamers in primates. fiC&JQBlULi Inhibition of Bxtracorpoyaaj Blood-Clotting By Thrombin Aptamer Anti coagulation of a hemodialysis filter was demonstrated using the 15-mer 5' GGTZGGTOTQGTTQO 3' thrombin aptamer with human blood, λ bolus of 15-mer DNA was delivered to human blood at 37*C to give an aptamer concentration of lOpM. The blood was contained in an extracorporeal hemodialysis circuit (Travenol, Model No. CA-90). Pressure proximal to the hemodialysis filter wae monitored to determine the time after administration of aptamer that coagulation occurred. Blood coagulation was marked by a pressure increase from about 50 sn Bg obeerved with uncoagulated blood (blood flow rate 200 mL/min) to pressure of at least 400 mm Bg.

Using untreated blood, coagulation occurred at about 9 minutes after fresh blood was placed in the hemodialysis unit and circulation was begun, λ heparin control (l U/mL) gave sustained anticoagulation until the experiment was terminated at 50 minutes after start of circulation in the unit. Blood coagulation occurred at SO >U3> minutaa in on· trial with the 15-mer. Zh a eecoad trial, coagulation did not occur.during tha 50 ninute course of th^ experiment.

Thus, method· fear obtaining aptamere that specifically bind eerua protein· such ae thrombin and Factor X, ei soeanoide, kinins such as bradykinin, and call surface ligands ara described, as well as the therapeutic · itility of these aptamers and tha uaa of tha aptamers in she dataction and isolation of such Although preferred embodiments of tha subject inveition have been described ln sane detail, it ia understood that obvious variations can be nada without departing frpm tha spirit and scope of tha appended claims.

I I. Proteins that ars not recognized to bind 4 1 X·' A». JExtragsimiar Profitin*i lipoprotein lipase lecithinlist-cholesterol aoyl transferase apolipoprotein A-l apoilpopribtelnli apolipcprf|gh,XV; . apollpoprratlh 8-41 apolipoprgtsln B-ioo ahF apolipoprotein CI apolipoprotein CII apolipoprotein CIII apolipoprotein 0 apolipoprotein £ insulin insulin-like growth factra I and II angiotensin I angiotensin II renin angiotensin converting snzyas atrial naturstio peptide iaaunoglobulin IgA constant region iaaunoglobulin Igd constant region iaaunoglobulin IgB constant region iaaunoglobulin IgM constant region iaaunoglobulin light chain kappa iaaunoglobulin light chain laabda iaaunoglobulin IgG Fo portion .^iaaunoglobulin IgM Fo portion •^iaaunoglobulin IgB Fo portion aayloid protein beta- aayloid protein aubstancs P lsu-onksphalln ast-snkophalin. soaatostatin interior*· ' interlev interlsi intern interlev inter lei interleukl interlouki interleukin® interleukin-i· .. s interleukin-11; interleukin-12 interleukin-13 colony stlaulating faotor-aaorophage ?Μ· f- ' TABLE 1/1 135 colony stimulating factor-granulocyte colony stimulating faotor-macrophage/granulocyte erythropoetin myelin basic protein earcinoembryonic antigen collagen type I collagen type IX collagen typq XZZ collagen typeiv collagen type v vitronectin fibrenactin fibrinogen albumin aminopeptidase amylaaa avidin B-cell growth factor Bence-Jones protein prothrombin thrombin tissue factor proaccelarin accalarin proconvertin antihemophiliac factor Christmas factor Stuart factor plasma thromboplastin antecedent Hageman factor Fibrin-atabiliBing factor prekallikrein high molecular weight klninogen bradykinln kinins calcitonin carboxypeptidasa λ carboxypaptidaaa B carboxypeptidasa C oatalase ceruloplai cholinesti chymotrypsl lipase amylase collagenase] complement complement pr< complement proteJ complement protein4 complement protein C2a complement protein C2b TABLB 1/2 136 complement protein C3 convertaee complement protein C3 complement protein C3b complement protein C4 complement protein c B-aaparagii epidermal grl fibrin flbrinopeptlde fibrinopeptide fllaggrin follicle-stimulating hormone follicle-stimulating -hormone releasing hormone r't’ ί TABLE 1/3 137 gastrin growth hormone glucagon lautinizing hormone lautinizing hormone releasing hormone human menopausal gonadotropin prolactin chorionic gonadotropin growth hormone releasing hormone hemosiderin placental lactogen inhibin kallikrein aold keritin vimsntin dasmin glial fibrillary acidic protein laukoklnin leupeptin luciferase melanin melanotropin melatonin melanotropin release inhibiting hormone mathemoglobin nerve growth factor oxytocin vaeoprasain neurophyein neurotensin beta-endorphin adrenorphin dynorphin alpha naoendorphin phospholipase A2 papain plasmin aeidic alphal glycoprotein alpha 1 lipoprotein alpha trypsin inhibitor betel lipoprotein heaopexln alpha 1 antitypsin transferrin. plasminogen _ platelet derived.«growth factor acidic fibroblast-growth factor basic fibroblast growth factor somatotropin release inhibiting hormone somatotropin releasing hormone superoxide diemutaee thymosin TABU 1/4 138 thyrotropin thyrotropin releasing hormone alpha fetoprotein tumor necrosis factor-alpha tumor necrosia factor-beta vasoaotiva intestinal opeptide von Willebrand factor tissue plasminogen activator gondatropin re leasing hormone parathyroid hormone antithrombin III protein C protein 8 activated protein C interferon alpha interferon beta interferon gamma ferritin haptoglobin Ail oncogene protein int-2 oncogene protein hit oncogene protein JU. Ceil .gurr ice Erpttlni CDla thymocyte call surface protein CDlb oortical thymocyte, dermal call surface protein CDlc oortical thymocyte cell surface protein C02 X rosette receptor CD3 ; T cell receptor complex CD4 τ helper/inducer cell surface protein CDS T cells, B call, call surface protein CD6 Fan Τ, B calls of CLL cell aurface protein CD7 T calls, NX call surface protein CDS T cytotoxic/auppreasor, NX call aurface protein CD9 Monocytes, Pre-B, platelet cell surface protein CD10 CALLA, Pre-B, granulocyte cell surface protein coils LFA-1 Alpha chain coilb Mao l (adhesion molecule) CD lie plSO-95 (adhesion molecule) CDwl2 Monocyte, granulocyte, platelet call aurface protein CD13 Pan myeloid (CA *4- mobilisation) cell aurface protein CD14 Monocyte cell surface protein CD15 Hapten X(fucoayl N aoetyllectosamina), granulocyte CD16 IgG Fo Receptor III, low affinity CDwl7 Lactocaramide CD18 β Chain of LFA-1, Mac 1, plSO-95 CD19 Fan B, cell surface protein CD20 B cells, dendritic reticular call aurface protein TABLE 1/5 139 CD21 CD22 CD23 CD 2 4 CD 2 5 CDS 6 CD27 CD28 CD 2 9 CD3O CD31 CD32 CD33 CD 3 4 CD 3 5 CD36 CD37 CD 3 8 CD39 CD40 CD41a CD41b CD42a CD42b CD43 CD44 CD45 CD45Ra CD45Rb CD45RO CD 4 6 CD47 CD48 CDv49a CDv49b CDV49O CDv49d CDW49e CDW49f CDV50 CD 51 CDV52 CD 5 3 CD54 CD 5 5 CD56 CD57 CD 5 8 CD 5 9 B calls, dendritic calls, CR2 (EBV Rc) Epstein Barr Virus Receptor B cell, cell surface protein IgE Fc Receptor lov affinity B cell, cell surface protein IL2 Receptor Dlpeptylpeptidase IV of activated T lymphocytes Mature T cell surface protein Tp44 Ag, T cells, plasma call surface protein VIA Beta chain Activation antigen Myeloid Ag. gplle Antigen IgG Fc Receptor Pan myeloid cell surface protein Lymphoid and myeloid precursor cell surface protein CRi, oranulocytes, monocytes, dendritic cell surface protein gpIV, thrombospondin receptor B call, cell surface protein BIT cells and plasmocyts cell surface protein B cells, macrophage·, endothelial cell surface protein B cells, B lymphocytes carcinoma (BLca) call aurfacs protein gpIIb/IIIa gpllb gpIX gplb T cells, granulocytes, RBC, cell surface protein T cells, pre-B, granulocytes, cell surface protein Leukocyte common antigen (LCA) Restricted LCA, subset of CD4 * T cells Leukocyte cell surface protein Restricted LCA Membrane Cofactor Protein (MCP) M-linked glycan Leukocytes (Pi-PLC linked) ax VLA chain gplalle, <2 VLA olain, collagen receptor a3 VLA chain a4 VLA chain gplc, aB VLA chain gplolla, ae VLA chain, laminin receptor Leukocyte cell surface protein a chain vitronectin Ro (VNR) receptor Campath-x, leukocyte cell surface protein Leukocyte oell surface protein ICAK-X (Intracellular Adhesion Molecule), leukocytes DAF (Decay Accelerating Factor) N-CAM (NXH-1), Adhesion Molecule HNKl, Natural Killer cell surface protein Leukocyte functional antigen cell aurface protein Leukocyte cell surface protein TABLE 1/6 0 CDv60 Neu AC-Nau Gal, τ lymphocyte· lubsat cd 61 gpXZZa, VNR β chain, Xntagrin CD62 GXP-140 (PADCEM) CDS3 Activated platelet call surface protein CD64 Fc receptor, monocytes C0w65 Fucogangliosida 0966 Granulocyte call surface protein CD67 ... Granulocyte (FZ linked) cell surface protein CD68 - Macrophage, cell surface protein CD69 _ Activation Inducer Molecule cdv70 Activated BA T calls, Reed Sternberg cell, cell surface protein CD71 Transferrin receptor CD72 Pan B cell surface protein CO73 Sotc5'Nucleotidase CD74 Class ΣΖ associated invariant chain CDw75 Mature B cell surface protein CD76 Mature B cells, T cell subset, granulocyte cell surface protein CD77 Globotrioasylceramide (Gb3), Burkitt's lymphoma cell surface protein CDw78 Pan B (monocyte) cell surface protein HISTOCOMPATIBILITY ANTIGENS (cell surface) HLA-A1, HLA-A2, HLA-A3, HLA-All, HLA-A23(9), KLA-A24(9), HLA-A25(10), HLA-A26(10), ΗΙΛ-Α29 (Vl9), HLA-A3O(W19), KLA-A31 (V19), HLA-A32(wl9), HLA-A33(wl9), HLA-AW34(10), HLA-AW36, HLA-AW43, HLA-Av66(10), HLA-AW68(28), HLA-AW69(28), HLA-AW74(V19), HLA-Bw4(4a), HLA-Bw6(4b), HLA-B7, HLA-B8, HLA-B13, HLA-B18, HLA-B27, HLA-B35, HLA-B37, HLA-B38(16), HLA-B39(16), HLA-&V41, HLA-BV42, HLA-B44(12), HLA-B45(12), HLA-BW46, HLA-BV47, HLA-&V48, HLA-B49(21), HLA-BvBO(21,, HLA-BSl(S), HLA-BwS2(S), HLA-BV83, HLA-BV54(22), KLA-Bw33(22), HXA-Bw56(22), HLA-BV57(17,, KLA-BW58(1?), HLA-BVS9, HLA-Bw60(40), HXA-Bv61(40), HLA-Bw 62(15), HLA-Bv63 (15), KLA-BW64(14), HLA-BW65(14), HLA-BV67, HLA-BW71(70), HLA-Bv72{70), HLA-BW73, HLA-BW75(15,, HLA-BW76(15), HLA-BV77 (15) HLA-Cwl, HLA-CW2, HLA-CW3, HLA-CV4, HLA-CvS, HLA-CW6, HLA-CW7, HIA-CV«,fKlA-Cv9(3), HLA-CW1O(3), HLA-Cwll, HLA-Dwl, HLA-DW2, KLA-bw3>r^LA-Dw4, ΉΑ-DWS, ΗΖΛ-DvS, HLA-DV9, HLA-DvlO, HLK-Dwll (7),. W&Bm} HLA-DW13, HLA-DW14, HLA-DwlS, HLA-DW16, KLA-DW17 (7) , #ΣΑ3ξΗ·(ν«) , HLA-DW19 (w6), HLA-Dw20, HLA-DV21, HLA-DW22, HLArJ^^^HU-0v24, KLA-Dv25, RLA-DW28, HLA-DR1, HLA-DR2, HLA-DMlj$Sf-DR4, HLX-DR5, HLA-DRV6, RLA-DR7, HLA-DRV8, HLA-DR9, HLA-DRvlb?£toA-DRvll(5), HLA-DRW12(5), HLA-DRW13(6), HLA-DRV14(«) , HLA-PRN15(2) , HLA-DRW 16(2), HLA-DRW17(3), HLA-DRWH (3,, HLA-DRw52, HLA-DRw53, HLA-DQwl, HLA-DQW2, HLA-DQw3, HLA-DQW4, HLA-DQW5 (wl)_, HLA-DQV6 (Wl) , HLA-DQW7 (w3 ) , HLA-DQW8 (W3), HZA-DQV9(W3), HLA-DPwl, HXA-DPV2, HLA-DPwS, HLA-DPW4, HLA-DPW5, KLA-DPW6 TABUS 1/7 t 4 1 Insulin receptor HRR2 Zneulin-like orowth factor receptor Sodium/pot a·· Ium ATPaae Sodium/chloride ^transporter ΣΧ.-1 receptor I L-3 receptor il-4 receptor Parathyroid hormone receptor CnRH receptor Csr-K receptor CSF-GM receptor CSF-G receptor Erythropoetin receptor Complement receptor Clb receptor EGF receptor Follicle stimulating hormone receptor Follicle stimulating hormone releasing hormone receptor Growth hormone receptor Glucagon receptor Leut inis ing hormone receptor Leutinising hormone releasing hormone receptor Growth hormone releasing hormone receptor Nerve growth faotor receptor Melanotropin release inhibiting hormone receptor Platelet derived growth faotor receptor Fibroblast growth factor receptor Somatotropin releaae inhibiting hormone receptor Somatotropin releasing hormone receptor Thyrotropin receptor Thyrotropin releasing hormone receptor Tumor necrosis factor - alpha receptor Tumor necrosis factor - beta receptor complement C3a receptor Complement CSa receptor complement C3b receptor Complement CR2 receptor Complement CR3 receptor erb-B oncogene ^protein . HBBziZnitt oncogen^'· protein oncogene ptartin* . , C, virus Targets HIV-X/HIV-a 1. reverse transcriptase (including RNAse H) 2. protease \ 3. Integrate TABLE 1/8 4. gag protein· (including pl7,p24, plS) . tat protein 6. rev protein 7. nsf protein ·. vif protein 9. vpr protein . vpu protein 11. envelope protein· (including gp 120, gp4i, HTLV-X/XX 1. gag proteins (including gp24, gpl9, gpl5) 2. protean· 3. pol (including revere· trasncriptass and RNAse H) 4. envelope ganas (including gp46 and gp4i) . tax 6. rex Hunan papillomavirus·· 1. 17 protein 2. Εβ protein 3» EO· protein 4. B4 protein 3. ll proteins 0. E1-S4 proteins 7. E2 proteins ·. capsid proteins (Ll and L2) 9. associated cellular proteinst pRB (retinoblastoma gene product), p53 Influence A and B 1. polymerase proteins (including PA, PB1, end PB2) 2. hemagglutinin (KA) 3. neuraminidase (NA) 4. nuoleoprotein (NP) . Ml and K2 proteins β. N81 end NB2 proteins Hepatitis B 1. Envelops (surfsee antigen? proteins (including pre-Sl, pre-82 and 8) 2. Nuclaocapeld (oora) proteins 2. P-gene product 4. X-gane product, Cyto»«galovirui£t£,1. Immediate •ably'’*(alpha) gene products (Including Hl and XE2) 3. Early (beta)gene products (including DNA pol pi40, DBPS2 EDBP 140) 3. Lata (gamma) structural gene products TABLE 1/9 3 Herpes Simplex Virus l. thymidine kinase 3. ribonucleotide reductase 3. true-encoded envelope glycoproteins Bpsteln-Barr Virus 1. immediate early gene products (including ZLF1 protein and RLF1 protein) 2. early gans products (including SMLF1, MRF1, ALF2, HRFi, ribonucleotide reductase, thymidine kinase (XLF1) 3. virus-encoded glycoproteins Cell-Surface Virus Receptor·: 1. HIV-l: CD4 2. Spetein-Barr virus: C3d complement receptor 3. human rhinovirua: Intercellular adhesion molecule-1 (1CAM-1) D. Intracellular Targets (proteine, lipid·, etc.) 1. Lipids lipids fatty aolda glycerides glycsrylsthsrs phospholipids sphingollpids terpenes steroids fat soluble vitamins glyoolipid phospholipids lecithins phoephatldlc acids (cephallns) sphingomyelin plasmalogena phosphatidyl inositol phosphatidyl choline phosphat idyl serene phosphatidylinositol diphoephatldyl glycerol fatty adds oleic acid palmitic acid stearic acid linolsic acid acylcoensyma λ TABLZ 1/10 1 phoephoglycerid· phoephitidata retinoic acid retinoids lipoprotein λ proteollpld sphingoliplds spbinqosine ceramides oerebroeldes ganclioaides sphingomyelins terpenes sesquiterpenes diterpenes triterpenes tetraterpene· steroids cholesterol cholic acid phosphatidylcholine estrogen testosterone androgens lipopolysaccharides (from gram negative or gram positive baoterla) 2-kato-3-deoxyoctanoate 2. Intracellular proteins methemoglobln hemoglobin A hemoglobin Al hemoglobin Λ2 hemoglobin Barcelona hemoglobin Berts hemoglobin Bath Israel hemoglobin BunburyV^ hemoglobin Cochih^ort Royal hemoglobin Covtown^;. hemoglobin Craheton ' · hemoglobin creteil;.· hemoglobin 0 hemoglobin D-Loe Angeles , hemoglobin D-Punjab hemoglobin F x , hemoglobin Cower TABLE 1/11 145 heaoglobin heaoglobin heaoglobin heaoglobin heaoglobin heaoglobin heaoglobin heaoglobin heaoglobin heaoglobin heaoglobin heaoglobin heaoglobin heaoglobin heaoglobin heaoglobin heaoglobin heaoglobin heaoglobin heaoglobin heaoglobin heaoglobin heaoglobin heaoglobin heaoglobin heaoglobin heaoglobin Kaaaersaith Kiroshiaa Indianapolis Kansas Xariya Xeapsey Kenya Lepors x X Hyde Park K Ivats x Saskatoon Nancy Phllly Quong Szs Ranier Raleigh S Sealy Seattle St. Louis St. Nands Titusville Torino Nayns York Zurich lEfl oncogens protein ftfcl oncogene protein XU oncogene protein Bit oncogens protein Ha-ras oncogene protein Kl-raa oncogene protein N-ras oncogene protein ifil onoogene protein noe oncogene protein oncogens protein piB oncogens protein SEh oncogens protein ftbl oncogens protein rel oncogens protein XU oncogens protein fgr oncogens protein trk oncogens, protein. L-ayc oncogens protein lnt-1 oncogens protein 111 oncogens protein roe oncogens protein oncogens protein TABLI 1 /12 6 l-acylglycerol-3-phoephate acyltransferaae 3-hydroxybutyrate dehydrogenase 3-ketothiolase acetyl glusosaminyl transferase acetyl spermine deactylase acetyl transacylase acetyl-CoA maleate citrate synthase acetyl-CoA-carboxylase add phosphatase actin adenosine deaminase adenosylhomocysteine hydrolase adenosylmethionine decarboxylase Alanine aminotransferase alcohol dehydrogenase aldolase aldose reductase alkaline phosphatase amelogenin amyloid b/A4 protein amyloid precursor protein arginase argininosucdnate lyase arginlnosucdnate synthetase aromatase aspartate aminotransferase ATPase b-ketoacyl-ACP reductase b-ketoacyl-ACP sythetase calmodulin cAMP phosphodiesterase carbamoyl-phosphate synthetase carbonic anhydrase carbonic anhydrase catechol methyltransferase cytochrome C peroxidase cytochrome P450 < cytosine methyl, transferase v*· ·>· * · * -ί·'*.; diacylglycerol acyltransferaae dlhydrofolate reductase endotoxin enolaae enoyl-ACP hydratase enoyl-ACP reductase Fatty Acid Synthesis Table 1/13 fructose bisphosphate aldolase GABA aminotransferase gelsolin glucophosphste isomerase glutaminase glycerol phosphate acyl transferase glycerol phosphate ddiydrogenase glydnamide ribonucleotide transfomylaae heavy meromyosin hexokinaae histidine decarboxylase hydroxy acyl CoA dehydrogenase hydroxy steriod dehydrogenase hydroxy-methylglutaryl CoA cleavage enzyme hydroxy-methylglutaryl CoA reductase hydroxy-methylglutaryl CoA sythetase inositol phosphate inositol phosphate phosphatase Isodtrate lyase lactate dehydrogenase leukocyte elastase lipoxygenase long chain fatty add CoA ligase malonyl transacylase mannosidase Methionine adenosyltransferaae myristoyltransferase ornithine carbamoyltransferase ornithine decarboxylase P-glycoprotein phenylalanine hydroxylase phosphaddate phosphatase phosphoenol pyruvate carboxykinase phosphofructokinase phosphoglucokinasa phoaphoglucomutase phoaphoglycerate kinase phosphoglyceromutate phospholipase A2Piotein kinase C pyruvate dehydrogenase pyruvate kinase serine/threonine kinase spermine synthase squalene epoxidaae tartrate dehydrogenase Table 1/14 8 thioesterase thromboxane A2 synthetase transacylase triosephosphate dehyrogenase triosephosphate isomerase troposmyrin tryptophan synthase tyrosine kinase urokinase type plasminogen activator Vitamin K reductase Table 1/15 J9 £« Small molecule· histamine serotonin leukotrienes platelet-activating factor prostaglandin D2 eosinophil chemotactic factor of anaaphyaxis-A intermediate molecular weight eosinophil chemotactic factor of anaphyaxls-A leukotriene C4 leukotriene D4 slow-reacting substance of anaphylaxis leukotriene Θ4 thromboxane A2 thromboxane B2 arachidonic acid acetylcholine choline carnitine muacarin carbachol methocholine pilocarpine arecollne oxotremorlne atropine scopolamine benztropine qulnuclldinylbromlde plrenxiplne nicotine carbachol arecollne suberyldicholine pancuronium alpha-bungarotoxln hemlchollne neostigmine physostigmine botuilnum toxin diptheria toxin acetyl-coenzyme A tetrahydrofoltc acid Table 1/16 150 adenine adenosine adenylate cyclase anti-diuretic hormone pregnenolone progesterone corticosterone aldosterone 17-hydroxyprogesterone cortisone epinephrine aflatoxin G1 aflatoxin M1 aflatoxin 01 pyrrolidine pyrrolizidine tropane piperidine quinpliztdine indole rutaceae terpene ellantoin ailodeoxycholic acid deoxycholic acid amiloride L-alanine L-arginine L-asparagins L-aspartie acid L-cyateine L-glutamic add L-glutamlne glycine L-histidine L-isoleucInt L-leucine L-lyslne Lmethionine L-phenylalanine L-prollne L-serine L-threonlne Table 1/17 L-tryptophant L-tyrosine L-valine aminopterin amylopectin amylose testosterone delta4-androatenedlone 5alpha-dihydroteeto8terone antipyrine arachldlo acid chorlsmlc acid dopamine norepinephrine L-aepartic acid l-azoeerine bacitracines p-benzoqulnone 6-benzylamlnopurine betamethazone bilirubin blllverdin biotin luoiferin beta-caratine carbollne carnitine alpha-carotin e gamma-carotene cholesterol cocaine codeine NAD NADP FNN FAD K CoenxymeQ llpole add cytochrome ferrodoxin thloredoxln pyrldoxal phosphate coenzyme A Table 1 /18 152 coumarin creatine cyanocobalamin Table 1/19 nuuxuAU»ttA imnpQunait 2rphoephOglyantf MtvdroxyBcyKoA 3-phofpho^pyTophoiphom«ralonata 3^hoiphedy«nt» s-phoq^honydioxypynivai· S-phoephoaortne T^prUrwATUIvViVwftVnXI· -afcresMal·TlVfcjb—J» 9*DvIOSWB0®vWW*s*OQV>MbBIUIS -phoephorlboayl 1-pyrophoaphata -phoa^alpha-riboayl-l-pyropho P^hoiphoribotjM^iifcoxanddo^-amlnofoidazole S-baisytaadnopuHM 17-hydroxyprofirtfront aottomlnophen acttytaoeuymt A acetylcholine aeetylsaUcyUcadd adonine adenosine ADP aflatadn BI aflatodnGl aflaksdn Ml aldosterone aUtatola aBodeocycfcolic add aUopurinol alpha ketoglutafshi alpha^etedlhydroxy^beta-methylvaltrata alpha*actto-aiphabungarotoxbi alpha-carodna dpha4ceto*feeia-methyhralerite alpha-ketofluterata alpfea'krtotiitjmto alphadBetagliitirftftt anUoride amlnooterin AMP amylopeedn amtioie antl«diuretU hormone antfpydne Table 1/20 4 aradtidfcadd anchidonlc tTtfiftMftC arginine argiitlnotuecunitate aaoocblcadd aspartate atmltldehyde ttgutyl phosphate atropine bedtredne tia··! i j___1__ PnSuOJwH betfrcaratae betamethazone bilirubin btiiwdln Mota botutaua Mn caibachol carbamoyl phosphate carboUne carnitine GDP cholesterol cholic add dtodnlc dsaoonHato citrate dtrulline CMF cocaine WWHW codeine CoanaymaQ coenzyme A cortisol COttflOBC coumarin craatai I creatinine OT cyanooobaleadn cydleAMP cydfcCMP cydicGMP cyclic TMP Table 1/21 155 cystathionine cytfdhw cytochrome O-Brythrose D-Pruitow D-Galactosamine D-«tucoee OGluciuunic add dADP dAMP dATP dCTP dttte^sndrostonedlone deoxyadenosyl cobalamin deoKVehottcsdd dQDP dQTP dihydroorotats d&i ' lycsrate diptheria toxin dopamine dTDP dTMP dTTP dUDP dUMP dUTP eosinophil chemotactic factor of anaaphyads-A tptae^hrlnt estrone fornesyl pyrophosphate fatty acyf+CoA terodoxin PMN FMNH; folic arid fructoee 2>dlphotphato fructose fructose l>dtphosphate Table 1/22 156 fructose 6-phoiphate Fructosel/dlphosphate fumarate gsladose GalNAc gama-aminoltvuilnite gamma-carotene gastric inhibitory protein eemtidfaoecotate gwauKMcm» gentamydn glucosamine glucosamine 6-phosphate glucose glucose M’dlphotphaie glucose l-phcephate glucose 6-pfcosphite Glutamate glutamate semialdshyde glutaryt-CoA glutathione glycsraldehvde phosphate glycerol 1-pnocphats glychochoiata glydne dyocylate GMP CTP guanine hemlcholtne histamine homogendsate hoaaoeerlne hydrocortisone hydroacyproline Indole laoeine Inositol inositol phosphate Intermediate molecular weight sosinophfl chemotactic factor of lsodmie leopentenyl pyrophosphate L-alanine L-arginine L-aspsngiM Table 1/23 157 Veiperifetdd Vqrttetne V-PUCQM Lfluttmic add L-glutamine L-hlatldlne L-Uotoudne L-leudne Ldyrine L-malate L-methloalne L-phenylalanine VpraUne L-eerine L4hreonlne Utryptophane L-tmdne L-valine Unoeterol leukotriene 84 leukotriene C4 leukotriene D4 leukotrienei Upoleedd ludferin malonate malonyl-CeA methochoUne methotrexate methylenetetrahydrofoUte methylmalonyl>CoA mevelonate mevitoniM'phofphAfte mueearln N-Formylmethlonine NAD NADH NADF NADTK neostigmine nicotinamide nicotine nicotinic add norepinephrine Tnhla 1/24 158 ortaithiae eaotnmorine p-bensoquinone paacuroaium pantothenic add phoephenoipyruvate phoephocreatlalne rimoMiaalM pQocupme piperiatne ptrauefaine piaatoquiaona platalcbacdvatlng factor porphobilinogen pregnenolone progesterone proUnamide propionyi*CoA prostaglandin D2 punopoappyvBi IA pteridino pyridoxal pyrldoxal phoephate pyridoxal phoephate pyrtdoxamlne pyrfctaaatae phoaphata pyrodoxtoe pyngtutaafc add pyrophosphate pyrrolidine pyrrdUae>0Caiboxylat· pyrtottddine otdaolitidiae qulaudidinyibromlde «ODpeptlde dbofianM f**sdsaosyihoiBocyitslns wdeaoeylmethtonine acopotaadM serotonin atow*ract!flg substance of anaphylaxis > squalene •uberyldlchoUne Table 1/25 159 MCdnete sucdnyi-CoA eucctartCOA UurocnoUfte Mnhydrofolfcadd thiamine thloredoxln thromboxane AZ thromboxane BZ thymine trcpane uhiqulnol ubiquinone UDP UDPgalactoae UMP uracil urea uric add UTP vitamin A vitamin D vitamin I vitamin K INTRACELLULAR PROTON USTi l-acylfiyoerol-^ptoiphate wyttranateiM 9-b*hydrox^ -steroid dahydrogenase(BC53J,D 9-hydromutyrate dehydrogenase 3 hetothioltm P-nudeotldaee eoxoguanodne dedycosylaM tlMwdroxyiaseiici.lUM) ZHimd nydroxyUseOC U4J9.1Q) RB-cxddosquilsae lanosterol cydase HZRehireliuductM· e-actln fmennoaldam «•meiqgenln a-tubufln Table 1/26 160 •cetolactate synthase •cetyl (hisaeamlftyl transferase acetyl spermine deadyiase imtyl transacylase acetyi-CoA carboxylase acetyt-CoA maleate dtrate synthase add phoephatase OGW mvwIII aconites· actin adenosine deaminase adenoeythomocysteta· hydrolase adenosylmethionine decarboxylase adenylate cydaM adenylate deaminase adenylate kinase edenybucdntte lyase adsnyisuodnate synthase alanine aminotransferase alcohol dehydrogenase aldolase aldose reductase alkaline phosphatase amldophos phoribosytamfae transferase AMP phosphodiesterase amyloid b/A4 protein snyioia pracunor proem ankarin ttglnaae aigialnoBuednate lyase afftafoosuodnate synthetase aromatase nytwttfttsae asjartafte amisotransfsrtM aspartate transcarbamoylase AW diphoophehydrolase ATPase Mate b-gjucurorddaae KaSeqfiSSwactest bkatoacp AGPsythetasa bspedrte Mropomyoete Mubulta C5a inactivation factor Table 1/27 1 celcttoto calmodulin eetoelnl cauetieulin cerbemoyl-phoiphate tynthetme carbonic anhydrase CtMfaU&Mtl OMtatilUMl catelaee catcchot methyitranafenae cathepain CftthmiB B and L cdcBpM cdclO cdclBptt cdeSSpBO ehaparonln cholera toxin ctoleeterol tetaraae choieeterol monooxygenase dtnto synthetase dathrin ooUiftn collagtnate emecttve tissue activating peptide core protein eeraeoi QonyBrDgenue cydinAanaB cydoehilin cytidine deesdnese cytfdylete deasdneee cytoauomeC peroxidase cytochrome W80 cytoeine methyl tranateue defends diacyigfycerol acdtranateaae d&ydrarolaic reductaee dlhydrainedl ddiydrogenaee dOtytooroteteie dmyroorotate dehydroBmaee (feminist dtetherte tods dopamine monooxygenase dynenin eueteae elaatln Table 1/28 162 elongation factor Tu —*40-*** tt enoleee sooyl-ACT hydratiM enoyl-ACF reductase fatty add synthetase fmdoidA fructose Usphosphate aldolsae femarase GABA aminotransferase gShioophoephate isomerase ghicoeyiceramide galactosyl transferase* giutaminaie glutamine phosphoribosylpyrophofphate amidotransferase glycerol phosphate acyl transferase glycerol phosphate dehydrogenase gtydnandda ribonucleotide transfomylese GTF binding protein heavy maromyoeln hexokliuiso hlstaminaso histidine decarboxylase H8P27 hydropyrimidine hydrolase hydroxy acyl CoA dehydrogenise hydroxy steriod dehydrogenase hydroxy«methytglutaryl CoA cleavage enzyme hydroxy-methylglutaryl CoA reductase i hydro^Mnethy$btaryl CoA eythetase » hmKantttine-guanine phosphorites yl .transferase Ddr dehydrogenase Indole lyme Inositol phosphate phosphatase ieodtrato lyeet ktnin generating mzyme lactate dehydroganaae laminin leukocyte elistase Upocortin SqfcSSrinfetty add CoA ligase Table 1/29 163 iyeocyme mator hade protein malate dehydrogenase malate synthase malonyl tranaacyiaae methionine adenoeytoansferase mixed funedon oxygenase mylopmotddase myonhunent mynstoyUranafarsM Needy!ducuronidaae Na/KATPam NAIMepaadent stool 4-carboxylaae NAOase NADffi-dependent 3*oxostoold reductase nexin nudeolar protein B2B nudeosld* diphosphate kinase ornithine amlnotranafsrtM ornithine carbamoyltransferase ornithine decarboxylase orotate decarboxylase csotete phoephcrfbosyl transferase pcpouyi prom nomerase pepddrianridogtycolate lyase phenylalanine hydroxylase phosphaddate phosphatase phosphoenoi pyruvate caxboxyklnaas phoephofructoUnise phosphogluwUBets phosphogittco&sutase phoepteglyearate Unass phoephemyceromutase phospho&peee Al phonholfaMSsC MomdmssGGI otamciSassD Γζ***>7 jr..... phoephortbomutaec phoephorfboeyiphosphate transferase ptaeadnofM sdhratcr inhibitor porin plb renttaabiaatoma gens product Table 1/30 4 properidin prottoglandin synthase rrotrin Unas* C purine nucleoside phosphorylass pyruvate dehydrogenate pyruvate Unaae rfiMDudeodde reductase I ribosephosphate pyrophosphate Unaae f ricin tropoeUtda sarine/montae Unite spectrin spermine synthase •qualm aporidise equaleae monooxygenase sterol metfeyltansreraae MslpU succinyl CoA synthetase superade dlsmutase tartrate dehydrogenase ddoestense thloredoxin thrombospondin thromboxane A2 synthetase thysddylate synthetase transacylase triosepnosphats dehyrogenase trioeephoephate Isomerase tRNA syn&etase tropomyosin tryptophan synthase tubulin tyrosine Unaae uMoquinone reductase uridine monophosphate kinase uroUnase type plasminogen activator vitamin K reductase Ml ·1 BMM ttOdtttfc xauhtae dehydrogenase xanthine oidaaee xyleeyl tranateaee

Claims (79)

1. We claim:

1. A single-etranded DNA aptamer containing at 5 least one binding region capable of binding specifically to a target molecule.

2. An aptamer containing at least one binding region capable of binding specifically to a target 10 molecule vlth a dissociation constant (Kd) of less than

3. An aptamer containing at least one binding region capable of binding specifically to a target 15 molecule, wherein the Kd with respect to the aptamer and said target molecule is less by a factor of at least 10, as compared to the Kd for said aptamer and other unrelated molecules. 20

4. An aptamer containing at leaet one binding region capable of binding specifically to a target molecule wherein said binding region contains less than 14 nucleotide residues. 25 B. An aptamer containing at least one binding region capable of binding specifically to a target molecule wherein eaid aptamer contains less than 15 nucleotide residues. 30 C. An aptamer containing at least one binding region capable of binding specifically to a target molecule selected from the group consisting of: bradykinin, PGP2e, CD4, HSR2, IL-1 receptor, Factor X, and thrombin. « π ο 7. The aptamer of claims 1-5 wherein the target molecule exhibits one or more biological functions.

5. 8. The aptamer of claim 7 wherein the target molecule does not exhibit the biological function of binding nucleic acids.

6. 9. The aptamer of claim 1-5 «herein the target

7. 10 molecule ia a protein or peptide. 10. The aptamer of claim 9 wherein the target molecule is an extracellular protein. 15

8. 11. The aptamer of claim 10 wherein the extracellular protein is selected from the group coneieting of collagenase, tumor neerosie factor, antithrombin III, and interleukins. 20

9. 12. The aptamer of claim 9 wherein the target molecule ie an intracellular protein.

10. 13. The aptamer of claim 12 wherein the intracellular protein is selected from the group 25 consisting of oncogens proteins, endotoxin and dihydrofolate reductase.

11. 14. The aptsmer of claim 9 wherein the target molecule ie a cell surface protein.

12. 15. The aptamer of claim 14 wherein ths cell surface protein is selected from the group consisting of HLA antigens, tumor necrosis factor receptors, and BOP receptor. It 920562 —' 167

13. 16. The aptamer of claim 9 wherein the target molecule is a glycoprotein.

14. 17. The aptaaer of claims 1-5 wherein the 5 target molecule is a carbohydrate.

15. 18. The aptamer of claim 17 wherein the carbohydrate is a selected from the group consisting of monosaccharide, disaccharide, polysaccharide, or is a 10 glucosaminoglycan or fragment thereof.

16. 19. The aptamer of claims 1-5 wherein tha target molecule is a lipid. 15 20. The aptamer of claim 19 wherein the lipid is a glycolipid. 21. The aptamer of claim 19 wherein the lipid is a cholesterol, steroid, or triglyceride. 22. The aptamer of claims 1-5 wherein the target molecule is a small molecule selected from the group consisting of α-bungarotoxin, botulinum toxin and diphtheria toxin. 23. The aptamer of claims 1-5 wherein the target molecule has a molecular weight from about 200 to about 1000 daltons. 30 24. The aptamer of claims 1*5 wherein the target molecule has a molecular weight from about 10 3 to about IO 4 daltons. 25. The aptamer of claims 1-5 wherein ths target molecule hae a molecular weight from about 10* to about 10* daltone. 5 26. The aptamer of claims 1-6 which contains a binding region of less than 14 nucleotide residues. 27. The aptamer of claims 1-6 which contain* a binding region of less than 6 nucleotide residues. 28. The aptamer of claims 1-4 or 6 which contains 6-100 nucleotide residues. 29. The aptamer of claims 1-4 or 6 which 15 contains 6-50 nucleotide residues. 30. The aptamer of claims 1-29 wherein said aptamer is capable of binding specifically to a target molecule at physiological conditions. 31. The single-stranded DNA aptamer of claims 1-30 wherein eaid aptamer binds to said target with a Kd of less than 10'*. 25 32. The aptamer of claim 31 wherein said aptamer binds to tha target with a Kd of lees than 10* 3 at physiological conditions. 33. The aptamer of claims 1-32 wherein ths Kd 30 with respect to the aptamer and said target molecule is less by a factor of at least 10, as compared to the Kd for eaid aptamer and other unrelated molecules. 169 34. The aptamer of elaime 1-33 wherein the aptamer contains at least one modified linking group, sugar residue and/or base. 5 35. The aptamer of claia 34 wherein the aptamer contains at leaet one linking group wherein P(0)0 is replaced by P(0)8, P(S)5, PfOJNRj, P(O)R, p(0)0R', CO or CHg, wherein each R or R* ie independently H or substituted or uneubatituted alkyl 10 (1-200 optionally containing an ether (-0-) linkage, aryl, alkenyl, cycloalkyl, cycloalkenyl or aralkyl; or the aptamer contains at least one linking group attached to an adjacent nucleotide through S or N; or the aptamer eontaine at leaet one modified form 15 of purine or pyrimidine or at leaet one abaelc site. 36. The aptamer of claim 35 which contains at least one linking group wherein P(0)0 ls replaced by P(0)8 and eaid linking group le attached to each adjacent

17. 20 nucleotide through 0; or which contains at least one linking group wherein P(0)0 le replaced by P(O)NH (CHgCHgOCHj) and said linking group is attached to each adjacent nucleotide through 0; or contains at least one uracil (dU) base substituted for thymine; or contains

18. 25 at least one abaelc site; or contains at least one 5peatynyluracil base eubetituted for thymine, or contains ae least one modified or analogous sugar other than ribose.

19. 30 37. The aptamer of claims 1-36 which le a secondary aptamer. 38. λ method for obtaining an aptamer containing at leaet one binding region that epecifically

20. 35 binds a target, which method comprises: 17 0 (a) Incubating said target vith a mixture of member ollgonucleotidee under conditions wherein the target complexes with some, but not all, members of the mixture to form oligonucleotide-target complexes; (b) separating the oligonucleotide-target complexes from uncomplexed oligonucleotides; (c) recovering and amplifying the complexed ollgonucleotidee from said complexes to obtain an aptamer; and (d) optionally determining the sequence of the recovered aptamer, wherein said aptamer ie a single-stranded DMA, or wherein said aptamer containe at leaet one binding region capable of binding specifically to e target molecule with a dissociation constant (Kd) of less than 10‘ 9 , or wherein eaid aptamer containe at least one binding region capable of binding epeclfically to a target molecule, wherein the Kd with respect to the aptamer and aaid target molecule le lese by a factor of at least 10, as compared to the Kd for said aptamer and other molecules, or wherein eaid aptamer containe at leaet one binding region capable of binding specifically to a target molecule wherein eaid binding region containe lees than 14 nucleotide residues, or wherein eaid aptamer containe at leaet one binding region capable of binding specifically to a target molecule wherein said aptamer containe lees than 1C nucleotide residues, or K wherein eaid aptamer contains at least one binding region capable ot binding epeolflcally to a target molecule selected from the group consist ing of exenplified targets. 171

21. 39. The method of claim 38 wherein aaid mixture of oligonucleotide· contain· at least on· modified oligonucleotide.

22. 40. The method of claim 39 wherein eaid amplifying is conducted using at least one modified nucleotide. 10

23. 41. The method of claims 38-40 wherein said mixture of oligonucleotides contains at least one randomized-sequence region.

24. 42. The method of claims 38-41 whieh further IS includes repeating steps (a) · (o) using ths recovered and amplified complexed oligonucleotides resulting from step (c) in succssding step (a).

25. 43. Tha method of claims 38-42 wherein the Xd 20 with respect to ths oligonucleotide mixture and target le at least 50-fold mors than the Xd with respect to the aptamer and target.

26. 44. An aptamer prepared by the method of 25 claims 38-43.

27. 45. A method to obtain a secondary aptamer that epecifically binds to a target molecule which method comprises: 30 (a) incubating said target molecule with a mixture of oligonucleotide eequencee under condition! wherein complexation occurs with some, but not all, members of ths mixture to form oligonucleotide-target complexes; It 920562 172 (b) separating the oligonucleotide-target eooplexea from uncomplexed oligonucleotides; (c) recovering and amplifying the complexed oligonueleotldee from said complexes; 5 (d) optionally repeating steps (a) - (c) with the recovered oligonucleotides of step (c); (e) determining the sequences of the recovered oligonucleotides; (f) determining a consensus sequence included 10 in the recovered oligonucleotides; and (g, synthesising a secondary aptamer which comprises ths consensus sequence.

28. 46. λ secondary aptamer prepared by the method 15 of claim 45.

29. 47. λ method for Obtaining an aptamer containing at least one binding region that specifically binds a target, which method comprises: 20 (a) incubating said target with a mixture of member oligonucleotides under conditions wherein ths target complexes with some, but not all, members of ths mixture to form oligonucleotide-target eooplexea; (b) separating the oligonucleotide-target 25 complexes from uncomplexed oligonucleotides; (e) recovering and amplifying the complexed oligonucleotides from said complexes to obtain an aptamer; and (d) optionally determining the eequence of the 30 recovered aptamer, wherein the dissociation constant (Kd) with respect to said target and mixture of oligonucleotides is l μΜ, or wherein the Kd with respect to the aptamer and 35 said target is leee by a factor of at least 50 as 173 compared to the Kd for Mid target and eaid mixture of oligonucleotides; or wherein steps (a) and (b) are conducted under physiological conditions, or 5 wherein eaid mixture of oligonucleotides consists of single-stranded DNA.

30. 48. The method of claim 47 wherein Mid mixture of oligonucleotides contains at least one 10 modified oligonucleotide.

31. 49. The method of claim 47 wherein said amplifying is conducted using at least one modified nucleotide. IS

32. 50. The method of claims 47-49 wherein said mixture of oligonucleotides contains at least one random!zed - eequence region. 20

33. 51. The method of claims 47-49 which further includes repeating steps (a)-(c) using the recovered and amplified complexed oligonucleotides resulting from step (c) in succeeding step (a). 25

34. 52. The method of claim 47 wherein said mixture of oligonucleotides ie of unpredetexmined sequence.

35. 53. Aa aptamer prepared by the method of 30 claims 47-52.

36. 54. A method to obtain an aptamer containing a binding region which specifically binds a target molecule which comprises: ί 174 (a) Incubating the target molecule reversibly coupled to a support with a mixture of oligonucleotide sequences under conditions wherein the coupled target molecule complexes with some, but not all, members of ths 5 mixture to form support-bound oligonucleotide complexes; (b) decoupling and recovering the oligonucleotide target complex from the support to obtain free aptamer-target complexes; (c) recovering and amplifying the complexed 10 oligonucleotides from the free oligonucleotide-target complexes to obtain a population of aptamers; (d, optionally repeating steps (a) - (c) using as said mixture the recovered population of aptamers of step (c); and IS (e) optionally determining the sequence of the recovered aptamers.

37. 55. The method of claim 54 wherein in step (a) the target substance le reversibly coupled to the support 20 using an activated thiol group on the support.

38. 56. Ths method of claim 54 wherein in step (b), decoupling is accomplished toy adding a reducing agent.

39. 57. The method of claim 56 wherein the reducing agent is dithiothreitol or 0-mercaptoethanol. 5·. The method of claim 54 wherein the support 30 is a lectin support and the target substance binds reversibly to lectin.

40. 59. The method of claim 58 wherein in step (b), decoupling is accomplished by adding a 35 monoaaccharlde. it 920562 175

41. 60. The method of claim 59 wherein the monoe&ccharlde ia a-methyl-mannoside. 5

42. 61. λ method for obtaining aptamera capable of binding a target, eaid method cooprlslng: (a) providing a first pool of oligonucleotidee of unpredetermined eequence, said pool comprising a quantity of oligonucleotides sufficiently reflective of 10 the structural complexity of said target aa to ensure the presence of at least one oligonucleotide capable of binding said target; (b, incubating said pool of oligonucleotides, or a portion thereof with said target under conditions 15 wherein complexation occurs between some oligonucleotides and said target, said complexed oligonucleotidee defining a firet aptamer population; (c) recovering said firet aptamers in substantially single stranded form from uncomplexed 20 ol igonucleotidee ι (d) attaching a known nucleotide eequence to at least one end of said first aptamers; (e) amplifying said first aptamers; (f) removing said known nucleotide sequence 25 from said first aptamers; (g) optionally repeating steps (a)-(f) a sufficient number of times to generate an optimal aptamer population having high affinity for target. 30

43. 62. λ method for obtaining an oligonucleotide capable of complexing to a desired target, said oligonucleotide being substantially non-predetermined sequence, said method comprisingι (a) Incubating said target with a pool of 35 oligonucleotides of non-predetermined or substantially 176 non·predetermined sequence under conditions wherein earns, but not all, oligonucleotides cooplsx with said target; (b) separating oligonucleotide:target complexes; 5 (c) recovering the oligonucleotides from step b in substantially single stranded form; (d) attaching a first linker to the 5' end of said oligonucleotide and a second linker to the 3' end of said oligonucleotide, both said 5' and said 3' linkers of 10 known nucleotide sequence, thereby generating an oligonucleotide having a S' linker portion, an oligonucleotide portion and a 3' linker portion; (e) amplifying the oligonucleotide of step d, thereby generating a duplex comprising a first strand IS having a 5* linker complement portion, an oligonucleotide ccnplement portion and a 3' linker complement portion, and a second strand comprising a 5* linker portion, an oligonucleotide portion and a 3' linker portion; (g) removing said 3' linker portion and said 5' 20 linker portion; (h) recovering eaid oligonucleotide in substantially single stranded form,

44. 63. The method of claim 62 wherein said 5' 25 linker has a restriction enzyme recognition site at or near tha 3' end thereof and aaid 3' linker has a restriction enzyme recognition site at or near the 5' end thereof. 30

45. 64. The method of claim 63 wherein eaid 3' linker portion ie removed by attaching eaid duplex to solid support; digesting said attached duplex with a restriction enzyme capable of recognising the restriction enzyme eite at the S' end thereof. 177

46. 65. λ method for obtaining an aptamer containing at least one binding region that specifically binds a target which method comprises: (a) incubating said target molecule with a 5 mixture of oligonucleotides under conditions whsrsln complexation occurs with some, but not all, members of the mixture to form oligonucleotide-target complex··, (b) separating the oligonucleotide-target complexes from uncomplexed oligonucleotide; 10 (c) recovering and amplifying the complexed oligonucleotide from said complexes, and (d) optionally determining the sequence of the recovered oligonucleotide, wherein said amplifying is conducted using at 15 least one modified nucleotide, or wherein said mixture of oligonucleotides contains at least one modified oligonucleotide.

47. 66. λ method to obtain an aptamer which 20 specifically binds a first target and faile to bind a second substance, which method comprises: incubating said first target with a mixture of member oligonucleotides under conditione wherein complexation occure with some, but not all, members of 25 said mixture; eeparating complexed from uncomplexed oligonucleotides; recovering the complexed oligonucleotides to provide a firet aptamer papulation; 30 incubating eaid second substance with said first aptamer population under conditions wherein complexation occurs with some, but not all, members of aid mixture; separating complexed from uncomplexed 35 oligonucleotides, 1 7 fi recovering the uncomplexed oligonucleotides to provide a second aptamer population which epecifically bind the first target; and recovering and amplifying the 5 oligonucleotide(e) from said second aptamer population.

48. 67. A method to obtain an aptamer which epecifically binds a first target and does not bind to a second substance, which method comprises: 10 contacting said second substance with a mixture of oligonucleotides under conditions wherein eome but not all of the members of the mixture bind to the second substance; □oparaeiag away these members which do net bind 15 to the second substance to obtain a first pool of ollgonuoleotldee; contacting the first pool with eaid first target; separating away and isolating those 20 oligonucleotides which bind to the first target to provide a pool of aptamere; recovering and aoplifylng the aptamere.

49. 68. An aptamer prepared by the method of any 25 of claims 47-67.

50. 69. A complex formed by a target molecule and the aptamer of claims 1-37, 44, 46, 53 or 68. 30

51. 70. λ method to detect the presence or absence of a target molecule, which method comprises contacting a sample suspected of containing eaid target molecule with the aptamer of elaime 1-37, 44, 46, 53 or 68 under conditions wherein a coeplex between said target molecule 35 and the aptamer ie formed, and 17 9 detecting the pretence or absence of eaid complex.

52. 71. A method to purify a target molecule, which method comprises contacting a sample containing eaid target molecule with the aptamer of claims 1-37, 44, 46, 53 or 68 attached to solid support under conditions wherein said target molecule ie bound to the aptamer coupled to solid support) washing unbound components of ths sample; and recovering the target molecule from said solid support.

53. 72. A pharmaceutical coaposition for medical use comprising the aptamer of claims 1-37, 44, 46, 53 or 68 ia admixture with a physiologically acceptable excipient.

54. 73. A composition for diagnostic use which comprises the aptamer of claims 1-37, 44, 46, 53 or 68.

55. 74. The aptamer of claims 1-37, 44, 46, 53 or 68 coupled to an auxiliary substance.

56. 75. Ths aptsmer of claim 74 wherein aald auxiliary substance ie selected from the group coneieting of a drug, a toxin, a solid support, and specific binding reagent, a label, a radioisotope or a contrast agent.

57. 76. A conjugate for modulating immune response to a pathologic cell, comprising: a targeting agent moiety that specifically binds to a surface feature of the pathologic cell; and an immunomodulatory moiety that Induces sn immunological response different from that elicited by 18 0 th· pathologic cell itaelf in the absence of the conjugate.

58. 77. A conjugate according to elaia 76, wherein 5 eaid targeting agent ie selected froa the group consisting of oligonucleotides, antibodies and ligands for cell surface receptors.

59. 78. A conjugate according to claim 77, wherein 10 eaid targeting agent ls the aptamer of claims 1*37, 44, 46, 53 or 68. 60. 79. λ conjugats according to claim 76, wherein the immunomodulatory moiety le selected from the group 15 consisting of peptides and carbohydrates.

60. A method for preparing a conjugate for modulating immune rseponee to a pathologic cell, comprising: 20 identifying a targeting agent that specifically binds to a aurface antigen of the pathologic cell; and associating said targeting agent with an immunomodulatory moiety that induces a deeired immune response.

61. 81. A method for modulating ismune response to a pathologic cell, comprising: administering an amount effective to modulate Immune response of a conjugate in accordance with claim 30 76. - 181

62. 82. A single-stranded DNA aptamer according to Claim 1, substantially as hereinbefore described and exemplified.

63. 83. An aptamer according to any one of Claims 2-6, substantially as hereinbefore described.

64. 84. A method for obtaining an aptamer according to any one of Claims 2-6, substantially as hereinbefore described and exemplified.

65. 85. An aptamer according to any one of Claims 2-6, whenever obtained by a method claimed in any one of Claims 38-43, 47-52, 54-61, 65 or 84.

66. 86. A method according to Claim 45 to obtain a secondary aptamer, substantially as hereinbefore described and exemplified.

67. 87. A secondary aptamer whenever obtained by a method claimed in Claim 45 or 86.

68. 88. A method according to Claim 62, for obtaining an oligonucleotide, substantially as hereinbefore described and exemplified.

69. 89. An oligonucleotide whenever obtained by a method claimed in any one of Claims 62-64 or 88.

70. 90. A method according to Claim 66 or 67 to obtain an aptamer which specifically binds a first target and fails to bind a second substance, substantially as hereinbefore described and exemplified. 182

71. 91. An aptamer which specifically binds a first target and fails to bind a second substance whenever obtained by a method claimed in any one of Claims 66, 67 or 90.

72. 92. A complex according to Claim 69, substantially as hereinbefore described.

73. 93. A method according to Claim 70 to detect the presence or absence of a target molecule, substantially as hereinbefore described.

74. 94. A method according to Claim 71, to purify a target molecule, substantially as hereinbefore described and exemplified.

75. 95. A target molecule, whenever obtained by a method claimed in Claim 71 or 94.

76. 96. A pharmaceutical composition according to Claim 72, substantially as hereinbefore described.

77. 97. A conjugate according to Claim 76, substantially as hereinbefore described and exemplified.

78. 98. A method according to Claim 80 for preparing a conjugate, substantially as hereinbefore described and exemplified.

79. 99. A conjugate whenever prepared by a method claimed in Claim 81 or 98.