HK1175813A - Methods, systems, and compositions for neuronal differentiation of multipotent stromal cells - Google Patents
Methods, systems, and compositions for neuronal differentiation of multipotent stromal cells Download PDFInfo
- Publication number
- HK1175813A HK1175813A HK13103059.7A HK13103059A HK1175813A HK 1175813 A HK1175813 A HK 1175813A HK 13103059 A HK13103059 A HK 13103059A HK 1175813 A HK1175813 A HK 1175813A
- Authority
- HK
- Hong Kong
- Prior art keywords
- mammal
- mirna
- cells
- microrna
- neuronal differentiation
- Prior art date
Links
Abstract
Some embodiments of the invention comprise methods, systems, and compositions to selectively induce, whether in vitro or in vivo, the neuronal differentiation of multipotent stromal cells through the application of microRNAs, including but not limited to miRNA- 124, miRNA-137 and/or miRNA-9* expression products of those miRNAs, and molecules and compositions containing functional elements of those miRNAs. Some embodiments of the invention also comprise the therapeutic administration and use of such induced cells to treat mammalian injuries and diseases, including but not limited to, nervous system injuries or diseases that may otherwise result in decreased cell or system function.
Description
Technical Field
Some embodiments of the invention relate to the induction and use of cell types for the treatment of injuries and diseases of the mammalian nervous system, but are not limited thereto.
Background
Certain nervous system injuries, autoimmune diseases affecting the central or peripheral nervous system, and neurodegenerative diseases are characterized by the loss of specific cells, or the presence of dysfunction of nerve cells, which can cause patients to develop different neurological signs and symptoms and possibly irreversible loss of nerve function. As just one example, some patients with stroke, spinal injury, or other neurological damage and degeneration experience loss of functional cell types, or neurological disorders such as parkinson's disease and alzheimer's disease that in turn result in loss of or abnormality in system function. Currently, there are limited treatment options for treating and repairing such cellular and systemic functions. Thus, there remains a need for methods, systems, and compositions to facilitate other treatments, including therapies directed to the replacement of missing or damaged nervous system cells, tissues, and functions.
Disclosure of Invention
Some embodiments of the invention include methods, systems and compositions for selectively inducing neuronal differentiation of pluripotent stromal cells in vitro or in vivo through the use of micrornas (micrornas), including but not limited to miRNA-124, miRNA-137, and/or miRNA-9, expression products of these mirnas, and molecules and compositions containing functional elements (functional elements) of these mirnas, but the invention is not limited to those embodiments described herein and there is no specific disclaimer. Some embodiments of the invention also encompass the therapeutic administration and use of such induced cells to treat injuries and diseases in mammals, including, but not limited to, injuries or diseases of the nervous system that may otherwise result in reduced cell or system function.
Drawings
Some embodiments of the invention will now be described, by way of example only, with reference to the accompanying drawings, in which:
FIG. 1 shows bright field images of MSCs treated with growth factors or transfected with control miRNA and miRAN-124 or miRNA-137 for 3, 5, and 9 days.
Figure 2 is a representation of data showing that miRAN-124, miRNA-137, and miRNA-9 induce neuronal labeling in MSCs.
Figure 3 shows western blot results after transfection of cells with the tested mirnas or treatment with DMEM.
FIG. 4 shows the results of transfection of (animal) adipose and umbilical cord derived MSCs (cord derived MSCs) with control miRNA, mirAN-124 or miRNA-137.
Detailed Description
Some embodiments of the present invention include methods, systems and compositions for selectively inducing neuronal differentiation of pluripotent stromal cells ("MSCs") in vitro or in vivo through the use of micrornas (micrornas), ("mirnas" or "mirs"), including, but not limited to, miRNA-124 and/or miRNA-137, and/or miRNA-9, expression products of these mirnas, and molecules and compositions containing functional elements of these mirnas, but the present invention is not limited to those embodiments described herein, and there is no specific disclaimer of any embodiment. Some embodiments of the invention also encompass therapeutic administration and use of such induced cells for the treatment of injuries and diseases in mammals, including, but not limited to, injuries or diseases of the nervous system that may otherwise result in reduced cell or system function. In some embodiments, such induction of differentiated MSCs, and/or the cells produced, may be used to treat cell, tissue or organ damage in a patient by administering to the patient a therapeutically effective amount of a miRNA of interest, or a differentiated MSC induced by such a miRNA.
We have unexpectedly found that certain mirnas are capable of inducing long-term neuronal differentiation of MSCs for use in cell-based therapies in subjects presenting with neurological injuries and diseases, including, but not limited to, neurodegenerative disorders and spinal cord injury. Such a subject may include a mammal, including but not limited to a human. We have therefore found a novel application of such mirnas and the resulting induced MSCs, which among other possible uses, are able to reduce or mitigate the effects of certain neurological injuries or diseases in mammals.
Some embodiments of the present invention include methods, systems, and/or compositions for inducing neuronal differentiation of MSCs by the use and expression of miRNA-124, miRNA-137, and/or miRNA-9, but are not limited thereto. MSCs are mesoderm-derived cells (mesoderm-derived cells) typically present in adult bone marrow at very low concentrations (about 1 out of 10000 nucleated cells). MSCs are capable of differentiating to produce cells such as bone marrow stroma, blood vessels, fat, bone, and cartilage. These cells may also have the potential to differentiate into neuronal \ or glial-like cells, depending on environmental signals. In addition, these cells may be further induced to express or maintain a particular neuronal or glial phenotype by culture with various combinations of growth factors and hormones.
MSCs have been shown to play a therapeutic role in a variety of neurological diseases and dysfunctions in experimental animal models, and more recently in experimental clinical trials. Their effects are mainly due to immunosuppressive and neuroprotective functions. In experimental autoimmune encephalitis ("EAE"), an animal model of multiple sclerosis ("MS"), treatment of mice with bone marrow-derived MSCs resulted in significant suppression of disease manifestations. Several studies have demonstrated that, in addition to reduced autoimmune modulation, neural differentiation of these cells enhances their therapeutic effect in various instances such as ischemic brain.
In our study, we examined the effect of three neuron-related mirnas, namely miRNA-124, miRNA-137 and miRNA-9, on human MSC differentiation. These mirnas are not normally expressed in MSCs. We found that expression of miRNA-124, miRNA-137 or miRNA-9 induced neuronal differentiation of MSCs as indicated by cell morphology and increased expression of β III-tubulin and MAP 2. miRNA-124, miRNA-137, and miRNA-9 caused an increase in tyrosine hydroxylase, suggesting differentiation of MSCs towards dopaminergic phenotypes. One of the targets of miRNA124 precursors (precursor miRNA124, pre-miRNA124) is the transcription factor REST, which inhibits a number of neuronal genes. Our results show that neuron-related mirnas can induce long-term neuronal differentiation of MSCs for use in cell-based therapies in neurodegenerative and neuroinflammatory disorders as well as spinal cord injury. One advantage of the use of mirnas over the prior methods, compared to transient differentiation induced by growth factor treatment, is that: miRNA precursors can be stably expressed in MSCs that will cause long-term neuronal differentiation. As such, the ease of obtaining patient's own bone marrow-derived MSCs, and the feasibility of large enrichment and expansion of MSCs suggest: neuronal differentiation of such cells can be used as autologous neural stem cells, which can be used to treat a number of acquired or congenital neurological disorders associated with neuronal deficiency or damage. As just one example, MSCs can be prepared from fats removed by liposuction, and from umbilical cord blood (cord blood) or placenta, but are not limited thereto. The reduced immunogenicity of MSCs may facilitate the use of off-the-shelf (off the shelf) or allogeneic neurons from matched or partially mismatched family members for the treatment, by way of non-limiting example only, of conditions caused by congenital absence of essential enzymes (essential enzymes) or other essential products (essential products).
(invention) is not limited to only the embodiments explicitly disclosed herein, and there is no specific disclaimer of any embodiment, some embodiments of the invention include:
neuronal differentiation of MSCs by culture or other exposure to mirnas, including but not limited to miRNA124 and/or miRNA137, and/or miRNA-9.
2. Transfection of MSCs with such mirnas;
3. administering MSCs that induce neuronal differentiation in vitro to a subject suffering from a nervous system injury or disease; and/or
4. MSCs transfected with such mirnas are administered to a subject suffering from a neurological injury or disease.
In some embodiments, with reproducible transdifferentiation of MSCs into neurons, therapeutic uses of MSCs can be obtained and expanded in vitro or in vivo to include (as just some examples): treatment of cerebrovascular disease, spinal cord injury, treatment of neurodegenerative disorders such as amyotrophic lateral sclerosis ("ALS"), multiple sclerosis ("MS"), and related motor neuron diseases, but is not limited thereto. Ongoing clinical studies have shown that intrathecal and intravenous infusion of MSCs can partially improve the clinical manifestations of disease in MS patients and to a lesser extent ALS patients. Such clinical studies provide evidence that both intrathecal and intravenous infusion of MSCs is a safe procedure, as none of the treated patients produce any serious side effects. Thus, cell therapy with MSCs represents, as a prophetic, an important approach for the treatment of a large number of neurological disorders, wherein, in particular, MSCs can be induced into neurons or oligodendrocytes and/or secreted factors that can induce neurogenesis in locally present stem cells.
Examples
The following examples of some embodiments of the present invention are provided, but are not intended to limit the invention to only those embodiments described herein and there is no specific disclaimer of any embodiment.
Micro RNA
Micrornas ("mirnas") represent a class of endogenous, small (as some non-limiting examples, 19-23 nucleotides) non-coding RNAs that act through RNA interference ("RNAi") pathways to affect post-transcriptional gene silencing. mirnas target mRNA of specific genes based on complementation, and mediate mRNA disruption (perfect complementation) or translation suppression (partial complementation). mirnas have been shown to play an important role in development and may function as essential gene regulatory elements for establishing or maintaining specific expression profiles that determine cell fate.
The manipulative (manipulating) neuronal differentiation of MSCs may involve regulatory pathways that coordinate the programming of gene expression during differentiation. Differentiation generally requires alteration of the mRNA and protein composition of the cell. One class of gene regulatory molecules is microrna, a subset of small (small) RNAs, which is believed to down-regulate expression of protein-encoding genes post-transcriptionally using elements (elements) in the RNA interference pathway. mirnas may play an important role in cell differentiation, as they are predicted to individually regulate hundreds of target genes simultaneously.
Method of producing a composite material
To determine the effect of miRNA-124, miRNA-137, and miRNA-9 on MSC differentiation, we used three different preparations of these cells in paragraphs 4-12 (passages). MSC cells were plated on DMEM + 10% FCS for 24hr, then transfected with double-stranded RNA oligonucleotides of the mature sequences of the three mirnas and a negative control oligonucleotide. The mirnas used were as follows:
dharmacon mimic product:
MI0000443/MIMAT 0000422-human
Selected precursor/maturation
And (3) maturing:
hsa-miR-124[MIMAT0000422]
precursor:
hsa-miR-124-1[MI0000443]
an organism:
human being
Mature sequence:
UAAGGCACGCGGUGAAUGCC(SEQ ID NO.1)
MI0000454/MIMAT 0000429-human
Selected precursor/maturation
And (3) maturing:
hsa-miR-137[MIMAT0000429]
precursor:
hsa-miR-137[MI0000454]
an organism:
human being
Mature sequence:
UUAUUGCUUAAGAAUACGCGUAG(SEQ ID NO.2)
miRNA 9 sequence:
AUAAAGCUAGAUAACCGAAAGU(SEQ ID NO.3)
MiRNA 9 mimicry
UCUUUGGUUAUCUAGCUGUAUGA(SEQ ID NO.4)
After 3 days, the cells were transferred to neural substrate medium (NB) supplemented with B27. Cell morphology was monitored every 24 hours and neuronal markers were analyzed by immunofluorescence staining, western blot analysis or real-time PCR 5, 7 and 9 days after transfection. As a positive control for neuronal differentiation induction, we used cells stimulated by a combination of Shh, FGF8 and bFGF.
Results
miRNA-124, miRNA-137, and miRNA-9 promote neuronal differentiation of MSCs.Figure 1 is a graphical representation of six separate experiments that yielded similar results. As shown in figure 1, transfection of cells with miRNA-137, miRNA-124, or miRNA-9 already reduced cell proliferation and induced morphological differentiation in cells 72 hours after transfection. Transfection of MSCs with miRNA-137 induced rapid and robust morphological changes, and the cells acquired a typical neuronal phenotype with compact cell bodies (compact cells) and long processes with varicose veins (elongase processes). miRNA-124-transfected cells show a strong decrease in cell proliferation and subsequent generation of several cell types; elongated cells with long processes (elongated cells), minicells with multiple shorter processes, and flat stellate cells. Control miRNA transfected cells were similar to control untreated cells. Interestingly, the effect of miRNA-137 was more rapid and stronger than the effect of GF. Approximately 90% of the miRNA-137 transfected cells showed neuronal morphology.
miRNA-124, miRNA-137, and miRNA-9 increase expression of neuronal markers in MSCs.To further examine the effect of miRNA-124, miRNA-137, and miRNA-9 on neuronal differentiation, we examined the expression of neural stem cell markers, nestin (nestin), astrocyte marker GFAP, and neuronal marker β III-tubulin, as well as tyrosine hydroxylase. Cell drugAppropriate mirnas were transfected or treated with DMEM or neural matrix medium + B27. After 5 days, nestin mRNA expression was determined using real-time PCR, and nestin, GFAP, β III-tubulin, and tyrosine hydroxylase expression was detected by western blot analysis after 9 days of treatment. Results are presented as five different experiments that yielded similar results. FIG. 2 shows a large increase in nestin mRNA, as determined by real-time PCR, 5 days after transfection. In contrast, we found increased expression of β III-tubulin 9 days after transfection with different mirnas, however no expression of nestin or GFAP was observed. Furthermore, we found that miRNA-137 and miRNA-9 induced a large increase in tyrosine hydroxylase expression, whereas a smaller increase was observed in miRNA-124 transfected cells. Expression of all these markers was absent or negligible in control miRNA transfected cells.
miR-9 induces dopaminergic markers, tyrosine hydroxylase, in MSCs.Figure 3 shows western blot results of MSCs after transfection with appropriate mirnas or treatment with DMEM. After 9 days, tyrosine hydroxylase expression was detected by western blot analysis. Results are presented as five different experiments that yielded similar results. In MSCs, miRNA-9 induces a dopaminergic marker, tyrosine hydroxylase.
Our results demonstrate that miRNA-124, miRNA-137, and miRNA-9 induce neuronal differentiation of MSCs, although to different extents (induction) in our test model, respectively. miRNA-137 induces a faster and more robust effect, resulting in a homogenous population of neuronal cells (homogenous population). The high level of expression of tyrosine hydroxylase in these cells suggests that these cells display a dopaminergic phenotype.
miRNA-124 also induced neuronal differentiation compared to control miRNA-treated cells, as determined by high levels of β III-tubulin. In our study, this treatment resulted in a mixed population of cells expressing lower levels of tyrosine hydroxylase. No treatment induced astrocyte differentiation as determined by loss of GFAP expression.
Furthermore, both mirnas caused a large transient increase in nestin expression after 5 days of treatment, indicating the generation of neural stem cell-like or neuronal progenitor-like cells. The controlled differentiation of MSCs into NSCs or NPC-like cells can be further exploited to differentiate these cells into different neuronal cell lines or neurons with different phenotypes by using specific transcription factors or specific combinations of growth factors.
miRNA-124 and miRNA-9 have been reported to be involved in neuronal differentiation and neurite outgrowth. Similarly, there is a report demonstrating the effect of miRNA137 on neuronal differentiation of glioma stem cells and NSCs. However, the effect of mirnas on neuronal differentiation of MSCs was not reported, and the effect of mirnas 124 and 137 on neuronal production with specific phenotypes was not shown. Furthermore, there is no report that any of these mirnas can induce cells with NSC/NPC phenotype.
MiRNA-124 and miRNA-137 induce adipose and umbilical cord-derived MSCs (cord derived) MSC) neuronal differentiation. Adipose and umbilical cord derived MSCs were transfected with control miRNA, miRNA-124 and miRNA-137, similar to bone marrow MSCs (figure 4).
Preparation of adipose-derived MSCs: adipose-derived MSCs were obtained by liposuction from the thigh or abdominal wall. The 100-. The cells were further processed and maintained as described for bone marrow derived MSCs.
Preparation of human umbilical cord MSC: fresh human umbilical cord was obtained postnatally (with parental consent) and collected in DMEM at 4 ℃. Umbilical vessels were removed and mesenchymal tissue (Wharton's jelly) was cut into small pieces. After centrifugation at 250 Xg for 5min, the tissue was washed with serum-free DMEM, treated with collagenase at 37 ℃ for 18h, and subsequently digested with 2.5% trypsin at 37 ℃ for 30 min. The isolated MSCs were further dispersed and maintained under similar conditions as described for bone marrow derived MSCs.
After 12 days, mRNA was extracted and the levels of b 3-tubulin and housekeeping gene (house keeping gene) S12 were determined using real-time PCR.
Our results (fig. 4) demonstrate that miRNA-124 and miRNA-137 induce neuronal differentiation not only in bone marrow-derived MSCs but also in adipose tissue and cord blood-derived cells. The neuronal marker β III tubulin was induced in these cells after miRNA treatment. Each of these cell sources has its own advantages. Bone marrow derived MSCs have been well characterized and have been successfully used for over 20 years without carcinogenicity. Adipose-derived MSCs are less described, but can be obtained in large quantities, and cord blood cells can be easily obtained in a non-invasive manner, they do not require complete genetic compatibility between the donor and the patient, and are thus more readily available.
Construction of a plasmid containing miRNA precursors and GDNF.Since GDNF has been implicated in the survival of dopaminergic neurons, we constructed plasmids that co-expressed miRNA-124 precursor or miRNA-137 precursor with GDNF under a separate promoter.
With respect to step by step cloning (step by step cloning) GDNF in the premir vector (CD-511-1 or PCDH-CMV-MCS-EF1-copGFP from Systembiosciences), the sequencing steps and procedures for cloning the miRNA precursor GDNF vector as well as the procedures for cloning the miRNA are described, but are not limited to only the embodiments described herein, and there is no specific disclaimer of any embodiment.
cDNA for human glial cell-derived neurotrophic factor ("GDNF") template was obtained from Origene. For cloning of GDNF into the premir 124 and 137 vectors (System Biosciences), primers with Xho1 and Sal1 restriction enzyme digestion sites for the GDNF ORF were designed as follows:
forward direction: cacc ctcgag (Xho1) atg aag tta tgg gat gtc gtg gct gtc tgc (SEQ ID NO.5)
And (3) reversing: aaaa gtcgac (Sal1) tca gat aca tcc aca cct ttt agc gga atg (SEQ ID NO.6)
Following PCR, the GDNF DNA product was washed, then digested with Xho1 and Sal1, and the DNA washed again, producing DNA for GDNF that could be cloned immediately.
The Xho1 restriction site was added to the premir 124 and premir137 vectors by using the following primers:
forward direction: gac gcc acc atg gag agc ctc gag (Xho1) agc ggc ctg ccc gcc (SEQ ID NO.7)
And (3) reversing: ggc ggg cag gcc gct ctc gag (Xho1) gct ctc cat ggt ggc gtc (SEQ ID NO.8)
The GFP gene was removed from the premir 124 and 137 vectors by using restriction enzymes Xho1 and Sal1, and then the vectors were washed.
GDNF ligation to the premir 124 and 137 vectors. The ligated plasmid was transferred into One Shot Top 10 chemically competent cells. After treatment with a small extraction method (mini prep), plasmids with premir 124 and 137 were selected by culturing clones.
GDNF insertion was detected by digesting the plasmid with Xho1 and Sal 1. The plasmid was then sequenced. Sequences of miR-124 and 137 and the backbone (backbone) of the premir vector:
MiR-124:
GAACAAAGAGCCTTTGGAAGACGTCGCTGTTATCTCATTGTCTGTGTGATTGGGGGAGCTGCGGCGGGGAGGATGCTGTGGTCCCTTCCTCCGGCGTTCCCCACCCCCATCCCTCTCCCCGCTGTCAGTGCGCACGCACACGCGCCGCTTTTTATTTCTTTTTCCTGGTTTTCTTATTCCATCTTCTACCCACCCCTCTTCCTTTCTTTCACCTTTCCTTCCTTCCTTCCTCCTTTCCTTCCTCAGGAGAAAGGCCTCTCTCTCCGTGTTCACAGCGGACCTTGATTTAAATGTCCATACAATTAAGGCACGCGGTGAATGCCAAGAATGGGGCTGGCTGAGCACCGTGGGTCGGCGAGGGCCCGCCAAGGAAGGAGCGACCGACCGAGCCAGGCGCCCTCCGCAGACCTCCGCGCAGCGGCCGCGGGCGCGAGGGGAGGGGTCTGGAGCTCCCTCCGGCTGCCTGTCCCGCACCGGAGCCCGTGGGGTGGGGAGGTGTGCAGCCTGTGACAGACAGGGGCTTAGAGATGC(SEQ ID NO.9)
MiR-137:
CAGCACTCTTCTGTGTTAAGTATTTGATTTTGTGATTTGTCTTTCAGAATTGGAAATAGAGCGGCCATTTGGATTTGGGCAGGAAGCAGCCGAGCACAGCTTTGGATCCTTCTTTAGGGAAATCGAGTTATGGATTTATGGTCCCGGTCAAGCTCAGCCCATCCCCAGGCAGGGGCGGGCTCAGCGAGCAGCAAGAGTTCTGGTGGCGGCGGCGGCGGCAGTAGCAGCGGCAGCGGTAGCAGCGGCAGCGGTAGCAGCGGCAGCGGCAGCTTGGTCCTCTGACTCTCTTCGGTGACGGGTATTCTTGGGTGGATAATACGGATTACGTTGTTATTGCTTAAGAATACGCGTAGTCGAGGAGAGTACCAGCGGCAGGGGGGCAGCGGCCGCCCTCCCCAGCCCACCAGCTGGCCACTAAACGCCCGTGGTTGCCAAGGTAGCACTTTCTTGTTCTTTTCATTTCCTCGGGTGTTTTCGCACTGGTTCCACCGGAAAGGCTGTGCGCTGCGCCTCTGGTGACCAGGACTGGA(SEQ ID NO.10)
attached is the sequence of the backbone vector (CD-511_ 1):
site (LOCUS) CD511B _1_ pCDH _ CMV _7544bp ds-DNA Loop 16-DEC-2008:
definition of
Login number
Version(s)
Source
Organism
Note
Note ApEinfo: methylation: 1
Characteristic sites/modifications (Qualifiers)
Characteristics that have not been classified (misc _ feature)2315..2764
EF1 promoter
color/ApEinfo _ fwd blue-green
Color of/ApEinfo _ rev being green
2789 characteristics not yet categorized
The/marker EF1 promoter (1)
the/ApEinfo _ tag ═ EF1 promoter
color/ApEinfo _ fwd blue-green
Color of/ApEinfo _ rev being green
Not yet categorized features 2874..3629
Mark ═ copGFP
, #00ff00,/ApEinfo _ fwd color
Color of/ApEinfo _ rev being green
Characteristics 3639..4229 that have not yet been categorized
WPRE mark
color/ApEinfo _ fwd blue-green
Color of/ApEinfo _ rev being green
Not yet categorized features 2790..2860
The/marker EF1 promoter (2)
the/ApEinfo _ tag ═ EF1 promoter
color/ApEinfo _ fwd blue-green
Color of/ApEinfo _ rev being green
2789 characteristics not yet categorized
Primer EFfwd
,/ApEinfo _ fwd color, # ff80ff
Color of/ApEinfo _ rev being green
Unclassified features 1922..2183
CMV marker
,/ApEinfo _ fwd color, # ff80ff
Color of/ApEinfo _ rev being green
2314 characteristic not yet categorized 2272
MCS with mark
, #80ff00,/ApEinfo _ fwd color
Color of/ApEinfo _ rev being green
Characteristics 2205..2271 that have not been categorized
Mark CMV (1)
(ii)/ApEinfo _ Mark as CMV
,/ApEinfo _ fwd color, # ff80ff
Color of/ApEinfo _ rev being green
Features 2184..2204 that have not been classified yet
DAB 90 Forward primer
color/ApEinfo _ fwd blue-green
Color of/ApEinfo _ rev being green
Source
1 acgcgtgtag tcttatgcaa tactcttgta gtcttgcaac atggtaacga tgagttagca
61 acatgcctta caaggagaga aaaagcaccg tgcatgccga ttggtggaag taaggtggta
121 cgatcgtgcc ttattaggaa ggcaacagac gggtctgaca tggattggac gaaccactga
181 attgccgcat tgcagagata ttgtatttaa gtgcctagct cgatacaata aacgggtctc
241 tctggttaga ccagatctga gcctgggagc tctctggcta actagggaac ccactgctta
301 agcctcaata aagcttgcct tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact
361 ctggtaacta gagatccctc agaccctttt agtcagtgtg gaaaatctct agcagtggcg
421 cccgaacagg gacctgaaag cgaaagggaa accagagctc tctcgacgca ggactcggct
481 tgctgaagcg cgcacggcaa gaggcgaggg gcggcgactg gtgagtacgc caaaaatttt
541 gactagcgga ggctagaagg agagagatgg gtgcgagagc gtcagtatta agcgggggag
601 aattagatcg cgatgggaaa aaattcggtt aaggccaggg ggaaagaaaa aatataaatt
661 aaaacatata gtatgggcaa gcagggagct agaacgattc gcagttaatc ctggcctgtt
721 agaaacatca gaaggctgta gacaaatact gggacagcta caaccatccc ttcagacagg
781 atcagaagaa cttagatcat tatataatac agtagcaacc ctctattgtg tgcatcaaag
841 gatagagata aaagacacca aggaagcttt agacaagata gaggaagagc aaaacaaaag
901 taagaccacc gcacagcaag cggccactga tcttcagacc tggaggagga gatatgaggg
961 acaattggag aagtgaatta tataaatata aagtagtaaa aattgaacca ttaggagtag
1021 cacccaccaa ggcaaagaga agagtggtgc agagagaaaa aagagcagtg ggaataggag
1081 ctttgttcct tgggttcttg ggagcagcag gaagcactat gggcgcagcc tcaatgacgc
1141 tgacggtaca ggccagacaa ttattgtctg gtatagtgca gcagcagaac aatttgctga
1201 gggctattga ggcgcaacag catctgttgc aactcacagt ctggggcatc aagcagctcc
1261 aggcaagaat cctggctgtg gaaagatacc taaaggatca acagctcctg gggatttggg
1321 gttgctctgg aaaactcatt tgcaccactg ctgtgccttg gaatgctagt tggagtaata
1381 aatctctgga acagattgga atcacacgac ctggatggag tgggacagag aaattaacaa
1441 ttacacaagc ttaatacact ccttaattga agaatcgcaa aaccagcaag aaaagaatga
1501 acaagaatta ttggaattag ataaatgggc aagtttgtgg aattggttta acataacaaa
1561 ttggctgtgg tatataaaat tattcataat gatagtagga ggcttggtag gtttaagaat
1621 agtttttgct gtactttcta tagtgaatag agttaggcag ggatattcac cattatcgtt
1681 tcagacccac ctcccaaccc cgaggggacc cgacaggccc gaaggaatag aagaagaagg
1741 tggagagaga gacagagaca gatccattcg attagtgaac ggatctcgac ggttaacttt
1801 taaaagaaaa ggggggattg gggggtacag tgcaggggaa agaatagtag acataatagc
1861 aacagacata caaactaaag aattacaaaa acaaattaca aaaattcaaa attttatcga
1921 tactagtatt atgcccagta catgacctta tgggactttc ctacttggca gtacatctac
1981 gtattagtca tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga
2041 tagcggtttg actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg
2101 ttttggcacc aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg
2161 caaatgggcg gtaggcgtgt acggtgggag gtctatataa gcagagctcg tttagtgaac
2221 cgtcagatcg cctggagacg ccatccacgc tgttttgacc tccatagaag attctagagc
2281 tagcgaattc gaatttaaat ggatccgcgg ccgcaaggat ctgcgatcgc tccggtgccc
2341 gtcagtgggc agagcgcaca tcgcccacag tccccgagaa gttgggggga ggggtcggca
2401 attgaacggg tgcctagaga aggtggcgcg gggtaaactg ggaaagtgat gtcgtgtact
2461 ggctccgcct ttttcccgag ggtgggggag aaccgtatat aagtgcagta gtcgccgtga
2521 acgttctttt tcgcaacggg tttgccgcca gaacacagct gaagcttcga ggggctcgca
2581 tctctccttc acgcgcccgc cgccctacct gaggccgcca tccacgccgg ttgagtcgcg
2641 ttctgccgcc tcccgcctgt ggtgcctcct gaactgcgtc cgccgtctag gtaagtttaa
2701 agctcaggtc gagaccgggc ctttgtccgg cgctcccttg gagcctacct agactcagcc
2761 ggctctccac gctttgcctg accctgcttg ctcaactcta cgtctttgtt tcgttttctg
2821 ttctgcgccg ttacagatcc aagctgtgac cggcgcctac gctagacgcc accatggaga
2881 gcgacgagag cggcctgccc gccatggaga tcgagtgccg catcaccggc accctgaacg
2941 gcgtggagtt cgagctggtg ggcggcggag agggcacccc caagcagggc cgcatgacca
3001 acaagatgaa gagcaccaaa ggcgccctga ccttcagccc ctacctgctg agccacgtga
3061 tgggctacgg cttctaccac ttcggcacct accccagcgg ctacgagaac cccttcctgc
3121 acgccatcaa caacggcggc tacaccaaca cccgcatcga gaagtacgag gacggcggcg
3181 tgctgcacgt gagcttcagc taccgctacg aggccggccg cgtgatcggc gacttcaagg
3241 tggtgggcac cggcttcccc gaggacagcg tgatcttcac cgacaagatc atccgcagca
3301 acgccaccgt ggagcacctg caccccatgg gcgataacgt gctggtgggc agcttcgccc
3361 gcaccttcag cctgcgcgac ggcggctact acagcttcgt ggtggacagc cacatgcact
3421 tcaagagcgc catccacccc agcatcctgc agaacggggg ccccatgttc gccttccgcc
3481 gcgtggagga gctgcacagc aacaccgagc tgggcatcgt ggagtaccag cacgccttca
3541 agacccccat cgccttcgcc agatcccgcg ctcagtcgtc caattctgcc gtggacggca
3601 ccgccggacc cggctccacc ggatctcgct aagtcgacaa tcaacctctg gattacaaaa
3661 tttgtgaaag attgactggt attcttaact atgttgctcc ttttacgcta tgtggatacg
3721 ctgctttaat gcctttgtat catgctattg cttcccgtat ggctttcatt ttctcctcct
3781 tgtataaatc ctggttgctg tctctttatg aggagttgtg gcccgttgtc aggcaacgtg
3841 gcgtggtgtg cactgtgttt gctgacgcaa cccccactgg ttggggcatt gccaccacct
3901 gtcagctcct ttccgggact ttcgctttcc ccctccctat tgccacggcg gaactcatcg
3961 ccgcctgcct tgcccgctgc tggacagggg ctcggctgtt gggcactgac aattccgtgg
4021 tgttgtcggg gaaatcatcg tcctttcctt ggctgctcgc ctgtgttgcc acctggattc
4081 tgcgcgggac gtccttctgc tacgtccctt cggccctcaa tccagcggac cttccttccc
4141 gcggcctgct gccggctctg cggcctcttc cgcgtcttcg ccttcgccct cagacgagtc
4201 ggatctccct ttgggccgcc tccccgcctg gtacctttaa gaccaatgac ttacaaggca
4261 gctgtagatc ttagccactt tttaaaagaa aaggggggac tggaagggct aattcactcc
4321 caacgaaaat aagatctgct ttttgcttgt actgggtctc tctggttaga ccagatctga
4381 gcctgggagc tctctggcta actagggaac ccactgctta agcctcaata aagcttgcct
4441 tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact ctggtaacta gagatccctc
4501 agaccctttt agtcagtgtg gaaaatctct agcagtagta gttcatgtca tcttattatt
4561 cagtatttat aacttgcaaa gaaatgaata tcagagagtg agaggaactt gtttattgca
4621 gcttataatg gttacaaata aagcaatagc atcacaaatt tcacaaataa agcatttttt
4681 tcactgcatt ctagttgtgg tttgtccaaa ctcatcaatg tatcttatca tgtctggctc
4741 tagctatccc gcccctaact ccgcccagtt ccgcccattc tccgccccat ggctgactaa
4801 ttttttttat ttatgcagag gccgaggccg cctcggcctc tgagctattc cagaagtagt
4861 gaggaggctt ttttggaggc ctagactttt gcagagacgg cccaaattcg taatcatggt
4921 catagctgtt tcctgtgtga aattgttatc cgctcacaat tccacacaac atacgagccg
4981 gaagcataaa gtgtaaagcc tggggtgcct aatgagtgag ctaactcaca ttaattgcgt
5041 tgcgctcact gcccgctttc cagtcgggaa acctgtcgtg ccagctgcat taatgaatcg
5101 gccaacgcgc ggggagaggc ggtttgcgta ttgggcgctc ttccgcttcc tcgctcactg
5161 actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc agctcactca aaggcggtaa
5221 tacggttatc cacagaatca ggggataacg caggaaagaa catgtgagca aaaggccagc
5281 aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg ctccgccccc
5341 ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg acaggactat
5401 aaagatacca ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc
5461 cgcttaccgg atacctgtcc gcctttctcc cttcgggaag cgtggcgctt tctcatagct
5521 cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg
5581 aaccccccgt tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc
5641 cggtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt agcagagcga
5701 ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc tacactagaa
5761 ggacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa agagttggta
5821 gctcttgatc cggcaaacaa accaccgctg gtagcggtgg tttttttgtt tgcaagcagc
5881 agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatcttttct acggggtctg
5941 acgctcagtg gaacgaaaac tcacgttaag ggattttggt catgagatta tcaaaaagga
6001 tcttcaccta gatcctttta aattaaaaat gaagttttaa atcaatctaa agtatatatg
6061 agtaaacttg gtctgacagt taccaatgct taatcagtga ggcacctatc tcagcgatct
6121 gtctatttcg ttcatccata gttgcctgac tccccgtcgt gtagataact acgatacggg
6181 agggcttacc atctggcccc agtgctgcaa tgataccgcg agacccacgc tcaccggctc
6241 cagatttatc agcaataaac cagccagccg gaagggccga gcgcagaagt ggtcctgcaa
6301 ctttatccgc ctccatccag tctattaatt gttgccggga agctagagta agtagttcgc
6361 cagttaatag tttgcgcaac gttgttgcca ttgctacagg catcgtggtg tcacgctcgt
6421 cgtttggtat ggcttcattc agctccggtt cccaacgatc aaggcgagtt acatgatccc
6481 ccatgttgtg caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc agaagtaagt
6541 tggccgcagt gttatcactc atggttatgg cagcactgca taattctctt actgtcatgc
6601 catccgtaag atgcttttct gtgactggtg agtactcaac caagtcattc tgagaatagt
6661 gtatgcggcg accgagttgc tcttgcccgg cgtcaatacg ggataatacc gcgccacata
6721 gcagaacttt aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa ctctcaagga
6781 tcttaccgct gttgagatcc agttcgatgt aacccactcg tgcacccaac tgatcttcag
6841 catcttttac tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa aatgccgcaa
6901 aaaagggaat aagggcgaca cggaaatgtt gaatactcat actcttcctt tttcaatatt
6961 attgaagcat ttatcagggt tattgtctca tgagcggata catatttgaa tgtatttaga
7021 aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccacct gacgtctaag
7081 aaaccattat tatcatgaca ttaacctata aaaataggcg tatcacgagg ccctttcgtc
7141 tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca
7201 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg
7261 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc
7321 accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc
7381 attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat
7441 tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt
7501 tttcccagtc acgacgttgt aaaacgacgg ccagtgccaa gctg(SEQ ID NO.11)
We found that MSCs transfected with these plasmids secrete GDNF and express individual mirnas. Thus, GDNF secreted by differentiated dopaminergic neurons is expected to provide survival signals to differentiated cells and endogenous dopaminergic neurons.
Construction of inducible mirnas.Implanted MSCs have been reported to migrateMigrate to damaged tissues of the central nervous system and exert neurotrophic and immunomodulatory effects. Specifically, in animal models of parkinson's disease, implanted MSCs have been shown to be transplanted (engraft) into the damaged striatum (striatum). In some embodiments, but not limited thereto, inducible miRNA precursor expression vectors may be used which will allow the induction of the expression of a particular miRNA precursor at a desired point in time. Thus, MSCs will be transfected with specific miRNA precursors and their expression will be induced at different time points prior to or subsequent to MSC transplantation in the damaged striatum. For such studies, we have employed inducible mirnas and staining (staining color) and a fluorescent protein reporter (reporter) using the Tet-on system (Clontech). This system allows the induction of specific mirnas (by way of example only, doxycycline) by the addition of promoters, and the identification of cells in which the mirnas are produced.
In summary, we have demonstrated the ability of miRNA124, miRNA137 and miRNA-9 to induce MSC transdifferentiation into NSCs/NPCs and neurons with a specific neuronal phenotype (miRNA 137). Other neuronal mirnas, such as miRNA-9 and miR218, can also affect MSC transdifferentiation and induce neuronal differentiation.
One advantage of using miRNA124 over existing methods, compared to transient differentiation induced by growth factor treatment, is: miRNA precursors can be stably expressed in MSCs, which will lead to long-term neuronal differentiation.
Our studies show that neuron-related mirnas can be used to induce long-term neuronal differentiation of MSCs for use in cell-based therapies in neurodegenerative disorders and spinal cord injury, which can be shown by the following, as just a few examples:
1. neuronal differentiation of MSCs by micrornas (miRNA-124, miRNA-137, and miRNA-9);
2. specific dopaminergic differentiation of MSCs by miRNA-137, miRNA-124 and miRNA-9; and
3. transient differentiation of MSCs into neural stem cell-like or neural progenitor-like cells is induced by micrornas. Transfection with mirnas provides an opportunistic window in which cells can be differentiated into different cell lines of the central nervous system (neurons, astrocytes and oligodendrocytes) or into specific neuronal phenotypes using specific combinations of transcription or growth factors. The window can be controlled by the level of miRNA expression or a specific time point after transfection.
The ability of mirnas to transdifferentiate MSCs into progenitor cells (committed neuronal cells) of undetermined differentiation direction and different subpopulations of neuronal cells makes it possible to use these cells for the treatment of a variety of neurological diseases, including spinal and peripheral nerve injury, damage to the central nervous system caused by bleeding or obstructive lesions ("CVA"), or traumatic central or peripheral nerve injury. In addition, transdifferentiated MSCs may be used in neurodegenerative diseases caused by idiopathic autoimmune diseases ("EAE") or diseases such as parkinson's disease or alzheimer's disease or diseases of unknown etiology such as ALS. In addition, improvement of nerve function by transdifferentiated MSCs can also be used in various degenerative diseases caused by drug-induced neuronal damage and/or toxicity.
Thus, in our study, miRNA-124, miRNA-137, and miRNA-9 promote neural differentiation of MSCs, with morphological changes and expression of phenotypic markers.
The induced mirnas of some embodiments can be administered and administered in accordance with good medical practice, taking into account the technique used to achieve the desired effect of the target MSCs, the clinical condition of the individual patient, the site and method of administration, the timing of administration, the age, sex, weight of the patient, and other factors known to the physician. The "pharmaceutically effective amount" for purposes herein can thus be determined by such considerations as are known in the art. The amount must be effective to achieve improvement, including, but not limited to, desired differentiation of MSCs in vivo and/or in vitro, reduction of damage and injury, or amelioration or elimination of symptoms, and other indicators selected by those of skill in the art as appropriate measures.
Embodiments of the present invention can expand the therapeutic window for the treatment of neurological injuries and diseases, and can be used to treat a large patient population suffering from such injuries and diseases in the united states each year. Thus, in some embodiments, the invention encompasses novel methods of preventing, controlling, or alleviating neurological injuries and diseases including, but not limited to, brain injury, neurodegeneration, or spinal cord injury in mammals by comprising selective use of the inducing mirnas of embodiments of the invention. According to some embodiments, such interventional therapy may be achieved, but is not limited to, inducing differentiation in target cells in vivo or in vitro by the use and/or administration of one or more such mirnas, for use in therapies that limit the impact of such injury or disease. Thus, some embodiments include novel compositions and methods for preventing, controlling, or reducing damage (including but not limited to brain damage) in mammals through the selective application and/or induction of transdifferentiated MSCs, without being limited to, nor without a specific disclaimer of the subject matter.
This application may refer to various publications, including but not limited to articles, reports, and U.S. patents, by author, citation, and/or by patent number. The disclosure of each of these documents is incorporated by reference into this application in its entirety.
While the present invention has been particularly shown and described with reference to the foregoing preferred and alternative embodiments, it will be understood by those skilled in the art that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention without departing from the spirit and scope of the invention as defined in the following claims. It is intended that the following claims define the scope of the invention and that the method and apparatus within the scope of these claims and their equivalents be covered thereby. This description of the invention should be understood to include all novel and non-obvious combinations of elements described herein, and claims may be presented in this or a later application to any novel and non-obvious combination of these elements. The foregoing embodiments are illustrative, and no single feature or element is essential to all possible combinations that may be claimed in this or a later application. Where the claims define "a" or "a first" element or the equivalent thereof, such claims should be understood to include incorporation of one or more such elements, neither requiring nor excluding two or more such elements.
Claims (18)
1. A method of stimulating neuronal differentiation of pluripotent stromal cells from a mammal, comprising the steps of:
providing a composition comprising microRNA-124, and
administering to a population of pluripotent stromal cells of a mammal a pharmaceutically effective amount of the composition to stimulate neuronal differentiation in the population.
2. The method of claim 1, wherein the mammal is a human.
3. A method of stimulating neuronal differentiation of pluripotent stromal cells from a mammal, comprising the steps of:
providing a composition comprising microRNA-137, and
administering to a population of pluripotent stromal cells of a mammal a pharmaceutically effective amount of the composition to stimulate neuronal differentiation in the population.
4. The method of claim 3, wherein the mammal is a human.
5. A method of stimulating neuronal differentiation of pluripotent stromal cells from a mammal, comprising the steps of:
providing a composition comprising microRNA-9, and
administering to a population of pluripotent stromal cells of a mammal a pharmaceutically effective amount of the composition to stimulate neuronal differentiation in the population.
6. The method of claim 5, wherein the mammal is a human.
7. Use of microrna-124 in a medicament for stimulating neuronal differentiation of pluripotent stromal stem cells in a mammal.
8. The use of claim 7, wherein the mammal is a human.
9. Use of microrna-137 in a medicament for stimulating neuronal differentiation of mesenchymal stem cells of a mammal.
10. The use of claim 9, wherein the mammal is a human.
11. Use of microrna-9 in a medicament for stimulating neuronal differentiation of pluripotent stromal cells in a mammal.
12. The use of claim 11, wherein the mammal is a human.
13. A method of treating a mammal suffering from a neurological injury or disease comprising the steps of:
stimulating neuronal differentiation of pluripotent stromal cells by exposing said cells in vitro to microrna-124, microrna-137, or microrna-9, alone or in any combination; and
administering such neuronal differentiated cells to the mammal.
14. The method of claim 13, wherein the mammal is a human.
15. A method of treating a mammal suffering from a neurological injury or disease comprising the steps of:
transfecting pluripotent stromal cells in vitro with microrna-124, microrna-137, or microrna-9, alone or in any combination; and
administering such transfected cells to said mammal.
16. The method of claim 15, wherein the mammal is a human.
17. A method of treating a mammal suffering from a neurological injury or disease comprising the steps of:
transfecting a pluripotent stromal cell with a vector comprising one or more nucleotides encoding microRNA-124, microRNA-137, or microRNA-9, alone or in any combination, wherein expression of such nucleotides in the vector is inducible by a promoter,
administering such transfected cells to said mammal, and
inducing expression of said nucleotide in said mammal by administering said promoter to said mammal to produce microRNA-124, microRNA-137, or microRNA-9.
18. The method of claim 15, wherein the mammal is a human.
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US61/185,773 | 2009-06-10 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| HK1175813A true HK1175813A (en) | 2013-07-12 |
Family
ID=
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20200063135A1 (en) | Methods, systems, and compositions for neuronal differentiation of multipotent stromal cells | |
| CN113549618B (en) | SARS-CoV-2 nucleic acid detection method based on RAA amplification and CRISPR-Cas13a system | |
| US20020025561A1 (en) | Vectors for gene-self-assembly | |
| CN106755092A (en) | GLCCI1 gene Cre-LoxP conditional gene knockout mouse model-based construction kit and construction method | |
| CN114933970B (en) | Toxoplasma gene knock-out strain lacking 6-phosphogluconate dehydrogenase 1 gene | |
| CN101405389A (en) | Novel protein expression system | |
| CN113584223A (en) | Method for identifying D614G mutation in SARS-CoV-2 based on CRISPR-Cas12a | |
| CN108285886A (en) | The method that recombined bacillus subtilis resting cell produces N-acetyl-neuraminate | |
| CN115678856A (en) | A kind of tumor killer cell and its application | |
| CN107937428B (en) | Construction method of carrier integrating functions of microRNA and CAR | |
| CN107312800B (en) | CIK capable of knocking down endogenous PD-1 expression and preparation method and application thereof | |
| CN111321163B (en) | Construction and application of bacillus subtilis linear plasmid system | |
| KR102624831B1 (en) | Production of transgenic dogs overexpressing muscle-specific PCK1 | |
| CN113073097B (en) | CHO cell endogenous temperature-sensitive promoter and application thereof | |
| CN114214347B (en) | Plasmid system for tracing liver precursor cells and application | |
| AU2020102457A4 (en) | Recombinant plasmid pmdmcherry, construction method of recombinant plasmid pmdmcherry, and method for labeling edwardsiella ictaluri by mcheey fluorescent protein genes | |
| AU2022312311A1 (en) | Anti-EGFRviii antibody, polypeptide, cell capable of expressing said polypeptide, pharmaceutical composition comprising said cell, method for producing said cell, and polynucleotide or vector comprising nucleotide sequence encoding said polypeptide | |
| CN113718047A (en) | Kit for detecting 10 bacteria in human breast milk by fluorescence quantitative method and application thereof | |
| CN114214459A (en) | African swine fever virus and porcine circovirus type 2 dual digital PCR detection primer composition and detection method thereof | |
| CN115707780B (en) | Lentiviral vector and application thereof | |
| CN112301059A (en) | CAR-NK transgenic vector based on replication-defective recombinant lentivirus and construction method and application thereof | |
| KR102468650B1 (en) | Recombinant vector inducing expression of T7 RNA polymerase and mRNA capping enzyme and uses thereof | |
| CN115216492B (en) | Preparation method and application of a mouse primary glioma model | |
| CN114540345B (en) | Label fluorescent probe with hairpin structure and fluorescent detection method | |
| CN114752615B (en) | CD19-targeting CAR-T cells overexpressing ATP5IF1 gene and their applications |