FR3009195A1 - COSMETIC OR DERMATOLOGICAL COMPOSITION AND USE THEREOF - Google Patents
COSMETIC OR DERMATOLOGICAL COMPOSITION AND USE THEREOF Download PDFInfo
- Publication number
- FR3009195A1 FR3009195A1 FR1357573A FR1357573A FR3009195A1 FR 3009195 A1 FR3009195 A1 FR 3009195A1 FR 1357573 A FR1357573 A FR 1357573A FR 1357573 A FR1357573 A FR 1357573A FR 3009195 A1 FR3009195 A1 FR 3009195A1
- Authority
- FR
- France
- Prior art keywords
- extract
- skin
- buds
- composition
- bud
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
- A61K8/97—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
- A61K8/9755—Gymnosperms [Coniferophyta]
- A61K8/9767—Pinaceae [Pine family], e.g. pine or cedar
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
- A61K8/97—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
- A61K8/9783—Angiosperms [Magnoliophyta]
- A61K8/9789—Magnoliopsida [dicotyledons]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
- A61Q19/08—Anti-ageing preparations
Abstract
La présente invention se rapporte, notamment, à une utilisation d'un extrait hydro-glycériné de bourgeons de pin comme actif anti-âge, une composition cosmétique comprenant un extrait de bourgeon de pin et un extrait de bourgeons de framboisier et/ou un extrait de bourgeons de cassis et/ou un extrait de bourgeons de hêtre. La présente invention se rapport également à un procédé de traitement cosmétique comprenant l'application d'une composition cosmétique comprenant un extrait de bourgeon de pin et un extrait de bourgeons de framboisier et/ou un extrait de bourgeons de cassis et/ou un extrait de bourgeons de hêtre.The present invention relates, in particular, to a use of a hydro-glycerinated extract of pine buds as an anti-aging active ingredient, a cosmetic composition comprising a pine bud extract and a raspberry bud extract and / or an extract of blackcurrant buds and / or an extract of beech buds. The present invention also relates to a cosmetic treatment method comprising the application of a cosmetic composition comprising a pine bud extract and a raspberry bud extract and / or an extract of blackcurrant buds and / or an extract of beech buds.
Description
COMPOSITION COSMETIQUE OU DERMATOLOGIQUE ET SON UTILISATION DESCRIPTION Domaine technique La présente invention se rapporte notamment à l'utilisation d'un extrait hydro-glycériné de bourgeons de pin comme actif anti-âge. La présente invention se rapporte également à une composition cosmétique comprenant un extrait de bourgeon de pin et un extrait de bourgeons de framboisier et/ou un extrait de bourgeons de cassis et/ou un extrait de bourgeons de hêtre, ainsi qu'à un procédé de soin cosmétique comprenant l'utilisation d'une composition cosmétique comprenant un extrait de bourgeon de pin et un extrait de bourgeons de framboisier et/ou un extrait de bourgeons de cassis et/ou un extrait de bourgeons de hêtre. La présente invention trouve une application notamment dans les domaines cosmétique et dermatologique. Dans la description ci-dessous, les références entre crochets ([ ]) renvoient à la liste des références présentées à la fin du texte.TECHNICAL FIELD The present invention relates in particular to the use of a hydro-glycerine extract of pine buds as an anti-aging active ingredient. The present invention also relates to a cosmetic composition comprising a pine bud extract and a raspberry bud extract and / or an extract of blackcurrant buds and / or an extract of beech buds, and to a method of cosmetic treatment comprising the use of a cosmetic composition comprising a pine bud extract and a raspberry bud extract and / or an extract of blackcurrant buds and / or an extract of beech buds. The present invention finds application particularly in the cosmetic and dermatological fields. In the description below, references in brackets ([]) refer to the list of references at the end of the text.
Etat de la technique Plus qu'une enveloppe extérieure, la peau est un organe à part entière qui joue un rôle essentiel, non seulement dans la protection du corps contre les agressions extérieures, mais aussi sur le plan esthétique et 25 émotionnel. Le vieillissement cutané peut entraîner une altération de perception de l'image corporelle avec, à terme, des symptômes dysmorphophobiques ou dépressifs tel que décrit dans Koblenzer CS. Psychologic aspects of aging and the skin. Clinics Dermatol 1996;14:171-7 [1]. Par ailleurs, les personnes ayant 30 des signes de vieillissement cutané sont souvent perçues par notre société comme étant en mauvaise santé et incapables d'initiatives (Koblenzer CS. Psychologic aspects of aging and the skin. Clinics Dermatol 1996;14:171-7 [1]). Ainsi, la demande thérapeutique et/ou cosmétique afin de prévenir le vieillissement cutané est aujourd'hui de plus en plus forte. Pour y répondre, une meilleure connaissance de sa physiopathologie, mais aussi de ses conséquences cliniques, est nécessaire. Comme tous les autres organes, la peau est soumise au vieillissement. Les facteurs chronologiques, génétiques et les facteurs endocriniens (Pierard GE. The quandary of climacteric skin ageing. Dermatology 1996;193:273-4 [2]), par exemple les bouleversements post-ménopausiques chez la femme, déterminent le vieillissement cutané intrinsèque. La peau est également soumise à des agressions extrinsèques qui, au fil du temps, amplifient le phénomène de vieillissement intrinsèque. Le rôle des rayons ultraviolets (UV) est majeur ainsi que les facteurs environnementaux (tabac, alcool, stress...). Avec l'âge, les différentes structures cutanées sont modifiées à la fois sur le plan morphologique et fonctionnel. Les principales conséquences sont un déclin des fonctions de défense, de cicatrisation, de perception et de thermo-régulation ainsi que l'installation d'un état inflammatoire chronique correspondant à une augmentation du nombre de macrophages et d'une sécheresse cutanée persistante (Harvell JD, Maibach HI. Percutaneous absorption and inflammation in aged skin: a review. J Am Acad Dermatol 1994;31:1015-21 [3]). En effet, dans l'épiderme, le stratum corneum devient plus perméable aux substances extérieures car moins riche en lipides et les kératinocytes se différencient plus lentement (Ghadially R.Aging and the epidermal permeability barrier : implication for contact dermatisis. Am J Contact Dermat. 1998 Sep;9(3):162-9. [4]).Dans le derme, outre une diminution des protéines matricielles, l'accumulation de composés matriciels non dégradés (élastose) génère une inflammation chronique basale majorée par des facteurs externes (stress/oxydation/UV) et internes (Giacomoni PU, Rein G. Factors of skin ageing share common mechanisms. Biogerontology. 2001;2(4):219-29. [5]). Les travaux récents considèrent que le vieillissement résulte d'altérations dues à des facteurs extrinsèques, intrinsèques auxquelles se rajoute une altération de l'immunité systémique impliquant un microenvironnement immunosuppresseur touchant principalement l'immunité innée. Cette immunosuppression locale empêche alors le développement des réponses immunitaires à point de départ local ou à expression cutanée et inhibe les fonctions phagocytaires des macrophages leur empêchant de dégrader la matrice extracellulaire altérée suite à une élastose physiologique et/ou pathologique. Cette altération de l'immunité systémique se traduit par une baisse de réponse qualitative et quantitative de tous les acteurs cellulaires (cellules dendritiques/ cellules NK/ lymphocytes B/ lymphocytes Treg) impliqués dans l'immunité innée mais aussi dans l'immunité adaptative (Frasca D, Blomberg BB. Effects of aging on B cell function. Curr Opin Immunol. 2009 [7] / Haynes L, Maue AC. Effects of aging on T celI function. Curr Opin Immunol, 2009 [8]). Au niveau de la réponse adaptative humorale, le nombre de lymphocytes B et leurs progéniteurs est diminué et l'affinité, la spécificité et les classes d'anticorps produits sont affectées. En ce qui concerne l'immunité innée, les macrophages produisent moins de cytokines inflammatoires en réponse aux attaques microbiennes du fait de la diminution d'expression des Toll Like Recepteurs ou d'une anomalie de la signalisation intracellulaire.State of the art More than an outer shell, the skin is an organ in its own right which plays an essential role, not only in the protection of the body against external aggressions, but also in terms of aesthetics and emotion. Skin aging can lead to an alteration of body image perception with, ultimately, dysmorphophobic or depressive symptoms as described in Koblenzer CS. Psychological aspects of aging and the skin. Clinics Dermatol 1996; 14: 171-7 [1]. On the other hand, people with signs of skin aging are often perceived by our society to be in poor health and incapable of initiative (Koblenzer CS, Psychologic aspects of aging and the skin, Clinics Dermatol 1996; 14: 171-7 [ 1]). Thus, the therapeutic and / or cosmetic application to prevent skin aging is now becoming stronger. To answer it, a better knowledge of its physiopathology, but also of its clinical consequences, is necessary. Like all other organs, the skin is subject to aging. Chronological, genetic, and endocrine factors (Pierard GE, Theory of climacteric skin aging, Dermatology 1996, 193: 273-4 [2]), such as postmenopausal changes in women, determine intrinsic skin aging. The skin is also subjected to extrinsic aggressions which, over time, amplify the phenomenon of intrinsic aging. The role of ultraviolet (UV) is major as well as environmental factors (tobacco, alcohol, stress ...). With age, the different skin structures are morphologically and functionally altered. The main consequences are a decline in defense, healing, perception and thermo-regulation functions as well as the establishment of a chronic inflammatory state corresponding to an increase in the number of macrophages and persistent dry skin (Harvell JD , Maibach HI, Percutaneous uptake and inflammation in aged skin: a review by J Am Acad Dermatol 1994; 31: 1015-21 [3]). Indeed, in the epidermis, the stratum corneum becomes more permeable to external substances because it is less rich in lipids and the keratinocytes differentiate more slowly (Ghadially R.Aging and the epidermal permeability barrier: implication for contact dermatisis.) Am J Contact Dermat. 1998 Sep; 9 (3): 162-9. [4]) In the dermis, in addition to a decrease in matrix proteins, the accumulation of non-degraded matrix compounds (elastosis) generates a chronic basal inflammation increased by external factors ( stress / oxidation / UV) and internal (Giacomoni PU, Rein G. Factors of skin aging common shares, Biogerontology, 2001; 2 (4): 219-29. [5]). Recent work considers that aging results from alterations due to intrinsic extrinsic factors, to which is added an alteration of the systemic immunity involving an immunosuppressive microenvironment mainly affecting innate immunity. This local immunosuppression then prevents the development of locally initiated immune responses or cutaneous expression and inhibits the phagocytic functions of macrophages preventing them from degrading the altered extracellular matrix following a physiological and / or pathological elastosis. This alteration of systemic immunity results in a decrease in the qualitative and quantitative response of all cellular actors (dendritic cells / NK cells / B cells / Treg lymphocytes) involved in innate immunity but also in adaptive immunity (Frasca D, Blomberg BB, Effects of aging on cell function, Curr Opin Immunol 2009 [7] / Haynes L, Maue AC, Effects of aging on T celI function, Curr Opin Immunol, 2009 [8]). At the level of the humoral adaptive response, the number of B cells and their progenitors is decreased and the affinity, specificity and classes of antibodies produced are affected. With respect to innate immunity, macrophages produce fewer inflammatory cytokines in response to microbial attack due to decreased expression of Toll Like Receptors or abnormal intracellular signaling.
Concernant les cellules dendritiques, le nombre et la fonction des cellules dendritiques myéloïdes et plasmacytoides sont impactés avec baisse d'initiation de la réponse immunitaire et inefficacité dans cette réponse. Concernant les cellules Natural Killer (NK) jouant un rôle important dans la défense innée contre les infections, leurs fonctions sont altérées avec baisse de l'activité cytotoxique et moins de cytokines produites ayant un effet sur la réponse adaptative (Vitale M, Zamai L, Neri LM, Galanzi A, Facchini A, Rana R, Cataldi A, Papa S. The impairment of natural killer function in the healthy aged is due to a postbinding deficient mechanism. 1992 [9]). De nombreuses compositions anti-âges sont connues dans l'état de la technique. Toutefois, ces compositions ne permettent pas de protéger la peau des agressions extérieures et ainsi de protéger la peau, en particulier de prévenir le vieillissement prématuré de la peau résultant notamment de facteurs extrinsèques et/ou intrinsèque. Il existe donc un réel besoin de trouver un nouveau composé, 30 composition et/ou un moyen permettant simultanément de traiter le vieillissement cutané prématuré et/ou des causes à l'origine de ce vieillissement prématuré tout en protégeant la peau des agressions extérieures palliant l'ensemble des défauts, inconvénients et obstacles de l'art antérieur cités ci-dessus. Exposé de l'invention La présente invention a précisément pour but de répondre à ce besoin en fournissant un extrait hydro-glycériné de bourgeons de pin pour son utilisation comme actif anti-âge dans une composition cosmétique. La présente invention se rapporte également à une composition cosmétique comprenant au moins un extrait de bourgeon de pin et un extrait de bourgeons de framboisier. Dans la présente par « bourgeons » on entend un ensemble de très jeunes pièces foliaires ou florales regroupées sur un axe extrêmement court, riche de cellules méristématiques. Il peut s'agir, par exemple de bourgeons à bois qui engendrent des rameaux feuilles, des bourgeons à fleurs qui engendrent des rameaux fleuris, de bourgeons mixtes générateurs de feuilles et de fleurs ou d'un mélange de ceux-ci. Dans la présente par « pin », on entend un arbre du genre Pinus de la famille des Pinaceae. Dans la présente par « extrait de bourgeon de pin» on entend tout extrait connu de l'homme du métier. Il peut s'agir par exemple d'un extrait choisi parmi un extrait liposoluble ou un extrait hydrosoluble de bourgeons de pin ou un mélange de ceux-ci. Dans la présente par « extrait liposoluble » on entend un extrait riche en acide gras et/ou en matière grasse et/ou un extrait non hydrosoluble, il peut s'agir par exemple d'un extrait huileux. Il peut s'agir par exemple d'un extrait obtenu par extraction huileuse par hyperfréquence, par extraction supercritique, par macération dans un solvant huileux, par extraction huileuse assistée par ultra sons ou par distillation. Dans la présente par « extrait hydrosoluble » on entend un extrait soluble dans l'eau. Il peut s'agir d'un extrait aqueux, hydro-alcoolique, hydro- glycériné ou hydro-alco-glycériné. Il peut s'agir par exemple d'un extrait obtenu, par exemple par distillation, par macération, par extraction assistée par hyperfréquence ou par ultrasons.Concerning dendritic cells, the number and function of myeloid and plasmacytoid dendritic cells are impacted with decreased immune response initiation and inefficiency in this response. Concerning Natural Killer (NK) cells playing an important role in the innate defense against infections, their functions are impaired with decreased cytotoxic activity and fewer cytokines produced having an effect on the adaptive response (Vitale M, Zamai L, Neri LM, Galanzi A, Facchini A, Rana R, Catalida A, Papa S. The impairment of natural killer function in the healthy aged is due to a postbinding deficient mechanism 1992 [9]). Many anti-aging compositions are known in the state of the art. However, these compositions do not protect the skin from external aggressions and thus protect the skin, in particular to prevent premature aging of the skin resulting in particular from extrinsic and / or intrinsic factors. There is therefore a real need to find a new compound, a composition and / or a means simultaneously making it possible to treat premature cutaneous aging and / or the causes causing this premature aging while protecting the skin from external aggression overcoming premature aging. all the defects, disadvantages and obstacles of the prior art mentioned above. SUMMARY OF THE INVENTION The present invention is specifically intended to meet this need by providing a hydro-glycerinated extract of pine buds for use as an anti-aging active ingredient in a cosmetic composition. The present invention also relates to a cosmetic composition comprising at least one pine bud extract and a raspberry bud extract. In the present "buds" is meant a set of very young foliar or floral parts grouped on an extremely short axis, rich in meristematic cells. These may include, for example, woody buds that produce leafy twigs, flowering buds that produce flowering twigs, mixed buds that generate leaves and flowers, or a mixture of them. In the present "pine" is meant a tree of the genus Pinus of the family Pinaceae. As used herein, "pine bud extract" means any extract known to those skilled in the art. It may be for example an extract selected from a fat-soluble extract or a water-soluble extract of pine buds or a mixture thereof. As used herein, "fat-soluble extract" means an extract rich in fatty acid and / or fat and / or a non-water-soluble extract, for example, an oily extract. It may be, for example, an extract obtained by oily extraction by microwave, by supercritical extraction, by maceration in an oily solvent, by oily extraction assisted by ultra sounds or by distillation. As used herein, "water-soluble extract" means a water-soluble extract. It may be an aqueous extract, hydro-alcoholic, hydroglycerine or hydro-alco-glycerine. It may be for example an extract obtained, for example by distillation, by maceration, by microwave assisted extraction or by ultrasound.
Selon l'invention, l'extrait de bourgeon de pin peut être un extrait hydroglycériné. Il peut s'agir par exemple d'un extrait hydroglycériné de bourgeon de pin obtenu par extraction aqueuse selon le procédé comprenant notamment une étape de cryo-broyage des bourgeons de pin puis une extraction aqueuse à température ambiante, par exemple à 25°C. Ensuite, une étape de séparation solide/liquide et une étape de clarification peuvent être effectuée. Puis, de la glycérine, par exemple environ 30% en poids par rapport au poids de l'extrait clarifié, de l'acide citrique et des conservateurs par exemple un mélange de benzoate de sodium et de sorbate de potassium peuvent être rajoutés à l'extrait clarifié. Enfin, une étape de filtration stérilisante, par exemple avec un filtre avec des pores d'un diamètre de 0,2pm, est effectuée permettant ainsi l'obtention d'un extrait hydroglycériné de bourgeon de pin Selon l'invention l'extrait hydro-glycériné de bourgeons de pin peut être un extrait commercial, par exemple un extrait commercialisé par la Société Vitaflor, par exemple le produit Vitaflor Extrait de Bourgeons Bio Pin Sylvestre. Selon l'invention, l'extrait de bourgeons de pin peut être présent dans la composition à une concentration comprise de 0,01% à 10% en poids par rapport au poids total de la composition, par exemple de 0,05 à 1`)/0 en poids par rapport au poids total de ladite composition.According to the invention, the pine bud extract can be a hydroglycerine extract. It may be, for example, a hydroglycerin extract of pine bud obtained by aqueous extraction according to the process comprising in particular a cryo-grinding step of the pine buds and then an aqueous extraction at ambient temperature, for example at 25 ° C. Then, a solid / liquid separation step and a clarification step can be performed. Then, glycerin, for example about 30% by weight relative to the weight of the clarified extract, citric acid and preservatives, for example a mixture of sodium benzoate and potassium sorbate may be added to the clarified extract. Finally, a sterilizing filtration step, for example with a filter with pores with a diameter of 0.2 μm, is carried out thus making it possible to obtain a hydroglycerinated extract of pine bud. According to the invention, the hydrophilic extract is Glycerine of pine buds may be a commercial extract, for example an extract marketed by the Vitaflor Company, for example the product Vitaflor Extract Buds Bio Sylvester. According to the invention, the pine bud extract may be present in the composition at a concentration of from 0.01% to 10% by weight relative to the total weight of the composition, for example from 0.05 to 1%. By weight relative to the total weight of said composition.
Selon l'invention, la composition cosmétique dans laquelle est utilisée un extrait hydro-glycériné de bourgeons de pin comme actif anti-âge peut comprendre en outre un extrait de bourgeons de framboisier. Dans la présente par « framboisier », on entend un arbre du genre Rubus de la famille des Rosacae.According to the invention, the cosmetic composition in which a hydro-glycerinated extract of pine buds is used as an anti-aging active agent may furthermore comprise an extract of raspberry buds. In the present "raspberry" means a tree of the genus Rubus of the family Rosacae.
Dans la présente par « bourgeons de framboisier » on entend des bourgeons tel que définis précédemment, par exemple des bourgeons à bois, des bourgeons à fleurs, des bourgeons mixtes ou un mélange de ceux-ci. Dans la présente par « l'extrait de bourgeons de framboisier » on entend tout extrait connu de l'homme du métier ; il peut s'agir par exemple d'un extrait liposoluble, un extrait hydrosoluble ou un mélange de ceux-ci. Selon l'invention, l'extrait hydrosoluble de bourgeon de framboisier peut être un extrait aqueux, hydro-alcoolique, hydro-glycériné ou hydro-alcoglycériné. Il peut s'agir par exemple d'un extrait obtenu, par exemple par distillation, par macération, par extraction assistée par hyperfréquence ou par ultrasons. Selon l'invention l'extrait hydrosoluble de bourgeon de framboisier peut être un extrait hydro-alco-glycériné. Il peut s'agir par exemple d'un extrait commercial, par exemple le produit « Framboisier bourgeons bio Hydro- alcoolique glycériné» commercialisé par la société par Greentech. Selon l'invention, l'extrait de bourgeons de framboisier peut être présent dans la composition par exemple à une concentration de 0,01 à 10% en poids par rapport au poids total de ladite composition, par exemple de 0,1 à 1 en poids par rapport au poids total de ladite composition. Selon l'invention, la composition cosmétique dans laquelle est utilisée un extrait hydro-glycériné de bourgeons de pin comme actif anti-âge peut comprendre en outre un extrait de bourgeons de cassis. Dans la présente par « cassis », on entend un arbrisseau du genre Ribes de la famille des Grossulariaceae. Dans la présente par « bourgeons cassis» on entend des bourgeons tel que définis précédemment, par exemple des bourgeons à bois, des bourgeons à fleurs, des bourgeons mixtes ou un mélange de ceux-ci. Selon l'invention, « l'extrait de bourgeons de cassis » peut être un extrait liposoluble, un extrait hydrosoluble ou un mélange de ceux-ci. Selon l'invention l'extrait hydrosoluble de bourgeons de cassis peut être un extrait hydro-alcoolique glycériné, il peut s'agir par exemple du produit « Cassis bourgeons bio Hydro-alcoolique glycériné (M&L)» commercialisé par la société par Greentech.In the present "raspberry buds" are meant buds as defined above, for example wood buds, flower buds, mixed buds or a mixture thereof. In the present "raspberry bud extract" is meant any extract known to those skilled in the art; it may be for example a liposoluble extract, a water-soluble extract or a mixture thereof. According to the invention, the water-soluble extract of raspberry bud may be an aqueous extract, hydro-alcoholic, hydro-glycerine or hydro-alcoglycerine. It may be for example an extract obtained, for example by distillation, by maceration, by microwave assisted extraction or by ultrasound. According to the invention, the water-soluble extract of raspberry bud can be a hydro-alco-glycerine extract. It may be for example a commercial extract, for example the product "raspberry bio buds Hydro-alcoholic glycerine" marketed by the company Greentech. According to the invention, the raspberry bud extract may be present in the composition, for example at a concentration of 0.01 to 10% by weight relative to the total weight of said composition, for example from 0.1 to 1% by weight. weight relative to the total weight of said composition. According to the invention, the cosmetic composition in which a hydro-glycerinated extract of pine buds is used as an anti-aging active agent may also comprise an extract of blackcurrant buds. In the present "cassis" is meant a shrub of the genus Ribes of the family Grossulariaceae. In the present "blackcurrant buds" are meant buds as defined above, for example wood buds, flower buds, mixed buds or a mixture thereof. According to the invention, "blackcurrant bud extract" can be a fat-soluble extract, a water-soluble extract or a mixture thereof. According to the invention, the water-soluble extract of blackcurrant buds may be a glycerine hydro-alcoholic extract, it may be for example the product "Cassis buds organic Hydro-alcoholic glycerine (M & L)" marketed by the company Greentech.
Selon l'invention, l'extrait de bourgeons de cassis peut être présent dans la composition par exemple à une concentration de 0,01 à 10% en poids par rapport au poids total de ladite composition, par exemple de 0,1 à 1% en poids par rapport au poids total de ladite composition. Selon l'invention, la composition cosmétique dans laquelle est utilisée un extrait hydro-glycériné de bourgeons de pin comme actif anti-âge peut comprendre en outre un extrait de bourgeons de hêtre. Dans la présente par « hêtre », on entend un arbre du genre Fagus de la famille de Fagaceae.According to the invention, the extract of blackcurrant buds may be present in the composition, for example at a concentration of 0.01 to 10% by weight relative to the total weight of said composition, for example from 0.1 to 1% by weight relative to the total weight of said composition. According to the invention, the cosmetic composition in which a hydro-glycerinated extract of pine buds is used as an anti-aging active agent may further comprise an extract of beech buds. In the present "beech" means a tree of the genus Fagus of the family Fagaceae.
Dans la présente par « bourgeons de hêtre» on entend des bourgeons tel que définis précédemment, par exemple des bourgeons à bois, des bourgeons à fleurs, des bourgeons mixtes ou un mélange de ceux-ci. Selon l'invention, « l'extrait de bourgeons de hêtre » peut être un extrait liposoluble, un extrait hydrosoluble ou un mélange de ceux-ci. Selon l'invention l'extrait hydrosoluble de bourgeons de hêtre peut être un extrait aqueux, il peut s'agir par exemple de l'extrait aqueux «Gatuline RC Bio)» commercialisé par la société par la société Gattefossé 5 Rue Montesquieu 92018 Nanterre, France.As used herein, "buds of beech" means buds as defined above, for example wood buds, flower buds, mixed buds or a mixture thereof. According to the invention, "the beech bud extract" may be a fat-soluble extract, a water-soluble extract or a mixture thereof. According to the invention the water-soluble extract of beech buds may be an aqueous extract, it may be for example the aqueous extract "Gatuline RC Bio" marketed by the company by the company Gattefossé 5 Rue Montesquieu 92018 Nanterre, France.
Selon l'invention, l'extrait de bourgeons de hêtre peut être présent dans la composition par exemple à une concentration de 0,01 à 10% en poids par rapport au poids total de ladite composition, par exemple de 0,1 à 3% en poids par rapport au poids total de ladite composition. La présente invention a également pour objet une composition cosmétique comprenant au moins un extrait de bourgeon de pin et un extrait de bourgeons de framboisier. L'extrait de bourgeon de pin et l'extrait de bourgeon de framboisier sont tels que définis précédemment. Selon l'invention, la composition cosmétique comprenant au moins un extrait de bourgeon de pin et un extrait de bourgeons de framboisier peut comprendre en outre au moins un, au moins 2 extraits choisi dans le groupe comprenant un extrait de bourgeon de cassis et un extrait de bourgeon de hêtre. L'extrait de bourgeon de cassis et l'extrait de bourgeon de hêtre sont tels que définis précédemment. Les concentrations en poids des différents extraits dans la composition cosmétique sont tels que définis précédemment. Selon l'invention, les extraits de bourgeons de pin, de cassis, de framboisier et de hêtre ou le mélange des quatre extraits ou la composition de la présente invention peut être ajoutée par exemple à une composition cosmétique existante ou faire l'objet, par exemple, d'une composition propre, c'est à dire développée spécialement pour recevoir la composition cosmétique ou dermatologique de la présente invention.According to the invention, the extract of beech buds may be present in the composition, for example at a concentration of 0.01 to 10% by weight relative to the total weight of said composition, for example from 0.1 to 3% by weight relative to the total weight of said composition. The present invention also relates to a cosmetic composition comprising at least one pine bud extract and a raspberry bud extract. Pine bud extract and raspberry bud extract are as previously defined. According to the invention, the cosmetic composition comprising at least one pine bud extract and a raspberry bud extract may further comprise at least one, at least 2 extracts selected from the group consisting of a blackcurrant bud extract and an extract. of beech bud. Blackcurrant bud extract and beech bud extract are as previously defined. The concentrations by weight of the various extracts in the cosmetic composition are as defined above. According to the invention, the extracts of pine buds, blackcurrant, raspberry and beech or the mixture of the four extracts or the composition of the present invention can be added for example to an existing cosmetic composition or be the subject, by for example, a composition proper, that is developed specifically to receive the cosmetic or dermatological composition of the present invention.
Selon l'invention, quel que soit l'extrait ou le mélanges d'extraits utilisés, la composition cosmétique ou dermatologique de la présente invention peut comprendre en outre au moins un agent actif additionnel choisi, par exemple parmi un agent anti-âge, un agent hydratant, un agent apaisant, un agent agissant sur la micro-circulation, un agent raffermissant, un agent tenseur ou un mélange de ces agents. Ces agents peuvent être ceux couramment utilisés dans les produits cosmétiques et/ou dermatologiques. Des exemples d'agents anti-âges utilisables peuvent être par exemple un extrait d'avoine. Des exemples d'agents hydratants utilisables peuvent être par exemple la glycérine ou l'acide hyaluronique. Des exemples d'agents apaisants utilisables peuvent être par exemple le bisabolol ou l'alentoïne. Des exemples d'agent agissant sur la micro-circulation peuvent être par exemple des extraits de corallina officinalis. Des exemples d'agents raffermissants peuvent être par exemple un extrait de seigle (riche en arabinoxylanes), des agents tenseurs par exemple des oligopeptides d'hibiscus. Ce ou ces agent(s) peuvent être utilisé(s) dans la composition de la présente invention par exemple aux concentrations usuellement utilisées et connues de l'homme du métier dans les compositions cosmétiques ou dermatologiques. La composition cosmétique ou dermatologique selon l'invention peut comprendre un ou plusieurs adjuvants connus de l'homme du métier. Il peut s'agir par exemple d'un ou plusieurs adjuvant(s) choisi(s) parmi des agents de type esters, des agents émollients, des agents épaississants minéraux, des agents épaississants organiques, associatifs ou non, des filtres solaires minéraux, des parfums, des conservateurs, des céramides, et pseudo- céramides, des vitamines et les provitamines, des protéines, des agents séquestrants, des agents alcanisants, des agents acidifiants, des agents réducteurs, des agents oxydants, des charges minérales, des colorants ou tout autre adjuvant pouvant être cité dans le dictionnaire INCI (International Nomenclature Cosmetic Ingredients) publié par le PCPC (Personnal Care Products council). Selon l'invention, la composition cosmétique ou dermatologique peut, par exemple, se présenter sous toute forme connue de l'homme du métier. Il peut s'agir, par exemple d'une émulsion huile-dans-l'eau, eau-dans-l'huile, d'une émulsion multiple, d'une mini-émulsion, d'une microémulsion, d'une nanoémulsion, d'une émulsion solide, d'un gel aqueux ou hydro-alcoolique, d'une crème, d'un lait, d'une pommade, d'un baume, d'un onguent d'un gel, d'un masque, d'une poudre, d'un support imbibé, par exemple un patch transdermique, d'une huile, d'une lotion aqueuse ou hydroalcoolique et/ou une cire. Selon l'invention, la composition cosmétique ou dermatologique peut être sous toute forme connue de l'homme du métier dans les domaines de la cosmétique et de la dermatologie, sans aucune restriction galénique particulière. La composition cosmétique ou dermatologique peut être sous toute forme galénique connue de l'homme du métier, par exemple sous la forme d'un onguent, d'une crème, d'une huile, d'un lait, d'une pommade, d'une poudre, d'un stick, d'un tampon imbibé, d'un patch transdermique, d'une solution, d'un gel, d'un spray, d'une lotion ou d'une suspension. Il peut s'agir par exemple d'une crème, d'un lait, d'un gel, d'un onguent, d'un patch transdermique. La composition cosmétique selon la présente invention peut être, par exemple une composition pour le soin du visage, du corps, par exemple des compositions pour le visage et/ou le corps.According to the invention, whatever the extract or mixture of extracts used, the cosmetic or dermatological composition of the present invention may further comprise at least one additional active agent chosen, for example from an anti-aging agent, a moisturizing agent, a soothing agent, an agent acting on the micro-circulation, a firming agent, a tightening agent or a mixture of these agents. These agents may be those commonly used in cosmetic and / or dermatological products. Examples of useful anti-aging agents may be, for example, oat extract. Examples of moisturizing agents that may be used may be, for example, glycerine or hyaluronic acid. Examples of soothing agents that may be used may be, for example, bisabolol or allantoin. Examples of agents acting on micro-circulation may be for example extracts of corallina officinalis. Examples of firming agents may be, for example, a rye extract (rich in arabinoxylans), tensing agents, for example hibiscus oligopeptides. This or these agent (s) may be used in the composition of the present invention for example at the concentrations usually used and known to those skilled in the cosmetic or dermatological compositions. The cosmetic or dermatological composition according to the invention may comprise one or more adjuvants known to those skilled in the art. It may be, for example, one or more adjuvants chosen from among ester type agents, emollient agents, mineral thickeners, organic thickeners, associative or not, mineral sunscreens, perfumes, preservatives, ceramides, and pseudo-ceramides, vitamins and provitamins, proteins, sequestering agents, alkanizing agents, acidifying agents, reducing agents, oxidizing agents, mineral fillers, dyes or any other adjuvant that may be listed in the INCI (International Nomenclature Cosmetic Ingredients) dictionary published by the PCPC (Personnal Care Products council). According to the invention, the cosmetic or dermatological composition may, for example, be in any form known to those skilled in the art. It may be, for example an oil-in-water emulsion, water-in-oil, a multiple emulsion, a mini-emulsion, a microemulsion, a nanoemulsion , a solid emulsion, an aqueous or hydro-alcoholic gel, a cream, a milk, an ointment, a balm, an ointment of a gel, a mask , a powder, an impregnated support, for example a transdermal patch, an oil, an aqueous or hydroalcoholic lotion and / or a wax. According to the invention, the cosmetic or dermatological composition may be in any form known to those skilled in the fields of cosmetics and dermatology, without any particular pharmaceutical restriction. The cosmetic or dermatological composition may be in any galenical form known to those skilled in the art, for example in the form of an ointment, a cream, an oil, a milk, an ointment, a powder, a stick, an impregnated buffer, a transdermal patch, a solution, a gel, a spray, a lotion or a suspension. It may be for example a cream, a milk, a gel, an ointment, a transdermal patch. The cosmetic composition according to the present invention may be, for example a composition for the care of the face, of the body, for example compositions for the face and / or the body.
La composition cosmétique selon l'invention peut être obtenue par tout procédé approprié connu de l'homme du métier pour la fabrication d'une composition cosmétique et/ou dermatologique. Il peut s'agir, par exemple d'un simple mélange. Il peut s'agir également, par exemple, d'un procédé comprenant une étape d'incorporation d'une phase interne dans une phase externe au moyen d'un émulseur, par exemple d'une turbine de type rotor- stator. Il peut s'agir également par exemple d'un procédé utilisant la Température d'Inversion de Phase (TIP), procédé classiquement utilisé par l'homme de l'art pour obtenir des émulsions huile dans eau dont les gouttelettes dispersées sont particulièrement fines, par exemple avec un diamètre de 0,1 à 1 pm. Selon l'invention, la composition cosmétique peut être une composition utilisée dans un traitement anti-âge Il peut s'agir par exemple d'une composition cosmétique pour le traitement du vieillissement cutanée, par exemple des rides et ridules. Selon l'invention, le traitement cosmétique peut-être un traitement un traitement anti-âge, un traitement protecteur.The cosmetic composition according to the invention can be obtained by any appropriate method known to those skilled in the art for the manufacture of a cosmetic and / or dermatological composition. It may be, for example a simple mixture. It may also be, for example, a method comprising a step of incorporating an internal phase into an external phase by means of an emulsifier, for example a rotor-stator type turbine. It may also be for example a method using the Phase Inversion Temperature (TIP) method conventionally used by those skilled in the art to obtain oil-in-water emulsions whose dispersed droplets are particularly fine, for example with a diameter of 0.1 to 1 μm. According to the invention, the cosmetic composition may be a composition used in an anti-aging treatment. It may be, for example, a cosmetic composition for the treatment of cutaneous aging, for example wrinkles and fine lines. According to the invention, the cosmetic treatment may be a treatment anti-aging treatment, a protective treatment.
La présente invention a également pour objet un procédé de traitement cosmétique comprenant l'application sur la peau d'une composition cosmétique comprenant au moins un extrait de bourgeon de pin et un extrait de bourgeon de framboisier. La présente invention a également pour objet un procédé de traitement cosmétique comprenant l'application sur la peau d'une composition cosmétique comprenant au moins un extrait de bourgeon de pin, au moins un extrait de bourgeons de framboisier et au moins un extrait de bourgeons de cassis. La présente invention a également pour objet un procédé de traitement cosmétique comprenant l'application sur la peau d'une composition cosmétique comprenant au moins un extrait de bourgeon de pin, au moins un extrait de bourgeons de framboisier, au moins un extrait de bourgeons de cassis et au moins un extrait de bourgeons de hêtre. Selon l'invention, le traitement cosmétique peut-être, un traitement anti-âge, un traitement raffermissant, un traitement protecteur. L'extrait de bourgeon de pin, l'extrait de bourgeons de framboisier, l'extrait de bourgeons de cassis, l'extrait de bourgeons de hêtre sont tels que définis ci-dessus. Pour cette application, on peut, par exemple, utiliser les formes galéniques décrites ci-dessus. L'application sur la peau peut donc être réalisée en fonction de la forme galénique utilisée. Il peut s'agir, par exemple d'une simple application sur la peau ou d'une application accompagnée d'un massage de la peau avec la composition de la présente invention.The present invention also relates to a cosmetic treatment method comprising the application on the skin of a cosmetic composition comprising at least one pine bud extract and a raspberry bud extract. The present invention also relates to a cosmetic treatment method comprising the application on the skin of a cosmetic composition comprising at least one pine bud extract, at least one raspberry bud extract and at least one bud extract. Cassis. The subject of the present invention is also a cosmetic treatment method comprising the application on the skin of a cosmetic composition comprising at least one pine bud extract, at least one raspberry bud extract, at least one extract of buds of blackcurrant and at least one extract of beech buds. According to the invention, the cosmetic treatment may be an anti-aging treatment, a firming treatment, a protective treatment. Pine bud extract, raspberry bud extract, blackcurrant bud extract, beech bud extract are as defined above. For this application, it is possible, for example, to use the galenic forms described above. The application to the skin can therefore be carried out according to the dosage form used. It may be, for example a simple application to the skin or an application accompanied by a massage of the skin with the composition of the present invention.
L'application est de préférence réalisée avec une quantité suffisante de la composition afin que toute la surface de la peau à traiter soit traitée. Il peut s'agir par exemple d'une application classique, comme une crème sur la peau. Il peut s'agir par exemple aussi d'une application pour former un masque traitant. L'application peut être, par exemple une application quotidienne, hebdomadaire et bi-mensuelle. Il peut s'agir par exemple d'une application une fois par jour, deux fois par jour ou plus. La présente invention se rapporte également à une trousse de soin cosmétique comprenant une composition cosmétique selon la présente invention et un manuel ou une notice d'utilisation. La trousse peut être par exemple un conditionnement.The application is preferably carried out with a sufficient amount of the composition so that the entire surface of the skin to be treated is treated. It may be for example a conventional application, such as a cream on the skin. For example, it may also be an application for forming a treating mask. The application can be, for example a daily, weekly and bi-monthly application. This may be for example an application once a day, twice a day or more. The present invention also relates to a cosmetic care kit comprising a cosmetic composition according to the present invention and a manual or instructions for use. The kit can be for example a packaging.
Le manuel ou cette notice peut avoir notamment pour fonction d'expliquer à l'utilisateur la manière et la fréquence d'application sur la peau la composition de la présente invention. Selon l'invention, la trousse de soin cosmétique peut également comprendre un applicateur, par exemple une spatule, une brosse, un applicateur dynamique, par exemple un dispositif de massage imprégné de la composition cosmétique de l'invention. Les inventeurs de la présente invention ont clairement démontré et de manière surprenante que la présente invention permet avantageusement d'obtenir un effet anti-âge sur la peau tout en protégeant la peau des agressions extérieures. En outre, les inventeurs de la présente invention ont clairement démontré que la composition selon l'invention permet avantageusement au niveau épidermique de renforcer la fonction barrière et de lissage de la peau en surface via l'obtention d'une couche cornée plus régulière. Ainsi, les inventeurs de la présente invention ont démontré que la composition selon l'invention permet, de manière surprenante de diminuer les rides et ridules tout en protégeant la peau des agressions extérieures susceptibles d'induire un vieillissement de la peau, par exemple la formation de rides ou ridules. En outre et de manière surprenante, les inventeurs de la présente invention ont démontré que la composition selon l'invention permet en outre et avantageusement une stimulation de la microcirculation cutanée permettant ainsi d'illuminer le teint.The manual or this notice may have the particular function of explaining to the user how and how often the composition of the present invention is applied to the skin. According to the invention, the cosmetic care kit may also comprise an applicator, for example a spatula, a brush, a dynamic applicator, for example a massage device impregnated with the cosmetic composition of the invention. The inventors of the present invention have clearly demonstrated and surprisingly that the present invention advantageously allows to obtain an anti-aging effect on the skin while protecting the skin from external aggressions. In addition, the inventors of the present invention have clearly demonstrated that the composition according to the invention advantageously allows the epidermal level to enhance the barrier function and smoothing of the skin on the surface via obtaining a more regular stratum corneum. Thus, the inventors of the present invention have demonstrated that the composition according to the invention makes it possible, surprisingly, to reduce wrinkles and fine lines while protecting the skin against external aggressions likely to induce an aging of the skin, for example the formation wrinkles or fine lines. In addition and surprisingly, the inventors of the present invention have demonstrated that the composition according to the invention also allows and advantageously a stimulation of the cutaneous microcirculation thus making it possible to illuminate the complexion.
La composition selon l'invention permet donc avantageusement l'obtention d'un effet cosmétique anti-âge complet via, notamment, la diminution des rides et ridules, la protection de la peau vis-à-vis des agressions extérieures susceptibles d'induire un vieillissement cutané et un effet éclaircissant du teint renforçant ainsi l'effet cosmétique anti-âge de la composition selon l'invention. D'autres caractéristiques et avantages apparaîtront encore à l'homme du métier à la lecture des exemples ci-dessous, donnés à titre illustratif et non limitatif.The composition according to the invention therefore advantageously makes it possible to obtain a complete anti-aging cosmetic effect via, in particular, the reduction of wrinkles and fine lines, the protection of the skin vis-à-vis the external aggressions likely to induce a cutaneous aging and a lightening effect of the complexion thus reinforcing the anti-aging cosmetic effect of the composition according to the invention. Other features and advantages will become apparent to those skilled in the art on reading the examples below, given by way of illustration and not limitation.
EXEMPLES Exemple 1 : Exemple de compositions cosmétique pour le soin du visage selon la présente invention Une composition de base décrite dans le tableau 1 ci-dessous a été préparée par mélange des différents composants indiqués dans le tableau 1 ci-dessous : Tableau 1 : composition de base pour le visage Ingrédients Quantité en % par rapport au poids total de la composition (%) Agents hydratants (glycérine) 1 à 15% Gélifiant (xanthan gum) 0,1 à 1,5% Huile végétale 0,5 à 5% Caprylique/caprique triglycérides 0,1 à 10% Parfum Qsp Conservateurs Qsp Eau qsp 100% Le procédé utilisé pour la fabrication de la composition comprenait les étapes suivantes : - Mélanger dans un récipient de l'eau et des agents hydratants à une vitesse de 1500 tours par minute jusqu'à dissolution, - Disperser sous agitation à une vitesse de 1500 tours par minute du gélifiant dans cette phase aqueuse jusqu'à dissolution, - Introduire sous agitation à une vitesse de 1500 tours par minute de la phase huileuse préalablement préparée par mélange d'huile végétale, par exemple d'une huile d'amande douce, et de caprylic/capric Triglycérides jusqu'à obtention d'un gel/crème homogène. - Ajouter du parfum et des conservateurs, par exemple le benzoate de sodium A partir de cette composition de base, des compositions pour le soin du corps, ont été fabriquées. Plusieurs compositions différentes conformes à la 15 présente invention ont été élaborées en ajoutant différents extraits en différentes concentrations. Les pourcentages en poids des différents extraits sont indiqués dans le tableau 2 suivant. Tableau 2 : Pourcentage en poids des extraits de bourgeons de pin 20 sylvestre, de framboisier, de cassis et de hêtre par rapport au poids de la composition % en poids % en poids % en poids % en poids d'extrait de d'extrait de d'extrait de d'extrait de bourgeons de bourgeons de bourgeons de bourgeons de pin sylvestre framboisier cassis par hêtre par Compositions par rapport par rapport au rapport au rapport au au poids total poids total de poids total de poids total de de la la composition la la composition (%) composition composition (%) (%) (%) 1 0,01 0,05 0,05 0,05 2 0,01 0,3 0,3 0,5 3 0,05 0,3 0,3 0,3 4 0,05 0,5 0,5 2 0,05 0,5 0,5 0,5 6 0,05 0,65 0,65 0,65 7 0,03 0,8 0,2 1 8 0,05 0,6 0,1 0,5 9 0,9 0,9 0,5 2 2 1 0,5 2 11 1,5 1 0,5 1 12 0,5 0,5 0,5 0,5 En outre, des compositions conformes à la présente ont été également produites et comprenaient en outre 0,05% d'oligopeptides d'hibiscus, 4% d'un extrait d'avoine bio riche en polysaccharides (effet tenseur). 5 Exemple 2 : Effet d'un extrait hydroglycériné de bourgeons de pin ou d'un extrait hydro-alco-glycériné de bourgeons de framboisier ou d'un extrait hydro-alcool-glycériné de bourgeons de cassis ou d'un extrait aqueux de bourgeons de hêtre et/ou du mélange des quatre pour, inhiber la 10 génération de ROS et stimuler la différenciation et prolifération épidermique et la prolifération dermique. Les expériences ont été réalisées avec un extrait hydroglycériné de bourgeons de pin ou d'un extrait hydro-alcool glycériné de bourgeons de framboisier ou d'un extrait hydro-alcool glycériné de bourgeons de cassis ou d'un extrait aqueux de bourgeons de hêtre et/ou du mélange des quatre. Pour l'extrait hydrosoluble de bourgeons de pin, il s'agissait d'un extrait hydro-glycériné de bourgeons de pin, de chez Greentech. obtenu par extraction aqueuse à température ambiante puis ensuite addition de glycérine - Pour l'extrait hydrosoluble de bourgeons de framboisier, il s'agissait d'un extrait hydro-alcool glycériné développé par les laboratoires M&L, obtenu par extraction sous agitation, à 50°C selon les étapes suivantes : cryo-broyage des bourgeons de framboisier puis extraction dans un mélange eau/alcool/glycérine dans les mêmes rapports (33/33/33) avec un ratio de bourgeons de 20% en poids par rapport au poids total du mélange. L'extraction a été réalisée sous agitation à 50°C environ pendant plusieurs heures, à savoir au moins 2 heures. Ensuite, séparation solide/liquide, clarification et filtration stérilisante ont été effectuées. - Pour l'extrait hydrosoluble de bourgeons de cassis, il s'agissait d'un extrait hydro-alcool glycériné développé par les laboratoires M&L, obtenu par extraction assistée par ultrasons selon le procédé décrit dans l'ouvrage « Eco-extraction du végétal » (F. Chemat, Editions Dunod, 2011) - Pour l'extrait hydrosoluble de bourgeons de hêtre, il s'agissait d'un extrait aqueux de bourgeons de hêtre disponible dans le commerce et commercialisé par la société Gattefossé. Le but de ces expériences était de valider ex vivo par une analyse transcriptomique par Puces à ADN, l'inhibition de la génération de ROS, la stimulation de la différenciation et prolifération épidermique et la prolifération dermique, la stimulation de gènes impliqués ou susceptible d'être impliqués dans la protection de la peau ou l'inhibition de gènes susceptibles d'être impliqués dans le vieillissement cutané, avec par un exemple de composition selon l'invention. Le transcriptome est l'ensemble des ARN messager, molécules servant de matrice pour la synthèse des protéines, issus de l'expression d'une partie du génome d'un tissu cellulaire ou d'un type de cellule. La caractérisation et la quantification du transcriptome dans un tissu donné et dans des conditions données ont permis d'identifier les gènes actifs, de déterminer les mécanismes de régulation d'expression des gènes et de définir les réseaux d'expression des gènes. Une des techniques utilisées pour mesurer simultanément le niveau d'expression d'un grand nombre de types différents d'ARN messager est celle de la puce à ADN tel que décrit dans la publication de Seitz et al (Seitz G, Bonin M, Fuchs J et al. Inhibition of glutathione-S-transferase as a treatment strategy for multidrug resistance in childhood rhabdomyosarcoma. International Journal of Oncology 2010 [10]). Les puces à ADN permettent de mesurer et de visualiser très rapidement les différences d'expression entre les gènes et ceci à l'échelle d'un génome complet. 1. Matériel et méthode 1.1 Préparation des échantillons : Des extraits de bourgeons de pin, de framboisier, de cassis et de bourgeons de hêtre et la combinaison de ces quatre extraits aux différentes concentrations présentées dans l'exemple 1 ont été réalisés en vue des analyses transcriptomiques. Après avoir réalisé un test de viabilité cellulaire, selon le procédé décrit dans la publication de T. Mosmann (Tim Mosmann.EXAMPLES Example 1: Example of cosmetic compositions for the care of the face according to the present invention A base composition described in Table 1 below was prepared by mixing the various components indicated in Table 1 below: Table 1: Composition Ingredients Amount in% relative to the total weight of the composition (%) Moisturizing agents (glycerin) 1 to 15% Gelling agent (xanthan gum) 0.1 to 1.5% Vegetable oil 0.5 to 5% Caprylic / capric triglycerides 0.1 to 10% Perfume Qsp Preservatives Qsp Water qs 100% The process used to manufacture the composition included the following steps: - Mix in a container water and moisturizing agents at a speed of 1500 RPM until dissolution, - Disperse with stirring at a speed of 1500 rpm of the gelling agent in this aqueous phase until dissolution, - Introduce stirring at a speed of 1500 revolutions per mi of the oily phase previously prepared by mixing vegetable oil, for example a sweet almond oil, and caprylic / capric triglycerides until a gel / cream homogeneous. Adding perfume and preservatives, for example sodium benzoate From this base composition, body care compositions have been manufactured. Several different compositions according to the present invention have been developed by adding different extracts in different concentrations. The percentages by weight of the various extracts are indicated in the following Table 2. Table 2: Percentage by weight of Scotch pine, raspberry, blackcurrant and beech bud extracts based on the weight of the composition% by weight% by weight% by weight% by weight of the extract of the extract of bud extract extract buds of blackcurrant pine buds blackcurrant beech per beech by Compositions compared to ratio to ratio to total weight total weight of total weight of total weight of composition composition (%) composition composition (%) (%) (%) 1 0.01 0.05 0.05 0.05 2 0.01 0.3 0.3 0.5 3 0.05 0.3 0 , 3 0.3 4 0.05 0.5 0.5 2 0.05 0.5 0.5 0.5 6 0.05 0.65 0.65 0.65 7 0.03 0.8 0, 2 1 8 0.05 0.6 0.1 0.5 9 0.9 0.9 0.5 2 2 1 0.5 2 11 1.5 1 0.5 1 12 0.5 0.5 0, In addition, compositions in accordance with the present invention were also produced and further comprised 0.05% hibiscus oligopeptides, 4% organic polysaccharide-rich oat extract (tensor effect). Example 2: Effect of a hydroglycerinated extract of pine buds or a hydro-alco-glycerinated extract of raspberry buds or a hydro-alcohol-glycerine extract of blackcurrant buds or an aqueous extract of buds of beech and / or the mixture of the four to inhibit the generation of ROS and to stimulate differentiation and epidermal proliferation and dermal proliferation. The experiments were carried out with a hydroglycerinized extract of pine buds or a hydro-alcoholic glycerine extract of raspberry buds or a glycerine hydro-alcohol extract of blackcurrant buds or an aqueous extract of beech buds and / or the mixture of the four. For the water-soluble extract of pine buds, it was a hydro-glycerine extract of pine buds, from Greentech. obtained by aqueous extraction at room temperature and then addition of glycerine - For the water-soluble extract of raspberry buds, it was a hydro-alcohol glycerine extract developed by M & L laboratories, obtained by extraction with stirring, at 50 ° C according to the following steps: cryo-grinding the raspberry buds and extraction in a water / alcohol / glycerine mixture in the same ratios (33/33/33) with a bud ratio of 20% by weight relative to the total weight of the mixed. The extraction was carried out with stirring at approximately 50 ° C. for several hours, namely at least 2 hours. Then, solid / liquid separation, clarification and sterilizing filtration were performed. - For the water-soluble extract of blackcurrant buds, it was a hydro-alcohol glycerine extract developed by the M & L laboratories, obtained by ultrasonic assisted extraction according to the process described in the book "Eco-extraction of the plant" (F. Chemat, Dunod Editions, 2011) - For the water-soluble extract of beech buds, it was an aqueous extract of beech buds commercially available and marketed by Gattefossé. The purpose of these experiments was to validate ex vivo by transcriptomic DNA chip analysis, inhibition of ROS generation, stimulation of epidermal differentiation and proliferation and dermal proliferation, stimulation of genes involved or susceptible to be involved in the protection of the skin or the inhibition of genes likely to be involved in skin aging, with an example of composition according to the invention. The transcriptome is the set of messenger RNAs, molecules that serve as a template for the synthesis of proteins, resulting from the expression of a part of the genome of a cellular tissue or a cell type. The characterization and quantification of the transcriptome in a given tissue and under given conditions made it possible to identify the active genes, to determine the mechanisms of regulation of gene expression and to define the expression networks of the genes. One of the techniques used to simultaneously measure the level of expression of a large number of different types of messenger RNA is that of the DNA chip as described in the publication of Seitz et al (Seitz G, Bonin M, Fuchs J et al Inhibition of glutathione-S-transferase as a treatment strategy for multidrug resistance in childhood rhabdomyosarcoma International Journal of Oncology 2010 [10]). DNA microarrays can measure and visualize very quickly the differences in expression between genes at the level of a complete genome. 1. Material and Method 1.1 Preparation of Samples: Extracts of pine buds, raspberry, blackcurrant and beech buds and the combination of these four extracts at the different concentrations presented in Example 1 were made for analysis transcriptomics. After carrying out a cell viability test, according to the method described in the publication of T. Mosmann (Tim Mosmann.
Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. Journal of Immunological Methods [11]) permettant de déterminer pour chaque extrait et le complexe la concentration maximale non toxique diluée à appliquer in-vitro, des explants de peau provenant de lifting du visage d'une patiente âgée de 62 ans ont été incubés 2 0 indépendamment en présence de chaque extrait ou du mélange des quatre pendant 24h dans du DMEM (Dulbecco/Vogt modified Eagle's minimal essential medium) sans sérum à 37°C en atmosphère humide à 5% de CO2. Un expiant de peau non traité a été incubé dans les mêmes conditions. Le tableau 2 récapitule les concentrations appliquées pour chaque extrait et le mélange. 25 Tableau 3 : concentrations maximales non toxiques exprimées en % pour chaque extrait de bourgeons de pin, framboisier, cassis et de hêtre et du mélange de ces quatre extraits. composition % en poids Extrait bourgeons de pin 0,5 Extrait bourgeons de framboisier 0,5 Extrait bourgeons de cassis 0,5 1.2 Extraction des ARN totaux et amplification linéaire Après incubation, les explants de peau ont été broyés puis les ARN totaux issus de chaque expiant ont été extraits en utilisant le RNeasy Kit (Qiagen, Hilden, Germany). Les ARN totaux ont été ensuite quantifiés puis la qualité a été vérifiée en utilisant le BlOanalyzer 2100 avec le RNA 6000 Nano LabChip Kit (Agilent Technologies, Boblingen, Germany). Un RIN obtenu entre 7,5 et 10 atteste de la bonne qualité des ARN totaux issus chaque expiant préalablement incubés ou non avec les quatre extraits de bourgeons de pin, framboisier, cassis et de bourgeons de hêtre ainsi que le mélange. 1.3 Mesure de l'expression génique sur puce oligonucléotide et acquisition des données : Les puces oligonucléotides Affymetrix Human Gene 1.0 ST Whole 15 Genome ont été utilisées pour chaque analyse d'expression génique (GeneChip HU Gene 1.0, Affymetrix, Santa Clara, USA). Le protocole expérimental est décrit dans la publication de Seitz Seitz et al [10]. Plus simplement, les cycles de rétrotranscription et d'amplification des ARN totaux en ARNc puis en ADNc ont été réalisés à l'aide des kits 20 Ambion WT Expression (Ambion, Applied Biosystem, USA) et du kit GeneChip WT terminal Labelling and Hybridization User (Affymetrix). L'hybridation des puces et les mesures ont été réalisées par les Microarray Facility Tubingen. Les Puces ont ensuite été scannées en utilisant le scanner GCS3000 Gene Chip (Affymetrix) et le software GCOS 1.4. Les images scannées ont été ensuite 25 analysées en utilisant la console Expression 1.0 (Affymetrix) afin de convertir Extrait bourgeons de hêtre 0,1 0,1°A en poids d'extrait de bougeons de pin 0,5 % en poids d'extrait de bougeons de framboisier 0,5 %en poids d'extrait de bougeons de cassis 0,5 %en poids d'extrait de bougeons de hêtre Mélange des 4 extraits de bourgeons des mesures d'intensité lumineuse en données numériques et de normaliser ces données. L'analyse complète des données et une analyse statistique ont été réalisées grâce au logiciel Genespring GX 11 (Agilent Technologies) sur la base, en particulier, d'algorithmes de classification. Des différences d'expression de gènes ainsi obtenues suite à l'application des différents extraits de bourgeons et/ou du mélange des quatre sur des explants de peau par rapport à un expiant non traité sont rassemblées dans le tableau 5. La valeur des gènes différentiellement exprimés entre la peau non traitée et la peau traitée chacun des quatre extraits de bourgeons et/ou le mélange des quatre présente une p-value < 0,01 (valeur statistique très significative). 1.4 Validation des données d'expression génique par PCR en temps réel Afin de valider au niveau génique, par une autre méthode, ces données, une expérience de QPCR a été réalisée sur quatre gènes cibles SOD2, TGFB2, IL7R, et CCL19 impliqués dans la protection de la peau, par exemple dans la lutte contre le vieillissement intrinsèque de la peau. Pour cela, des amorces en position 3' et 5 `de chaque gène ont été sélectionnés puis synthétisés afin d'amplifier chaque gène pris séparément. Le tableau 4 regroupe la séquence et les caractéristiques de ces amorces.Rapid colorimetric assay for cell growth and survival: Application to proliferation and cytotoxicity assays. Journal of Immunological Methods [11]) to determine for each extract and the complex the maximum non-toxic diluted concentration to be applied in-vitro, skin explants from facelift of a patient aged 62 were incubated 2 0 independently in the presence of each extract or the mixture of four for 24 hours in DMEM (Dulbecco / Vogt modified Eagle minimal essential medium) without serum at 37 ° C in a humid atmosphere at 5% CO2. An untreated skin explant was incubated under the same conditions. Table 2 summarizes the concentrations applied for each extract and the mixture. Table 3: non-toxic maximum concentrations expressed in% for each pine, raspberry, blackcurrant and beech bud extract and the mixture of these four extracts. composition% by weight Pine bud extract 0.5 Raspberry bud extract 0.5 Blackcurrant bud extract 0.5 1.2 Total RNA extraction and linear amplification After incubation, the skin explants were crushed and then the total RNA from each Expiant were extracted using the RNeasy Kit (Qiagen, Hilden, Germany). The total RNAs were then quantified and then the quality was verified using the BlOanalyzer 2100 with the RNA 6000 Nano LabChip Kit (Agilent Technologies, Boblingen, Germany). An INR obtained between 7.5 and 10 attests to the good quality of the total RNA from each explant previously incubated or not with the four extracts of pine buds, raspberry, blackcurrant and beech buds and the mixture. 1.3 Measurement of Gene Expression on an Oligonucleotide Chip and Data Acquisition: The Affymetrix Human Gene 1.0 ST Whole Genome oligonucleotide chips were used for each gene expression analysis (GeneChip HU Gene 1.0, Affymetrix, Santa Clara, USA). The experimental protocol is described in the publication of Seitz Seitz et al [10]. More simply, the cycles of retrotranscription and amplification of the total RNAs in cRNA then in cDNA were carried out using the Ambion WT Expression kits (Ambion, Applied Biosystem, USA) and the GeneChip WT kit Terminal Labeling and Hybridization User (Affymetrix). The hybridization of the chips and the measurements were carried out by Microarray Facility Tubingen. The chips were then scanned using the Gene Chip GCS3000 scanner (Affymetrix) and the GCOS 1.4 software. The scanned images were then analyzed using the Expression 1.0 (Affymetrix) console to convert 0.1 to 0.1% beech bud extract by weight of pine bud extract 0.5% by weight of extract of raspberry bud 0.5% by weight of black currant extract 0.5% by weight of beech bud extract Blend of 4 bud extracts from light intensity measurements in digital data and to normalize these data . Comprehensive data analysis and statistical analysis were performed using Genespring GX 11 software (Agilent Technologies) based, in particular, on classification algorithms. Differences in gene expression thus obtained following the application of the different bud extracts and / or the mixture of the four on skin explants compared to an untreated explant are collated in Table 5. The value of the genes differentially expressed between the untreated skin and the treated skin each of the four bud extracts and / or the mixture of the four has a p-value <0.01 (very significant statistical value). 1.4 Validation of gene expression data by real-time PCR In order to validate at the gene level, by another method, these data, a QPCR experiment was performed on four target genes SOD2, TGFB2, IL7R, and CCL19 involved in the protection of the skin, for example in the fight against the intrinsic aging of the skin. For this purpose, primers at the 3 'and 5' positions of each gene were selected and then synthesized in order to amplify each gene taken separately. Table 4 groups together the sequence and the characteristics of these primers.
Tableau 4 : séquence et caractéristiques des amorces permettant d'amplifier SOD2, TGFB2, IL7R, et CCL19 amorces Séquence EN BASE TM %GC SEQ ID NO SOD2 L aagtaccaggaggcgttgg 60 58 1 SOD2 R tgaacttcagtgcaggctga 60 50 2 IL7R L aaagttttaatgcacgatgtagctt 59 32 3 IL7R R tgtgctggataaattcacatgc 60 41 4 TGFB2 L ccaaagggtacaatgccaac 60 50 5 TGFB2 R cagatgcttctggatttatggtatt 59 36 6 CCL19 L gcctgctggttctctggac 60 63 7 CCL19 R ggatgggtttctgggtcac 60 58 8 GAPDH L agccacatcgctcagacac 60 58 9 GAPDH R gcccaatacgaccaaatcc 60 53 10 Une étape de rétrotranscription a été tout d'abord réalisée en utilisant le système Superscript First-Srand Synthesis System for RT-PCR (lnvitrogen Corp, Carlsbad, CA) des ARN issus des explants de peau précédant (Devilard E, Bladou F, Ramuz O, Karsenty G, Dalès JP, Gravis G, Nguyen C, Bertucci F, Xerri L, Birnbaum D. FGFR1 and WT1 are markers of human prostate cancer progression. BMC Cancer. 2006 [12]). Les expériences de PCR en temps réel ont été réalisées en utilisant le LightCycler 2.0 Detection (Roche Diagnostic, Suisse) en triplicate avec la GAPDH comme gène de référence et contrôle interne. Le kit d'amplification utilisé dans cette expérience est le FastStart DNA Master plus SYBR Green I Master Mix (Roche Diagnostics, Suisse) (Devilard E, Bladou F, Ramuz O, Karsenty G, Dalès JP, Gravis G, Nguyen C, Bertucci F, Xerri L, Birnbaum D. FGFR1 and WT1 are markers of human prostate cancer progression. BMC Cancer. 2006 Nov 30; 6:272. [12]). 2/ RESULATS 2.1 Profil d'expression génique (« gene profiling ») Tableau 5 : différence d'expression génique et signification biologique des gènes suite à l'application d'extraits de bourgeons de pin sur des 20 explants de peau par rapport à un même expiant non traité. GENES dbEST FONCTIONS STATUT: stimulation par rapport à la peau non traitée S100A9 S100 NM 002965.3 - précurseurs qui régulent la X 6,5 (protéine de différentiation des kératinocytes liaison au en fonction du flux calcique calcium "calcium binding protein A9") S100A8 S100 NM 002964.4 - précurseurs qui régulent la X4,5 (protéine de différentiation des kératinocytes liaison au en fonction du flux calcique calcium "calcium binding protein A8") S100A7 S100 NM 002963.3 précurseurs qui régulent la X 6,5 (protéine de différentiation des kératinocytes liaison au en fonction du flux calcique+ calcium "calcium acteur antimicrobien binding protein A7") SPRR4 (petite NM_173080.1 protéine sécrétée en réponse à X 6,5 protéine 4 riche une agression environnementale en proline) (UV) de la barrière cutanée afin de prévenir sa réparation SPRR2C (petite BC120937.1 Impliqué dans la différentiation X 8,5 protéine 2C riche tardive des kératinocytes et en proline) constitue une famille de protéines structurales formant l'enveloppe cornée avec l'involucrine et la loricrine SPRR2G NM 0010142 Impliqué dans la différentiation X 8,5 (petite protéine 91.3 tardive des kératinocytes et 2G riche en constitue une famille de proline) protéines structurales formant l'enveloppe cornée avec l'involucrine et la loricrine SPRR2E NM 0010242 Impliqué dans la différentiation X 8 (petite protéine 09.2 tardive des kératinocytes et 2E riche en constitue une famille de proline ) protéines structurales formant l'enveloppe cornée avec l'involucrine et la loricrine SPRR2F NM 0010144 Impliqué dans la différentiation X8 (petite protéine 50.1 tardive des kératinocytes et 2F riche en constitue une famille de proline ) protéines structurales formant l'enveloppe cornée avec l'involucrine et la loricrine LCE1B (proteine NM_178349.1 Impliqué dans la différentiation X 5,5 de l'enveloppe terminale des kératinocytes et cornifiée 1B) constituent une famille de protéines avec d'autres qui constitue stratum corneum LCE2C (proteine NM_178429.2 Impliqué dans la différentiation X 7,5 de l'enveloppe terminale des kératinocytes et cornifiée 2C) constituent une famille de protéines avec d'autres qui constitue stratum corneum LCE1A (proteine NM_178348.2 Impliqué dans la différentiation X 4,5 de l'enveloppe terminale des kératinocytes et cornifiée 1A) constituent une famille de protéines avec d'autres qui constitue stratum corneum CCL18 NM 002988.2 - Chémokine impliquée dans la X8,5 (chemokine 18 à régulation de la balance entre motif CCL) inflammation et système immunitaire CXCL9 NM 002416.1 _ Chémokine impliquée dans la X 5,5 (chemokine 9 à signalisation des lymphocytes T motif C-X-C ) (Immunité adaptative) CCL20 NM 004591.2 - Chémokine sécrétée par les X 4,5 (chemokine 20 à cellules dendritiques à visée motif CCL) antimicrobienne (Immunité innée) CCL19 NM 006274.2 _ En se fixant au récepteur CCR7, X 5,5 (chemokine 19 à joue un rôle central dans la motif CCL) signalisation des lymphocytes T et dans la migration des lymphocytes B et T (Immunité adaptative) et a une action anti- inflammatoire CD276 (Cluster BC011578.2 Protéine appartenant à la famille X 3 de des Immunoglobulines Designation276) impliquées dans les réponses humorales (Immunité adaptative) IL27RA NM 004843.3 - Protéine impliquée dans les X2 (Récepteur alpha réponses de type Th1 et Th2 de l'interleukine (Immunité Adaptative) 27) CCR7 NM 001838.3 - Ce récepteur active les X2 (Récepteur de la lymphocytes B et T (Immunité chemokine 7à adaptative) motif C-C) IFITM3 (Protéine NM006435.2 Protéine à visée anti-virale X2 transmembranair (Immunité innée) e 3 induisant l'interféron) CXCL1 BT006880.1 Joue un rôle très important dans X4,5 (chemokine 1 à l'homéostasie, le développement motif C-X-C) et la fonction du système immunitaire avec action anti- inflammatoire LYZ (lysozyme) NM 000239.2 Protéine antimicrobienne X8 présente dans la salive, les larmes, la peau, le lait humain, le plasma..... (Immunité innée) PTAFR BT009801.1 Joue un rôle significatif dans la X2 (Récepteur au vasculogénèse /angiogénèse facteur d'activation plaquettaire) TNFAIP6 NM 007115.3 Protéine primordiale à action X 5,5 (Facteur tumoral anti-inflammatoire de necrose induisant la protéine alpha 6) IDO1 NM 002164.5 Cette enzyme joue un rôle dans X5,5 (indoleamine 2,3- dioxygenase 1) de nombreux processus pathologiques avec des actions pléitropiques antimicrobienne, anti-inflammatoire, anti-tumorale et anti-oxydante LCN2 (lipocaline NM -005564.3 Protéine antimicrobienne X3 2) permettant d'attirer les macrophages et polynucléaires neutrophiles sur les lieux de la blessure (Immunité innée) Dans le tableau 5 précité, Xn représente le facteur de stimulation par rapport à la peau non traitée. Tel que démontré dans le tableau 5 ci-dessus, l'extrait de bourgeon de pin augmente significativement l'expression des gènes CXCL9, CCL9, CD276, IL27RA, CCR7, CXCL1 impliquée dans l'immunité adaptative et permettant de restaurer efficacement les fonctions cellulaires des lymphocytes B et T. De plus, l'expression des gènes LYZ, LNC2, CCL20, IFITM2 permettant d'alerter efficacement lors d'agressions microbiennes, de restaurer efficacement les fonctions cellulaires des macrophages, cellules dendritiques et polynucléaires, est surexprimé en présence de l'extrait de bourgeons de pin contrant ainsi un état immunosuppresseur impliquant immunité innée et immunité adaptative jouant un rôle clé dans le vieillissement cutané et/ou l'inflammation cutané chronique (« l'Inflammaging »). Par ailleurs, l'expression des gènes TNFAIP6, CCL19, CXC1 et CCL18 est surexprimée dans l'extrait de bourgeons de pin permettant ainsi de limiter un éventuel état inflammatoire chronique et permettant de nouveau d'assurer un équilibre au niveau de la peau entre inflammation et immunité. Les gènes IDO1 et SPRR4 sont également surexprimés dans l'extrait de bourgeons permettant ainsi de stimuler les défenses cutanées mais également de lutter contre la génération de ROS et l'action des UV permettant ainsi de protéger la peau tout en évitant une aggravation d'un éventuel état inflammatoire et/ou d'un état inflammatoire chronique (« Inflammaging »). De plus, les gènes du Cluster de Différentiation Epidermique (famille S100A, famille LCE, famille SPRR) sont surexprimés permettant la stimulation de la différentiation kératinocytaire assurant ainsi une meilleure régénération de l'épiderme et un meilleur lissage de surface limitant ainsi l'impact d'un éventuel état inflammatoire de la peau (« Inflammaging ») tout en facilitant de nouveau une meilleure différentiation épidermique. Tout ceci permet au niveau épidermique de renforcer la fonction barrière et de lissage de la peau en surface via l'obtention d'une couche cornée plus régulière. L'extrait de pin stimule également l'expression de PTAFR, gène impliqué dans l'angiogenèse physiologique et pathologique, permettant ainsi d'illuminer le teint en stimulant la microcirculation cutanée, qui est perturbée lors du vieillissement de la peau et/ou d'un état inflammatoire de la peau.Table 4: Sequence and Characteristics of Primers for Amplifying SOD2, TGFB2, IL7R, and CCL19 Primers Sequence BASIC TM% GC SEQ ID NO SOD2 L agagaccaggaggggggggggg 58 SOD2 R tgaacttcagtgcaggctga 60 50 2 IL7R L aaagttttaatgcacgatgtagctt 59 32 3 IL7R R tgtgctggataaattcacatgc 60 41 4 60 50 TGFB2 L ccaaagggtacaatgccaac 5 TGFB2 R cagatgcttctggatttatggtatt 59 36 6 L gcctgctggttctctggac CCL19 CCL19 R 60 63 7 60 58 8 GAPDH ggatgggtttctgggtcac agccacatcgctcagacac L 60 58 9 GAPDH R gcccaatacgaccaaatcc 60 53 10 a step of reverse transcription was first performed using the Superscript First-Srand Synthesis System for RT-PCR system (Invitrogen Corp., Carlsbad, CA) RNAs from previous skin explants (Devilard E, Bladou F, Ramuz O, Karsenty G, Dalès JP, Gravis G, Nguyen C, Bertucci F, Xerri L, Birnbaum D. FGFR1 and WT1 are markers of human prostate cancer progression, BMC Cancer, 2006 [12]. Real-time PCR experiments were performed using LightCycler 2.0 Detection (Roche Diagnostic, Switzerland) in triplicate with GAPDH as a reference gene and internal control. The amplification kit used in this experiment is the FastStart DNA Master plus SYBR Green I Master Mix (Roche Diagnostics, Switzerland) (Devilard E, Bladou F, Ramuz O, Karsenty G, Dalès JP, Gravis G, Nguyen C, Bertucci F , Xerri L, Birnbaum D. FGFR1 and WT1 are markers of human prostate cancer progression.BMC Cancer 2006 Nov 30; 6: 272 [12]). 2 / RESULTS 2.1 Gene profiling profile Table 5: Gene expression difference and biological significance of the genes following the application of pine bud extracts to skin explants in relation to a gene same expierant untreated. GENES dbEST FUNCTIONS STATUS: stimulation compared to untreated skin S100A9 S100 NM 002965.3 - precursors that regulate X 6.5 (keratinocyte differentiation protein binding as a function of calcium flux calcium "calcium binding protein A9") S100A8 S100 NM Precursors that regulate X4.5 (differentiation protein binding keratinocytes as a function of calcium flow calcium "calcium binding protein A8") S100A7 S100 NM 002963.3 precursors that regulate X 6.5 (keratinocyte differentiation protein binding to according to the calcium flux + calcium "calcium actor antimicrobial binding protein A7") SPRR4 (small NM_173080.1 secreted protein in response to X 6.5 protein 4 rich environmental stress proline) (UV) of the cutaneous barrier to prevent its SPRR2C repair (small BC120937.1 Involved in differentiation X 8.5 late rich protein 2C keratinocytes and proline) constitutes a e family of structural proteins forming the envelope horny with involucrine and loricrin SPRR2G NM 0010142 Involved in the differentiation X 8.5 (small protein 91.3 late keratinocytes and 2G rich constitutes a family of proline) structural proteins forming the horny envelope with involucrin and loricrin SPRR2E NM 0010242 Involved in X 8 differentiation (small late protein 09.2 keratinocytes and 2E rich in proline family) structural proteins forming horny envelope with involucrin and loricrin SPRR2F NM 0010144 Involved in the differentiation X8 (small protein 50.1 late keratinocytes and 2F rich constitutes a family of proline) structural proteins forming the horny envelope with involucrine and loricrine LCE1B (protein NM_178349.1 Involved in differentiation X 5 , 5 of the terminal envelope of keratinocytes and cornified 1B) constitute a family of proteins with others which constitutes stratum corneum LCE2C (protein NM_178429.2 Involved in the differentiation X 7.5 of the terminal envelope of keratinocytes and cornified 2C) constitute a family of proteins with others which constitutes stratum corneum LCE1A (protein NM_178348 .2 Involved in the differentiation X 4.5 of the keratinocyte terminal envelope and cornified 1A) constitute a family of proteins with others which constitutes stratum corneum CCL18 NM 002988.2 - Chemokine involved in the X8.5 (chemokine 18 with regulation of the balance between CCL motif) inflammation and immune system CXCL9 NM 002416.1 _ Chemokine involved in X 5.5 (Chemokine 9 with CXC T-cell signaling) (Adaptive Immunity) CCL20 NM 004591.2 - X-secreted Chokokine 4,5 (antimicrobial motif-type dendritic chemokine 20) (innate immunity) CCL19 NM 006274.2 By binding to the CCR7 receptor, X 5.5 (gamokin 19 to central role in the CCL motif) T cell signaling and in B and T lymphocyte (Adaptive Immunity) migration and has an anti-inflammatory action CD276 (Cluster BC011578.2 Protein belonging to the X 3 family of Immunoglobulin Designation276) involved in humoral responses (Adaptive immunity) IL27RA NM 004843.3 - Protein involved in X2 (Receptor alpha Th1 and Th2 responses of interleukin (Adaptive Immunity) 27) CCR7 NM 001838.3 - This receptor activates X2 (Receptor of lymphocytes B and T (chemokine immunity to adaptive immunity) motif CC) IFITM3 (Protein NM006435.2 Viral transmissible protein X2 transmembrane (innate immunity) e 3 inducing interferon) CXCL1 BT006880.1 plays a very important role in X4.5 (chemokine 1 at homeostasis, CXC pattern development) and immune system function with anti-inflammatory action LYZ (lysozyme) NM 000239.2 X8 antimicrobial protein present in saliva, tears, skin, human milk, plasma ..... (innate immunity) PTAFR BT009801.1 Plays a significant role in X2 (Receptor to vasculogenesis / angiogenesis platelet activating factor) TNFAIP6 NM 007115.3 Primordial protein with action X 5.5 (anti-inflammatory tumor factor of necrosis inducing alpha 6 protein) IDO1 NM 002164.5 This enzyme plays a role in X5.5 (indoleamine 2,3-dioxygenase 1) of many pathological processes with pleiotropic antimicrobial, anti-inflammatory, anti-tumor and antioxidant actions LCN2 (lipocalin NM -005564.3 X3 2 antimicrobial protein) to attract macrophages and polymorphonuclear neutrophils at the site of injury (innate immunity) In table 5 above , Xn represents the stimulation factor relative to the untreated skin. As shown in Table 5 above, the pine bud extract significantly increases the expression of the CXCL9, CCL9, CD276, IL27RA, CCR7, CXCL1 genes involved in adaptive immunity and for effectively restoring cellular functions. In addition, the expression of the LYZ, LNC2, CCL20, IFITM2 genes, which make it possible to effectively alert during microbial attacks, to effectively restore the cellular functions of macrophages, dendritic and polymorphonuclear cells, is overexpressed in the presence of pine bud extract thereby counteracting an immunosuppressive state involving innate immunity and adaptive immunity playing a key role in skin aging and / or chronic skin inflammation ("Inflammaging"). Moreover, the expression of the TNFAIP6, CCL19, CXC1 and CCL18 genes is overexpressed in the pine bud extract thus making it possible to limit a possible chronic inflammatory state and again making it possible to ensure a skin balance between inflammation. and immunity. The IDO1 and SPRR4 genes are also overexpressed in the bud extract, thus stimulating the skin defenses, but also combating the generation of ROS and the action of the UV thus making it possible to protect the skin while avoiding a worsening of the skin. possible inflammatory state and / or chronic inflammatory state ("Inflammaging"). In addition, the genes of the Epidermal Differentiation Cluster (S100A family, LCE family, SPRR family) are overexpressed allowing the stimulation of keratinocyte differentiation thus ensuring a better regeneration of the epidermis and a better surface smoothing thus limiting the impact of the epidermis. a possible inflammatory state of the skin ("Inflammaging") while facilitating again a better epidermal differentiation. All this allows the epidermal level to enhance the barrier function and smoothing of the skin on the surface via obtaining a more regular stratum corneum. Pine extract also stimulates the expression of PTAFR, a gene involved in physiological and pathological angiogenesis, thus making it possible to illuminate the complexion by stimulating cutaneous microcirculation, which is disturbed during aging of the skin and / or an inflammatory condition of the skin.
Tableau 6 : différence d'expression génique et signification biologique des gènes suite à l'application d'un mélange d'extraits de bourgeons comprenant un extrait de bourgeons de pin, de framboisier, de hêtre et de cassis sur des explants de peau par rapport à un même expiant non traité.Table 6: Difference in Gene Expression and Biological Significance of the Genes Following the Application of a Mixture of Bud Extracts Comprising Pine, Raspberry, Beech and Blackcurrant Bud Extract on Skin Explants Relative to to the same untreated expier.
GENES dbEST FONCTIONS STATUT: stimulation par rapport à la peau non traitée S100A9 NM 0029 précurseurs qui régulent la X 7 dans le mélange S100 65.3 différentiation des kératinocytes en (protéine de fonction du flux calcique liaison au calcium "calcium binding protein A9") S100A8 NM_0029 précurseurs qui régulent la X3 dans le mélange S100 64.4 différentiation des kératinocytes en (protéine de fonction du flux calcique liaison au calcium "calcium binding protein A8") S100A7 NM_0029 précurseurs qui régulent la X 7,5 dans le mélange/x6 dans l'extrait de bourgeons de framboisier/x2,5 dans l'extrait de bourgeons de cassis S100 63.3 différentiation des kératinocytes en (protéine de fonction du flux calcique+ acteur anti- liaison au microbien calcium "calcium binding protein A7") SPRR4 NM 1730 protéine sécrétée en réponse à une agression environnementale (UV) de la barrière cutanée afin de prévenir sa réparation X 6,5 dans le (petite - mélange protéine 4 80.1 riche en proline) SPRR2C BC120937. Impliqué dans la différentiation X 6,5 dans le (petite 1 tardive des kératinocytes et constitue mélange/x5 dans protéine 2C une famille de protéines structurales l'extrait de riche en formant l'enveloppe cornée avec bourgeons de proline) l'involucrine et la loricrine framboisier/x6 dans l'extrait de bourgeons de cassis SPRR2B NM 0010 Impliqué dans la différentiation X 3,5 dans le (petite 17418.1 tardive des kératinocytes et constitue mélange/x5 dans protéine 2B une famille de protéines structurales l'extrait de riche en formant l'enveloppe cornée avec bourgeons de cassis proline) l'involucrine et la loricrine SPRR2E NM 00102 Impliqué dans la différentiation X 5 dans le (petite 4209.2 tardive des kératinocytes et constitue mélange/x5 dans protéine 2E une famille de protéines structurales l'extrait de riche en formant l'enveloppe cornée avec bourgeons de cassis proline ) l'involucrine et la loricrine SPRR2G NM 0010 Impliqué dans la différentiation X6,5 dans le (petite 14450.1 tardive des kératinocytes et constitue mélange/ x5 dans protéine 2G une famille de protéines structurales l'extrait de riche en formant l'enveloppe cornée avec bourgeons de proline ) l'involucrine et la loricrine framboisier/x5,5dans l'extrait de bourgeons de cassis LCE1 B NM 1783 Impliqué dans la différentiation X 4,5 dans le (proteine de 49.1 terminale des keratinocytes et constituent une famille de protéines avec d'autres qui constitue stratum mélange l'enveloppe corneum cornifiée 1B) LCE2C NM 1784 Impliqué dans la différentiation X 5 dans le (proteine de . terminale des keratinocytes et constituent une famille de protéines avec d'autres qui constitue stratum mélange/x5dans l'enveloppe 29 2 corneum l'extrait de cornifiée bourgeons de 2C) framboisier LCE2D NM 1784 Impliqué dans la différentiation X5 dans le (proteine de . terminale des keratinocytes et constituent une famille de protéines avec d'autres qui constitue stratum mélange/x3,5 dans l'enveloppe 30 2 corneum l'extrait de cornifiée bourgeons de 2D) framboisier CST6 NM 0013 Cette protéine contrôle la X3 dans le mélange (cystatine 23.3 régénération épidermique et la E/M) fonction barrière en régulant la desquamation TCHH NM 0071 Protéine impliquée dans la X4 dans le mélange (Trichohyali . différentiation terminale des ne) 13 2 kératinocytes et en combinaison avec l'involucrine structure l'enveloppe cornée FGF7 NM 0020 Facteur de croissance spécifique aux X3,5 dans le mélange (facteur de 09. cellules épithéliales entrainant la croissance 09.3 prolifération des kératinocytes fibroblastiqu e 7) LCE3E NM 1784 Impliqué dans la différentiation X3 dans le mélange (proteine de 35 2 terminale des keratinocytes et constituent une famille de protéines avec d'autres qui constitue stratum l'enveloppe . corneum cornifiée 3E) CCL20 NM 0045 Chémokine sécrétée par les cellules X8 dans le mélange (chemokine 91.2 dendritiques à visée antimicrobienne 20 à motif (Immunité innée) CCL) CCL19 NM 0062 En se fixant au récepteur CCR7, joue X 8,5 dans le (chemokine 74.2 un rôle central dans la signalisation mélange 19 à motif des lymphocytes T et dans la CCL) migration des lymphocytes B et T (Immunité adaptative) et a une action anti-inflammatoire IFITM3 NM 0064 Protéine à visée anti-virale (Immunité X3,5 dans le (Protéine 35.2 innée) mélange transmembr anaire 3 induisant l'interféron) CXCL1 BT006880 Joue un rôle très important dans X10 dans le (chemokine .1 l'homéostasie, le développement et la mélange 1 à motif C- fonction du système immunitaire avec X-C) action anti-inflammatoire TNFAIP6 NM 0071 Protéine primordiale à action anti- X 10,5 dans le (Facteur 15.3 inflammatoire mélange tumoral de necrose induisant la protéine alpha 6) IL7R NM 0021 Joue un rôle critique dans la X3 dans le mélange (Récepteur 85.3 recombinaison V (D) J et dans la à différenciation des lymphocytes T l'interleukin (Immunité adaptative) 7) BNIP3 NM 0040 Cette protéine confère à la peau une immunité anti-virale (Immunité innée) X4 dans le mélange (Protéine 3 52.2 de 19 kDa interagissais t avec l'adénovirus E1B) CCR7 NM 0018 Ce récepteur active les lymphocytes X2,5 dans le (Récepteur 38.3 B et T (Immunité adaptative) mélange de la chemokine 7à motif C- C) CXCL10 NM 0015 Cette chémokine stimule les X4 pour le mélange (chemokine 65.3 monocytes et les cellules NK et de 4 bourgeons/ 10 à motif i X5,5 dans l'extrait CXC) intervient aussi dans la migration des lymphocytes T(Immunités innée+adaptative) de bourgeons de framboisier PTX3 NM 0028 PTX3 est produite par les X5 dans le mélange pentraxine 52.3 polynucléaires, macrophages et 3, forme cellules dendritiques et joue un rôle longue important dans l'immunité innée TGFB2 NM 0032 Peptide multifonctionnel impliqué en X2,5 dans le (facteur de 38.3 autre dans la différentiation des mélange croissance monocytes en macrophages avec transforman action anti-inflammatoire t 2) SOD2 BT006967 Cette enzyme convertit le peroxyde X4 dans le mélange superoxide .1 d'hydrogène et l'oxygène di-atomique dismutase (ROS générés), sa sous-expression 2, entraine un vieillissement prématuré mitochondri ale ELK3 NM 0052 Protéine exprimée sous hypoxie X3 dans le mélange ELK3, 30.2 tissulaire et cellulaire permettant de (protéine à stimuler la microcirculation et de domaine lutter contre le stress oxydatif ETS) PGF (facteur de croissance placentaire) S72960.1 Facteur de croissance stimulant X3 dans le mélange l'angiogenèse LOXL2 NM 0023 Cette enzyme catalyse la première X9 dans le mélange (lysyl 18.2 étape dans la formation du réseau oxidase-like fibrillaire de la matrice extracellulaire 2) entre élastine et collagène FMOD NM 0020 Cette protéine participe à l'assemblage du réseau matriciel en interagissant avec les collagènes 1,11 et inhibe la fibrinolyse génératrice de X4 dans le mélange (fibromoduli 23.3 réaction inflammatoire chronique ne) VCAN BC050524 Protéoglycane majeur de la matrice X3 dans le mélange (versican) 1 extracellulaire impliqué dans la migration, prolifération cellulaires et l'angiogenèse et joue un rôle central dans la morphogénèse cutanée Dans le tableau 6 précité, x N représente le facteur de multiplication de la stimulation par rapport à la peau non traitée. Dans le tableau 6 ci-dessus, seule la stimulation a été indiquée, l'absence de stimulation en présence de l'extrait de bourgeons de framboisier pris séparément, de l'extrait de cassis pris séparément et de l'extrait de bourgeons de hêtre pris séparément n'a pas été indiqué. 2.3.1 Impact du mélange des 4 extraits de bourgeons sur l'immunité innée et adaptative et sur l'inhibition de l'inflammation.GENES dbEST FUNCTIONS STATUS: stimulation compared to untreated skin S100A9 NM 0029 precursors that regulate X 7 in S100 65.3 differentiation of keratinocytes into calcium binding protein (calcium binding protein A9) Calcium S100A8 NM_0029 precursors that regulate X3 in the S100 64.4 differentiation of keratinocytes into calcium-binding calcium-binding function (calcium binding protein A8) protein S100A7 NM_0029 precursors that regulate X 7.5 in the mixture / x6 in the extract of raspberry buds / x2.5 in blackcurrant bud extract S100 63.3 differentiation of keratinocytes into (calcium flux function protein + calcium microbial binding actor calcium "calcium binding protein A7") SPRR4 NM 1730 protein secreted in response to an environmental aggression (UV) of the cutaneous barrier to prevent its repair X 6.5 in the (small-protein mixture 4 80.1 r iche proline) SPRR2C BC120937. Involved in the differentiation X 6.5 in the (small 1 late keratinocytes and constitutes mixture / x5 in protein 2C a structural protein family the rich extract forming the horny envelope with proline buds) the involucrine and the loricrin raspberry / x6 in blackcurrant bud extract SPRR2B NM 0010 Involved in differentiation X 3.5 in the (small late 17418.1 keratinocytes and constitutes mixture / x5 in protein 2B a family of structural proteins the extract of rich in forming the horny envelope with blackcurrant proline buds) involucrine and loricrin SPRR2E NM 00102 Involved in the differentiation X 5 in the (small 4209.2 late keratinocytes and constitutes mixture / x5 in protein 2E a structural protein family the extract rich in forming the corneous envelope with blackcurrant proline buds) involucrine and loricrin SPRR2G NM 0010 Involved in differentiation X6,5 in the (pet ite 14450.1 late keratinocytes and constitutes mixture / x5 in protein 2G a family of structural proteins rich extract forming the horny envelope with proline buds) involucrine and raspberry loricrin / x5,5in the bud extract of cassis LCE1 B NM 1783 Involved in the differentiation X 4.5 in the 49.1 terminal protein of keratinocytes and constitute a family of proteins with others that constitutes stratum mixes the cornified corneum envelope 1B) LCE2C NM 1784 Involved in the differentiation in the (protein of. keratinocyte terminal and constitute a family of proteins with others that constitutes stratum mixture / x5in the envelope 29 2 corneum cornified extract buds of 2C) raspberry LCE2D NM 1784 Involved in the differentiation X5 in the (terminal protein keratinocytes and constitute a family of proteins with others which constitutes stratum mixture / x3,5 in the envelope 2 corneum the cornified extract buds of 2D) raspberry CST6 NM 0013 This protein controls the X3 in the mixture (cystatin 23.3 epidermal regeneration and E / M) barrier function by regulating desquamation TCHH NM 0071 Protein involved in X4 in the mixture (Trichohyali, terminal differentiation of ne) 13 2 keratinocytes and in combination with the involucrine structure the horny envelope FGF7 NM 0020 Growth factor specific for X3,5 in the mixture (factor of 09. epithelial cells causing growth) 09.3 proliferation of Fibroblastic keratinocytes 7) LCE3E NM 1784 Involved in the differentiation X3 in the mixture (keratinocyte terminal 2 protein and constitute a family of proteins with others which constitutes stratum envelope. corneum corneum 3E) CCL20 NM 0045 Chemokine secreted by X8 cells in the mixture (chemokine 91.2 patterned antimicrobial dendritic 20 (innate immunity) CCL) CCL19 NM 0062 By binding to the CCR7 receptor, plays X 8.5 in the chemokine 74.2 plays a central role in patterned T-cell signaling and in the CCL) B and T cell migration (adaptive immunity) and has an anti-inflammatory action IFITM3 NM 0064 Anti-viral Protein (Immunity X3, 5 in (Protein 35.2 innate) interferon-inducing 3-transmembrane mixture) CXCL1 BT006880 plays a very important role in X10 in (chemokine .1 homeostasis, development and mixing 1 with pattern C- immune system function with XC) anti-inflammatory action TNFAIP6 NM 0071 Primordial protein with anti-X 10.5 action in the (Factor 15.3 inflammatory tumor mixture of necrosis inducing alpha-6 protein) IL7R NM 0021 Play a critical role in the X3 in the mixture (Receptor 85.3 Recombination V (D) J and in T cell differentiation Interleukin (Adaptive Immunity) 7) BNIP3 NM 0040 This protein confers on the skin an anti-viral immunity (innate immunity X4 in the mixture (19 kDa Protein 3 52.2 interacted with adenovirus E1B) CCR7 NM 0018 This receptor activates X2.5 lymphocytes in the (Receptor 38.3 B and T (Adaptive Immunity) mixture of chemokine 7 with C motif - C) CXCL10 NM 0015 This chemokine stimulates the X4 for the mixture (chemokine 65.3 monocytes and NK cells and 4 buds / 10 X5.5 pattern in the CXC extract) also involved in the migration of T lymphocytes (Immunities innate + adaptive) raspberry buds PTX3 NM 0028 PTX3 is produced by X5 in pentraxin mixture 52.3 polynuclear, macrophages and 3, form dendritic cells and plays a long important role in innate immunity TGFB2 NM 0032 Multifunctional peptide X2.5 involved in X2.5 in the (38.3 other factor in the differentiation of monocyte growth mixture into macrophages with transformant anti-inflammatory action t 2) SOD2 BT006967 This enzyme converts X4 peroxide into the superoxide mixture .1 of hydrogen and l di-atomic oxygen dismutase (ROS generated), its sub-expression 2, causes premature mitochondrial aging ELK3 NM 0052 Protein expressed under hypoxia X3 in ELK3 mixture, 30.2 tissue and cell allowing (protein to stimulate microcirculation and field fight against oxidative stress ETS) PGF (placental growth factor) S72960.1 Stimulating growth factor X3 in the mixture angiogenesis LOXL2 NM 0023 This enzyme catalyzes the first X9 in the mixture (lysyl 18.2 step in the formation of the network Fibrillar oxidase-like extracellular matrix 2) between elastin and collagen FMOD NM 0020 This protein participates in the assembly of the res matrix water by interacting with 1,11 collagens and inhibiting X4-generating fibrinolysis in the mixture (fibromoduli 23.3 chronic inflammatory reaction no) VCAN BC050524 Major proteoglycan of the X3 matrix in the extracellular (versican) 1 mixture involved in migration, proliferation Cellular and angiogenesis and plays a central role in skin morphogenesis In Table 6 supra, x N represents the multiplication factor of stimulation compared to untreated skin. In Table 6 above, only the stimulation was indicated, the absence of stimulation in the presence of the raspberry bud extract taken separately, the blackcurrant extract taken separately and the extract of beech buds. taken separately was not indicated. 2.3.1 Impact of the mixture of 4 bud extracts on innate and adaptive immunity and on inhibition of inflammation.
Tel que démontré dans le tableau 6 ci-dessus, la synergie constituée d'un mélange d'extrait de bourgeons de pin, framboisier, cassis et hêtre stimule respectivement par 8 et par 8,5 deux gènes CCL20 et CCL19 codant pour des chémokines impliquées dans l'immunité innée et dans l'immunité adaptative avec action anti-inflammatoire pour CCL19. Aucune surexpression de ce gène n'a été détectée dans la peau non traitée, dans la peau traitée avec les extraits de bourgeons de hêtre, de framboisier et de cassis pris séparément. L'extrait de bourgeons de pin stimule l'expression de CCL20 et CCL19 par 4,5 et 5,5 respectivement. Il existe donc un réel effet synergique de ce mélange d'extraits de 4 bourgeons permettant d'amplifier la stimulation de 2 fois pour CCL20 et de 1,5 fois pour CCL19. De plus, la synergie constituée d'un mélange d'extrait de bourgeons de pin, framboisier, cassis et hêtre stimule par 10 le gène CXCL1 codant pour une chémokine impliquée dans le développement et la fonction du système immunitaire avec une action anti-inflammatoire. Aucune surexpression de ce gène n'a été détectée dans la peau non traitée, dans la peau traitée avec les extraits de bourgeons de hêtre, de framboisier et de cassis pris séparément. L'extrait de bourgeons de pin stimule l'expression de CXCL1 par 4,5. Il existe donc un réel effet synergique de ce mélange d'extraits de 4 bourgeons permettant d'amplifier la stimulation de 2 fois pour ce gène CXCL1. Le gène TNFAIP6 est stimulé par 10,5 par le mélange contenant les 4 extraits de bourgeons gène anti-inflammatoire par excellence. Aucune surexpression de ce gène n'a été détectée dans la peau non traitée, dans la peau traitée avec les extraits de bourgeons de hêtre, de framboisier et de cassis pris séparément. L'extrait de bourgeons de pin stimule l'expression de TNFAIP6 par 5,5. Il existe donc un réel effet synergique de ce mélange d'extraits de 4 bourgeons permettant d'amplifier la stimulation de 1,75 fois pour ce gène TNFAIP6. La synergie constituée d'un mélange d'extrait de bourgeons de pin, framboisier, cassis et hêtre stimule par 3,5 l'expression d'IFITM3, protéine à action antivirale. Aucune surexpression de ce gène n'a été détectée dans la peau non traitée, dans la peau traitée avec les extraits de bourgeons de hêtre, de framboisier et de cassis pris séparément. L'extrait de bourgeons de pin stimule l'expression d'IFITM3 par 2. Il existe donc un réel effet synergique de ce mélange d'extraits de 4 bourgeons permettant d'amplifier la stimulation de 1,5 fois pour ce gène IFITM3. La synergie constituée d'un mélange d'extrait de bourgeons de pin, framboisier, cassis et hêtre stimule par 2,5 l'expression de CCR7, gène codant le récepteur à la chémokine 7 stimulant l'immunité adaptative en activant les lymphocytes B et T. Aucune surexpression de ce gène n'a été détectée dans la peau non traitée, dans la peau traitée avec les extraits de bourgeons de hêtre, de framboisier et de cassis pris séparément. L'extrait de bourgeons de pin stimule l'expression de CCR7 par 2. Il existe donc un réel effet synergique de ce mélange d'extraits de 4 bourgeons. D'autre part, ce mélange stimule par 3 l'expression d'IL7R codant pour le récepteur à l'interleukine 7 impliquée dans l'immunité adaptative en jouant un rôle crucial dans l'activation des lymphocytes T et dans la recombinaison V(D)J. Aucune surexpression de ce gène n'a été détectée dans la peau non traitée, dans la peau traitée avec les extraits de bourgeons de hêtre, de framboisier, de pin et de cassis pris séparément. Il existe donc un réel effet synergique de ce mélange d'extraits de 4 bourgeons. Le mélange contenant les 4 extraits de bourgeons et l'extrait de bourgeons de framboisier stimulent respectivement l'expression de CXCL10 par 4 et par 5.5 impliqué dans l'immunité innée et adaptative en boostant les monocytes et les cellules NK et en favorisant la migration des lymphocytes T. Ce mélange stimule également par 4 l'expression de BNIP3 codant pour une protéine à action protectrice antivirale. Aucune surexpression de ce gène n'a été détectée dans la peau non traitée, dans la peau traitée avec les extraits de bourgeons de hêtre, de framboisier, de pin et de cassis pris séparément. Il existe donc un réel effet synergique de ce mélange d'extraits de 4 bourgeons. Le mélange contenant les 4 extraits de bourgeons stimule également l'expression de PTX3 par 5 jouant un rôle primordial dans l'immunité innée. Aucune surexpression de ce gène n'a été détectée dans la peau non traitée, dans la peau traitée avec les extraits de bourgeons de hêtre, de framboisier, de pin et de cassis pris séparément. Il existe donc un réel effet synergique de ce mélange d'extraits de 4 bourgeons. Le mélange contenant les 4 extraits de bourgeons stimule également l'expression de TGFB2 par 2,5, facteur de croissance impliqué dans la différentiation des monocytes en macrophages tout limitant les inflammations locales. Aucune surexpression de ce gène n'a été détectée dans la peau non traitée, dans la peau traitée avec les extraits de bourgeons de hêtre, de framboisier, de pin et de cassis pris séparément. Il existe donc un réel effet synergique de ce mélange d'extraits de 4 bourgeons. De ce fait, le mélange constitué des 4 extraits de bourgeons stimule l'immunité innée et adaptative tout en inhibant les réactions inflammatoires cutanées, permettant, ainsi, de protéger la peau des agressions extérieures, d'éviter un état inflammatoire chronique de la peau entrainant un vieillissement prématuré. Ainsi, la composition selon l'invention permet avantageusement de protéger la peau d'agressions extérieures tout en ayant un effet anti-âge. 2.3.2 Impact du mélange des 4 extraits de bourgeons sur l'action anti-radicalaire et vieillissement prématuré. Tel que démontré dans le tableau 6 ci-dessus, l'expression de SOD2 est stimulée par 4 dans le mélange contenant les 4 extraits de bourgeons. Cette enzyme permet d'éliminer les espèces réactives à l'oxygène, sa sous- 2 5 expression entrainant un vieillissement cutané prématuré. Aucune surexpression de ce gène n'a été détectée dans la peau non traitée, dans la peau traitée avec les extraits de bourgeons de hêtre, de framboisier, de pin et de cassis pris séparément. Il existe donc un réel effet synergique de ce mélange d'extraits de 4 bourgeons. 30 De ce fait, le mélange constitué des 4 extraits de bourgeons permet de lutter contre la génération de ROS et l'action des UV aggravant le processus d'Inflammaging. 2.3.3 Impact du mélange des 4 extraits de bourgeons sur la stimulation de l'angiogenèse. Tel que démontré dans le tableau 6 ci-dessus, le mélange contenant les 4 extraits de bourgeons stimule par 3 deux gènes PGF et EKL3 codant respectivement pour le facteur de croissance placentaire et pour une protéine à domaine ETS impliqués dans l'angiogenèse, permettant également pour ELK3 de lutter contre le stress oxydatif. Aucune surexpression de ces 2 gènes n'a été détectée dans la peau non traitée, dans la peau traitée avec les extraits de bourgeons de hêtre, de framboisier, de pin et de cassis pris séparément. Il existe donc un réel effet synergique de ce mélange d'extraits de 4 bourgeons. De ce fait, le mélange constitué des 4 extraits de bourgeons permet d'illuminer le teint en tout en stimulant la microcirculation cutanée perturbée lors du vieillissement de la peau et/ou d'un état inflammatoire de la peau. 2.3.4 Impact du mélange des 4 extraits de bourgeons sur la production des protéines et réseaux fibrillaire constituant la MEC dermique. Tel que démontré dans le tableau 6 ci-dessus, le mélange contenant les 4 extraits de bourgeons stimule l'expression de 3 gènes LOXL2, VCAN et FMOD respectivement par 9,3 et 4. Aucune surexpression de ces 3 gènes n'a été détectée dans la peau non traitée, dans la peau traitée avec les extraits de bourgeons de hêtre, de framboisier, de pin et de cassis pris séparément. Il existe donc un réel effet synergique de ce mélange d'extraits de 4 bourgeons. LOXL2 dont l'expression est stimulée par 9 code pour une enzyme catalysant la première étape de la formation du réseau fibrillaire entre collagène et élastine. FMOD dont l'expression est multipliée par 4, quand à lui, code pour la fibromoduline, protéine participant à l'assemblage du réseau entre fibres de collagènes I et II et inhibant la fibrinolyse génératrice d'inflammation chronique. VCAN code pour le protéoglycane et constituant majeur de la matrice extracellulaire jouant un rôle primordial dans la morphogenèse cutanée, voit son expression multipliée par 3.As shown in Table 6 above, the synergy consisting of a mixture of pine bud extract, raspberry, blackcurrant and beech stimulates respectively by 8 and by 8.5 two genes CCL20 and CCL19 coding for chemokines involved. in innate immunity and adaptive immunity with anti-inflammatory action for CCL19. No overexpression of this gene was detected in untreated skin, in skin treated with beech, raspberry and blackcurrant bud extracts taken separately. Pine bud extract stimulates the expression of CCL20 and CCL19 by 4.5 and 5.5 respectively. There is therefore a real synergistic effect of this mixture of extracts of 4 buds to amplify the stimulation of 2 times for CCL20 and 1.5 times for CCL19. In addition, the synergy of a mixture of pine bud extract, raspberry, blackcurrant and beech stimulates the CXCL1 gene encoding a chemokine involved in the development and function of the immune system with anti-inflammatory action. No overexpression of this gene was detected in untreated skin, in skin treated with beech, raspberry and blackcurrant bud extracts taken separately. Pine bud extract stimulates the expression of CXCL1 by 4.5. There is therefore a real synergistic effect of this mixture of extracts of 4 buds to amplify the stimulation of 2 times for this gene CXCL1. The TNFAIP6 gene is stimulated by 10.5 with the mixture containing the 4 anti-inflammatory gene bud extracts par excellence. No overexpression of this gene was detected in untreated skin, in skin treated with beech, raspberry and blackcurrant bud extracts taken separately. Pine bud extract stimulates the expression of TNFAIP6 by 5.5. There is therefore a real synergistic effect of this mixture of extracts of 4 buds to amplify the stimulation of 1.75 times for this gene TNFAIP6. The synergy of a mixture of pine bud extract, raspberry, blackcurrant and beech stimulates by 3.5 the expression of IFITM3, an antiviral protein. No overexpression of this gene was detected in untreated skin, in skin treated with beech, raspberry and blackcurrant bud extracts taken separately. The pine bud extract stimulates the expression of IFITM3 by 2. There is therefore a real synergistic effect of this mixture of extracts of 4 buds to amplify the stimulation of 1.5 times for this gene IFITM3. The synergy of a mixture of pine bud extract, raspberry, blackcurrant and beech stimulates by 2.5 the expression of CCR7, gene encoding the chemokine receptor 7 stimulating adaptive immunity by activating B lymphocytes and T. No overexpression of this gene was detected in untreated skin, in skin treated with extracts of beech, raspberry and black currant buds taken separately. The pine bud extract stimulates the expression of CCR7 by 2. There is therefore a real synergistic effect of this mixture of extracts of 4 buds. On the other hand, this mixture stimulates the expression of IL7R encoding the interleukin 7 receptor involved in adaptive immunity by playing a crucial role in T cell activation and V recombination. ) J. No overexpression of this gene was detected in the untreated skin, in the skin treated with extracts of beech, raspberry, pine and black currant buds taken separately. There is therefore a real synergistic effect of this mixture of extracts of 4 buds. The mixture containing the 4 bud extracts and the raspberry bud extract respectively stimulate the expression of CXCL10 by 4 and by 5.5 involved in innate and adaptive immunity by boosting monocytes and NK cells and promoting the migration of This mixture also stimulates by 4 the expression of BNIP3 encoding a protein with antiviral protective action. No overexpression of this gene was detected in the untreated skin, in the skin treated with extracts of beech, raspberry, pine and black currant buds taken separately. There is therefore a real synergistic effect of this mixture of extracts of 4 buds. The mixture containing the 4 bud extracts also stimulates the expression of PTX3 by playing a primordial role in innate immunity. No overexpression of this gene was detected in the untreated skin, in the skin treated with extracts of beech, raspberry, pine and black currant buds taken separately. There is therefore a real synergistic effect of this mixture of extracts of 4 buds. The mixture containing the 4 bud extracts also stimulates the expression of TGFB2 by 2.5, a growth factor involved in the differentiation of monocytes into macrophages while limiting local inflammations. No overexpression of this gene was detected in the untreated skin, in the skin treated with extracts of beech, raspberry, pine and black currant buds taken separately. There is therefore a real synergistic effect of this mixture of extracts of 4 buds. As a result, the mixture of 4 bud extracts stimulates innate and adaptive immunity while inhibiting inflammatory skin reactions, thereby protecting the skin from external aggressions, avoiding a chronic inflammatory state of the skin causing premature aging. Thus, the composition according to the invention advantageously protects the skin from external aggressions while having an anti-aging effect. 2.3.2 Impact of the mixture of 4 bud extracts on the anti-radical action and premature aging. As shown in Table 6 above, the expression of SOD2 is stimulated by 4 in the mixture containing the 4 bud extracts. This enzyme makes it possible to eliminate reactive species with oxygen, its under-expression leading to premature cutaneous aging. No overexpression of this gene was detected in the untreated skin, in the skin treated with extracts of beech, raspberry, pine and black currant buds taken separately. There is therefore a real synergistic effect of this mixture of extracts of 4 buds. As a result, the mixture consisting of the 4 bud extracts makes it possible to combat the generation of ROS and the action of UVs aggravating the Inflammaging process. 2.3.3 Impact of the mixture of the 4 bud extracts on the stimulation of angiogenesis. As shown in Table 6 above, the mixture containing the 4 bud extracts stimulates by 3 two genes PGF and EKL3 encoding respectively for placental growth factor and for an ETS domain protein involved in angiogenesis, also allowing for ELK3 to fight against oxidative stress. No overexpression of these 2 genes was detected in the untreated skin, in the skin treated with extracts of beech, raspberry, pine and black currant buds taken separately. There is therefore a real synergistic effect of this mixture of extracts of 4 buds. As a result, the mixture of 4 bud extracts illuminates the complexion while stimulating cutaneous microcirculation disturbed during aging of the skin and / or an inflammatory state of the skin. 2.3.4 Impact of the mixture of 4 bud extracts on the production of fibrillar proteins and networks constituting the dermal ECM. As shown in Table 6 above, the mixture containing the 4 bud extracts stimulates the expression of 3 LOXL2, VCAN and FMOD genes respectively by 9.3 and 4. No overexpression of these 3 genes was detected. in untreated skin, in skin treated with extracts of beech, raspberry, pine and black currant buds taken separately. There is therefore a real synergistic effect of this mixture of extracts of 4 buds. LOXL2 whose expression is code-stimulated for an enzyme catalyzing the first step of fibrillar network formation between collagen and elastin. FMOD whose expression is multiplied by 4, while it codes for fibromodulin, protein involved in the assembly of the network between fibers of collagens I and II and inhibiting fibrinolysis generating chronic inflammation. VCAN code for proteoglycan and major constituent of the extracellular matrix plays a key role in cutaneous morphogenesis, its expression multiplied by 3.
De ce fait, le mélange constitué des 4 extraits de bourgeons permet de lutter contre l'élastose dermique, génératrice d'inflammation chronique et permet ainsi de préserver la peau d'un éventuel vieillissement prématurée. 2.3.5 Impact du mélange des 4 extraits de bourgeons sur la différentiation épidermique et la prolifération des kératinocytes. Tel que démontré dans le tableau 6 ci-dessus, le mélange contenant les 4 extraits de bourgeons stimule l'expression de FGF7 induisant la prolifération des kératinocytes par 3,5. Aucune surexpression de ce gène n'a été détectée dans la peau non traitée, dans la peau traitée avec les extraits de bourgeons de hêtre, de framboisier, de pin et de cassis pris séparément. Il existe donc un réel effet synergique de ce mélange d'extraits de 4 bourgeons. De plus, ce mélange entraine la stimulation de l'expression du gène CST6 par 3 contrôlant la régénération épidermique et la fonction barrière. Aucune surexpression de ce gène n'a été détectée dans la peau non traitée, dans la peau traitée avec les extraits de bourgeons de hêtre, de framboisier, de pin et de cassis pris séparément. Il existe donc un réel effet synergique de ce mélange d'extraits de 4 bourgeons. Par ailleurs, ce mélange stimule par 4 l'expression du gène TCHH codant pour une protéine qui associée avec l'involucrine, permet de structurer l'enveloppe cornée renforçant la fonction barrière. Aucune surexpression de ce gène n'a été détectée dans la peau non traitée, dans la peau traitée avec les extraits de bourgeons de hêtre, de framboisier, de pin et de cassis pris séparément. Il existe donc un réel effet synergique de ce mélange d'extraits de 4 bourgeons. De plus, le mélange contenant les 4 extraits de bourgeons stimule l'expression par 7, 3 et 7,5 respectivement de 3 gènes de la Famille S100, S100A9, S100A8 et S100A7 impliqués dans la fonction barrière et dans la différentiation terminale des kératinocytes. L'extrait de bourgeons de pin stimule par 6,5 l'expression de S100A9, par 6,5 l'expression de S100A7 et par 4,5 l'expression de S100A8.As a result, the mixture consisting of 4 bud extracts makes it possible to fight against dermal elastosis, which generates chronic inflammation and thus makes it possible to preserve the skin from possible premature aging. 2.3.5 Impact of mixing of 4 bud extracts on epidermal differentiation and proliferation of keratinocytes. As shown in Table 6 above, the mixture containing the 4 bud extracts stimulates the expression of FGF7 inducing the proliferation of keratinocytes by 3.5. No overexpression of this gene was detected in the untreated skin, in the skin treated with extracts of beech, raspberry, pine and black currant buds taken separately. There is therefore a real synergistic effect of this mixture of extracts of 4 buds. In addition, this mixture leads to the stimulation of the expression of the CST6 gene by controlling the epidermal regeneration and the barrier function. No overexpression of this gene was detected in the untreated skin, in the skin treated with extracts of beech, raspberry, pine and black currant buds taken separately. There is therefore a real synergistic effect of this mixture of extracts of 4 buds. Moreover, this mixture stimulates by 4 the expression of the TCHH gene encoding a protein which is associated with involucrine, makes it possible to structure the horny envelope reinforcing the barrier function. No overexpression of this gene was detected in the untreated skin, in the skin treated with extracts of beech, raspberry, pine and black currant buds taken separately. There is therefore a real synergistic effect of this mixture of extracts of 4 buds. In addition, the mixture containing the 4 bud extracts stimulates the expression by 7, 3 and 7.5, respectively, of 3 genes of the S100 family, S100A9, S100A8 and S100A7 involved in the barrier function and in the terminal differentiation of keratinocytes. Pine bud extract stimulates S100A9 expression by 6.5, S100A7 expression by 6.5, and expression of S100A8 by 4.5.
Aucune surexpression de ce gène n'a été détectée dans la peau non traitée, dans la peau traitée avec les extraits de bourgeons de hêtre, de framboisier, de pin et de cassis pris séparément. Il existe donc un réel effet synergique de ce mélange d'extraits de 4 bourgeons pour S100A9 ET S100A7.No overexpression of this gene was detected in the untreated skin, in the skin treated with extracts of beech, raspberry, pine and black currant buds taken separately. There is therefore a real synergistic effect of this mixture of extracts of 4 buds for S100A9 and S100A7.
De ce fait, le mélange constitué des 4 extraits de bourgeons permet une meilleure régénération de l'épiderme et un meilleur lissage de surface de la peau, permettant avantageusement de limiter d'un éventuel état inflammatoire et/ou d'un état inflammatoire chronique, en facilitant de nouveau une meilleure différentiation épidermique et un meilleur renouvellement épidermique. 2.2 PCR en temps réel Les résultats de PCR quantitative en temps réel (RT PCR) permettant de valider sur les gènes SOD2, IL7R, CCL19 etTGFB2 les données de micro- array, sont regroupés dans le tableau 7. Tableau 7 : expression génique de SOD2, IL7R, CCL19 etTGFB2 par RTQPCR suite à l'application de l'extrait de bourgeons de pin, et du mélange contenant l'extrait de bourgeons de pin, l'extrait de bourgeons de framboisier, l'extrait de bourgeons de cassis et l'extrait du bourgeons de hêtre sur explants de peau par rapport à un même expiant non traité. GENES/Statut Extrait bourgeons de Mélange des 4 extraits pin de bourgeons SOD2 NS X3,5 IL7R NS X2 CCL19 NS X6 TGFB2 NS X2 Dans le tableau 7 ci-dessus « ns » signifie : non stimulé Le complexe associant les 4 extraits de bourgeons stimulent l'expression 20 de SOD2 par 3,5, IL7R par 2, CCL19 par 6 et TGFB2 par 2. Aucune surexpression ne fut retrouvée dans l'extrait de bourgeons de pin. Les résultats obtenus lors de cette expérience sont identiques à l'expérience sur puces à ADN ce qui confirme et valide les données de microarrays. 25 Les résultats obtenus lors de cette expérience sont identiques à l'expérience sur puces à ADN ce qui confirme et valide les données de microarrays.As a result, the mixture consisting of the 4 bud extracts allows a better regeneration of the epidermis and a better surface smoothing of the skin, advantageously making it possible to limit a possible inflammatory state and / or a chronic inflammatory state, by facilitating again a better epidermal differentiation and a better epidermic renewal. 2.2 Real-time PCR The real-time quantitative PCR (RT PCR) results for validating the microarray data on the SOD2, IL7R, CCL19 andTGFB2 genes are summarized in Table 7. Table 7: SOD2 gene expression , IL7R, CCL19 and TGFB2 by RTQPCR following the application of pine bud extract, and the mixture containing pine bud extract, raspberry bud extract, blackcurrant bud extract and extract of beech buds on skin explants compared to the same untreated expierant. GENES / Status Extract Mix buds of 4 bud pine extracts SOD2 NS X3,5 IL7R NS X2 CCL19 NS X6 TGFB2 NS X2 In Table 7 above "ns" means: unstimulated The complex associating the 4 bud extracts stimulate the expression of SOD2 by 3.5, IL7R by 2, CCL19 by 6 and TGFB2 by 2. No overexpression was found in the pine bud extract. The results obtained during this experiment are identical to the experiment on microarrays which confirms and validates the microarrays data. The results obtained during this experiment are identical to the experiment on microarrays which confirms and validates the microarrays data.
Exemple 3 : Tests d'usages et d'efficacité Dans cet exemple, la composition utilisée était la composition 5 du tableau 2. Cette composition est désignée ci-dessous « contour yeux jeunesse» Afin de valider l'acceptabilité cutanée du « contour yeux jeunesse », 30 femmes âgées entre 40 et 49 ans ont été recrutées. Cette étude a été réalisée sur 28 jours avec application une fois par jour de la composition sur une zone de la peau. Un examen cutané de la zone a été réalisé par un dermatologue juste avant la première application et au 28ème jour d'application. Les résultats obtenus ont démontré qu'aucun signe clinique imputable à la composition n'a été observé et qu'aucune sensation d'inconfort n'a été rapportée. Afin de valider l'acceptabilité oculaire (tolérance locale) du « contour yeux jeunesse », 30 femmes âgées entre 40 et 49 ans ont été recrutées. Cette étude a été réalisée sur 28 jours avec application une fois par jour de la composition sur une zone de la peau. Un examen palpébral et oculaire de la zone a été réalisé par un ophtalmologiste juste avant la première application et au 28ème jour d'application. Les résultats obtenus ont démontré qu'aucun signe clinique imputable à la composition n'a été observé et qu'aucune sensation d'inconfort n'a été rapportée.Example 3: Uses and Effectiveness Tests In this example, the composition used was the composition of Table 2. This composition is designated below "youth eye contour" In order to validate the cutaneous acceptability of the "youth eye contour" 30 women aged between 40 and 49 were recruited. This study was carried out over 28 days with application once a day of the composition on an area of the skin. A skin examination of the area was performed by a dermatologist just before the first application and at the 28th day of application. The results obtained showed that no clinical signs attributable to the composition were observed and that no sensation of discomfort was reported. In order to validate the ocular acceptability (local tolerance) of the "youth eye contour", 30 women between 40 and 49 years old were recruited. This study was carried out over 28 days with application once a day of the composition on an area of the skin. Ocular and eyelid examination of the area was performed by an ophthalmologist just before the first application and at the 28th day of application. The results obtained showed that no clinical signs attributable to the composition were observed and that no sensation of discomfort was reported.
Afin de valider l'effet de la composition selon l'invention sur les rides et ridules, 31 femmes âgées entre 40 et 49 ans ont été recrutées. Cette étude a été réalisée sur 28 jours avec application une fois par jour de la composition sur une zone de la peau. Un scorage clinique à l'aide d'une échelle ordinale en 4 points de 0 à 3 a été réalisé par l'investigateur juste avant la première application et au 28ème jour d'application. L'échelle était la suivante : 0 : absence de rides, 1 : ridulation légère, 2 : ridulation modérée, 3 : ridulation sévère. Une comparaison statistique avec un test de Wilcoxon des scores obtenus au premier jour par rapport au score au 28ème jour ont montré une diminution statistiquement significative de la ridulation cutané au niveau du contour des yeux, à savoir 66 ,1%, après 28 jours d'application de la composition selon l'invention. Afin de valider l'efficacité au niveau de la peau du « contour yeux jeunesse », 31 femmes âgées entre 40 et 49 ans ont été recrutées pour cette étude afin de tester l'effet anti-âge, son efficacité ainsi que les qualités « cosmétiques » de cette composition. De ce fait, la composition a été appliquée une fois par jour pendant 28 jours dans les conditions normales d'utilisation.In order to validate the effect of the composition according to the invention on wrinkles and fine lines, 31 women between 40 and 49 years old were recruited. This study was carried out over 28 days with application once a day of the composition on an area of the skin. A clinical scoring using a 4-point ordinal scale from 0 to 3 was performed by the investigator just before the first application and at the 28th day of application. The scale was as follows: 0: absence of wrinkles, 1: slight wrinkling, 2: moderate wrinkling, 3: severe wrinkling. A statistical comparison with a Wilcoxon test of the scores obtained on the first day compared to the score on the 28th day showed a statistically significant reduction in the skin's wrinkling at the level of the eye contour, namely 66.1%, after 28 days. application of the composition according to the invention. In order to validate the skin's effectiveness of the "youth eye contour", 31 women between 40 and 49 years old were recruited for this study in order to test the anti-aging effect, its effectiveness as well as the "cosmetic" qualities. Of this composition. As a result, the composition was applied once a day for 28 days under normal conditions of use.
Les résultats obtenus sont résumés dans le tableau 8 et démontrent l'efficacité de la composition selon l'invention. Tableau 8 : GENERALITE favorable Facilité d'application 100% Appréciation globale 80% Texture agréable à très agréable 81°A Couleur agréable à très agréable 80% Odeur agréable à très agréable 61 A L'APPLICATION La texture est non collante 87% La texture est onctueuse 87% La texture pénètre facilement 81°A IMMEDIATEMENT La peau tiraille moins 100% Les rides du contour de l'ceil semblent moins marquées 68% Le contour de l'ceil est comme réhydraté 97% La peau du contour de l'ceil semble plus souple 93% EN FIN DE JOURNEE La peau du contour de l'ceil paraît nourrie 90% La peau du contour de l'ceil parait hydratée 93% La peau du contour de l'ceil parait plus lisse 71°A La peau du contour de l'ceil semble régénérée 74% La peau du contour de l'ceil est comme retendue 68% APRES 4 SEMAINES D'UTILISATION La peau du contour de l'ceil est nourrie 90% La peau du contour de l'ceil est hydratée 94% La peau du contour de l'ceil est plus résistante 65% La peau du contour de l'ceil a retrouvé son élasticité 74% La peau du contour de l'ceil est régénérée 71°A La peau du contour de l'ceil est plus lisse 74% Les rides et ridules sont lissées 65% Le regard est éclatant 61 Tel que démontré dans cet exemple, une composition selon l'invention, ici une composition « contour yeux jeunesse » permet avantageusement de de diminuer les rides et ridules tout en illuminant le teint.The results obtained are summarized in Table 8 and demonstrate the effectiveness of the composition according to the invention. Table 8: GENERAL DETAILED Ease of application 100% Overall appreciation 80% Pleasant to very pleasant texture 81 ° A Pleasant to very pleasant color 80% Pleasant to very pleasant odor 61 A APPLICATION Texture is non-sticky 87% Texture is creamy 87% The texture penetrates easily 81 ° A IMMEDIATELY The skin furrows less 100% The wrinkles of the contour of the eye seem less marked 68% The contour of the eye is like rehydrated 97% The skin of the contour of the eye seems softer 93% at the end of the day The skin of the contour of the eye seems nourished 90% The skin of the contour of the eye appears hydrated 93% The skin of the contour of the eye looks smoother 71 ° A The skin of the contour The skin of the eye contour is resuscitated 68% AFTER 4 WEEKS OF USE The skin of the contour of the eye is nourished 90% The skin of the contour of the eye is hydrated 94 % The skin of the contour of the eye is more resistant 65% The skin of the contour of the eye has regained its elasticity 74% The skin around the eye is regenerated 71 ° A The skin around the eye is smoother 74% Fine lines and wrinkles are smoothed 65% Look is radiant 61 demonstrated in this example, a composition according to the invention, here a composition "eye contour youth" advantageously reduces wrinkles and fine lines while illuminating the complexion.
Un second test d'usage a été réalisé avec la composition 4 du tableau 2. Cette composition est désignée ci-dessous « crème de jeunesse nuit». Pour ce faire, 32 femmes âgées entre 40 et 60 ans ont été recrutées pour cette étude afin de tester l'activité anti-âge de « crème de jeunesse nuit ». De ce fait, la composition a été appliquée une fois par jour pendant 28 jours dans les conditions normales d'utilisation. Afin de valider l'acceptabilité cutanée de la « crème de jeunesse nuit», 32 femmes âgées entre 40 et 60 ans ont été recrutées. Cette étude a été réalisée sur 28 jours avec application une fois par jour de la composition sur une zone de la peau. Un examen cutané de la zone a été réalisé par un dermatologue juste avant la première application et au 28ème jour d'application. Les résultats obtenus ont démontré qu'aucun signe clinique imputable à la composition n'a été observé et qu'aucune sensation d'inconfort n'a été rapportée. Afin de valider l'effet de la composition selon l'invention sur la fermeté et l'élasticité de la peau, 32 femmes âgées entre 40 et 60 ans ont été recrutées. Cette étude a été réalisée sur 28 jours avec application une fois par jour de la composition sur une zone de la peau, en particulier du visage et du cou. Un scorage clinique à l'aide d'une échelle ordinale en 4 points de 1 à 4 a été réalisé par l'investigateur juste avant la première application et au 28ème jour d'application. L'échelle était la suivante : 1 : peau très relâchée, 2 : peau relâchée, manque de fermeté, 3 : peau ferme, pas relâchée, 4 peau très ferme, élastique. Une comparaison statistique avec un test de Wilcoxon des scores obtenus au premier jour par rapport au score au 28ème jour ont montré une augmentation statistiquement significative de la fermeté de la peau, à savoir +45%, après 28 jours d'application de la composition selon l'invention. Afin de valider l'effet de la composition selon l'invention sur les rides et ridules de la peau, 32 femmes âgées entre 40 et 60 ans ont été recrutées. Cette étude a été réalisée sur 29 jours avec application une fois par jour de la composition sur une zone de la peau. Un scorage clinique à l'aide d'une échelle ordinale en 4 points de 0 à 3 a été réalisé par l'investigateur juste avant la première application et au 29ème jour d'application. L'échelle était la suivante : 0 : pas de ridulation cutanée, absence de ride ou ridules, 1 : ridulation cutanée légère, rides peu nombreuses, courtes, fines et peu profondes, 2 : ridulation cutanée modérée, au moins une ride profondes et/ou longue 1 cm) sur la partie plane du contour de 3 : ridulation cutanée sévère. Une comparaison statistique avec un test de Wilcoxon des scores obtenus au premier jour par rapport au score au 29ème jour ont montré une diminution statistiquement significative des rides et ridules cutanées au niveau du contour des yeux, à savoir -13%. En outre, une validation de l'effet antiride de la composition « crème de jeunesse nuit» avec le logiciel Qu'antirides (marque déposée) a été effectuée. Pour ce faire, 32 femmes âgées entre 40 et 60 ans ont été recrutées.A second use test was carried out with composition 4 of Table 2. This composition is referred to below as "youth night cream". To do this, 32 women between 40 and 60 years old were recruited for this study to test the anti-aging activity of "youth night cream". As a result, the composition was applied once a day for 28 days under normal conditions of use. In order to validate the cutaneous acceptability of the "youth night cream", 32 women between 40 and 60 years old were recruited. This study was carried out over 28 days with application once a day of the composition on an area of the skin. A skin examination of the area was performed by a dermatologist just before the first application and at the 28th day of application. The results obtained showed that no clinical signs attributable to the composition were observed and that no sensation of discomfort was reported. In order to validate the effect of the composition according to the invention on the firmness and elasticity of the skin, 32 women between 40 and 60 years old were recruited. This study was carried out over 28 days with application once a day of the composition to an area of the skin, especially the face and neck. A clinical scoring using a 4-point ordinal scale from 1 to 4 was performed by the investigator just before the first application and at the 28th day of application. The scale was as follows: 1: very loose skin, 2: relaxed skin, lack of firmness, 3: firm skin, not relaxed, 4 very firm skin, elastic. A statistical comparison with a Wilcoxon test of the scores obtained on the first day compared to the score at the 28th day showed a statistically significant increase in the firmness of the skin, namely + 45%, after 28 days of application of the composition according to the invention. In order to validate the effect of the composition according to the invention on the wrinkles and fine lines of the skin, 32 women between 40 and 60 years old were recruited. This study was carried out over 29 days with application once a day of the composition to an area of the skin. A clinical scoring using a 4-point ordinal scale from 0 to 3 was performed by the investigator just before the first application and at the 29th day of application. The scale was as follows: 0: no skin wrinkling, no wrinkles or fine lines, 1: slight skin wrinkles, few wrinkles, short, thin and shallow, 2: moderate skin wrinkles, at least one deep wrinkle and / or 1 cm long) on the flat part of the contour of 3: severe skin wrinkling. A statistical comparison with a Wilcoxon test of the scores obtained on the first day compared to the score on the 29th day showed a statistically significant reduction of skin wrinkles and fine lines at the level of the eye contour, namely -13%. In addition, a validation of the anti-wrinkle effect of the composition "youth cream night" with the software Qu'antirides (trademark) was carried out. To do this, 32 women between 40 and 60 years old were recruited.
Cette étude a été réalisée sur 29 jours avec application une fois par jour de la composition sur une zone de la peau. Une prise d'empreinte préalable a été effectuée au niveau d'une des pattes d'oie /contour de L'effet antiride de la composition a été évalué après analyse des images du microrelief avec le logiciel Quantirides (marque déposée) avant première application et après 29 jours d'utilisation du produit testé une heure après la dernière application, par comparaison des paramètres suivants : N : nombre total de rides, Lt : longueur totale des rides (en mm), Pm : profondeur moyenne des rides (en pm), St : surface totale des ride (en mm2). Pour chaque paramètre précité, après une analyse de la normalité de distribution de données obtenues (test de Shapiro- Wilk), une comparaison des valeurs obtenues au premier et au 29ème jour a été effectuée selon un test de Student. Les résultats obtenus montrent, notamment, une diminution significative du nombre totale de rides, à savoir -18,8%, une diminution de la longueur totale des rides, à savoir -26,4%, et une diminution de la surface des rides, à savoir -27%. Ces résultats démontrent donc clairement l'effet antiride de la composition selon l'invention. De plus, le tableau 9 ci-dessous comprend les résultats obtenus et démontre l'efficacité de la composition utilisée.This study was carried out over 29 days with application once a day of the composition to an area of the skin. A preliminary impression was taken at one of the crow's feet / contour of the anti-wrinkle effect of the composition was evaluated after analysis of the images of the microrelief with the software Quantirides (trademark) before first application and after 29 days of use of the tested product one hour after the last application, by comparison of the following parameters: N: total number of wrinkles, Lt: total length of wrinkles (in mm), Pm: average depth of wrinkles (in pm) , St: total surface of the wrinkles (in mm2). For each aforementioned parameter, after an analysis of the normality of data distribution obtained (Shapiro- Wilk test), a comparison of the values obtained at the first and at the 29th day was carried out according to a Student's test. The results obtained show, in particular, a significant decrease in the total number of wrinkles, namely -18.8%, a decrease in the total length of wrinkles, namely -26.4%, and a decrease in the surface of wrinkles, to know -27%. These results clearly demonstrate the anti-wrinkle effect of the composition according to the invention. In addition, Table 9 below includes the results obtained and demonstrates the effectiveness of the composition used.
Propriétés Favorable Appréciation globale du produit 97% Aspect du produit 97% Texture agréable 97% Couleur agréable 88% Odeur agréable 78% Produit facile à appliquer 100% A l'application La texture s'applique facilement 100% La texture pénètre rapidement 97% La texture est confortable 97% La texture est riche 97% La texture est onctueuse 94% Le parfum est frais et fleuri 66% Immédiatement La peau semble hydratée 97% La peau semble plus souple 94% La peau tiraille moins 94% La peau semble repulpée 78% Les rides et ridules semblent moins marquées 72% Les traits semblent instantanément lissés 81 La peau est comme gainée 81% Le visage est comme lifté 66% Au réveil La peau parait nourrie 97% La peau parait hydratée 97% La peau semble repulpée 81% La peau parait plus ferme 84% Les rides et ridules semblent lissées 72% La peau semble régénérée 88% Le visage semble lifté 66% Les rides et ridules semblent comblées 69% Après un 28 jours La peau est nourrie 97% La peau est hydratée 97% La peau est plus résistante 88% Le teint est plus lumineux, plus éclatant 88% La peau a retrouvée son élasticité 91% La peau est plus lisse 91% La peau est plus ferme 81% La peau est régénérée 84% Les rides et ridules sont lissées 72% Les rides et ridules sont comblées 69% L'ovale du visage parait redessiné 63% La peau du visage paraît plus jeune 66% Le visage est comme lifté 63% Le visage est comme remodelé 63% Tel que démontré dans cet exemple, une composition selon l'invention, ici une crème de nuit, permet avantageusement de combler les rides et a un effet anti-âge.5 Références bibliographiques 1 Koblenzer CS. Psychologic aspects of aging and the skin. Clinics Dermatol 1996;14:171-7 2. Pierard GE. The quandary of climacteric skin ageing. Dermatology 1996;193:273-4 3. Harvell JD, Maibach HI. Percutaneous absorption and inflammation in aged skin: a review. J Am Acad Dermatol 1994;31:1015-21 4. Ghadially R.Aging and the epidermal permeability barrier :implication for contact dermatisis. Am J Contact Dermat.Favorable Properties Overall Product Appreciation 97% Product Aspect 97% Pleasant Texture 97% Pleasant Color 88% Pleasant Smell 78% Easy to apply 100% At application Texture is easy to apply 100% Texture penetrates quickly 97% texture is comfortable 97% The texture is rich 97% The texture is creamy 94% The fragrance is fresh and flowery 66% Immediately The skin seems hydrated 97% The skin looks softer 94% The skin tugs 94% The skin seems plumped 78 % The wrinkles and fine lines seem less marked 72% The features seem instantly smoothed 81 The skin is like sheathed 81% The face is like lifted 66% Wake up The skin seems nourished 97% The skin appears hydrated 97% The skin seems plumped 81% The skin looks firmer 84% The lines and wrinkles seem smoothed 72% The skin seems refreshed 88% The face looks lifted 66% The lines and wrinkles seem filled 69% After a 28 days The skin is nourished 97% The pea u is hydrated 97% The skin is more resistant 88% The complexion is brighter, more radiant 88% The skin has regained its elasticity 91% The skin is smoother 91% The skin is firmer 81% The skin is regenerated 84% Wrinkles and fine lines are smoothed 72% Wrinkles and fine lines are filled 69% The oval of the face appears redrawn 63% The skin of the face looks younger 66% The face is like lifted 63% The face is like remodeled 63% Such as demonstrated in this example, a composition according to the invention, here a night cream, advantageously makes it possible to fill wrinkles and has an anti-aging effect. 5 References 1 Koblenzer CS. Psychological aspects of aging and the skin. Clinics Dermatol 1996; 14: 171-7 2. Pierard GE. The when of climacteric skin aging. Dermatology 1996; 193: 273-4 3. Harvell JD, Maibach HI. Percutaneous absorption and inflammation in aged skin: a review. J Am Acad Dermatol 1994; 31: 1015-21 4. Ghadially R.Aging and the epidermal permeability barrier: implication for contact dermatisis. Am J Contact Dermat.
1998 Sep;9(3):162-9. 5. Giacomoni PU, Rein G. Factors of skin ageing share common mechanisms. Biogerontology. 2001;2(4):219-29. 6. Makoto Goto. Inflammaging (inflammation + aging): A driving force for human aging based on an evolutionarily antagonistic pleiotropy theory?. BioScience Trends 2008; 2(6):218-230.1998 Sep; 9 (3): 162-9. 5. Giacomoni PU, Rein G. Factors of skin aging common shares. Biogerontology. 2001; 2 (4): 219-29. 6. Makoto Goto. Inflammaging (inflammation + aging): A driving force for human aging based on an evolutionarily antagonistic pleiotropy theory. BioScience Trends 2008; 2 (6): 218-230.
7 Frasca D, Blomberg BB. Effects of aging on B cell function. Curr Opin Immunol.7 Frasca D, Blomberg BB. Effects of aging on B cell function. Curr Opin Immunol.
2009 Aug;21(4):425-30. 8. Haynes L, Maue AC. Effects of aging on T cell function. Curr Opin Immunol, 2009 Aug;21(4):414-17. 9. Vitale M, Zamai L, Neri LM, Galanzi A, Facchini A, Rana R, Cataldi A, Papa S. The impairment of natural killer function in the healthy aged is due to a postbinding deficient mechanism. Cell Immunol.2009 Aug; 21 (4): 425-30. 8. Haynes L, Maue AC. Effects of aging on T cell function. Curr Opin Immunol, 2009 Aug; 21 (4): 414-17. 9. Vitale M, Zamai L, Neri LM, Galanzi A, Facchini A, Rana R, Catalida A, Papa S. The impairment of natural killer function in the healthy aged is due to a postbinding deficient mechanism. Cell Immunol.
1992 Nov;145(1):1-10. 10. Seitz G, Bonin M, Fuchs J et al. Inhibition of glutathione-S-transferase as a treatment strategy for multidrug resistance in childhood rhabdomyosarcoma. International Journal of Oncology 2010 36:491-500. 11. Tim Mosmann. Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. Journal of Immunological Methods Volume 65, Issues 1-2, 16 December 1983 Pages 55-63. 12. Devilard E, Bladou F, Ramuz O, Karsenty G, Dalès JP, Gravis G, Nguyen C, Bertucci F, Xerri L, Birnbaum D. FGFR1 and WT1 are markers of human prostate cancer progression. BMC Cancer.Nov 1992; 145 (1): 1-10. 10. Seitz G, Bonin M, Fuchs J et al. Inhibition of glutathione-S-transferase as a treatment strategy for multidrug resistance in childhood rhabdomyosarcoma. International Journal of Oncology 2010 36: 491-500. 11. Tim Mosmann. Rapid colorimetric assay for cell growth and survival: Application to proliferation and cytotoxicity assays. Journal of Immunological Methods Volume 65, Issues 1-2, 16 December 1983 Pages 55-63. 12. Devilard E, Bladou F, Ramuz O, Karsenty G, Dalès JP, Gravis G, Nguyen C, Bertucci F, Xerri L, Birnbaum D. FGFR1 and WT1 are markers of human prostate cancer progression. BMC Cancer.
2006 Nov 30; 6:272.2006 Nov 30; 6: 272.
Claims (12)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
FR1357573A FR3009195B1 (en) | 2013-07-31 | 2013-07-31 | COSMETIC OR DERMATOLOGICAL COMPOSITION AND USE THEREOF |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
FR1357573A FR3009195B1 (en) | 2013-07-31 | 2013-07-31 | COSMETIC OR DERMATOLOGICAL COMPOSITION AND USE THEREOF |
Publications (2)
Publication Number | Publication Date |
---|---|
FR3009195A1 true FR3009195A1 (en) | 2015-02-06 |
FR3009195B1 FR3009195B1 (en) | 2015-08-07 |
Family
ID=49510320
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
FR1357573A Active FR3009195B1 (en) | 2013-07-31 | 2013-07-31 | COSMETIC OR DERMATOLOGICAL COMPOSITION AND USE THEREOF |
Country Status (1)
Country | Link |
---|---|
FR (1) | FR3009195B1 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2022208005A1 (en) * | 2021-04-02 | 2022-10-06 | Credo | Cosmetic composition comprising at least one birch extract and at least one beech bud extract |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
FR3122093B3 (en) | 2021-04-23 | 2023-09-22 | Beauty Business Company | New combination of extracts of blackcurrant, beech and linden buds, composition including it and cosmetic use. |
Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
FR2792203A1 (en) * | 1999-04-19 | 2000-10-20 | Mu Laboratoire | Compositions for the prevention of skin aging contain a mixture of extracts of pine and blackcurrant |
US20050175719A1 (en) * | 2004-02-05 | 2005-08-11 | Ying Sun | Procyanidins for treatment and prevention of enzymatic irritation to the skin |
UA24504U (en) * | 2006-09-25 | 2007-07-10 | Nat Univ Uzhgorod | "lehenda karpat" "zakarpattia balsam", a composition of ingredients for treatment and prophylactic balsam |
KR20070108966A (en) * | 2006-05-09 | 2007-11-15 | 강동표 | A composition of cosmetic for improving skin wrinkle or enhancing skin elasticity |
FR2905867A1 (en) * | 2006-09-20 | 2008-03-21 | Oreal | Preparation of topical skin-care products or make-up, involves extracting vegetable substances with fluid under pressure and adding the extract to a preparation containing hydrophilic hydrolysable compounds |
RO126917A2 (en) * | 2010-06-25 | 2011-12-30 | Hofigal Export - Import S.A. | Range of natural products with bactericidal, fungicidal and virucidal properties and process for preparing the same |
-
2013
- 2013-07-31 FR FR1357573A patent/FR3009195B1/en active Active
Patent Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
FR2792203A1 (en) * | 1999-04-19 | 2000-10-20 | Mu Laboratoire | Compositions for the prevention of skin aging contain a mixture of extracts of pine and blackcurrant |
US20050175719A1 (en) * | 2004-02-05 | 2005-08-11 | Ying Sun | Procyanidins for treatment and prevention of enzymatic irritation to the skin |
KR20070108966A (en) * | 2006-05-09 | 2007-11-15 | 강동표 | A composition of cosmetic for improving skin wrinkle or enhancing skin elasticity |
FR2905867A1 (en) * | 2006-09-20 | 2008-03-21 | Oreal | Preparation of topical skin-care products or make-up, involves extracting vegetable substances with fluid under pressure and adding the extract to a preparation containing hydrophilic hydrolysable compounds |
UA24504U (en) * | 2006-09-25 | 2007-07-10 | Nat Univ Uzhgorod | "lehenda karpat" "zakarpattia balsam", a composition of ingredients for treatment and prophylactic balsam |
RO126917A2 (en) * | 2010-06-25 | 2011-12-30 | Hofigal Export - Import S.A. | Range of natural products with bactericidal, fungicidal and virucidal properties and process for preparing the same |
Non-Patent Citations (4)
Title |
---|
DATABASE GNPD [online] MINTEL; April 2010 (2010-04-01), "Tony Moly Puretox Daily Lotion", XP002725747, Database accession no. 1324470 * |
DATABASE GNPD [online] MINTEL; January 2013 (2013-01-01), "Antiwrinkle & Firming Night Cream", XP002725746, Database accession no. 1983070 * |
DATABASE WPI Week 200858, Derwent World Patents Index; AN 2008-J92797, XP002725749 * |
DATABASE WPI Week 201223, Derwent World Patents Index; AN 2012-D25329, XP002725748 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2022208005A1 (en) * | 2021-04-02 | 2022-10-06 | Credo | Cosmetic composition comprising at least one birch extract and at least one beech bud extract |
FR3121359A1 (en) * | 2021-04-02 | 2022-10-07 | Credo | COSMETIC COMPOSITION COMPRISING AT LEAST ONE BIRCH EXTRACT AND AT LEAST ONE BEECH BUD EXTRACT |
Also Published As
Publication number | Publication date |
---|---|
FR3009195B1 (en) | 2015-08-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP2706980B1 (en) | Cosmetic or dermatological composition made from extracts of everlasting and use thereof | |
EP3370833B1 (en) | Synergistic extract of palmaria palmata | |
FR3057462A1 (en) | ANIGOZANTHOS FLAVIDUS EXTRACT FOR ITS COSMETIC USE | |
WO2001043701A2 (en) | Cosmetic or dermopharmaceutical compositions containing the n-palmytoyl-gly-hys-lys tripeptide | |
EP3370832B1 (en) | Cosmetic or dermatological composition comprising an extract of jania rubens and an essential oil of immortelle and uses thereof | |
FR3018191A1 (en) | COSMETIC USES OF SWERTIAMARIN | |
WO2013004953A2 (en) | Cosmetic composition comprising a mixture of honeys | |
FR2980698A1 (en) | Use of a combination of macroalgae and microalgae extracts for preparing cosmetic and/or dermocosmetic product for topical application on oily skin and/or acne skin, and for fighting against free radicals and limiting irritation of skin | |
EP2961379A1 (en) | Cosmetic composition containing a brown alga extract, a yeast extract and ascorbic acid | |
EP2763652B1 (en) | Use of glucans obtained from prunus persica as an anti-aging cosmetic agent | |
WO2014102483A2 (en) | Cosmetic or dermatological composition made of iris extracts and use thereof | |
WO2019069007A1 (en) | Process for using a let-7b inhibitor in cosmetics and/or nutraceuticals | |
WO2014140485A2 (en) | Cosmetic or dermatological composition and use thereof | |
FR3009195A1 (en) | COSMETIC OR DERMATOLOGICAL COMPOSITION AND USE THEREOF | |
FR3004347A1 (en) | COSMETIC COMPOSITION COMPRISING ESSENTIAL OIL OF SAGE AND USE THEREOF | |
FR2918882A1 (en) | USE OF AT LEAST ONE EXTRACT OF AIRBORNE PARTITIONS OF THE EPILOBA AND / OR ONAGER FOR THE PREPARATION OF A COMPOSITION INTENDED TO RESTORE THE BARRIER FUNCTION OF KERATINIZED TISSUE OR MUCOUS MEMBRANES | |
FR3018448A1 (en) | ACTIVE PRINCIPLE OBTAINED FROM ALGAE HYPNEA MUSCIFORMIS AND COSMETIC USES | |
FR3052666A1 (en) | COSMETIC COMPOSITION COMPRISING SOFT ALMOND EXTRACT AND CARE METHOD | |
FR2997300A1 (en) | Cosmetic/dermatological composition, useful to treat and/or prevent diseases e.g. melasma and linea nigra induced by melanocytes and for treating skin pigmentation spots and hyperpigmentation, comprises sea lily and wintergreen extracts | |
WO2019077268A1 (en) | Cosmetic composition for active prevention of the signs of ageing | |
FR3010314A1 (en) | COSMETIC OR DERMATOLOGICAL USE OF A TAPIRIRA GUYANENSIS EXTRACT | |
FR3019987A1 (en) | COSMETIC COMPOSITION COMPRISING A MIXTURE OF HONEY AND KNIPHOFIA NECTAR | |
FR3097127A1 (en) | Method of using a Let-7b inhibitor in cosmetics and / or nutraceuticals | |
EP3763355A1 (en) | Composition comprising passion flower seed polyphenols, avocado peptides and an extract of witch hazel and use for treating and/or preventing stretch marks | |
FR3072877A1 (en) | COSMETIC USE OF A MIXTURE OF OLIGO-CARRAGHENANES TO PREVENT OR TREAT THE SIGNS OF THE AGING OF EPIDERMA |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PLFP | Fee payment |
Year of fee payment: 4 |
|
PLFP | Fee payment |
Year of fee payment: 5 |
|
PLFP | Fee payment |
Year of fee payment: 6 |
|
PLFP | Fee payment |
Year of fee payment: 7 |
|
PLFP | Fee payment |
Year of fee payment: 8 |
|
PLFP | Fee payment |
Year of fee payment: 9 |
|
PLFP | Fee payment |
Year of fee payment: 10 |
|
PLFP | Fee payment |
Year of fee payment: 11 |