FR2844523A1 - Multiplex detection and identification of bacteria in complex mixtures or water, useful e.g. for testing food, by simultaneous, but spatially resolved amplification - Google Patents

Abstract

Process for detecting and identifying bacteria present in a complex mixture or in water by simultaneous but spatially separated, multiplex amplification of target nucleic acids (I). Process for detecting and identifying bacteria present in a complex mixture or in water by multiplex amplification, simultaneous but spatially separated, of target nucleic acids (I) comprises: (1) contacting the sample of (I) with at least 2 pairs of primers for amplification, each pair being specific and exclusive for (I) of a bacterial species, genus or group; (2) amplification of (I); and (3) detecting and identifying bacteria in the mixture. Independent claims are also included for the following: (1) similar process that includes quantification of the bacteria, where amplification is by real-time PCR; (2) eleven primer pairs (sequences defined in the specification) for the process; (3) eleven sets of primer pairs and a probe (sequences defined in the specification) for the process; (4) probes for the process, specific and exclusive for a bacterial species, genus or group, that are complementary to amplification products generated by primers of (2); (5) kit for determining, identifying and optionally quantifying bacterial nucleic acid that contains at least 2 each of the new primer pairs and new probes; and (6) nucleic acid microarray or chip for identifying bacteria by the new process.

Description

<Desc / Clms Page number 1>

METHOD AND NUCLEOTIDE SEQUENCES FOR DETECTION
AND THE IDENTIFICATION OF MICROORGANISMS IN A MIXTURE
COMPLEX OR IN WATER
The present invention falls within the field of the analysis of the contamination of samples of agro-food origin or from the environment for example.

 In the context of the invention, the analysis of such samples refers to the detection, identification and, where appropriate, quantification of the microorganisms they contain.

 In other words, the invention is part of the improvement of procedures and the development of effective means for the detection, identification and, where appropriate, quantification of microorganisms contained in complex samples. Thus, the invention aims to provide a method using molecular biology techniques, as well as related tools, adapted to the qualitative and / or quantitative determination of the bacterial content of complex mixtures, in particular food samples.

 For the purpose of the present invention, a complex mixture refers to any composition containing in particular bacteria cells, said composition possibly being heterogeneous in nature, such as a crude food sample, not modified by drying for example, which gathers several different constituents, some of which are found in the liquid state and other solid, or more homogeneous nature, such a bacterial culture.

 In the present text, it will be indifferent to speak of bacteria present in water, in an aqueous medium, or in an aqueous medium, it being understood that this broadly designates bacteria present in any type of aqueous liquid.

<Desc / Clms Page number 2>

 The present invention relates to a method for the detection, identification and, where appropriate, quantification of bacteria contained in a complex mixture or in an aqueous medium, said method comprising a step of multiple amplifications, simultaneous but separated in space of target nucleic acid sequences.

 The invention also relates to pairs of amplification primers useful for implementing said method, as well as nucleotide probes for the detection and, where appropriate, quantification of nucleic acid sequences of bacteria contained therein. in a complex mixture or in an aqueous medium. In the context of the invention, the nucleotide probes can be associated with primer pairs for amplification, for the purposes of the real-time amplification of target nucleic acid sequences. The nucleotide probes can also be used for the detection of target sequences according to DNA-DNA hybridization techniques.

 The present invention further relates to molecular biological tools, namely an assay kit and microarrays or nucleic acid chips for the detection and identification of bacteria contained in a complex mixture or in an aqueous medium.

 The prokaryotic bacteria or microorganisms are remarkable for the heterogeneity of their characteristics, in particular in terms of their shape (bacilli, shells, etc.); habitat (soil, water, living hosts ...); cell envelope structure (possible presence of a wall, composition of said wall, optional presence of an outer membrane); saprophyte, commensal or parasitic diet; host spectrum in the case of commensals and parasites, pathogenicity profile and possible antibiotic resistance characteristics characteristic of certain parasites; ability to transfer nucleic acid sequences within the species, the genus, or even to species belonging to other genera bacterial ... Most often, these properties have a specificity at the level of the genus or the bacterial species. However, they can

<Desc / Clms Page number 3>

 also be subject to extreme variability between strains of the same species due to different environmental factors and stress conditions directing said strains to separate pathways of adaptive evolution. In view of such a level of heterogeneity in the properties of bacteria, the difficulties posed by the clear and formal typing and identification of said bacteria when contained in complex samples among other cellular components are easily measured. .

 However, the fact remains that such identification involves many activities. As such, it represents a challenge to considerable challenges.

 In the medical field, it is essential to have procedures and means for identifying optimal bacteria in terms of reliability and discriminating power, this in view of the public health problems generated by bacterial infections, including infections by bacteria multidrug-resistant, sometimes very difficult to control. Thus, the precise identification of bacteria up to the level of the species is intended to meet several expectations, not only of the public but also of the medical staff. For the latter, it is in particular to be able to: (i) accurately diagnose patients' pathologies; (ii) anticipate treatments, which are therefore more targeted and better adapted to the pathologies involved; (iii) prevent and, if necessary, deal with any relapses or recurrences; and (iv) deepen the epidemiological knowledge of pathogenic microorganisms, particularly through the characterization of factors favorable to the development of infections.

 In the field of health surveillance, it is important to ensure the quality and safety of the food available on the market, in particular to avoid any potential risk of epidemic mass contamination.

In this respect, consumers are concerned about issues relating to the nutritional properties of foods, their flavors, their

<Desc / Clms Page number 4>

 inoffensive character, and sometimes even their possible prophylactic or therapeutic virtues, with the recent concept of foodsmedicaments, so-called nutraceuticals. The current trend of the public is to demand a perfect transparency throughout the food chain, that is to say both in the production of raw materials or finished products and the manufacture of intermediate products, at the level of conveying said raw materials or finished and intermediate products to their sales site, and at the level of their marketing or their use in the context of the preparation of more complex products, such as ready meals. This is why safety and quality standards have been laid down for producers, manufacturers, transporters, distributors and restaurateurs, standards whose non-compliance is sanctioned by specialized authorities responsible for health surveillance, among which veterinary experts and the Directorate General of Consumption, Competition and the Repression of Frauds. Thus, controls are carried out, regularly or sporadically, punctually or on a larger scale, in order to cover the entire food chain, from production to sale to the individual. In this respect, it is fundamental to guarantee the quality and reliability of the microbiological control of food, particularly as regards the determination of the zero level of contamination by pathogenic bacteria for humans and / or animals.

 For the purpose of the detection and identification of bacteria, methods based on biochemical reactions have been used for a long time to demonstrate in vitro the phenotypic and metabolic characteristics of the strains tested. However, these conventional methods often show a limited capacity to identify bacteria up to the level of the species, in that they are based on the outcome of often random reactions of possibly fermentative metabolisation of various nutrient sources, for example sources. carbon and nitrogen. Indeed, the identification

<Desc / Clms Page number 5>

 Phenotypic involves combining and crossing the responses of bacteria to a variety of biochemical tests. As a result, when certain species do not respond to one or more of these tests - which is the case for certain bacterial species which, although pathogenic, are rarely isolated in hospitals, in particular - the analysis becomes risky and devoid of objectivity. Also, to improve the specificity and acuity, additional tests are required, requiring time, effort and means sometimes expensive. Ultimately, such methods are long and complicated to implement, the result is generally obtained after 24 to 48 hours, and random in terms of specificity and reliability. Admittedly, commercial phenotypic identification systems, such as miniaturized galleries for manual use of the API range (bioMérieux, France) or cards intended to be sown, incubated and read by means of a PLC (VITEK, bioMérieux, France ), nevertheless remain used clinically and in industry. However, the tests at issue concern bacterial species that are currently isolated and easy to cultivate. In addition, they are not performed to respond to an emergency since the incubation times required by such systems often reach 24 hours.

 In order to develop procedures leading to rapid and correct discrimination of bacteria, alternative approaches to traditional physiological tests have been proposed.

 Some of these approaches remain in the field of phenotypic characterization, for example, methods based on antibody reactions or bacteriophage typing based on bacterial receptor profiles. However, such methods are of questionable reproducibility with regard to the variability of expression of the phenotypic characteristics in question, such as the expression of virulence factors and antigens, sporadic because they are influenced to a very large extent by the environment and the stress.

<Desc / Clms Page number 6>

 As for the other procedures, they were developed for the purpose of discriminating not phenotypically but genotypically, that is to say at the level of the nucleic acid sequences themselves and their organization. In this respect, they make use of molecular biology techniques (Gurtler and Mayall, 2001. Int.J. J. Evol Microbiol, 51 (Pt 1): 3-16).

 In particular, genetic typing methods are of particular interest when the analysis concerns pathogens whose handling is difficult and non-reproducible, in particular because of a low speed and a versatility of growth, as well as the lack of specific pre-requisites in terms of growing conditions. Such circumstances make the metabolic tests quite inappropriate (Versalovic et al., 1993. Arch.

Pathol. Lab. Med. 117: 1088-1098).

 Many of the molecular biology techniques used for bacterial typing and characterization are based on electrophoretic separation of products derived from the digestion of the nucleic acids of said bacteria, these products having, hopefully, different molecular sizes from in order to obtain migration profiles that are as clear and exploitable as possible. These techniques include Pulse Field Pulse Electrophoresis (PFGE), Restriction Fragment Length Polymorphism (RFLP) and fragment length polymorphism. Cleavase 1 (Cleavase I-Fragment Length Polymorphism (CFLP) endonuclease cleavage (Olive and Bean, 1999. J. Clin Microbiol 37: 1661-1669).

 Despite the time and effort required for experimental development and implementation, the resulting restriction profiles are often extremely complex and difficult to analyze and interpret, requiring the assistance of appropriate software. Also the investments imposed by the implementation of such methods

<Desc / Clms Page number 7>

 can they be ultimately high or even prohibitive for some structures, including laboratories and small industries.

 Simpler and faster, amplification reactions, and especially polymerase chain reaction amplification, more commonly known as PCR (Polymerase Chain Reaction), make it possible to characterize species-specific nucleic acid sequences, by targeting either ubiquitous genes such as those encoding 16S ribosomal RNAs or D-alanine: D-alanine ligases, pivotal enzymes of the metabolism of the bacterial wall (Evers et al., 1996. J. Mol., Evol 42: 706-712), that is, intergenic spaces such as the region between the 16S and 23S ribosomal DNAs (Gurtler and Stanisich, 1996. Microbiology 142 (Pt 1): 3-16) .The amplification involves the use of nucleotide primers capable of hybridizing with complementary sequences present in the nucleic acid molecules serving as templates. This is a simple technique, easy to implement routinely, reliable and reproducible if the tools used, including primers, DNA polymerase and, in the case of thermo-dependent amplifications, the conditions of temperature, are themselves respectively specific, faithful and adapted.

In the context of the identification of bacteria, the amplification, in particular the PCR, can be applied alone or, for a finer differentiation of the species, coupled with other techniques, among which the determination of the sequence of the products of amplification, RFLP and amplification product size polymorphism (Amplified Fragment
Length Polymorphism; AFLP) (Olive and Bean, 1999, supra). The implementation of these latter, obviously longer and heavier combinations of techniques is, however, not necessary for the establishment of a routine analysis.

 In the end, for the purposes of such an analysis, which must be simple, fast and efficient, the amplification technique can be self-sufficient, provided that the means and tools used meet the

<Desc / Clms Page number 8>

 requirements of specificity, reliability, reproducibility and discriminative power mentioned above. Such a technique also has the advantage of being particularly sensitive and, consequently, of allowing the treatment of small volumes and / or quantities of nucleic acids.

 Thus, in view of the considerable stakes in terms of health and public safety, it is absolutely necessary to develop methods for the detection and identification of bacteria meeting the following criteria, said criteria being imposed by the requirements of implementation in routines encountered by clinicians, research and analysis laboratories, agri-food and pharmaceutical industries: (i) simplicity; (ii) speed; (iii) acuity; (iv) reliability; (v) reproducibility; (vi) performance, including the number of samples that can be processed simultaneously; (vii) cost; and (viii) volume of facilities.

 The present invention therefore relates to a method for the detection, identification and, where appropriate, quantification of bacteria contained in a complex mixture or in an aqueous medium, said process fulfilling all of the implementation requirements listed above. The method involves performing at least two simultaneous but spatially separated amplification reactions of at least two specific and exclusive target nucleic acid sequences of at least two distinct species, genera or bacterial groups. In this regard, said method comprises at least the following steps: a) bringing the nucleic acid sample into contact with at least two pairs of amplification primers and, where appropriate, at least two associated probes, each couple and each probe associated with said pair being specific and exclusive of a target nucleotide sequence; b) the amplification of the target nucleotide sequences, in particular by real-time PCR; and

<Desc / Clms Page number 9>

 c) the detection of the presence, the identification and, where appropriate, the quantification of the bacteria contained in the complex mixture or in the starting water.

 The primers for amplification and associated probes that are the subject of the present invention were chosen from target sequences derived from the literature by application of the following criterion, referred to as dual specificity, namely a specificity of sequence and size.

 On the one hand, the sequence specificity is such that: (i) said primers and associated probes could be used in the context of multiplex amplification reactions, i.e. multiple amplification reactions, simultaneous and occurring within one and the same reaction medium, without the risk of obtaining undesired secondary amplification products, likely to distort the analysis; (ii) they are not hybridizable to each other, which prevents false-negative results; and (iii) they are specific for nucleotide sequences that are themselves specific to species or genera, or even bacterial groups.

 On the other hand, the size specificity of the generated amplification products makes it possible to unambiguously attribute, by means of conventional analytical methods known to those skilled in the art, such gel electrophoresis, each of said products to the bacterium of which he comes from.

 Said primers for amplification and associated probes, in addition to being specific, are also exclusive under the conditions of use described in the context of the present invention.

This exclusivity applies not only to (i) species, genus or even bacterial groups in the presence, primers and probes being chosen so as to avoid any hybridization with the nucleic acids of other species, genera or bacterial groups that that actually sought, but also (ii) vis-à-vis the nucleotide sequences of the species, genus or target group, insofar as said primers

<Desc / Clms Page number 10>

 and probes are not able to hybridize with other sequences than the desired sequence. As such, the exclusivity of the primers for amplification and associated probes according to the invention guarantees the obtaining of results devoid of false positives.

 The above-defined specificity and exclusivity characteristics are applicable not only to the amplification primers and associated probes, but also to the target nucleic acid sequences.

 In the context of the present description, it will be agreed that the terms bacterial species or species may refer, as the case may be, to bacterial species proper and in accordance with conventional taxonomic use, or to bacterial genera, level of taxonomic classification immediately superior to the species, or to bacterial groups, said groups representing either bacterial families as classically listed in the field of microbial systematics and corresponding to the classification level located above the genus, or groups genera or families of bacteria having one or more common phenotypic or physiological characters. For example, such bacterial groups can collect bacilli as opposed to shells, or mesophilic organisms (ie, organisms whose optimum growth temperature is between about 20 and 37 ° C) as opposed to psychrophilic or thermophilic organisms (ie, organisms whose optimum growth temperature is between 4 and 10 C or approximately 45 to 60 C respectively), or saprophytic bacteria (ie, bacteria living in nature independently) as opposed to commensal bacteria, symbiotic or parasitic (ie, bacteria living in close association with the host cells, respectively without benefit or disadvantage for one another, or benefiting from this combination, or from which only the bacteria benefit, the latter generally impairing the metabolism of host cells). The skilled person

<Desc / Clms Page number 11>

 specialized in bacteriology is perfectly able to define bacterial groups, in addition to those listed above, based on common morphological and / or phenotypic and / or physiological criteria. The meaning to be given to the terms bacterial species or species will be clear from the context. In particular, one skilled in the art can refer to Table # infra to know if the target nucleotide sequences of the amplification reactions, and the sequences of the amplification primers and associated probes according to the invention, are specific and exclusive of species genera (Salmonella spp., for example) or bacterial groups (Escherichia coli, Shigella spp., Yersinia enterocolitica and Hafnia alvei, for example).

Thus, a preferred embodiment of the method which is the subject of the invention consists in using as a matrix a sample consisting of nucleic acids previously extracted and purified from the cells of bacteria contained in a complex mixture, in particular a food mixture, or in water, using an extraction automaton. An example of such an automaton has been described in the French patent application N 0204424 relating to a process for extracting nucleic acids from microorganisms contained in a complex mixture, especially food, said method comprising at least the following steps:
1) clarification of the mixture by filtration;
2) the retention of the microorganisms contained in the filtrate on a filtration cartridge type device;
3) lysis of microorganisms in situ;
4) recovering nucleic acids from the filter cartridge; and
5) the concentration and purification of the nucleic acids by liquid-solid adsorption chromatography, such as silica column chromatography.

 The application N 0204424 also relates to an automaton capable of implementing such an extraction method.

<Desc / Clms Page number 12>

 According to the detection method that is the subject of the present invention, the term amplification is given a generic meaning, in that it refers to any molecular biology technique whose principle consists in amplifying or multiplying exponentially a sequence of target nucleic acid. Non-limiting examples include PCR, Transcription-Mediated Amplification (TMA), nucleic acid sequence-based amplification (Nucleic Acid Sequence Based Amplification, NASBA). , Self-Sustained Sequence Replication (3SR), Strand Displacement Amplification (SDA), and Ligase Chain Reaction (LCR).

 It should be noted that the acronym PCR may be used in the context of the present invention to specifically designate the PCR reaction, or indifferently any amplification reaction such as those mentioned above.

 The amplification reactions thus targeted can be isothermal or require cyclic exposure at different temperatures. According to this latter configuration, it is advantageous to speak of a thermo-dependent amplification reaction, although the latter term may sometimes be tacit, in which case the person skilled in the art is able to deduce it clearly and unambiguously from the context.

 According to one embodiment of the invention, the amplification is carried out for the purpose of a purely qualitative detection of the bacteria contained in a complex mixture or in water.

 In contrast, according to another embodiment, the analysis carried out in accordance with the method which is the subject of the invention is quantitative, in that it makes it possible to determine the initial concentration of the target sequence within the nucleic acid sample. . The so-called quantitative, kinetic or real-time amplification techniques known to those skilled in the art are then used.

<Desc / Clms Page number 13>

 In particular, these techniques make it possible to measure by fluorescence the accumulation of the products during the amplification reaction, the intensity of the fluorescence emitted being proportional to the quantity of amplified molecules. Many real-time detection systems for PCR amplification products have thus been developed, among which we distinguish the intercalating agents emitting a fluorescent signal when they are bound to DNA double-stranded DNA (DNA binding dye), the fluorescent primers, hybridization probes and hydrolysis probes (for review, see The Technoscope entitled Real-Time PCR, Booklet N 139, in the journal Biofutur N 219 of February 2002).

 Among the most widely used systems include TaqMan ™ hydrolysis probes (ABI, Foster City, CA, USA). These probes have between 25 and 35 nucleotides, and carry a fluorophore at their 5 'end and a fluorescence absorber (hereinafter quencher) at the 3' end. The quencher, placed a short distance from the fluorophore, absorbs the fluorescence emitted by it and emits a fluorescence which is not detected by the PCR automaton. By way of example, 5-TAMRA, which re-emits at 568 nm can be inhibited. Taq DNA polymerase (hereinafter Taq polymerase), by its exonuclease activity in the 5 'to 3' direction, will degrade the probe hybridized to the region of the target sequence which is complementary to it. This degradation is effected by the enzyme sequentially from the 5 'end of the probe. It is precisely this process of degradation by hydrolysis of the probe which is at the origin of the fluorescence emitted, the fluorophore thus being physically separated from the quencher by a mechanism directly involving the sequence to be detected.

 Briefly, during the hybridization step of the PCR reaction, the amplification primers and the associated probe recognize their complementary sequence. The Taq polymerase then proceeds to extend the primers in the 5 'to 3' direction until it encounters the double-stranded structure formed by the hybridized target sequence region.

<Desc / Clms Page number 14>

 with the probe. The 5 'to 3' exonuclease activity of the enzyme then sequentially cleaves the probe from its 5 'end. This progressive hydrolysis releases the fluorophore into the reaction medium, which causes an increase in the emitted fluorescence. The measurement of the fluorescence at the end of each extension step of the PCR reaction makes it possible to follow the evolution of the reaction over time and to determine the initial concentration of target nucleic acids in the starting sample.

 It is also possible to cite purely illustrative molecular beacons, belonging to the group of hybridization probes. These beacons carry a fluorophore and a quencher respectively located at the 5 'and 3' ends of the probes. The sequences of the 5 'and 3' ends of the probes are drawn independently of the target sequence and are mutually complementary, in order to form in solution a stem-loop structure, or hairpin structure, in which the fluorophore and the quencher are located in a screw position. -a-vis. The central region of the probes is complementary to an internal region of the target sequence, and forms the loop of this structure. In the presence of the target sequence, the probes hybridize to their complementary sequence by their central part, which causes the deployment of the folded structure of the probes. The fluorophore is then separated from the quencher. Unlike TaqManTM chemistry, the fluorescence emitted must be measured during the hybridization step, when the probes emit a fluorescent signal by binding to the region of the target sequence complementary thereto.

 For the purposes of the present invention, the term "analysis" as well as the expression "detection of bacteria" may mean both detection, identification and, where appropriate, quantification of said bacteria. Such a meaning is clear to the person skilled in the art clearly and unequivocally from the context.

<Desc / Clms Page number 15>

 The present invention relates to a method of multiple, simultaneous but spatially separated amplifications in that an amplification reaction is not carried out using a single trio comprising a pair of primers and a probe. associated, but several concomitant amplification reactions of several different target sequences present in the same sample, said reactions being such that: (i) they involve several distinct trios combining pairs of primers and probes; (ii) at each pair of primers and associated probe is assigned a particular reaction space; and (iii) each amplification reaction is carried out within a specific reaction medium contained in said space.

 Advantageously, such a space is a reaction chamber of a single-use cartridge described in US patent application No. 09/981070 benefiting from the priority of the French patent application published on February 1, 2002 under number 2812306. For example, such a cartridge comprises in particular a plurality of reaction chambers, each containing a pair of primers and an associated probe for the amplification of target nucleotide sequences, to which is connected a sample supply reservoir of nucleic acids serving as templates when multiple amplifications, simultaneous but separated in space. The number of reaction chambers may vary from about 20 to about 500, or from about 30 to about 100. For example, Genedisc, marketed by GeneSystems (Bruz, France), comprises 36 reaction chambers.

 This cartridge can be used in a device of the automaton type for the amplification of nucleic acid sequences, said device comprising, in addition to the cartridge or cartridges themselves, at least one heating plate of which at least two distinct zones can be brought to at least two different temperatures and kept constant, each temperature thus corresponding to a given step of an amplification cycle, namely the denaturation, hybridization or

<Desc / Clms Page number 16>

 of elongation, as well as means for relative displacement between the cartridge or cartridges and the platinum or plates, said displacement ensuring a cyclic exposure of the reaction chambers of a cartridge to the temperature of each of the zones of a platen, which allows automatically chaining the cycles of the amplification reaction taking place inside said chambers.

 For the purposes of the invention, the term many means to be synonymous with expressions, themselves equivalent, at least two and two or more.

 Nucleic acids cover, according to the usual meaning, DNAs and RNAs, the former being for example genomic, plasmidic, recombinant, complementary (cDNA), and second, messengers (mRNA), ribosomal (rRNA), transfer (tRNA).

 Amplification reactions are applicable to both DNAs and RNAs, in the second case by introducing a preliminary reverse transcription step, providing a copy of the RNA in the form of a cDNA and generating by there, a matrix that can be used for amplification purposes using the chosen pairs of nucleotide primers and, if appropriate, probes associated with said pairs. In this case, the amplification reaction is known to those skilled in the art under the acronym RT-PCR (Reverse Transcription - PCR). It is one of the grouped reactions, as defined above, under the name amplification or PCR.

 According to the usual vocabulary for PCR, the nucleic acid sequences to be amplified are called targets or matrices.

As stated above, in the particular context of the present invention, said sequences are coated with specificity and exclusivity properties as defined above.

 Thus, according to the method that is the subject of the present invention, the target nucleic acid sequences are amplified using specific and exclusive nucleotide primer pairs, the expression specific primer

<Desc / Clms Page number 17>

 and exclusive designating in this case any nucleotide sequence useful as a primer for amplification and capable of hybridizing under strict conditions with at least 80% of the target nucleic acid sequences. The stringent hybridization conditions follow the conventional definition and are known to those skilled in the art (Sambrook and Russel, 2001. Molecular cloning: a laboratory manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY) Strict hybridization conditions are, for example, conditions allowing specific hybridization of two single-stranded DNA sequences, after at least one washing step.

The hybridization step may in particular be carried out at about 65 ° C., in a solution comprising 6 × SSC, 0.5% SDS, 5 × Denhardt's solution and 100 g non-specific DNA (for example Salmon sperm DNA), or in any other solution of equivalent ionic strength. The following step, comprising at least one washing, is for example carried out at about 65 ° C., in a solution comprising SSC at most 0.2 × and SDS at at most 0.1%, or in any other solution of force. ionic equivalent. The parameters defining the hybridization conditions depend on the temperature Tm at which 50% of the paired strands separate. For sequences of more than 30 bases, the temperature Tm is defined by the relationship: Tm = 81.5 + 0.41x (% G + C) + 16.6xLog (concentration of cations) - 0.63x (% formamide) - (600 / number of bases). For sequences of less than 30 bases, the temperature Tm is defined by the relation: Tm = 4x (number of G + C) + 2x (number of A + T).

The hybridization conditions can therefore be adapted by those skilled in the art according to the size of the sequences, the GC content and other parameters, as indicated in particular in the protocols described in Sambrook and Russel (2001, supra).

 In the remainder of this text, the primers and the probes will be preferably defined by their percentage of identity with the sequences described. Several programs exist to calculate the percentage identity between two sequences, among which is the BLAST software, which

<Desc / Clms Page number 18>

 can be used here. In particular, version 2. 06 can be used, as well as the standard version of nucleotide alignment available on the NCBI site or, for sequences between 7 and 20 nucleotides, the specific version for short sequences, available on this same site (www.ncbi.nlm.nih.gov/BLAST/). The similar sequences thus envisaged may be of the same length as the sequences described in the present text and in Table I, or of a different length, then preferably comprised between 15 and 35 bases.

 The terms and expressions primers, primers for amplification and nucleotide primers are equivalent to the meaning of the present invention. It is understood that primers so designated are necessarily specific and exclusive, although this is not always explicitly specified in the text.

 The present application describes in particular primer pairs specific for certain microorganisms, and usable under certain conditions. It is obvious that a pair of primers corresponding to the complementary reverse sequences of each of the primers of a pair of primers described in the present application can be used instead of said pair of primers. Such a pair of primers will be called pair of complementary reverse primers of the first pair.

Preferably, the method according to the present invention leads to the detection of pathogenic bacteria of mammals, men and / or animals. In particular, said method makes it possible to detect the possible presence of several bacterial species among the following pathogenic infectious agents: Escherichia coli and / or Shigella spp. and / or Hafnia alvei and / or Yersinia enterocolitica, Staphylococcus aureus, Listeria monocytogenes, Salmonella spp., Bacillus cereus, Clostridium perfringens,
Y. enterocolitica, Campylobacter jejuni, and Legionella spp., Including Legionella pneumophila. These bacterial species are, for the most part, among the most common food contaminants and water contaminants of greatest concern to them.

<Desc / Clms Page number 19>

 pathogenicity and their resistance or even their resistance to common antibiotics.

 In the case of H. alvei, this enterobacteria, although rare, may nevertheless be at the origin of the alteration of certain foods, in particular meat packaged under a low oxygen atmosphere. In addition, H. alvei is difficult to identify by conventional methods and frequently confused with Salmonella for example. The present invention makes it possible to discriminate in a simple and rapid manner H. alvei from Salmonella spp.

 For the most part, these bacteria are pathogenic and cause gastrointestinal disorders (diarrhea, vomiting ...), sometimes severe and possibly accompanied by fevers. In this respect, they represent a particular danger for pregnant women, young children and the elderly in particular, a danger that should be removed by drastic measures if necessary, as evidenced by the fact that in recent years increase the number of food withdrawal campaigns, especially raw milk cheese, in which Listeria monocytogenes or Salmonella spp. exceeded the normative tolerated thresholds.

 Bacteria of the genus Legionella spp. are present in the water (drinking water, hot and cold sanitary water, cooling tower water, surface water, groundwater), and have been responsible for nosocomial infections or in people frequenting certain thermal establishments, leading to provisional closure of such establishments. It is therefore important to be able to easily and quickly detect any contamination of the water by Legionella.

 In order to detect the above-mentioned bacterial species, the pairs of primers and probes associated hereafter have been chosen or drawn in such a way as to fulfill the conditions of specificity and exclusivity required in the context of the implementation of the process. object of the invention and in

<Desc / Clms Page number 20>

 particular, of the step of multiple amplifications, simultaneous but separated in space.

 Advantageously, the nucleotide sequences designed for E. coli also make it possible to identify H. alvei, and thereby to distinguish this bacterial species Salmonella, with which it is generally confused.

 If necessary, the subsequent discrimination between E. coli and H. alvei can be carried out by determining the type of nitrate reductase, the majority of enterobacteria, including E. coli, having a type A nitrate reductase, while H. alvei has a type B nitrate reductase (for the procedure to be followed for the purpose of this determination, see Marchai et al.

1982. In Culture media for isolation and biochemical identification of bacteria. Doin Editors, Paris, France).

 The sequences designed for E. coli make it possible, in addition to H. alvei, to detect Shigella spp. and Y. enterocolitica.

 However, the distinction between E. coli, Shigella spp. and H. alvei on the one hand, and Y. enterocolitica on the other hand, is ensured by the use of specific and exclusive nucleotide sequences of the latter bacterial species.

 In addition, discrimination between E. coli, Shigella spp. and H. alvei can be carried out on the basis of biochemical criteria such as that mentioned above and, for example, by using API20E-type commercial assays (bioMérieux, supra).

 The pair of primers (LmHlyAf; LmHlyAr) has been described by Nogva et al. (2000. Appl., Microbial 66: 4266-4271). The primer pairs (Ye86f; Ye86r), (Ec97f; Ec97r), (Se98f; Se98r), (Sa193f; Sa193r), (Bc84f; Bc84r), (Cp97f; Cp97r) and (Cju76f; Cju76r) were drawn at purposes of the present invention based on the genomic sequences respectively published and deposited in GenBank by Ibrahim et al.

 (1997. J. Clin Microbiol 35: 1636-1638; N Access X65999), Smith et al.

 (1992. J. Bacteriol 174: 5820-5826; access N M84024), Bäumler et al.

<Desc / Clms Page number 21>

(1996. Gene 183: 207-213; U62129 access N), Shortle (1983. Gene 22: 181-189; V01281 access N), Gilmore et al. (1989. J. Bacteriol 171: 744-753, access N M24149), St. Joanis et al. (1989. Mol Gen Genet 219: 453-460, Access N X17300) and Taylor et al. (1990. Mol.Cell Probes 4: 261-271, Access N U27272). The primer pairs (Lg189f; Lg69r), (Lg69f; Lg69r), and (Lpn112f; Lpn112r) were designed for the purpose of the present invention from the genomic sequences respectively deposited in GenBank under numbers AF122885 (for both first couples) and Y12705.

 The following Table I details, for each bacterium, the characteristics of the pairs of primers and associated probes, as well as the amplification products generated by means of said pairs. In this Table, the sequences SEQ ID N 17 to 24, whose name carries the extension TqFT, correspond to the probes associated with amplification primer pairs, said probes being for example TaqManTM type (supra).

 It is understood that any hybridizable sequence under strict conditions at least 80% with the sequences of the probes shown in Table I, or any sequence having at least 80% identity with such a probe or its complementary reverse sequence, and responding to the criteria of specificity and sequence exclusivity given above, may be used, in the context of the present invention, as a probe.

 Similarly, it is clear that any nucleotide sequence having at least 80% identity with one of the primers listed in Table I or its complementary reverse sequence, may be used as a primer for amplification according to the invention.

<Desc / Clms Page number 22>

BOARD

<tb> Size <SEP> of
<tb><SEP> designation of <SEP> SEQ <SEP> Gene <SEP> products
<tb> Bacteria <SEP> primers <SEP> and <SEP> Sequence <SEP> ID <SEP> N <SEP> target <SEP> Product <SEP> of <SEP> gene <SEP> amplification
<tb> probes <SEP> (pb)
<tb> LmHlyAf <SEP> 5 '<SEP> CCTgCAAgTCCTAAgACgCCA <SEP>3'<SEP> 1
<tb> Listeria <SEP> LmHlyAr <SEP> 5 '<SEP> CACTgCATCTCCgTggTATAC <SEP>3'<SEP> 2 <SEP> HlyA <SEP> Listeriosis <SEP> O <SEP> 113
<tb> monocytogenes
<tb> Lmll3TqFT <SEP> 5 '<SEP> CgATTTCATCCgCgTgTTTCTTTTCg <SEP>3'<SEP> 17
<tb> Ye86f <SEP> 5 '<SEP> CAgTgATgCATTATCgACACC <SEP>3'<SEP> 3 <SEP> 86
<tb> Yersinia <SEP>
<tb> enterocolitica <SEP> Ye86r <SEP> 5 '<SEP> CACTACTgACTTCggCTggT <SEP>3'<SEP> 4 <SEP> Yst <SEP> Enterotoxin
<tb> Ye86TqFT <SEP> 5 '<SEP> CAAgCAAgCTTgTgATCCTCCgC <SEP>3'<SEP> 18
<tb> Escherichia <SEP> coli <SEP> Ec97f <SEP> 5 '<SEP> CgACCTgCgTTgCgTAAATATg <SEP>3'<SEP> 5
<tb> and / or <SEP> Hafnia <SEP> alvei <SEP> Ec97r <SEP> 5 '<SEP> CCTCggAAgAACCAATggTgT <SEP>3'<SEP> 6 <SEP> GAD <SEP> glutamate
<tb> and / or <SEP> Shigella <SEP> spp. <SEP> Ec97TqFT <SEP> 5 '<SEP> CCgAAAAATggTCAggCCgTTg <SEP>3'<SEP> 19 <SEP> decarboxylase <SEP> 97
<tb> and / or <SEP> Yersinia <SEP> ND <SEP> ND
<tb> enterocolitica
<tb> Se98f <SEP> 5 '<SEP> TggACCACTgATTgCCgCTA <SEP>3'<SEP> 7
<tb> Salmonella <SEP> spp. <SEP> Se98r <SEP> 5 '<SEP> gTgATTTCgTCACgCCTTTg <SEP>3'<SEP> 8 <SEP> IroB <SEP> Glucosyltransferase <SEP> 98
<tb> Se98TqFT <SEP> 5 '<SEP> CTTCggTCATACgCCCTggCAC <SEP>3'<SEP> 20
<tb> Sal93f <SEP> 5 '<SEP> ATggACgTggCTTAgCgTAT <SEP>3'<SEP> 9
<tb> Staphylococcus <SEP> Sal93r <SEP> 5 '<SEP> TgACCTgAATCAgCgTTgTC <SEP>3'<SEP> 10 <SEP> Nuc <SEP> nuclease <SEP> 193
<tb> aureus
<tb> Sal <SEP> 93TqFT <SEP> 5 '<SEP> TCgTCAAggCTTggCTAAAgTTgC <SEP>3'<SEP> 21 <SEP>
<tb> Bacillus <SEP> cereus <SEP> Bc84f <SEP> 5 '<SEP> gATTggTTCgTAAgAgCAgCTg <SEP>3'<SEP> 11 <SEP> CerA <SEP> phospholipase <SEP> C <SEP> 84
<Tb>

<Desc / Clms Page number 23>

<tb> Bc84r <SEP> 5 '<SEP> AACgCTTACCTgTCATTggTg <SEP>3'<SEP> 12
<tb> Bc84TqFT <SEP> 5 '<SEP> TgCAgATAAATggCgCgCTgAAg <SEP>3'<SEP> 22
<tb> Cp97f <SEP> 5 '<SEP> CTATCTTggAgAAgCTATgCAC <SEP>3'<SEP> 13
<tb> Clostridium <SEP> Cp97r <SEP> 5 '<SEP> gTCTCAAACTTAACATgTCCTg <SEP>3'<SEP> 14 <SEP> PLC <SEP> toxin <SEP> alpha <SEP> or <SEP> 97
<tb> perfringens <SEP> Cp97r <SEP> 5 '<SEP> gTCTCAAACTTAACATgTCCTg <SEP> PLC <SEP> phosphohospase <SEP> C <SEP>
<tb> Cp97TqFT <SEP> 5 '<SEP> CATCCTgCTAATgTTACTgCCgTTg <SEP>3'<SEP> 23
<tb> Cju76f <SEP>5'CTTgCAAATCgTTCTTTggg3'<SEP> 15 <SEP> 76
<tb> Campylobacter <SEP> Cju76r <SEP> 5 '<SEP> TAgCggTACgACTgTCTTgg <SEP>3'<SEP> 16 <SEP> ND <SEP> ND
<tb> jejuni
<tb> Cju76TqFT <SEP> 5 '<SEP> TCAAACCCTAACCTCAgCTCCAgC <SEP>3'<SEP> 24
<tb> Lg189f <SEP> 5 <SEP>'<SEP> - <SEP> GCAGCAAACGCGATAAGTTG <SEP> -3 <SEP>'<SEP> 33
<tb> Legionella <SEP> spp. <SEP> Lg69r <SEP> 5 '<SEP> - <SEP> CAGTGTTCCCGAAGGCACTA <SEP>-3'<SEP> 34 <SEP> rDNA <SEP> RNA <SEP> 16S <SEP> 189
<tb> Lg189TqFT <SEP>5'-<SEP> CCCTTGACATACAGTGGATTTTGCA <SEP> -3 '<SEP> 38
<tb> Lg69f <SEP> 5 <SEP>'<SEP> - <SEP> GCAACGCGAAGAACCTTACC <SEP> -3 <SEP>'<SEP> 35
<tb> Legionella <SEP> spp. <SEP> Lg69r <SEP> 5 '<SEP> - <SEP> CAGTGTTCCCGAAGGCACTA <SEP>-3'<SEP> 34 <SEP> rDNA <SEP> RNA <SEP> 16S <SEP> 69
<tb> Lg69TqFT <SEP>5'-<SEP> CATACAGTGGATTTTGCAGAGATGCA <SEP> -3 '<SEP> 39
<tb> Lpnll2f <SEP> 5 '<SEP> - <SEP> TCAGAAACGGGTTTGCTACC <SEP>-3'<SEP> 36
<tb> Legionella <SEP> Lpnll2r <SEP> 5 '<SEP> - <SEP> CTAGTAACGCCCCTTCAGAC <SEP>-3'<SEP> 37 <SEP> icmS <SEP> IcmS <SEP> 112
<tb> pneumophila
<tb> Lpnll2TqFT <SEP>5'-<SEP> CCATTGCCAAGAGAGCGGATC <SEP> -3 '<SEP> 40
<Tb>
ND, not determined.

<Desc / Clms Page number 24>

 According to a preferred embodiment of the method which is the subject of the present invention, step b) relating to the multiple, simultaneous but spatially separated amplifications of the target nucleotide sequences is of the thermo-dependent type, such as time PCR. real. In this case, an amplification cycle comprises at least the following sub-steps: b1) the denaturation step, during which the double-stranded DNA is separated into two single-stranded DNA molecules, is carried out between and 95 ° C, preferably at about 94 ° C, for 15 seconds to 1 minute, preferably 30 seconds; b2) the hybridization step, making it possible to match the complementary single-stranded nucleic acids, which will serve as templates in the next step, the specific nucleotide primers and, if appropriate, the associated probe, is carried out between 55 and 62; C, preferably at about 60 ° C., the temperature of this step being in all cases dictated by the sequences of the primer pairs for amplification and associated probes (see the definition of the temperature Tm above), for 15 seconds at 1 minute, preferably for 30 seconds; and b3) the step of elongation, leading to the replication of the matrix or matrices, is carried out between 60 ° C. and 72 ° C., for 15 seconds to 2 minutes, preferably for about 30 seconds.

 Advantageously, step b) of the method which is the subject of the invention comprises, in addition to the abovementioned substeps b1) to b3), a preliminary sub-step bO) for activating the Taq polymerase at a temperature of approximately 94 ° C. for 3 to 15 minutes, preferably for 3 to 5 minutes. This step bO) is optional, but becomes necessary if the Taq polymerase used is an enzyme called Hot start, such as PlatinumTM Taq DNA Polymerase (InvitrogenTM Life Technologies, Invitrogen, Cergy Pontoise, France).

 In general, sub-steps b1) to b3) supra undergo at least 40 amplification cycles.

<Desc / Clms Page number 25>

 The present invention furthermore relates to amplification primer pairs that are useful for carrying out the method described above for the detection of specific and exclusive nucleic acid sequences of bacteria contained in a complex mixture.

Said pairs of primers allow the amplification of specific and exclusive nucleic acid fragments of Y. enterocolitica, E. coli and / or H. alvei and / or Shigella spp. and / or Y. enterocolitica, Salmonella spp., S. aureus, B. cereus, C. perfringens, C. jejuni, Legionella spp. and L. pneumophila and are constituted by sequences selected from the following primers: Ye86f (SEQ ID No. 3) and Ye86r (SEQ ID No. 4) for Y. enterocolitica; Ec97f (SEQ ID No. 5) and Ec97r (SEQ ID No. 6) for E. coli and / or H. alvei and / or Shigella spp. and / or Y. enterocolitica; Se98f (SEQ ID No. 7) and Se98r (SEQ ID No. 8) for
Salmonella spp. ; Sa193f (SEQ ID No. 9) and Sa193r (SEQ ID No. 10) for S. aureus; - Bc84f (SEQ ID No. 11) and Bc84r (SEQ ID No. 12) for B. cereus; Cp97f (SEQ ID No. 13) and Cp97r (SEQ ID No. 14) for C. perfringens; Cju76f (SEQ ID No. 15) and Cju76r (SEQ ID No. 16) for C. jejuni; and - Lg189f (SEQ ID N 33) and Lg69r (SEQ ID No. 34) for
Legionella spp. ; Lg69f (SEQ ID No. 35) and Lg69r (SEQ ID No. 34) for
Legionella spp. ; and - Lpn112f (SEQ ID N 36) and Lpn112r (SEQ ID N 37) for
Legionella pneumophila.

<Desc / Clms Page number 26>

 As indicated above, it is furthermore considered that any sequence having at least 80% identity with one of the above-mentioned nucleotide sequences, or with its complementary reverse sequence, constitutes a specific and exclusive primer suitable for use in the framework of a method for detecting bacterial species simple, fast and reliable, and in particular in the context of the method object of the invention.

 In addition, the subject of the present invention is nucleotide probes that may, depending on the embodiments, be associated with pairs of amplification primers such as those described above, for the purpose of real-time amplification of DNA sequences. target nucleic acids, or used for the detection of target sequences according to DNA-DNA hybridization techniques.

Thus, according to a first embodiment of the probes that are the subject of the invention, they are used in the context of real-time amplification reactions, in accordance with the principles of TaqManTM chemistry (above) or the molecular beacons mentioned above and known to those skilled in the art. In particular, said probes are oligonucleotides of TaqManTM type (supra), 5 'labeled with a fluorophore, such as 6-methylfluorescein (FAM), and 3' with a quencher, such as tetramethylrhodamine (TAMRA), whose sequences are specific. and exclusive of bacterial species, are chosen from: - Lm113TqFT (SEQ ID No. 17) for L. monocytogenes; Ye86TqFT (SEQ ID No. 18) for Y. enterocolitica; - Ec97TqFT (SEQ ID No. 19) for E. coli and / or H. alvei and / or
Shigella spp. and / or Y. enterocolitica; Se98TqFT (SEQ ID No. 20) for Salmonella spp. ; Sa193TqFT (SEQ ID No. 21) for S. aureus; - Bc84TqFT (SEQ ID N 22) for B. cereus; Cp97TqFT (SEQ ID No. 23) for C. perfringens; Cju76TqFT (SEQ ID N 24) for C. jejuni;

<Desc / Clms Page number 27>

Lg189TqFT (SEQ ID N 38) for Legionella spp. ;
Lg69TqFT (SEQ ID NO: 39) for Legionella spp. ;
Lpn112TqFT (SEQ ID N 40) for Legionella pneumophila; and any hybridizable sequence under strict conditions to at least
80% with the sequences above, or any sequence having at least 80% identity with said sequences SEQ ID 17 to 24 and 38 to 40 or with their complementary reverse sequences.

 Preferably, the aforementioned probes are used in combination with the primer pairs for amplification described above. Another subject of the invention is, moreover, a set of nucleic acids comprising one or more pair (s) of primers and associated probe (s), such as the pairs of primers specific for microorganisms and the corresponding probes described above. Of course, in these sets of nucleic acids, a pair of primers can be replaced by its pair of complementary reverse primers, and the probe can be replaced by its complementary reverse sequence, the replacement of the pair of primers or the probe being independent of each other. Primers or probes having at least 80% identity with the sequences described in the present application, or with their complementary reverse sequences, are also usable.

 According to another embodiment of the nucleotide probes which are the subject of the present invention, they are useful for the detection of specific and exclusive nucleic acid sequences of bacteria contained in a complex mixture or in water. Said probes, chemically labeled (cold) or radioactively (hot), then allow the implementation of hybridization procedures such as Southern hybridization, colony hybridization and hybridization on dot deposits (Dot Blot ) (Sambrook and Russel, 2001, supra). These techniques

<Desc / Clms Page number 28>

 Hybridization, commonly used both in the laboratory and in industry, are therefore part of the general knowledge of the skilled person.

 Thus, the nucleotide probes of the invention allow the detection of specific and exclusive nucleic acid fragments of Y. enterocolitica, E. coli and / or H. alvei and / or Shigella spp. and / or Y. enterocolitica, Salmonella spp., S. aureus, B. cereus, C. perfringens, C. jejuni, Legionella spp. and L. pneumophila.

According to a first aspect of this embodiment, said probes are constituted by the amplification products obtained with the aid of the pairs of primers chosen from: Ye86f (SEQ ID No. 3) and Ye86r (SEQ ID No. 4) for Y. enterocolitica; Ec97f (SEQ ID No. 5) and Ec97r (SEQ ID No. 6) for E. coli and / or H. alvei and / or Shigella spp. and / or Y. enterocolitica; Se98f (SEQ ID No. 7) and Se98r (SEQ ID No. 8) for
Salmonella spp. ; Sa193f (SEQ ID No. 9) and Sa193r (SEQ ID No. 10) for S. aureus; - Bc84f (SEQ ID No. 11) and Bc84r (SEQ ID No. 12) for B. cereus; Cp97f (SEQ ID No. 13) and Cp97r (SEQ ID No. 14) for C. perfringens; and - Cju76f (SEQ ID No. 15) and Cju76r (SEQ ID No. 16) for C. jejuni; Lg189f (SEQ ID No. 33) and Lg69r (SEQ ID No. 34) for
Legionella spp. ; Lg69f (SEQ ID No. 35) and Lg69r (SEQ ID No. 34) for
Legionella spp. ; - Lpn112f (SEQ ID N 36) and Lpn112r (SEQ ID N 37) for
Legionella pneumophila;

<Desc / Clms Page number 29>

 any pair of reverse primers complementary to the above pairs; and any pair of primers comprising at least one hybridizable sequence primer under strict conditions at least 80% with the above sequences, or sequence having at least 80% identity with them.

In another aspect, the subject probes of the invention are oligonucleotides whose sequences are chosen from: - Lm113TqFT (SEQ ID No. 17) for L. monocytogenes; Ye86TqFT (SEQ ID No. 18) for Y. enterocolitica; - Ec97TqFT (SEQ ID No. 19) for E. coli and / or H. alvei and / or
Shigella spp. and / or Y. enterocolitica; Se98TqFT (SEQ ID No. 20) for Salmonella spp. ; Sa193TqFT (SEQ ID No. 21) for S. aureus; - Bc84TqFT (SEQ ID N 22) for B. cereus; Cp97TqFT (SEQ ID No. 23) for C. perfringens; Cju76TqFT (SEQ ID N 24) for C. jejuni; Lg189TqFT (SEQ ID No. 38) for Legionella spp. ; Lg69TqFT (SEQ ID No. 39) for Legionella spp. ; Lpn112TqFT (SEQ ID N 40) for Legionella pneumophila; and any hybridizable sequence under strict conditions to at least
80% with the above sequences, or any sequence having at least 80% identity with said sequences SEQ ID 17 to 24 and 38 to 40 or their complementary reverse sequences.

 It is understood that, for the implementation of this aspect of the invention, the sequences SEQ ID N 17 to 24 and 38 to 40, useful for the detection of bacterial species by ADN DNA hybridization techniques, are devoid of the markings using a 5 'fluorophore and

<Desc / Clms Page number 30>

 a 3 'quencher, characteristics of TaqManTM systems (above) or molecular beacons, as described supra.

 The present invention further relates to molecular biological tools, assay kit and microarray or nucleic acid chips, for the detection of bacteria contained in a complex mixture or in an aqueous medium.

Thus, the present invention provides a kit or system for the detection of nucleic acids of at least two different bacterial species contained in a complex mixture or in water. Said kit makes it possible in particular to implement the method according to the invention, in that it provides pairs of primers that can be used during the step of multiple amplifications of said method. Thus, this kit comprises: at least two pairs of primers whose sequences are chosen from the group consisting of SEQ ID N 1 to SEQ ID N 16 and SEQ ID N 33 to SEQ ID N 37 of Table I, and any sequence having at least 80% identity with them or their complementary reverse sequences, for the amplification of specific and exclusive fragments of bacteria selected from the group consisting of Y. enterocolitica, E. coli and / or H. alvei and / or Shigella spp. and / or Y. enterocolitica, S. aureus, L. monocytogenes, Salmonella spp., B. cereus, C. perfringens, C. jejuni, Legionella spp. and L. pneumophila; and / or at least two nucleotide probes, respectively labeled 5 'and 3' by a fluorophore and a quencher, selected from the sequences SEQ ID N 17 to SEQ ID N 24 and SEQ ID N 38 to SEQ
ID N 40 of Table I, and any hybridizable sequence under strict conditions at least 80% with the latter or having at least 80% identity with them or their complementary reverse sequences; and / or at least two nucleotide probes chosen from the group comprising the probes of sequences SEQ ID N 17 to 24 and SEQ ID N 38 to SEQ ID N 40 (Table I, supra), devoid of labeling by a 5 'fluorophore and a 3 'quencher, the amplification products

<Desc / Clms Page number 31>

 obtained using the pairs of primers of SEQ ID N 1 to SEQ ID N 16 and SEQ ID N 33 to SEQ ID N 37 (Table I, supra), and any hybridizable sequence under strict conditions to at least 80% with the latter, or having at least 80% identity with them or their complementary reverse sequences, for the detection of Y. enterocolitica, E. coli and / or H. alvei and / or Shigella spp. and / or Y. enterocolitica, S. aureus, L. monocytogenes, Salmonella spp., B. cereus, C. perfringens and C. jejuni.

 A kit as defined above will preferably comprise the pair of primers constituted by the following sequences: LmHlyAf (SEQ ID No. 1) and LmHlyAr (SEQ ID No. 2), or the pair of complementary reverse primers of the pair {LmHlyAf , LmHlyAr}, or any sequence having at least 80% identity therewith, for the specific and exclusive amplification of L. monocytogenes.

 The invention further relates to microarrays or nucleic acid chips for the detection of at least two different bacterial species contained in a complex mixture or in water.

According to a first embodiment, a microgrid according to the present invention is useful for the purpose of implementing multiple amplification reactions, simultaneous but separated in space. Said microgrid then comprises: at least two pairs of primers whose sequences are chosen from the group consisting of SEQ ID N 1 to SEQ ID N 16 of Table I, and any sequence similar to at least 80% to these latter for the amplification of specific and exclusive fragments of microorganisms from the group consisting of Y. enterocolitica, E. coli and / or H. alvei and / or Shigella spp. and / or Y. enterocolitica, S. aureus, L. monocytogenes, Salmonella spp., B. cereus, C. perfringens, C. jejuni,
Legionella spp. and L. pneumophila; and, where appropriate, at least two nucleotide probes labeled respectively in 5 'and in 3' by a fluorophore and a

<Desc / Clms Page number 32>

 quencher, selected from the sequences SEQ ID N 17 to SEQ ID N 24 and SEQ ID N 33 to SEQ ID N 37 of Table I, and any hybridizable sequence under strict conditions at least 80% with the latter or having at least 80% identity with them or their complementary reverse sequences.

According to another embodiment, a microarray which is the subject of the invention can be used for the detection of at least two bacterial species among Y. enterocolitica, E. coli and / or H. alvei and / or Shigella spp. and / or Y. enterocolitica, S. aureus, L. monocytogenes, Salmonella spp., B. cereus, C. perfringens, and C. jejuni, said species being contained in a complex mixture, and among Legionella spp. and L. pneumophila, present in water, the detection being carried out by DNA-DNA hybridization techniques. In this case, the micro-array comprises at least two nucleotide probes chosen from: the sequences SEQ ID N 17 to 24 and 38 to 40 (Table I, supra), devoid of the 5 'fluorophore and the 3' quencher, and any hybridizable sequence under strict conditions at least 80% with the latter or having at least
80% identity with them or their complementary reverse sequences; and the amplification products obtained with the aid of the pairs of primers of SEQ ID N 1 to 16 and 33 to 37 (Table I, supra) or the pairs of complementary reverse primers of said pairs, and any sequence exhibiting less than 80% identity with these amplification products.

 The following figures are provided for purely illustrative purposes and in no way limit the object of the present invention.

 FIG. 1: amplification curves obtained with the L. monocytogenes DNA using primers LmHlyAF (SEQ ID No. 1) and LmHlyAR (SEQ ID No. 2) as well as the Lm113TqFT probe (SEQ ID No. 17) and

<Desc / Clms Page number 33>

 corresponding to initial amounts of genomic DNA equivalent of: *: 5.105; +: 5.104; #: 5.103; #: 5.102; and: 5 copies per reaction.

 RFU: relative fluorescence unit.

 Figure 2: amplification curves of the L. monocytogenes DNA obtained by multiparametric detection in rotary PCR.

 Figure 3: Curves obtained by amplification of Salmonella spp. using the primers Se98f (SEQ ID No. 7) and Se98r (SEQ ID No. 8) in the presence of the Se98TqFT probe (SEQ ID No. 20) and corresponding to initial amounts of genomic DNA equivalent of: 5.105; #: 5.104; *: 5.103; +: 5.102; #: 50; and # 5 copies per reaction.

 Figure 4: 2% agarose gel electrophoresis.

 Lane 1 and 2: fragments obtained by amplification of Salmonella spp. with the primers Se98f (SEQ ID No. 7) and Se98r (SEQ ID No. 8), respectively from 5 × 10 5 and 5 copies of genomic equivalents.

 Lane 3: PCR negative (the 5 l of DNA were replaced by 5 l of water).

Mq track: molecular weight (Low DNA Mass Ladder, Invitrogen, supra)
FIG. 5: curves obtained by amplification of the E. coli DNA using the primers Ec97f (SEQ ID No. 5) and Ec97r (SEQ ID No. 6) and corresponding to initial amounts of genomic DNA equivalent of: : 5.106; #: 5.105; +: 5.103; 50 and 5 copies per reaction.

 FIG. 6: Y. enterocolitica DNA amplification curves obtained using primers Ye86f (SEQ ID No. 3) and Ye86r (SEQ ID No. 4) associated with the Ye86TqFT (SEQ ID No. 18) probe and corresponding at initial amounts of genomic DNA equivalent of: *: 5.106; #: 5.105; +: 5.104; #: 5.103; #: 5.102; #: 50; and: 5 copies per reaction.

 FIG. 7: amplification curves for B. cereus DNA using the primers Bc84f (SEQ ID No. 11) and Bc84r (SEQ ID No. 12), as well as the

<Desc / Clms Page number 34>

 Bc84TqFT probe (SEQ ID No. 22) and corresponding to initial amounts of genomic DNA equivalent of: 5.106; #: 5.105; *: 5.104; +: 5.103; 0: 5.102; and 0: 50 copies per reaction.

 Figure 8: 2% agarose gel electrophoresis.

 Lane 1 and 2: fragments resulting from the amplification of B. cereus DNA using the primers Bc84f (SEQ ID No. 11) and Bc84r (SEQ ID No. 12), respectively from 5 × 10 6 and 50 copies of genomic equivalents.

 Lane 3: PCR negative (the 5 l of DNA were replaced with 5 l of water); the band that appears corresponds to primer dimers.

 Mq track: molecular weight marker (Low DNA Mass Ladder, supra).

 Figure 9: amplification curves of B. cereus DNA obtained by multiparametric detection in rotary PCR.

 FIG. 10: Curves obtained by amplification of C. perfringens DNA using the primers Cp97f (SEQ ID No. 13) and Cp97r (SEQ ID No. 14) and the associated probe Cp97TqFT (SEQ ID No. 23) and corresponding to initial amounts of genomic DNA equivalent of: #: 5.106; #: 5.105; #: 5.104; : 5.103; #: 5.102; 50; and 5 copies per reaction.

 11: amplification curves of the DNA of C. jejuni obtained using the primers Cju76f (SEQ ID No. 15) and Cju76r (SEQ ID No. 16) associated with the probe Cju76TqFT (SEQ ID No. 24) and corresponding at initial amounts of genomic DNA equivalent of: *: 5.105; +: 5.104; #: 5.103; #: 5.102; #: 50; and: 5 copies per reaction.

 FIG. 12: S. aureus DNA amplification curves obtained using the primers Sa193f (SEQ ID No. 9) and Sa193r (SEQ ID No. 10) as well as the Sa193TqFT (SEQ ID No. 21) and corresponding probe. at initial amounts of genomic DNA equivalent of: ## EQU1 ## #: 5.105; #: 5.104; #: 5.103; #: 5.102; and +: 50 copies per reaction.

<Desc / Clms Page number 35>

 FIG. 13: curves resulting from the amplification of L. pneumophila DNA with primers Lg189f and Lg69r as well as the Lg189TqFT probe corresponding to initial amounts of genomic DNA equivalent of: 2.106, #: 2.105, #: 2.104, #: 2.103 and -: 2.102 copies / reaction.

 FIG. 14: curves resulting from the amplification of the L. pneumophila DNA with the primers Lg69f and Lg69r as well as the Lg69TqFT probe corresponding to initial amounts of genomic DNA equivalent of 2.105, II: 2.104,: 2.10 3 , 0: 2.102 and *: 20 copies / reaction.

 FIG. 15: curves resulting from the amplification of L. pneumophila DNA with primers Lpn112f and Lpn112r as well as the Lpn112TqFT probe corresponding to initial amounts of genomic DNA equivalent of *: 2.106, #: 2.105, # : 2.104, #: 2.103 and O: 2.102 copies / reaction.

 Figure 16: 2% agarose gel electrophoresis.

 Lane 1: product of amplification of the icms gene by primers Lpn112f and Lpn112r Lane 2: of molecular weight with, from top to bottom, the bands corresponding to 2000, 1200, 800, 400, 200, and 100 bp.

 Lane 3: amplification of the gene coding for 16S RNA by primers Lg69f and Lg69r Lane 4: amplification of the gene coding for 16S RNA by primers Lg189f and Lg69r.

 The experimental part below, supported by examples and figures, is intended to illustrate the invention without limiting its scope.

<Desc / Clms Page number 36>

EXPERIMENTAL PART
1- Conditions for the implementation of PCR reactions:
1-1- Reaction mixture:
In a final volume of between about 5 and 15 l, and preferably about 10 l, the conventional reagents of the PCR reactions were added. Depending on the conditions of use, it has sometimes proved useful to add Tween20, in particular in order to eliminate the residual inhibitors of Taq DNA polymerase possibly present in the reaction mixture.

 Table II below indicates the final concentrations of the various constituents of the reaction mixture, which corresponds, in the context of the present invention, to the reaction mixture before addition of the sample of nucleic acids.

~~~~~~~~~~~~~~~~~ TABLE t) ~~~~~~~~~~~~~~~~~

<Tb>
<tb> Constituent <SEP> Concentration <SEP> Final
<tb> Seps <SEP> and <SEP> associated <SEP> probes <SEP> between <SEP> 0.1 <SEP> and <SEP> 0.5 <SEP> mole / L <SEP> of <SEP> each ,
<tb> of <SEP> preference <SEP> 0.25 <SEP> ole / L
<tb> of <SEP> each
<tb> Buffer <SEP> of <SEP> PCR <SEP> 10X <SEP> 1X
<tb> MgCl2 <SEP> between <SEP> about <SEP> 2 <SEP> and <SEP> 5 <SEP> mmol / L, <SEP> from
<tb> preferably <SEP> about <SEP> 4 <SEP> mmol / L
<tb> Mix <SEP> dNTP <SEP> at <SEP> minus <SEP> 200 <SEP> ole / L <SEP> of <SEP> each
<tb> Tween20 <SEP> between <SEP> 0 <SEP> and <SEP> 0.01 <SEP>%
<tb> BSA <SEP> (Serum <SEP> Albumin <SEP> Bovine) <SEP> between <SEP> approximately <SEP> 0 <SEP> and <SEP> 0.5 <SEP>% <SEP> m / v
<tb> Taq <SEP> DNA <SEP> polymerase <SEP> between <SEP> approximately <SEP> 0.5 <SEP> and <SEP> 0.75 <SEP> units
<Tb>

According to a particular mode of implementation of the invention, the PCR reactions were carried out under the following conditions.

 The 10X PCR buffer, for example Qiagen PCR Buffer 10X (Qiagen, Courtaboeuf, France), had the following formula: Tris-HCl, KCl, (NH4) 2SO4 and MgCl2, and a pH equal to 8.7 ( measured at 20 C).

<Desc / Clms Page number 37>

 The dNTP mixture consisted of 10 mM dATP, dCTP, dGTP and dTTP (Sigma-Aldrich, Lyon, France).

The reaction mixture for an amplification reaction had the following composition:
5 l of reaction mixture, ie:
1 l of Qiagen PCR Buffer 10X
1 l of MgCl 2 at 25 mM
0.1% BSA 1%
0.2 l of dNTP mix
0.75 units of Taq DNA polymerase (Qiagen, supra) ultra pure water qs. 5 l and 5 l of nucleic acid sample, ie a final volume of 10 l.

I-2- Nucleic acid samples:
1-2-1- Extraction of genomic DNA from a pure culture:
For the purpose of chemical lysis of bacterial cells, 500 μl of a pure bacterial culture was mixed with 500 μl of 15% TENS-Chelex-100 15% solution (100 mM Tris-HCl pH 8.0, EDTA 40). mM pH 8.0, 200 mM NaCl, 2% SDS and 15% Chelex-100) or 500 l of 25% Chelex-100 solution in water.

 This mixture was incubated between 60 and 100 C for 10 to 20 minutes.

 If necessary, this mixture has undergone a second cell lysis treatment, mechanically.

 This mechanical treatment, consisting of the ultrasonication of the bacterial cells and / or the residues resulting from the chemical lysis, was applied to the mixture subsequently to the chemical lysis, under the same conditions of buffer and temperature as this one.

<Desc / Clms Page number 38>

 In some cases, lysis by mechanical treatment could be applied alternately to chemical lysis.

 Optionally, the lysate was purified and concentrated using the Nucleospin Plant L system (Macherey Nagel, Düren, Germany).

 In this case, the nucleic acids were mixed volume to volume with a binding buffer (C4) and absolute ethanol. This mixture was vigorously stirred for 30 seconds and then deposited on a silica column.

 The column was washed successively with 1 and 2 ml of the CQW and C5 buffers, respectively, before being dried for 10 minutes by centrifugation at 5500 x g at room temperature.

 In order to elute the DNA fixed on the silica, 200 l of CE buffer preheated to 70 C were incubated for 5 minutes on the column.

 Alternatively, if the lysate was not purified, 200 l were taken and stored in the ice for PCR analysis.

1-2-2- Extraction of nucleic acids from a food matrix:
25 g of food matrix were diluted in 225 ml of EPT [buffered peptone water (Biokar, Beauvais, France)] or Fraser (Biokar), respectively, for enrichments in Salmonella spp. or Listeria monocytogenes.

 The mixture was homogenized with a stomacher for 3 minutes.

 The media thus obtained were incubated 18 h at 37 ° C. and 24 h at 30 ° C., respectively, for enrichments in Salmonella spp. and L. monocytogenes.

 Between 1 and 10 ml of ground food was taken and centrifuged for 5 minutes at 500 x g to remove large debris, Le., Large food matrix particles.

 The supernatant was recovered and centrifuged for 3 minutes at 16,000 x g.

<Desc / Clms Page number 39>

 300 l of 2X TENS buffer - 15% Chelex-100 or 25% aqueous Chelex-100 solution were added to the bacterial pellet.

 This mixture was incubated between 60 and 100 C for the purpose of chemical lysis (see paragraph 1-2-1 above).

 As described above, the mixture could, alternatively or subsequent to the chemical lysis, be mechanically treated.

 Optionally, the lysate was purified and concentrated using the Nucleospin Plant L system (see paragraph 1-2-1 above).

 Alternatively, if the lysate was not purified, 200 l were taken and stored in the ice for PCR analysis.

1-2-3- Extraction of nucleic acids from water;
250 to 1000 ml of water are filtered on polycarbonate membrane 0. 45 m (Sartorius). 1 to 4 ml (preferably 2 ml) of 2X TENS buffer - 15% Chelex-100 or 25% aqueous solution of Chelex-100 are added to the membrane having retained the bacteria. This mixture is incubated between 60 and 100 C for chemical lysis and may alternatively or subsequently be mechanically treated. The lysate is then purified and concentrated using the Nucleospin Plant L system.

I-3- Deposits in the Genedisc #:
As indicated in the descriptive part, the present invention is capable of being implemented by means of a single-use cartridge described in the US patent application No. 09/981070 benefiting from the priority of the published French patent application. February 1, 2002 under the number 2812306. The Genedisc marketed by GeneSystems (Bruz, France) is an example of such a cartridge.

 This cartridge, and in particular the Genedisc, is usable in a device of the automaton type for the amplification of nucleic acid sequences, also described in the aforementioned patent applications.

<Desc / Clms Page number 40>

 Advantageously, the Genedisc is divided into identical sectors.

By sector, a part of the Genedisc consists of a fraction of the total number of reaction chambers carried by said Genedisc, for example 1/3 or 1/6 of the 36 chambers, associated with a compartment of the central reservoir, said compartment supplying the reaction chambers included in the abovementioned fraction. For example, Genedisc's central reservoir is divided into three or six compartments in all identical points, each of these compartments thus serving one third or one sixth of the total number of reaction chambers. The Genedisc then comprises, according to this example, three or six sectors.

 The following components were previously deposited in the reaction chambers of the Genedisc: the associated primers and probes, as well as the Tween20. With regard to the primers and probes, each pair of primers and associated probe was deposited in one or more reaction chambers of Genedisc. The Tween20 has, meanwhile, been distributed in all the reaction chambers.

 The other components listed in Table II above were deposited, along with the nucleic acid sample, into the Genedisc feed tank.

 For a sector of Genedisc, the volume of reaction mixture to be prepared as described in paragraph 1-1 above, corresponded to the volume of reaction mixture for amplification (10 l) multiplied by the number of reaction chambers included in the sector, each said chambers being the seat of amplification. For example, with a Genedisc comprising three sectors, a sector then being represented by a third of the 36 rooms, that is to say 12 rooms, the volume of reaction mixture to be prepared for an area was 120 l.

 Thus, for each sector of the Genedisc, the 120 l of reaction mixture was deposited in a compartment of the central tank. The

<Desc / Clms Page number 41>

 The mixture was then served in the reaction chambers containing the pre-deposits of trios, pairs of primers and associated probes, and Tween20 at concentrations of 200 nM and 0.01% respectively for 10 μl final.

I-4- Implementation of the step of multiple amplifications [step b) of the method object of the invention]:
The number of amplification cycles performed during this step varied between 40 and 45.

 At the end of the reaction, the sectors of Genedisc were brought back to room temperature.

Il- Examples and results:
11-1- Multiparametric Analysis:
A mixture of nucleic acids extracted from pure cultures of L. monocytogenes and B. cereus, respectively at 102 and 105 equivalent copies of genomic DNA per 1, was added to the reaction mixture, before being introduced into a compartment. of the Genedisc Reservoir.

 As indicated in the previous paragraph I-3, Tween20, at a final concentration of 0.01%, as well as primer pairs and probes specific for L. monocytogenes and B. cereus, at a final concentration of 200 nM, had previously been deposited in the reaction chambers of the corresponding sector, due to a distribution of 8 chambers by microorganism to be detected, a total of 16 reaction chambers.

 Rotary PCR yielded amplification curves for both detections, with threshold cycles (cycles from which fluorescence is significantly higher than background, Ct) respectively 25.2%. 84 cycles and 29.5 0.55 cycles for B. cereus (Figure 11) and L. monocytogenes (Figure 3).

<Desc / Clms Page number 42>

11-2- Comparison of manual vs automated implementation, using Genedisc #:
Two nucleic acid samples extracted from L. monocytogenes-enriched ground beef were amplified by PCR in a final reaction volume of 10 l, one hand manually, by an experimenter, in the iCycler # (Bio-Rad , Marne la Coquette, France), and on the other hand in an automated way, using Genedisc, in the Genedisc Cycler (GeneSystems, Bruz, France).

 The DNA extracts were diluted 10th before being added to the reaction mixture.

The average Cs calculated by the two devices were comparable, with values of 26.4 1.7 and 26.2 0.2 cycles for the iCycler #, and 26.3
0.3 and 25.8 0.1 for the Genedisc Cycler.

II-3- Amplification of nucleic acids extracted from pure cultures by pairs of primers and associated probes specific for species, genera or bacterial groups:
11-3-1- Microorganisms studied:
The amplifications were carried out in a final reaction volume of 10 l over 10-fold dilution ranges of nucleic acid samples extracted from pure cultures of different microorganisms.

 The microorganisms studied with the primer pair and the probe specific for Escherichia coli and / or Hafnia alvei and / or Shigella spp, as well as with the pairs of primers and associated probes specific for Yersinia enterocolitica, Staphylococcus aureus, Listeria monocytogenes, Salmonella spp., Bacillus cereus, Clostridium perfringens, and Campylobacter jejuni are: Listeria monocytogenes (11 strains), Listeria innocua, Listeria ivanovii, Listeria welshimeri, Salmonella spp. (27 serovars), Yersinia enterocolitica, Bacillus cereus, Staphylococcus aureus, Campylobacter jejuni, Campylobacter coli, Campylobacter lari, Escherichia coli (4

<Desc / Clms Page number 43>

strains), Clostridium perfringens, Proteus vulgaris, Klebsiella pneumoniae, Enterococcus durans, Pseudomonas stutzeri, Shigella flexneri, Morganella morganii, Hafnia alvei, Providencia rettgeri, Serratia marcescens, Enterobacter aerogenes, Enterobacter cloacae (2 strains),
The microorganisms studied with the pairs of primers and associated probes specific for Legionella spp. and Legionella pneumophila are: Acanthamoeba polyphaga, Acinetobacter baumanii, Acinetobacter junii, Acinetobacter Iwofii, Aerococcus viridans, Aeromonas hydrophila, Alcaligenes faecalis, Bacillus subtilis, Bulkhoderia cepacia, Campylobacter jejuni, Campylobacter coli, Citrobacter freundii, Clostridium perfringens, Enterobacter cloacae, Enterobacter aerogenes, Escherichia coli, Enterococcus faecalis, Enterococcus faecium, Enterococcus durans, Klebsiella oxytoca, Klebsiella pneumoniae, Proteus mirabilis, Pseudomonas aeruginosa, Pseudomonas fluorescens, Pseudomonas paucimobilis, Pseudomonas putida, Proteus peneri, Shigella dysenteriae, Staphylococcus aureus, Staphylococcus gallinarum Staphylococcus lugdunensis, Stenotrophomonas maltophilia , Streptococcus bovis, Streptococcus equinus, Yersinia enterocolitica, L. pneumophila serogroups 1-14 (14 strains of collection and 9 strains of environmental origin), L. anisa, L. birminghamensis, L. erythra, L. bozemanii, L. brumensis , L. che rrii, L. cincinatiensis, L. dumofii, L. feelei, L. gormanii, L. gratiana, L. hackeliae (2 strains), L. israelensis, L. jamestowniensis, L. jordanis, L. lansingensis, L. longbeacheae serogroups 1 and 2, L. micdadei,
L. maceachernii, L. nagaro, L. oakridgensis, L. parisiensis, L. rubriculens, L. santicrusis, L. sainthelensi, L. tucsonensis, L. wadsworthii and 13 strains of
Legionella spp. from the environment.

11-3-2- Sequences drawn for the detection of Listeria monocytogenes:
The pair of primers and associated probe designed for the detection of L. monocytogenes made it possible to obtain amplification curves in

<Desc / Clms Page number 44>

 real time of this species, with a sensitivity of 1 to 10 equivalents of genomic DNA by PCR reaction (Figure 1). No amplification products were obtained with the other Listeria species, nor with the studied bacteria belonging to other genera than Listeria. The amplification product (SEQ ID Nos. 25 and 26 below) was purified and its sequence determined on both strands using primers LmHlyAf (SEQ ID No. 1) and LmHlyAr (SEQ ID No. 2). The sequence SEQ ID No. 25 was obtained using the primer LmHlyAr (SEQ ID No. 2).

The nucleotides located between the 72 and 92 positions, underlined in the sequence SEQ ID No. 25 below, represent the sequence complementary to the LmHlyAf primer (SEQ ID No. 1). The sequence SEQ ID No. 26 was determined using the primer LmHlyAf (SEQ ID No. 1).

The underlined nucleotides, located between positions 74 and 94 of the sequence SEQ ID No. 26 below, represent the sequence complementary to the primer LmHlyAr (SEQ ID No. 2). The sequence of the amplification product thus determined on each strand and corresponding to the sequences SEQ ID No. 25 and SEQ ID No. 26, was identical to the target sequence sought.

SEQ ID No. 25:
5'ATACATTGTTTTTATTGTAATCCAATCCTTGTATATACTTATCGATTT
CATGCCGCGTGTTTCTTTTCGATTGGCGTCTTAGGACTTGCAGG 3 '
SEQ ID No. 26:
5'CGAAAAGAACACGCGGATGAAATCGATAAGTATATACAAGGATT
GGATTACAATATAAAACAATGTATTAGTATACCACGGAGATGCAGTG3 '
11-3-3- Sequences drawn for the detection of Salmonella spp. :
The pair of primers and associated probe designed for the amplification of a sequence of Salmonella spp. allowed to amplify a fragment of the expected size, and this, specifically, with a sensitivity of 1 to 10 equivalents copies of genomic DNA by PCR reaction (Figure 3). No amplification products were obtained during the

<Desc / Clms Page number 45>

 reactions performed on extracts from other bacterial genera studied. The size of the amplification product estimated by agarose gel electrophoresis was consistent with the expected size of 98 bp (Figure 4).

11-3-4- Sequences drawn for the detection of Escherichia coli:
The pair of primers and associated probe designed for E. coli allowed the amplification of a DNA fragment of the expected size for the 4 E. coli strains. coli studied (Figure 5), as well as for Y. enterocolitica, S. flexneri and H. alvei.

11-3-5- Sequences designed for the detection of Yersinia enterocolitica:
The pair of primers and associated probe designed for Y. enterocolitica allowed to obtain real-time amplification curves specific for this species, with a sensitivity of 1 to 10 equivalents copies of genomic DNA by PCR reaction ( Figure 6). No amplification products were obtained in the context of the reactions carried out on the extracts from the studied bacterial genera other than Yersinia. The single amplification product was purified. The sequence of this product, corresponding to the sequence SEQ ID No. 27, was determined using the primer Ye86f (SEQ ID No. 3). The bases located between positions 37 and 56, underlined in the sequence SEQ ID No. 27 below, represent the sequence complementary to the primer Ye86r (SEQ ID No. 4). The sequence SEQ ID No. 27 below corresponded to the expected target sequence.

SEQ ID No. 27:
5'TGANGTTTANCAGCAAGCTTGTGATCCTCCGTCGCCACCAGCCG
AAGTCAGTAGTGATCCAGCCGAAG 3 '

<Desc / Clms Page number 46>

11-3-6- Sequences drawn for the detection of Bacillus cereus:
The pair of primers and associated probe designed for B. cereus made it possible to obtain specific real-time amplification curves, with a sensitivity of 50 equivalent copies of genomic DNA by PCR reaction (FIG. 7). The size of the amplification product was verified by agarose gel electrophoresis and indeed corresponded to the expected size, ie, 84 bp (FIG. 8). No amplification product was obtained during the reactions performed on extracts from other bacterial genera.

11-3-7- Sequences designed for the detection of Clostridium perfringens:
The pair of primers and associated probe designed for C. perfringens made it possible to obtain, in a manner specific to this species, real-time amplification curves, with a sensitivity of 1 to 10 equivalents of genomic DNA copies. by PCR reaction (Figure 10). No amplification products were obtained during the reactions carried out on the extracts from the studied bacterial genera other than Clostridium. The amplification product was purified. Its sequence, SEQ ID No. 28, was determined using primer Cp97f (SEQ ID No. 13). The underlined nucleotides in the sequence SEQ ID No. 28 below, located between positions 59 and 78, represent primer Cp97r (SEQ ID No. 14). The sequence SEQ ID No. 28 below was identical to the target sequence sought.

SEQ ID No. 28:
5'TATTTTGGAGTAATAGATACTCCATATCATCCTGCTAATGTTACTG
CCGTTGATAGCGCAGGACATGTTAAGTTTGAG 3 '11-3-8- Sequences drawn for the detection of
Campylobacter jejuni:

<Desc / Clms Page number 47>

The pair of primers and associated probe designed for C. jejuni allowed to obtain real-time amplification curves specifically for this species, with a sensitivity of 1 to 10 genomic DNA equivalent copies per reaction. PCR (Figure 11). The amplification product was purified and its sequence determined on both strands.

The following sequence SEQ ID No. 29: 5 'ATTCAGCCAAACCCTAACCTCAGCTCCAGCCCAAGACAGTCGACCGCTA 3', was obtained using the primer Cju76f (SEQ ID No. 15). The underlined bases, located between positions 31 and 49 of the above sequence, represent the complementary sequence of primer Cju76r (SEQ ID No. 16).

 The following sequence SEQ ID NO: 5 'CTGGAGCTGAGGTTAGGGTTTGGCTGAATTTAATACCCAAAGAACGATTTGC AAG 3' was determined using primer Cju76r (SEQ ID No. 16). The nucleotides located between the 36 and 55 positions and underlined in the sequence above, represent the sequence complementary to the Cju76f primer (SEQ ID No. 15).

 The sequences SEQ ID No. 29 and 30 corresponded to those of the target sought. No amplification product was obtained during the reactions performed on nucleic acid samples extracted from bacterial species or genera analyzed, other than Campylobacter.

11-3-9- Sequences drawn for the detection of
Staphylococcus aureus:
The pair of primers and associated probe designed for S. aureus made it possible to obtain real-time amplification curves specific for this species, with a sensitivity of 50 equivalent copies of genomic DNA by PCR reaction (FIG. 12 ). The amplification product was purified and its sequence determined on both strands.

 The following sequence SEQ ID No. 31:

<Desc / Clms Page number 48>

 5'TTTATGCTGATGGAAAAATGGTAAACGAAGCTTTAGTTCGTCAAGGCT TGGCTAAAGTTGCTTATGTTTATAAACCTAACAATACACATGAACAACTTTTAA GAAAAAGTGAAGCACAAGCAAAAAAAGAGAAATTAAATATTTGGAGCGAAGAC AACGCTGATTCAGGTCA 3 ', was obtained with the primer Sa193f (SEQ ID No. 9). The underlined bases, located between positions 154 and 172, represent the complementary sequence of primer Sa193r (SEQ ID No. 10).

 The sequence SEQ ID No. 32: 5'AAATATTTAATTTCTCTTTTTTTGCTTGTGCTTCACTTTTTCTTAAAA GTTGTTCATGTGTATTGTTAGGTTTATAAACATAAGCAACTTTAGCCAAGCCTT GACGAACTAAAGCTTCGTTTACCATTTTTCCATCAGCATAAATATACGCTAAG CCACGTCCAT 3 ', was determined using the primer Sa193r (SEQ ID No. 10). The nucleotides between positions 146 and 165 and underlined in the above sequence represent the sequence complementary to the primer Sa193f (SEQ ID No. 9). The double-stranded sequence thus obtained, corresponding to the sequences SEQ ID No. 31 and 32 above, was found to be identical to the target sequence sought.

11-3-10- Sequences designed for the detection of Legionella spp. Two pairs of primers and associated probes have been developed for the detection and quantification of Legionella spp. : 1st couple:
The first couple, drawn from the sequence of the gene coding for the 16S RNA of L. pneumophila subsp. pascullei (Genbank Accession
Number: AF122885), consists of primers Lg189f (SEQ ID N 33), and
Lg69r (SEQ ID N 34), and associated with the Lg189TqFT probe (SEQ ID N 38).

 These pairs of primers and associated probes, designed for the detection and quantification of the genus Legionella spp., Made it possible to obtain

<Desc / Clms Page number 49>

 with a sensitivity of 200 copies per reaction, specific real-time amplification curves of this kind on DNA extracts of L. pneumophila serogroups 1 to 14 (14 strains of collection and 9 strains of environmental origin), L anisa, L. birminghamensis, L. bozemanii, L. brumensis, L. cherrii, L. cincinatiensis, L. dumofii, L. feelei, L. gormanii, L. gratiana, L. hackeliae (2 strains), L. jamestowniensis , L. jordanis, L. longbeacheae serogroups 1 and 2, L. nagaro, L. oakridgensis, L. parisiensis, L. santicrusis, L. sainthelensi, L. tucsonensis, L. wadsworthii and 13 strains of Legionella spp. from the environment (Figure 13).

These pairs of primers and associated probe also made it possible to obtain, with a sensitivity of 104 copies per reaction, specific real-time amplification curves of this kind on DNA extracts of L. israelensis, L. lansingensis. , L. micdadei and L. rubriculens.

 The size of the amplification product estimated by electrophoresis was consistent with the expected size of 189 bp (Figure 16, lane 4).

 Only the DNA of the L. erythra species did not give rise to amplification. DNAs from other microorganisms likely to be found in water such as Acanthamoeba polyphaga, Acinetobacter baumanii, Acinetobacter junii, Acinetobacter Iwofii, Aerococcus viridans, Alcaligenes faecalis, Bacillus subtilis, Bulkhoderia cepacia, Campylobacter jejuni, Campylobacter coli, Citrobacter freundii, Clostridium perfringens, Enterobacter cloacae, Enterobacter aerogenes, Escherichia coli, Enterococcus faecalis, Enterococcus durans, Klebsiella oxytoca, Klebsiella pneumoniae, Proteus mirabilis, Pseudomonas aeruginosa, Pseudomonas fluorescens, Pseudomonas paucimobilis, Pseudomonas putida, Proteus peneri, Shigella dysenteriae, Staphylococcus aureus Staphylococcus gallinarum, Staphylococcus lugdunensis, Streptococcus bovis, Streptococcus equinus and Yersinia enterocolitica did not produce amplification products. DNAs from Aeromonas hydrophila, Enterococcus faecium and Stenotrophomonas maltophilia generated a weak signal

<Desc / Clms Page number 50>

 amplification when their genomic DNA equivalent exceeds 105 copies.

2nd couple:
This second pair, also drawn from the sequence of the gene coding for the 16S RNA of L. pneumophila subsp. pascullei (Genbank Accession Number: AF122885), includes primers Lg69f (SEQ ID N 35) and Lg69r 5SEQ ID N 34, same as for the 1st pair), is associated with the Lg69TqFT probe (SEQ ID N 39).

 These couples of primers and associated probe designed for the detection and quantification of the genus Legionella spp., Have obtained, with a sensitivity of 20 copies of genomic equivalent, specific amplification curves in real time of this kind. on DNA extracts of L. pneumophila serogroups 1 to 14 (14 strains of collection and 9 strains of environmental origin), L. anisa, L. birminghamensis, L. B, L. brumensis, L. cherrii, L. cincinatiensis, L. dumofii, L. feelei, L. gormanii, L. gratiana, L. hackeliae (2 strains), L. jamestowniensis, L. jordanis, L. longbeacheae serogroups 1 and 2, L. micdadei, L. nagaro, L. oakridgensis, L. parisiensis, L. santicrusis, L. sainthelensi, L. tucsonensis, L. wadsworthii and 13 strains of Legionella spp. from the environment (Figure 14). These pairs of primers and associated probe also made it possible to obtain, with a sensitivity of 104 copies per reaction, specific real-time amplification curves of this kind on DNA extracts of L. erythra, L. israelensis. , and L. rubriculens.

 The size of the amplification product estimated by electrophoresis was consistent with the expected size of 69 bp (Figure 16, lane 3).

 Only the DNA of the species L. lansingensis, did not give rise to an amplification. DNAs from other genera that may be found in water such as Acanthamoeba polyphaga, Acinetobacter baumanii, Acinetobacter junii, Acinetobacter Iwofii, Aerococcus viridans, Aeromonas hydrophila, Alcaligenes faecalis, Bacillus subtilis, Bulkhoderia cepacia,

<Desc / Clms Page number 51>

 Campylobacter jejuni, Campylobacter coli, Citrobacter freundii, Clostridium perfringens, Enterobacter cloacae, Enterobacter aerogenes, Escherichia coli, Enterococcus faecalis, Enterococcus durans, Klebsiella oxytoca, Klebsiella pneumoniae, Proteus mirabilis, Pseudomonas aeruginosa, Pseudomonas fluorescens, Pseudomonas paucimobilis, Pseudomonas putida, Proteus peneri , Shigella dysenteriae, Staphylococcus aureus, Staphylococcus gallinarum, Staphylococcus lugdunensis, Streptococcus bovis, Streptococcus equinus, Yersinia enterocolitica, and Stenotrophomonas maltophilia did not produce amplification products. DNA from Enterococcus faecium generated a weak amplification signal when its genomic DNA equivalent exceeded 105 copies.

11-3-11- Sequences designed for the detection of Legionella pneumophila:
Drawn from the sequence of the icmS gene coding for an IcmS protein involved in the infectious nature of L. pneumophila (Genbank Accession Number: Y12705), the primer pair comprises primers Lpn112f (SEQ ID N 36) and Lpn112r (SEQ ID N 37). It is associated with the Lpn112TqFT probe (SEQ ID N 40).

 Couplings of primers and associated probe designed for the detection and quantification of the genus Legionella spp. were able to obtain, with a sensitivity of 200 genomic equivalents, specific real-time amplification curves of this kind on DNA extracts of L. pneumophila serogroups 1 to 14 (14 strains of collection and 9 strains of environmental origin) (Figure 15).

 The size of the amplification product estimated by electrophoresis was consistent with the expected size of 112 bp (Figure 16, lane 1).

* No signal was obtained for DNA from other Legionella species: L. anisa, L. birminghamensis, L. bozemanii, L. brumensis,
L. cherrii, L. cincinatiensis, L. dumofii, L. erythra, L. feelei, L. gormanii, L. gratiana, L. hackeliae (2 strains), L. israelensis, L. jamestowniensis, L.

<Desc / Clms Page number 52>

 L. lansingensis, L. longbeacheae serogroups 1 and 2, L. micdadei, L. maceachernii, L. nagaro, L. oakridgensis, L. parisiensis, L. rubriculens, L. santicrusis, L. sainthelensi, L. tucsonensis, L. wadsworthii and 13 strains of Legionella spp. from the environment and for DNA from other genera that may be found in water such as Acanthamoeba polyphaga, Acinetobacter baumanii, Acinetobacter junii, Acinetobacter Iwofii, Aerococcus viridans, Aeromonas hydrophila, Alcaligenes faecalis, Bacillus subtilis, Bulkhoderia Cepacia, Enterococcus faecalis, Enterococcus durans, Enterococcus faecium, Klebsiella oxytoca, Proteus mirabilis, Pseudomonas aeruginosa, Pseudomonas fluorescens, Pseudomonas putida, Proteus peneri, Shigella dysenteriae, Staphylococcus gallinarum, Staphylococcus lugdunensis, Stenotrophomonas maltophilia, Streptococcus bovis and Streptococcus equinus.

Claims (20)

A method for detecting and identifying bacteria contained in a complex mixture or in water by multiple, simultaneous but spatially separated amplifications of target nucleic acid sequences, said method comprising at least the following steps: a) contacting the nucleic acid sample with at least two pairs of amplification primers, each pair being specific and exclusive of a nucleotide sequence of a species, a genus or a group bacterial; b) amplification of the target nucleotide sequences; and c) detecting the presence and identification of the bacteria contained in the complex mixture or in the starting water.  A method for detecting, identifying and quantifying bacteria contained in a complex mixture or in water by multiple, simultaneous but spatially separated amplifications of target nucleic acid sequences, said method comprising at least steps following: a) bringing the nucleic acid sample into contact with at least two pairs of amplification primers and at least two associated nucleotide probes, each pair and associated probe being specific and exclusive of a nucleotide sequence of a species, genus or bacterial group; b) the amplification of the target nucleotide sequences by Real-time PCR; and <Desc / Clms Page number 54>  c) the detection of the presence, identification and quantification of the bacteria contained in the complex mixture or in the starting water.  3. The method of claim 1 or 2, wherein the detected bacteria are mammalian pathogens, particularly human.  The method according to any one of claims 1 to 3, wherein at least two species, genera or bacterial groups are selected from Yersinia enterocolitica, Escherichia coli and / or Hafnia alvei and / or Shigella spp. and / or Yersinia enterocolitica, Staphylococcus aureus, Listeria monocytogenes, Salmonella spp., Bacillus cereus, Clostridium perfringens, Campylobacter jejuni, Legionella spp. and Legionella pneumophila.  5. Method according to any one of claims 1 to 4, for the detection and identification of bacteria contained in a complex mixture, wherein at least two species, genera or bacterial groups are chosen from Yersinia enterocolitica, Escherichia coli and / or or Hafnia alvei and / or Shigella spp. and / or Yersinia enterocolitica, Staphylococcus aureus, Listeria monocytogenes, Salmonella spp., Bacillus cereus, Clostridium perfringens, and Campylobacter jejuni.  Process according to any one of claims 1 to 4 for the detection and identification of Legionella spp. and / or Legionella pneumophila contained in water.  The method of any one of claims 4 to 6, wherein the primer pairs are selected from the group of following sequences: <Desc / Clms Page number 55> Lpn112f (SEQ ID No. 36), Lpn112r (SEQ ID No. 37) for the specific and exclusive amplification of Legionella pneumophila; or any sequence having at least 80% identity with them or their complementary reverse sequences. Lg69f (SEQ ID No. 35), Lg69r (SEQ ID No. 34) for the specific and exclusive amplification of Legionella spp. ; and Lg189f (SEQ ID No. 33), Lg69r (SEQ ID No. 34) for the specific and exclusive amplification of Legionella spp. ; Cju76f (SEQ ID No. 15), Cju76r (SEQ ID No. 16), for the specific and exclusive amplification of C. jejuni; Cp97f (SEQ ID No. 13), Cp97r (SEQ ID No. 14), for the specific and exclusive amplification of C. perfringens; Bc84f (SEQ ID No. 11), Bc84r (SEQ ID No. 12), for the specific and exclusive amplification of B. cereus; Sa193f (SEQ ID No. 9), Sa193r (SEQ ID No. 10), for the specific and exclusive amplification of S. aureus; Se98f (SEQ ID No. 7), Se98r (SEQ ID No. 8), for the specific and exclusive amplification of Salmonella spp. ; Ec97f (SEQ ID No. 5), Ec97r (SEQ ID No. 6), for the specific and exclusive amplification of E. coli and / or H. alvei and / or Shigella spp. and / or Y. enterocolitica; Ye86f (SEQ ID No. 3), Ye86r (SEQ ID No. 4), for the specific and exclusive amplification of Y. enterocolitica; LmHlyAf (SEQ ID NO: 1), LmHlyAr (SEQ ID No. 2), for the specific and exclusive amplification of L. monocytogenes;  The method of claim 7, wherein the probes associated with the primer pairs are selected from the group of following sequences: Lm113TqFT (SEQ ID No. 17), for specific and exclusive real-time amplification of L. monocytogenes; <Desc / Clms Page number 56> Lpn112TqFT (SEQ ID N 40), for specific and exclusive real-time amplification of Legionella pneumophila; or any sequence having at least 80% identity therewith or with their complementary reverse sequences. Lg69TqFT (SEQ ID N 39), for specific and exclusive real-time amplification of Legionella spp. ;and Lg189TqFT (SEQ ID N 38), for specific and exclusive real-time amplification of Legionella spp. ; Cju76TqFT (SEQ ID N 24), for specific and exclusive real-time amplification of C. jejuni; Cp97TqFT (SEQ ID No. 23), for specific and exclusive real-time amplification of C. perfringens; Bc84TqFT (SEQ ID N 22), for specific and exclusive real-time amplification of B. cereus; Sa193TqFT (SEQ ID No. 21), for specific and exclusive real-time amplification of S. aureus; Se98TqFT (SEQ ID No. 20), for specific and exclusive real-time amplification of Salmonella spp. ; Ec97TqFT (SEQ ID No. 19), for specific and exclusive real-time amplification of E. coli and / or H. alvei and / or Shigella spp. and / or Y. enterocolitica; Ye86TqFT (SEQ ID No. 18), for specific and exclusive real-time amplification of Y. enterocolitica;  9. Method according to any one of claims 1 to 8, characterized in that it is implemented on a sample of nucleic acids previously extracted and purified from the cells of bacteria contained in a complex mixture, including food , or in water, using an extraction automaton. <Desc / Clms Page number 57>  10. The method of claim 1 or 2, wherein step b) comprises at least the following substeps: b1) a denaturation step carried out between 94 and 95 C, preferably at about 94 C, for 15 seconds at 1 minute, preferably 30 seconds; b2) a hybridization step carried out between 55 and 62 C, preferably at about 60 C, for 15 seconds to 1 minute, preferably 30 seconds; and b3) a step of elongation carried out between 60 and 72 C, for 15 seconds to 2 minutes, preferably for about 30 seconds; said substeps representing an amplification cycle and step b) comprising at least 40 amplification cycles.  The method of claim 10, further comprising a preliminary step b) of activating the Taq polymerase at about 94 ° C for 3 to 15 minutes, preferably 3 to 5 minutes.  12. A pair of primers for implementing the method according to any one of claims 1 to 11, said pair being chosen from the group consisting of: Ye86f (SEQ ID No. 3) and Ye86r (SEQ ID No. 4), or any sequence having at least 80% identity therewith, for the amplification of a specific and exclusive nucleic acid fragment of Yersinia enterocolitica ; Ec97f (SEQ ID No. 5) and Ec97r (SEQ ID No. 6); or any sequence having at least 80% identity therewith for the amplification of a specific and exclusive nucleic acid fragment of Escherichia coli and / or Hafnia alvei and / or Shigella spp. and / or Yersinia enterocolitica; Se98f (SEQ ID No. 7) and Se98r (SEQ ID No. 8), or any sequence having at least 80% identity therewith, for the amplification of a specific and exclusive nucleic acid fragment of Salmonella spp. . ; <Desc / Clms Page number 58> Lpn112f (SEQ ID N 36) and Lpn112r (SEQ ID N 37), or any sequence having at least 80% identity therewith, for the amplification of a specific and exclusive nucleic acid fragment of Legionella pneumophila ; and any pair of complementary reverse primers of one of the couples mentioned above. Lg69f (SEQ ID No. 35) and Lg69r (SEQ ID No. 34), or any sequence having at least 80% identity therewith, for the amplification of a specific and exclusive nucleic acid fragment of Legionella spp. . ; Lg189f (SEQ ID No. 33) and Lg69r (SEQ ID No. 34), or any sequence having at least 80% identity therewith, for the amplification of a specific and exclusive nucleic acid fragment of Legionella spp. . ; Cju76f (SEQ ID No. 15) and Cju76r (SEQ ID No. 16), or any sequence having at least 80% identity therewith, for the amplification of a specific and exclusive nucleic acid fragment of Campylobacter jejuni ; Cp97f (SEQ ID No. 13) and Cp97r (SEQ ID No. 14), or any sequence having at least 80% identity therewith, for the amplification of a specific and exclusive nucleic acid fragment of Clostridium perfringens ; Bc84f (SEQ ID No. 11) and Bc84r (SEQ ID No. 12), or any sequence having at least 80% identity therewith, for the amplification of a specific and exclusive nucleic acid fragment of Bacillus cereus ; Sa193f (SEQ ID No. 9) and Sa193r (SEQ ID No. 10), or any sequence having at least 80% identity therewith, for the amplification of a specific and exclusive nucleic acid fragment of Staphylococcus aureus. ;  13. Couples of primers and associated probes for carrying out the process according to any one of Claims 1 to 11, said pairs of primers and associated probes being chosen from the group consisting of: <Desc / Clms Page number 59> Bc84f (SEQ ID No. 11), Bc84r (SEQ ID No. 12), and Bc84TqFT (SEQ ID No. 22), or any sequence having at least 80% identity therewith or their complementary reverse sequences, for amplification in real time a specific and exclusive nucleic acid fragment of Bacillus cereus; Sa193f (SEQ ID No. 9), Sa193r (SEQ ID No. 10), and Sa193TqFT (SEQ ID No. 21), or any sequence having at least 80% identity therewith or their complementary reverse sequences, for amplification in real time a specific and exclusive nucleic acid fragment of Staphylococcus aureus; Se98f (SEQ ID No. 7), Se98r (SEQ ID No. 8), and Se98TqFT (SEQ ID No. 20), or any sequence having at least 80% identity therewith or their complementary reverse sequences, for amplification in real time a specific and exclusive nucleic acid fragment of Salmonella spp. ; Ec97f (SEQ ID No. 5), Ec97r (SEQ ID No. 6), and Ec97TqFT (SEQ ID No. 19), or any sequence having at least 80% identity therewith or their complementary reverse sequences, for amplification in real time a specific and exclusive nucleic acid fragment of Escherichia coli and / or Hafnia alvei and / or Shigella spp. and / or Yersinia enterocolitica; Ye86f (SEQ ID No. 3), Ye86r (SEQ ID No. 4), and Ye86TqFT (SEQ ID No. 18), or any sequence having at least 80% identity therewith or their complementary reverse sequences, for amplification in real time a specific and exclusive nucleic acid fragment of Yersinia enterocolitica; LmHlyAf (SEQ ID No. 1), LmHlyAr (SEQ ID No. 2), and Lm113TqFT (SEQ ID No. 17), or any sequence having at least 80% identity therewith or their complementary reverse sequences, for amplification in real time a specific and exclusive nucleic acid fragment of Listeria monocytogenes; <Desc / Clms Page number 60> Lpn112f (SEQ ID No. 36), Lpn112r (SEQ ID No. 37), and Lpn112TqFT (SEQ ID No. 40), or any sequence having at least 80% identity therewith or their complementary reverse sequences, for amplification in real time a specific and exclusive nucleic acid fragment of Legionella pneumophila. Lg69f (SEQ ID No. 35), Lg69r (SEQ ID No. 34), and Lg69TqFT (SEQ ID No. 39), or any sequence having at least 80% identity therewith or their complementary reverse sequences, for amplification in real time a specific and exclusive nucleic acid fragment of Legionella spp. ; and Lg189f (SEQ ID No. 33), Lg69r (SEQ ID No. 34), and Lg189TqFT (SEQ ID No. 38), or any sequence having at least 80% identity therewith or their complementary reverse sequences, for amplification in real time a specific and exclusive nucleic acid fragment of Legionella spp. ; Cju76f (SEQ ID No. 15), Cju76r (SEQ ID No. 16), and Cju76TqFT (SEQ ID No. 24), or any sequence having at least 80% identity therewith or their complementary reverse sequences, for amplification in real time a specific and exclusive nucleic acid fragment of Campylobacter jejuni; Cp97f (SEQ ID No. 13), Cp97r (SEQ ID No. 14), and Cp97TqFT (SEQ ID No. 23), or any sequence having at least 80% identity therewith or their complementary reverse sequences, for amplification in real time a specific and exclusive nucleic acid fragment of Clostridium perfringens;  14. Nucleotide probe for carrying out the method according to any one of claims 1 to 11, said probe being specific and exclusive of a species, a genus or a bacterial group chosen from Yersinia enterocolitica, Escherichia coli and / or Hafnia alvei and / or Shigella spp. and / or Yersinia. enterocolitica, Staphylococcus aureus, Salmonella <Desc / Clms Page number 61>  spp., Bacillus cereus, Clostridium perfringens, Campylobacter jejuni, Legionella spp. and Legionella pneumophila and corresponding to an amplification product obtained using a pair of primers of sequences chosen from the sequences SEQ ID N 4 to 16 and any sequence having at least 80% identity with these .  15. A nucleotide probe for carrying out the method according to claim 1, said probe having a sequence chosen from: Lm113TqFT (SEQ ID No. 17) and any sequence having at least 80% identity therewith or with its complementary reverse sequence, said sequences being specific and exclusive of Listeria monocytogenes; Ye86TqFT (SEQ ID No. 18) and any sequence having at least 80% identity therewith or with its complementary reverse sequence, said sequences being specific and exclusive to Yersinia enterocolitica; Ec97TqFT (SEQ ID No. 19) and any sequence having at least 80% identity therewith or with its complementary reverse sequence, said sequences being specific and exclusive of Escherichia coli and / or Hafnia alvei and / or Shigella spp. and / or Yersinia enterocolitica; Se98TqFT (SEQ ID No. 20) and any sequence having at least 80% identity therewith or with its complementary reverse sequence, said sequences being specific and exclusive of Salmonella spp. ; Sa193TqFT (SEQ ID N 21) and any sequence having at least 80% identity therewith or with its complementary reverse sequence, said sequences being specific and exclusive of Staphylococcus aureus; Bc84TqFT (SEQ ID No. 22) and any sequence having at least 80% identity therewith or with its complementary reverse sequence, said sequences being specific and exclusive of Bacillus cereus; <Desc / Clms Page number 62> Lpn112TqFT (SEQ ID N 40), and any sequence having at least 80% identity therewith or with its complementary reverse sequence, said sequences being specific and exclusive to Legionella pneumophila. Lg69TqFT (SEQ ID No. 39), and any sequence having at least 80% identity therewith or with its complementary reverse sequence, said sequences being specific and exclusive to Legionella spp. ; and Lg189TqFT (SEQ ID No. 38), and any sequence having at least 80% identity therewith or with its complementary reverse sequence, said sequences being specific and exclusive to Legionella spp. ; Cju76TqFT (SEQ ID N 24) and any sequence having at least 80% identity therewith or with its complementary reverse sequence, said sequences being specific and exclusive of Campylobacter jejuni; Cp97TqFT (SEQ ID No. 23) and any sequence having at least 80% identity therewith or with its complementary reverse sequence, said sequences being specific and exclusive to Clostridium perfringens;  16. Kit for the detection and identification of nucleic acids of bacteria contained in a complex mixture or in water, said kit comprising: at least two pairs of primers chosen from a group comprising primer pairs according to claim 12, wherein the pair of primers consisting of the following sequences: LmHlyAf (SEQ ID N 1) and LmHlyAr (SEQ ID N 2), or the pair of complementary reverse primers of the pair {LmHlyAf, LmHlyAr}, or any sequence having at least 80% identity therewith, for the specific amplification and exclusive of L. monocytogenes; and / or at least two nucleotide probes according to the claim 14 and / or claim 15. <Desc / Clms Page number 63>  17. Kit for the detection, identification and quantification of nucleic acids of bacteria contained in a complex mixture or in water, said kit comprising: at least two pairs of primers and associated probes according to claim 13; and / or at least two nucleotide probes according to claim 14 and / or claim 15.  18. A microarray or nucleic acid chip for the detection and identification of bacteria contained in a complex mixture or in water, comprising at least two pairs of primers chosen from a group comprising primer pairs according to claim 12 and the pair of primers consisting of the following sequences: LmHlyAf (SEQ ID N 1) and LmHlyAr (SEQ ID N 2), or any sequence similar to at least 80% thereto, for specific amplification and exclusive to L. monocytogenes.  19. A microarray or nucleic acid chip for the detection, identification and quantification of bacteria contained in a complex mixture or in water, comprising at least two pairs of primers and associated probes according to claim 13.  20. Micro-array or nucleic acid chip for the detection and identification of bacteria contained in a complex mixture or in water, said microarray comprising at least two nucleotide probes according to claim 14 and / or the claim 15.