FR2741891A1 - Cells for prodn. of recombinant adeno and adeno-associated virus - Google Patents

Abstract

Cell for prodn. of defective adenovirus (AV) has inserted into its genome a part of the 2E4 region of the AV genome contg. the open reading frame ORF6 under control of a functional promoter. Also new are: (1) plasmids contg. the specified E4 region under control of an inducible promoter; (2) stocks of pure, recombinant defective AV lacking at least the E4 region, produced in the new cells; and (3) the recombinant defective AV DELTA E1,ORF3-, ORF6- (AV1), DELTA E1, DELTA E4,ORF1+ (AV2), DELTA E1, DELTA E4,ORF4+(AV3) and DELTA 1, DELTA E4 (AV4).

Description

 The present invention relates to new cell lines which can be used for the production of defective recombinant adenoviruses. It also relates to the purified viral preparations produced in these lines, as well as the plasmids allowing their constitution. More particularly, the new cell lines according to the invention allow the transcomplementation of the E4 region and a clonal production with high titers of defective recombinant adenoviruses in particular for all or part of the E4 region.

 Adenoviruses have certain properties which are particularly advantageous for use as a vector for gene transfer in gene therapy.

In particular, they have a fairly broad host spectrum, are capable of infecting quiescent cells, do not integrate into the genome of the infected cell, and have not been associated to date with significant pathologies in man. Adenoviruses have thus been used to transfer genes of interest into the muscle (Ragot et al.,
Nature 361 (1993) 647), the liver (Jaffe et al., Nature genetics 1 (1992) 372), the nervous system (Akli et al., Nature genetics 3 (1993) 224), etc.

 Adenoviruses are linear double-stranded DNA viruses approximately 36 kb in size. their genome includes in particular a repeated inverted sequence (1TR) at each end, an encapsidation sequence (Psi), early genes and late genes (see FIG. 1). the main early genes are contained in regions E1, E2, E3 and E4. Among these, the genes contained in the El region in particular are necessary for viral propagation. The main late genes are contained in regions L1 to L5. the genome of the Ad5 adenovirus has been fully sequenced and is accessible on the database (see in particular Genebank M73260).

Likewise, parts or even all of other adenoviral genomes (Ad2, Ad7, Ad12, etc.) have also been sequenced.

For their use in gene therapy, different vectors derived from adenoviruses have been prepared, incorporating different genes (equal, OTC, c-lAT, cytokines, etc.). In each of these constructions, the adenovirus was modified so as to render it incapable of replication in the infected cell. Thus, the constructions described in the prior art are adenoviruses deleted from the E1 region, essential for viral replication, at the level of which heterologous DNA sequences are inserted (Levrero et al., Gene 101 (1991) 195; Gosh-Choudhury et al.,
Gene 50 (1986) 161). These adenoviruses are produced in a complementation line (line 293) in which a part of the adenovirus genome has been integrated. More specifically, line 293 contains the left end (approximately 11 12 o) of the adenovirus genome serotype 5 (Ad5), comprising the left lTR, the packaging region, the El region, including Ela, Elb, and part of the region coding for the pix protein. This line is capable of trans-complementing recombinant adenoviruses defective for the E1 region, that is to say devoid of all or part of the E1 region, and to produce viral stocks having high titers.

However, the vectors deficient for the El region (El-, so-called first generation vectors) have certain drawbacks for therapeutic use. In particular, they may not be totally defective for replication in vivo, in particular because of the existence of certain complementary cellular functions. Thus, an E1 transcomplementation activity has been demonstrated in F9 embryonic carcinoma cells (Imperiale et al., 1984).

A similar activity, regulated by interleukin-6, has also been demonstrated (Spergel et al., 1992). Other drawbacks linked to these vectors are the presence of numerous viral genes, capable of being expressed in vivo after gene transfer, and of inducing an immune and / or inflammatory response.

To overcome these drawbacks, it has been proposed to create other deletions or modifications in the genome of the adenovirus. Thus, a heat-sensitive point mutation was introduced into the mutant ts125, making it possible to inactivate the DNA binding protein (DBP) of 72kDa (Van der Vliet et al., 1975). These vectors can also be produced with high titers in cells of line 293 at the permissive temperature (32 "C.). However, this type of vector also has a certain number of drawbacks such as an in vivo overexpression of the region
E4; the presence of a point mutation, therefore subject to reversion, a risk of partial activity at 37 "C, etc.

Another approach to overcome these problems is the deletion of another region essential for viral replication and / or spread. In this regard, the applicant is more particularly interested in the E4 region. The region
E4 is indeed involved in the regulation of the expression of late genes, in the stability of late nuclear RNA, in the extinction of the expression of proteins of the host cell and in the efficiency of DNA replication Adenoviral vectors in which the E1 and E4 regions are deleted therefore have very limited transcription background noise and expression of viral genes (see in particular application PCT / FR94 / 00851). However, the construction and the industrial and therapeutic exploitation of such vectors implies the provision of an efficient system of transcomplementation of these two functions for the production of viral stocks.

 The present invention provides a solution to this problem. The present invention indeed provides cell lines allowing the transcomplementation of the E4 region and a clonal production and with high titers of recombinant adenoviruses defective for this region. The lines according to the invention are advantageously capable of transcomplementing the two functions E1 and E4, and therefore make it possible to produce viruses deficient for these two functions. The present invention also provides plasmids allowing the construction of these lines; a process for the preparation of defective recombinant adenoviruses and purified viral stocks. More particularly, the Applicant has now shown that production ligabs capable of efficiently transcomplementing the E4 region are obtained by introducing only part of the E4 region. Thus, lines having particularly advantageous properties are obtained when only a reduced functional unit of the E4 region, corresponding to the reading phase ORF6 or to the reading phases ORF6 and ORF6 / 7, are present.

A first object of the invention therefore resides in a cell usable for the production of defective recombinant adenoviruses comprising, iridescent in its genome, part of the E4 region of an adenovirus genome comprising the reading phase
ORF6 under the control of a functional promoter. According to a preferred embodiment, the cells of the invention comprise a part of the E4 region of an adenovirus genome comprising the reading phases ORF6 and ORF6 / 7 under the control of a functional promoter.

As indicated above, the cell lines according to the present invention have particularly advantageous properties: They allow first of all the transcomplementation of the functions E1 and E4. However, in a particularly advantageous manner, they are capable of inducing the formation of plaques of viruses deficient in these functions, which is essential for the cloning of the recombinant viruses, then for their amplification and their purification. In this regard, the Applicant has indeed shown that lines having the entire E4 region or larger functional units, including for example the reading phase
ORF4, are unable to form plaques of viruses deficient for the E4 region.

The identification of specific functional units of the E4 region allows the creation of a very efficient system of transcomplementation and production of defective viruses for the E1 and E4 functions. Other advantages of the lines according to the invention are in particular their aptitude for the amplification in a liquid medium of such viruses deficient for the El and E4 regions, the high titers of such viruses that they produce, and the absence of production of contaminating replicative viral particle.

 The E4 region of the adenoviral genome consists of 7 open reading phases, designated ORF1, ORF2, ORF3, ORF4, ORF3 / 4, ORF6 and ORF6t7 (Figures 2 and 3). As indicated above, the cells of the invention are particularly characterized by the presence of only a part of this region, comprising the reading phase ORF6 possibly associated with the reading phase ORF6 / 7. It is particularly important that the part of the E4 region present in the cells of the invention does not contain the functional ORF4 reading phase.

Advantageously, the E4 region present in the cells of the invention does not contain the functional ORF1-ORF4 reading phases. In a particularly preferred manner, the E4 region present in the cells of the invention is deleted from at least part of the ORF1-ORF4 reading phases. These different parts of the E4 region can be obtained by enzymatic cleavages or modified according to methods known to those skilled in the art. According to a preferred embodiment, the cell lines of the invention comprise an inserted fragment containing less than 2 kb of the E4 region of an adenovirus genome containing all of the reading phases
ORF6 and possibly ORF6 / 7. As preferred examples, the reading phase
ORF6 can be isolated from the E4 region in the form of a BglII-PvuII fragment, corresponding to nucleotides 34115-33126, and the ORF6-ORF6 / 7 reading phases can be isolated from the region M in the form of a BglII- fragment BglII corresponding to nucleotides 34115-32490 of the Ad5 genome.

In this regard, a particularly preferred embodiment of the invention consists of a cell comprising, inserted into its genome, a Bglll- fragment
BglII corresponding to nucleotides 34115-32490 of the Ad5 genome. This fragment is present in particular in the plasmid pORF6Gen described in the examples, used for the construction of the cell line cloned # 2. Another particularly preferred embodiment of the invention consists of a cell comprising, inserted into its genome, a BglII-PvuII fragment corresponding to nucleotides 3411533126 of the Ad5 genome.

 The part of the E4 region present in the cells according to the invention can be derived from adenoviruses of different origins or seotypes. There are in fact different serotypes of adenoviruses, the structure and properties of which vary somewhat, but which have a comparable genetic organization. More particularly, the E4 region present in the cells according to the invention can be derived from an adenovirus of human or animal origin.

 With regard to adenoviruses of human origin, there may be preferably mentioned those classified in group C. More preferably still, among the various serotypes of human adenovirus, it is preferred to use, within the framework of the present invention, adenoviruses of type 2 or 5 ( Ad 2 or Ad 5). Among the various adenoviruses of animal origin, it is preferred to use, within the framework of the invention, adenoviruses of canine origin, and in particular all the strains of the adenoviruses CAV2 [Manhattan strain or A26 / 61 (ATCC VR-800) for example] .

Other adenoviruses of animal origin are cited in particular in application WO94 / 26914 incorporated herein by reference.

In a preferred embodiment of the invention, the part of the region
E4 comes from a genome of human adenovirus of group C. More preferably, it comes from the genome of an adenovirus Ad2 or Ad5.

 As indicated previously, the part of the E4 region present in the cells of the invention is placed under the control of a functional promoter in said cells. Advantageously, it is an inducible promoter, making it possible to control the levels and / or the periods of expression of these genes. In a particularly advantageous manner, it is the promoter of the LTR of MMTV (Pharmacia), which is induced by dexamethasone or of a promoter regulated by tetracycline (US published application No. 08 / 076,327; WO94 / 04672). It is understood that other promoters can be used, and in particular variants of the LTR of MMTV carrying, for example, heterologous regulatory regions ("enhancer" regions in particular).

 The cells according to the invention can be prepared from different pharmaceutically usable cells, that is to say cultivable under industrially acceptable conditions and having no recognized pathogenic character. n can be established cell lines or primary cultures. Advantageously, these are cells of human origin, which can be infected with an adenovirus. In this regard, we can cite the cells KB, Hela, 293, Vero, gmDBP6, etc.

 The cells of the KB line are derived from a human epidemic carcinoma.

They are accessible to ATCC (ref. CCL17) as well as the conditions allowing their cultivation. The Hela human cell line comes from a carcinoma of the human epithelium. It is also accessible to ATCC (ref. CCL2) as well as the conditions allowing its cultivation. The cells of line 293 are human embryonic kidney cells (Graham et al., J. Gen. Virol. 36 (1977) 59). This line contains in particular, integrated into its genome, the left part of the genome of the human adenovirus Ad5 (12%). The gm DBP6 cell line (Brough et al.,
Virology 190 (1992) 624) is made up of Hela cells carrying the adenovirus E2 gene under the control of the LTR of MMTV.

 n can also be cells of canine origin (BHK, MDCK, etc.). In this regard, cells from the MDCK canine line are preferred. The culture conditions of MDCK cells have been described in particular by Macatney et al., Science 44 (1988) 9.

 The cell lines according to the invention can be constructed in different ways. Generally, they are prepared by transformation of a cell culture with a plasmid carrying the selected fragment of the E4 region under the control of a functional promoter. The transfection of the cells can be carried out by any technique known to a person skilled in the art, and in particular in the presence of calcium phosphate, by electroporation, etc. According to a particular embodiment, the plasmid used also carries a marker gene making it possible to identify and select the transformed cells. n can be in particular any gene for resistance to an antibiotic (geneticin, hygromycin, etc.). The marker gene can also be carried by a separate construct, co-transfected with the plasmid. After transfection and selection for the marker gene, the cells obtained can be selected for their capacity to transcomplement adenoviruses lacking the E4 region. For this, different mutant adenoviruses defective for different parts of the E4 region can be used, such as in particular the adenoviruses Ad2dl808 (Weinberg et al., 1986), Ad5dl1004, dl1007 or dl1014 (Bridge et al., 1989), dIlOîl (Bridge et al., 1993), as shown in the examples.

Advantageously, the cells according to the invention are also capable of transcomplementing for the El region. These can be constructed as described above from cells which already tracomplement the El region (example: cells 293), or by sequential introduction of a building bringing the region
El and of a construction providing the part of the region E4 according to the invention.

 According to a particularly preferred embodiment, the cells according to the invention derive from the cell line 293. In this regard, particularly advantageous results have been obtained with cells of the line 293 transformed with the plasmid pORF6Gen.

 The present invention also describes the construction of plasmids comprising a part of the E4 region of an adenovirus genome carrying the reading phase ORF6 or ORF6 and ORF6 / 7 under the control of an inducible promoter (see in particular plasmid pORF6Gen). These plasmids can be used directly to transfect a selected cell population, then, by selection, for the identification of cells which have stably acquired the E4 function.

Another object of the invention resides in the use of the cells described above for the production of recombinant adenoviruses defective at least for the region
E4. The invention indeed provides a method for producing recombinant adenoviruses defective at least for the E4 region which is particularly advantageous, using the above cells. According to this method, a culture of cells as described above is transformed with one or more plasmids providing the different regions of the genome of said defective recombinant adenovirus and then the viruses produced are harvested. This method is particularly advantageous for the production of adenovirus having non-functional El and E4 regions. These are in particular vectors in which the regions E1 and E4 have been inactivated or made non-functional by total or partial deletion. Such modifications can be obtained in vitro (on isolated DNA) or in situ, for example, using genetic engineering techniques, or alternatively by treatment with mutagenic agents. The said genetic modification (s) may be located in a coding part of the region, or outside of a coding region, and for example in the regions responsible for the expression and / or transcriptional regulation of said genes. The deletion can be carried out by digestion using appropriate restriction enzymes, then ligation, according to conventional molecular biology techniques.

According to a particularly advantageous mode, the method of the invention is used for the production of recombinant adenoviruses in which the E1 region is inactivated by deletion of a PvuII-BglII fragment going from nucleotide 454 to nucleotide 3328, on the sequence of l adenovirus Ad5. This sequence is accessible in the literature and also on the database (see in particular Genebank nO
M73260). In another preferred embodiment, the E1 region is inactivated by deletion of a HinfH-Sau3A fragment going from nucleotide 382 to nucleotide 3446.

In a particular mode, the method allows the production of vectors comprising a deletion of the entire E4 region. This can be achieved by excision of a MaeII-MscI fragment corresponding to nucleotides 35835-32720. The cell lines according to the invention are in fact capable of transcomplementing and amplifying adenoviruses carrying any type of deletion or inactivation of the region
E4. In another particular mode, only a functional part of E4 is deleted.

This part includes at least the ORF3 and ORF6 phases. By way of example, these coding phases can be deleted from the genome in the form of PvuII fragments
AluI and Bglll-Pvull respectively, corresponding to nucleotides 34801-34329 and 34115-33126 respectively. The deletions of the E4 region of the Ad2 dl808 virus or of the Ad5 dl1004, Ad5 dl1007, Ad5 dIIIO1 or Ad5 d101014 viruses can also be used in the context of the invention. In this respect, the cells of the invention are particularly advantageous for the production of viruses comprising an inactive E1 region and a deletion in the E4 region of the type of that present in the genome of
Ad5 dl1014, i.e. Zire of virus E4- retaining the reading phase ORF4.

 The present invention therefore also describes defective recombinant adenoviruses whose genome comprises a deletion in the E1 region and a deletion in the E4 region. More particularly, it describes defective recombinant adenoviruses whose genome comprises a deletion in the E1 region and a deletion in the E4 region corresponding at least to the ORF3 and ORF6 reading phases.

Thus, the adenoviruses according to the invention preferably comprise the following deletions affecting all or part of the El and M regions:
- Adenovirus lvE1, ORF3-, ORF6-: deletion of all or part of the E1 region and of the nucleotides 34801-34329 and 34115-33126 of the M region;
- Adenovirus l, EE4, ORFl +: deletion of all or part of the El region and of the E4 region with the exception of the ORF1 reading phase. This deletion in the E4 region preferentially covers nucleotides 33093 to 35053. It is obtained for example from the mutant Ad5 d11004. Other deletions can be used for the production of adenovirus AE1, AE4,0RF1 + of the invention, on the basis of the information given in the present application and of the nucleotide sequence SEQ
ID No. 4. This double-stranded sequence represents the right portion of the adenoviral genome, including the E4 region and the right TR of nucleotide 32749 (1 in SEQ ID No. 4) to 35935 (3186 in SEQ ID No. 04). It is a purely illustrative sequence and other published sequences can also be used. The different reading phases of the E4 region are represented, in particular ORF7, ORF6, ORF4, ORF3, ORF2 and ORFI. An hE1E4,0RF1 + adenovirus of the invention advantageously comprises a deletion in the E1 region and a deletion of a fragment whose 5 ′ end is included in the reading phase ORF7 and whose 3 ′ end is located in the phase ORF2 reading. Even more preferably, the deletion relates to a fragment whose 5 'end is between nucleotides 32920 to 33190 of the adenovirus genome and whose 3' end is between nucleotides 34710 to 35090 of the adenoviral genome. This deletion corresponds approximately to nucleotides 170 to 440 (5 'end) and 1960 to 2340 (3' end) on the sequence SEQ ID No. 4.

- AE1, AE4,0RF4 + adenovirus: deletion of all or part of the E1 region and of the E4 region with the exception of the ORF4 reading phase. An adenovirus 1, EE4, ORF4 + of the invention advantageously comprises a deletion in the El region, a deletion of a fragment whose 5 'end is included in the reading phase ORF7 and whose 3' end is located in the ORF6 reading phase (with the exception of the part overlapping the ORF4 reading phase), and a deletion of a fragment whose 5 'end is included in the ORF3 reading phase and whose 3' end is located in the reading phase ORF1 or in the promoter region of E4. More preferably, these adenoviruses according to the invention comprise:
(i) a deletion of all or part of El,
(ii) a deletion of a fragment whose 5 'end is between nucleotides 32920 to 33190 of the adenovirus genome and whose 3' end is between nucleotides 33200 to 34000 of the adenoviral genome, and,
(iii) a deletion of a fragment whose 5 'end is between nucleotides 34360 to 34700 of the adenovirus genome and whose 3' end is between nucleotides 35150 to 35530 of the adenoviral genome.

 The corresponding positions of the deletion (ii) on the sequence SEQ ID no. 4 are 180 to 445 (5 'end) and 450 to 1250 (the 3' end). The corresponding positions of the deletion (iii) on the sequence SEQ ID n "4 are 1610 to 1950 (5 'end) and 2410 to 2870 (3' end).

 These deletions in the E4 region preferentially cover nucleotides 33093 (SmaI) -33695 and 3463435355 (SmaI). They can be obtained for example from the mutant Ad5 dl1014.

 - Adenovirus hE1, AE4: deletion of all or part of the El region and of nucleotides 32720-35835, or 33466-35355 (this deletion can be obtained for example from the mutant Ad5 dol 1007) or 33093-35355 (this deletion can be obtained for example from the mutant Ad5 dl1011). These 3 deletions cover the entire E4 region.

 As indicated above, the deletion in the region El advantageously covers all or part of the regions E1A and E1B. This deletion must be sufficient to render the virus incapable of autonomous replication in a cell. The part of the El region deleted in the adenoviruses according to the invention advantageously covers the nucleotides 454-3328 or 382-3446.

The positions given above refer to the sequence of the adenovirus
Wild Ad5 as published and accessible on the database. Although minor variations may exist between the different adenovirus serotypes, these positions are generally applicable to the construction of recombinant adenoviruses according to the invention from any serotype, and in particular adenoviruses Ad2 and Ad7.

 Furthermore, the adenoviruses of the invention may have other alterations in their genome. In particular, other regions can be deleted to increase the capacity of the virus and reduce these side effects linked to the expression of viral genes. Thus, all or part of the E3 or IVa2 region in particular can be deleted. Regarding the E3 region, it may however be particularly advantageous to keep the part coding for the protein gpl9K. This protein in fact makes it possible to prevent the adenovirus vector from undergoing an immune reaction which (i) limits its action and (ii) could have undesirable side effects. According to a particular mode, the E3 region is deleted and the sequence coding for the protein gpl9k is reintroduced under the control of a heterologous promoter.

 The recombinant adenoviruses according to the invention have particularly attractive properties for use in gene therapy. These vectors combine indeed properties of infection, safety (the risks of immune and / or inflammatory reaction are greatly reduced) and very high gene transfer capacity. In addition, the lines of the invention allow the production of viral stocks totally devoid of replicating contaminating particles (RCA).

Thus, the results presented show the construction and production by the lines of the invention of adenoviruses defective for the E1 and E4 regions, devoid of RCA.

In particular, the appearance of replicating contaminating particles E4 + during the production of the viruses # E1, # E4, ORF1 +, # E1, # E4, ORF4 + or # E1, # E4 according to the invention is not possible with the lines of the invention since (i) these viruses do not contain overlapping sequences on either side of the region integrated into the genome of the cell (FIG. 3) and (ii) a simple homologous recombination event between the cell regions and viral would generate an unsustainable virus lacking right ITR. Another advantage of the viruses according to the invention lies in their increased cloning capacity, allowing the insertion of large transgenes (greater than 10 kb). This allows in particular the use of transcription regulatory sequences making it possible to improve the , regulation and duration of expression. This also makes it possible to use lower doses of virus and to obtain a comparable therapeutic effect with very reduced cytopathic side effects.

As indicated before, adenoviruses constitute very efficient gene transfer vectors for gene and cell therapy applications. For this, a heterologous nucleic acid sequence whose transfer and / or expression in a cell, an organ or an organism is sought can be inserted into their genome. This sequence may include one or more therapeutic genes, such as a gene whose transcription and possibly translation into the target cell generate products having a therapeutic effect. Among the therapeutic products, mention may be made more particularly of enzymes, blood derivatives , hormones, lymphokines: interleukins, interferons, TNF, etc. (FR 9203120), growth factors, neurotransmitters or their precursors or synthetic enzymes, trophic factors: BDNF, CNTF, NGF, IGF, GMF, aFGF, bFGF, NT3, NT5, etc; apolipoproteins: ApoAI, ApoAIV, ApoE, etc. (W094 / 25073), dystrophin or a minidystrophin (W093 / 06223), tumor suppressor genes: p53, Rb,
RaplA, DCC, k-rev, etc (WO94 / 24297), the genes coding for factors involved in coagulation: Factors VII, VIII, IX, etc, the suicide genes: Thymidine kinase, cytosine deaminase, etc; or all or part of a natural or artificial immunoglobulin (Fab, ScFv, etc., W094 / 29446), etc. The therapeutic gene can also be an antisense gene or sequence, the expression of which in the target cell makes it possible to control the expression of genes or the transcription of cellular mRNAs. Such sequences can for example be transcribed, in the target cell, into RNAs complementary to cellular mRNAs and thus block their translation into protein, according to the technique described in patent EP 140 308. The therapeutic gene can also be a gene encoding for an antigenic peptide, capable of generating an immune response in humans, with a view to producing vaccines. It may in particular be antigenic peptides specific for the epstein barr virus, the HIV virus, the hepatitis B (EP 185 573), of the pseudo-rabies virus, or even specific for tumors (EP 259 212).

 Generally, the heterologous nucleic acid sequence also comprises a promoter region for functional transcription in the infected cell, as well as a region located 3 ′ of the gene of interest, and which specifies a transcriptional end signal and a site for polyadenylation. All of these elements constitute the expression cassette. As regards the promoter region, it may be a promoter region naturally responsible for the expression of the gene considered when it is capable of functioning in the infected cell. They can also be regions of different origin (responsible for the expression of other proteins, or even synthetic). In particular, they can be promoter sequences of eukaryotic or viral genes or any promoter or derivative sequence , stimulating or repressing the transcription of a gene in a specific way or not and in an inducible way or not. By way of example, they may be promoter sequences originating from the genome of the cell which it is desired to infect, or from the genome of a virus, and in particular, the promoters of the E1A, MLP genes of adenovirus, the CMV promoter, LTR-RSV, etc. Among the eukaryotic promoters, mention may also be made of ubiquitous promoters (HPRT, vimentin, a-actin, tubulin, etc.), promoters of intermediate filaments (desmin, neurofilaments, keratin, GFAP, etc.) promoters of therapeutic genes (MDR type , CFTR, factor VIII, etc.) tissue-specific promoters (pyruvate kinase, villin, promoter of the intestinal fatty acid binding protein, promoter of actin to smooth muscle cells, specific promoters for the liver; Apo AI , Apo AII, Human albumin etc) or even promoters responding to a stimulus (steroid hormone receptor, retinoic acid receptor, etc.). In addition, these expression sequences can be modified by adding activation, regulation sequences, or allowing tissue-specific or majority expression. Furthermore, when the nucleic acid inserted does not contain expression sequences, it can be inserted into the genome of the defective virus downstream of such a sequence.

 Furthermore, the heterologous nucleic acid sequence may also comprise, in particular upstream of the therapeutic gene, a signal sequence directing the therapeutic product synthesized in the secretory pathways of the target cell. This signal sequence may be the natural signal sequence of the therapeutic product, but it may also be any other functional signal sequence, or an artificial signal sequence.

 The therapeutic gene expression cassette can be inserted into different sites of the genome of the recombinant adenovirus, according to the techniques described in the prior art. It can first of all be inserted at the level of the E1 deletion. It can also be inserted at the level of the E3 region, in addition to or in substitution for sequences. It can also be located at the level of the deleted E4 region.

 The present invention also relates to the purified viral preparations obtained according to the process of the invention, as well as any pharmaceutical composition comprising one or more defective recombinant adenoviruses prepared according to this process. The pharmaceutical compositions of the invention can be formulated for topical, oral, parenteral, intranasal, intravenous, intramuscular, subcutaneous, intraocular, transdermal, etc. administration.

 Preferably, the pharmaceutical composition contains pharmaceutically acceptable vehicles for an injectable formulation. They can be in particular saline solutions (monosodium phosphate, disodium, sodium chloride, potassium, calcium or magnesium, etc., or mixtures of such salts), sterile, isotonic, or dry compositions, in particular lyophilized, which, by addition, as appropriate, of sterilized water or physiological saline, allow the constitution of injectable solutes. Other excipients can be used such as for example a hydrogel. This hydrogel can be prepared from any biocompatible and non-cytotoxic polymer (homo or hetero). Such polymers have for example been described in application WO93 / 08845. Some of them, such as in particular those obtained from ethylene oxide and / or propylene, are commercial. The doses of virus used for the injection can be adapted according to various parameters, and in particular according to the mode of administration used, the pathology concerned, the gene to be expressed, or even the duration of the treatment sought. In general, the recombinant adenoviruses according to the invention are formulated and administered in the form of doses of between 104 and 1014 pfu, and preferably 106 to 1010 pfu. The term pfu ("plaque forming unit") corresponds to the infectious power. of a virus solution, and is determined by infection of an appropriate cell culture, and measures, generally after 15 days, the number of plaques of infected cells. The techniques for determining the pfu titer of a viral solution are well documented in the literature.

 Depending on the therapeutic gene, the adenoviruses thus produced can be used for the treatment or prevention of many pathologies, including genetic diseases (dystrophy, cystic fibrosis, etc.), neurodegenerative diseases (alzheimer, parkinson, ALS, etc.), cancers , pathologies linked to coagulation disorders or dyslipoproteinemias, pathologies linked to viral infections (hepatitis, AIDS, etc.), etc.

 The present invention will be more fully described with the aid of the following examples, which should be considered as illustrative and not limiting.

Figure legend Figure: Genetic organization of the Ad5 adenovirus. The complete sequence of Ad5 is available on the database and allows those skilled in the art to select or create any restriction site, and thus to isolate any region of the genome.

Figure 2: Genetic organization of the E4 region.

Figure 3: Genetic organization of the E4 region in wild and defective E4 adenoviruses. The size of the deletion is represented by a thick bar.

Figure: (A) Schematic representation of the MMTV LTR / (ORF6 +
ORF7). Oligos 1, 2 and 3 used for amplification or RT-PCR are located.

+ 1 = Transcription initiation site. AAA = Polyadenylation site. (B)
Structure of products obtained by RT-PCR. SD = 5 'splice donor site. SA =
Site 3 'splice acceptor.

 Figure: Analysis of the production of adenoviral fiber by immunological detection using a polyclonal serum against the fiber (Boulanger et al.). The cell extracts are prepared after 72 hours of viral infection, the dexamethazone is added at the same time as the virus (final concentration 600 nM). (A) Infection with the d11014 virus (ME = 10); (B) Infection with the 1001 virus (ME = 1); Infection with the dl1004 virus (MOI = 10); (wt) Infection with the Ad5 virus (ME = 10).

 Figure: Inducibility of M in cells of clone # 2. Analysis of cell extracts not infected (control less than O) or infected with the dl1007 virus, 72 after infection. DM = dexamethazone (600 nM).

Figure 7: Clonal construction strategy of the ove1, AE4 viruses.

General techniques of niolecular biology
Methods conventionally used in molecular biology such as preparative extractions of plasmid DNA, centrifugation of plasmid DNA in cesium chloride gradient, electrophoresis on agarose or acrylamide gels, purification of DNA fragments by electroelution, the extraction of proteins with phenol or phenylchloroform, the precipitation of DNA in a saline medium with ethanol or isopropanol, the transformation in Escherichia coli, etc. are well known to the man of trade and are abundantly described in the literature [Maniatis T. et al., "Molecular Cloning, a Laboratory Manual", Cold Spring Harbor
Laboratory, Cold Spring Harbor, NY, 1982; Ausubel FM et al. (eds), "Current
Protocols in Molecular Biology ", John Wiley & Sons, New York, 1987].

The pBR322, pUC and phage plasmids of the M13 series are of commercial origin (Bethesda Research Laboratories). For ligations, the DNA fragments can be separated according to their size by electrophoresis in agarose or acrylamide gels, extracted with phenol or with a phenovchloroform mixture, precipitated with ethanol and then incubated in the presence of DNA ligase. phage T4 (Biolabs) according to the supplier's recommendations. The filling of the protruding 5 ′ ends can be carried out by the Klenow fragment of DNA Polymerase I of E. coli (Biolabs) according to the supplier's specifications. Destruction of the prominent 3 'ends is carried out in the presence of phage DNA Polymerase
T4 (Biolabs) used according to the manufacturer's recommendations. The destruction of the protruding 5 ′ ends is carried out by gentle treatment with nuclease S1.

Mutagenesis directed in vitro by synthetic oligodeoxynucleotides can be carried out according to the method developed by Taylor et al. [Nucleic Acids Res. ll (1985) 8749-8764] using the kit distributed by Amersham. The enzymatic amplification of DNA fragments by the technique called PCR olymerase-catalyzed Chain Rection, Saiki RK et al., Science XQ (1985) 1350-1354; Mullis
KB and Faloona FA, Meth. Enzym. 155 (1987) 335-350] can be carried out using a "DNA thermal cycler" (Perkin Elmer Cetus) according to the manufacturer's specifications. Verification of the nucleotide sequences can be carried out by the method developed by Sanger et al. [Proc. Natl. Acad. Sci. USA, 74 (1977) 54635467] using the kit distributed by Amersham.

Example 1. Construction of plasmids carrying different functional units of the E4 region under the control of a promoter
1.1. Construction of the plasmid pE4Gen
The plasmid pPY2 corresponds to the cloning of the Avr2-Sall fragment (approximately 1.3 kb including the MMTV promoter) of the plasmid pMSG (Pharmacia) between the Xbal and Sall sites of the plasmid pIC20H prepared from an E. coli dam + context.

The plasmid pPY4 is derived from the plasmid pPY2 by deletion of a 35 bp fragment after cleavage with BamH1 and Bgl2 and then religation. The plasmid pPY5 corresponds to the plasmid pIC20H in which the Taql-Bgl2 fragment including the E4 region of the adenovirus type 5 located between positions 35576 (Taql) and 32490 (Bgl2), was cloned between the ClaI and BamH1 sites. The E4 region of the plasmid pPY5 is therefore included in an EcoRV-Sphl fragment which can be cloned after partial digestion between the SmaI and Sphl sites of the plasmid pPY4, which generates the plasmid pPY6.

The insertion of the Xhol fragment, which carries a gene conferring resistance to geneticin in 293 cells, in the plasmid pPY6 generates the plasmid pE4Gen.

This plasmid therefore carries a selectable gene and the entire E4 region of the adenovirus expressed from the promoter of MMTV. In this particular plasmid these two genes follow each other and the respective coding sequences are carried by the same strand of DNA. In this plasmid, the main donor 5 ′ site for splicing located upstream of the reading phase ORF1 (towards position 35548) is therefore preserved to ensure correct alternative splicing, making it possible to generate the various expression products of all the coding phases of the E4 region and in a comparable manner to the alternative splicing observed during the viral cycle.

1.2. Construction of the plasmid pORF6Gen
The plasmid pPY13 corresponds to the cloning of the Bgl2-Xbal fragment of the plasmid pPY6 between the corresponding sites of the plasmid pIC20H. This 1.6 kb fragment therefore includes the type 5 adenovirus sequence from position 34115 (Bgl2) to position 32490 (Bgl2, followed by the Xbal site from the cloning multisite of plasmid pIC20H). The plasmid pPY13 therefore contains all of the open reading phases ORF6 and ORF7 of the adenovirus, now included in a fragment
Xhol-Sphl. The cloning of this fragment between the Sall and Sphl sites of the plasmid pPY4 generates the plasmid pPY15. The insertion of the Xhol fragment, which carries a gene conferring resistance to geneticin in 293 cells, in the plasmid pPY15 generates the plasmid pORF6Gen. This plasmid therefore carries a selectable gene and the open reading phases ORF6 and ORF7 of the region E4 of the adenovirus expressed from the promoter of MMTV. In this particular plasmid these two genes follow each other and the respective coding sequences are carried by the same strand of DNA. The first codon to initiate translation is that of the open phase
ORF6 (position 34077 in the Ad5 genome), and it is separated from the CAP site of the MMTV promoter by 235 nucleotides. To the extent that alternative splicing is sequential and involves first of all recognition of the 5 'donor site , the main 5 ′ donor site located upstream of the reading phase ORF1 (towards position 35548) was therefore not included in the construction of the plasmid pORF6Gen to subsequently allow efficient expression of the products of the reading phases ORF6 and ORF6 / 7 (Figure 4A).

1.3. Construction of the plasmid pORF4Gen
Plasmid pPY14 corresponds to the cloning of the 1.9 kb Bgl2-Xbal fragment (obtained after partial digestion with the enzyme Bgl2), of plasmid pPY6 between the corresponding sites of plasmid pIC20H. This 1.9 kb fragment therefore includes the sequence of the adenoviuus type 5 from position 34387 (Bgl2) to position 32490 (Bgl2, followed by the Xbal site from the cloning multisite of the plasmid pIC20H).

The plasmid pPY14 is therefore isogenic with the plasmid pPY13 with the exception that it additionally includes a Bgl2 fragment corresponding to the entire open reading phase ORF4. This plasmid therefore contains all of the open reading phases
ORF4, ORF6 and ORF7 of the adenovirus, now included in an Xhol fragment
Sphl. The cloning of this fragment between the Sall and Sphl sites of the plasmid pPY4 generates the plasmid pPY16. The insertion of the Xhol fragment, which carries a gene conferring resistance to geneticin in 293 cells, in the plasmid pPY16 generates the plasmid pORF4Gen. This plasmid therefore carries a selectable gene and the open reading phases ORF4, ORF6 and ORF7 of the M region of the adenovirus expressed from the promoter of MMTV. In this particular plasmid these two genes follow each other and the respective coding sequences are carried by the same strand of DNA. As with the plasmid pORF6Gen, the main 5 ′ donor site located upstream of the reading phase ORF1 (towards position 35548) was not included in the construction of the plasmid pORF4Gen to allow subsequent efficient expression of the products of the phase of reading ORF4, ORF6 and ORF6 / 7.

1.4. Construction of plasmids pJY1 and pJY2
This example describes the construction of a pasmide comprising a functional unit of E4 (cf. example 1.2.) Under the control of a promoter derived from
MMTV. More particularly, this promoter is a derivative of MMTV comprising 5 elements of response to glucocorticoids, that is to say a derivative highly inducible by glucocorticoids. This plasmid was constructed in the following manner.

The Ad5 BglII fragment (position 34115 to 32490) includes the sequences (ORF6 + ORF7) of the M region. This fragment was first cloned between the BglII and BamHI sites of the plasmid pIC20H (Marsh et al., Gene 32 (1984) 481), which generates the plasmid pPY13 in which the BglII site located upstream of ORF6 is conserved. The BglII-SalI fragment of the plasmid pPY13 therefore includes all of the sequences (ORF6 + ORF7) of the E4 region of Ad5. This fragment was cloned between the sites
BamHI and SalI of the plasmid pIC20H, which generates the plasmid pPY45.

The XbaI fragment (approximately 1 kb) of the plasmid pGRE5-1 (Mader and White,
PNAS 90 (1993) 5603) corresponds to a promoter derived from MMTV, highly inducible by glucocorticoids. This fragment was isolated and cloned between sites
XbaI of the plasmid pIC20H isolated from a dam- context. The plasmid obtained was designated pPY21. In this plasmid, the BglII site originating from the cloning multisite of the plasmid pIC20H is located immediately upstream of the 5 elements of the promoter capable of binding the nuclear receptor to glucocorticoids. The BglII-EcoRI fragment of the plasmid pPY21, containing the promoter highly inducible by glucocorticoids, was then cloned between the BglII and EcoRI sites of the plasmid pIC20H, which generates the plasmid pPY26.

 The cloning of the EcoRI-SphI fragment of the plasmid pPY45 between the corresponding sites of the plasmid pPY26 generates the plasmid pJY1 which contains the sequences (ORF6 + ORF7) of Ad5 under the control of the promoter highly inducible by glucoeorticoids (cassette pGRE5 / (ORF6 + ORF7)).

 A pJY1 derivative has also been constructed containing a resistance gene.

The XhoI-SalI fragment of the plasmid pMSCV contains a gene conferring resistance to eukaryotic cells to geneticin (APH), expressed from a strong and ubiquitous promoter (PGK) in the cells. This fragment was cloned into the plasmid pJY1, at the salI site. The plasmid obtained was designated pJY2. This plasmid contains the expression cassettes pGRE5 / (ORF6 + ORF7) and PGK / APH transcribed in the same direction.

Example 2 - Construction of cell lines
This example describes the construction of complementary cell lines for the El and E4 regions of the adenoviruses according to the invention. These lines allow the construction and propagation of recombinant adenoviruses deleted for these regions, without using a helper virus.

 The lines of the invention were constructed by co-transfection of the selected cells in the presence of calcium phosphate, with the plasmids described in Example 1 and a construction coding for the glucocorticoid receptor (Hollenberg et al., 1985). More specifically, the cells of line 293 in dishes 5 cm in diameter were transfected with 1 to 5 μg of plasmid E4 (pMGen, pORF6Gen, pORF4Gen or pJY2) and possibly 5 Eg of a plasmid for expression of the human receptor for glucocorticoids expressed from the SV40 virus early promoter (plasmid pSGSHGR constructed by Dr R. Foy), in the presence of calcium phosphate, according to the protocol described by Graham and Van der Eb (Virology 52 (1973) 456).

2.1. Selection of geneticin-resistant clones
After transfection of the cells, these are washed, then the culture medium (MEM, Sigma) supplemented with fetal wish serum (7% final) is added and the cells are incubated for 20 hours. The following day, the cells are selected in the presence of geneticin at the effective concentration of 400 mg / l. Geneticin is changed every three days and selectable clones appear after about 3 weeks. When all of the non-transfected cells are dead, only the cells that have inserted the resistance gene remain and divide to generate cell clones. When the cell clones are large enough to be visible to the naked eye, they are individually transferred into the culture wells of a "24-hole" culture plate. Each clone is then gradually amplified in the presence of geneticin first in the wells of a culture plate "12 holes", then "6 holes" to be then amplified in cell culture dishes.

Each cell clone is then stored by freezing in liquid nitrogen.

 2.2. Selection of clones capable of producing viruses deceptive for E4.

 The adenoviruses Ad2dl808 (Weinberg and Ketner, J. Virol. 57 (1986) 833), Ad5dl1004, dl1007 or dl1014 (Bridge and Ketner, J. Virol. (1989) 631), dIlOîl (Bridge et al., Virology 193 (1993) ) 794) are deletion mutants carrying significant deletions in the E4 region. These mutants are incapable of replicating in 293 cells, but can be produced in W162 cells (Weinberg and Ketner, PNAS EQ (1983) 5383). In a second step, the 50 clones resistant to geneticin were tested for their ability to produce these E4- viruses and therefore to transcomplement the E4 region. 60 clones transfected with the geneticin-resistant plasmid pJY2 were also screened for this capacity to transcomplement the M region.

For this, each clone is infected in a liquid medium with the dl808 virus at a multiplicity of infection of approximately 0.1 PFU / cell (the viral titer is obtained on the W162 line). The infection was carried out at an ego of 0.5 pfu / cell for the clones pJY2, in a medium supplemented with dexamethazone (1yM). The appearance of an amplifiable cytopathic effect by successive reinfection of the cells with the cell lysate obtained is an indicator of a certain viral spread of dl808 by the cells of the clone considered. This transcomplementation is then objectified both by analysis of the level of replication and the ability of cells to form viral plaques (a possible protocol is described by Hitt, M .; Bett, AJ .; Prevec, L. and
Graham, KL. "Construction and propagation of human adenovirus vectors" in: Cell
Biology; a Laboratory Handbook. Volume 1. JE Celis (Ed); Academic Press Inc.

(San Diego, CA, USA). p479-490) after infection with dl808.

 This step made it possible to highlight several particular clones exhibiting effective properties of transcomplementation of the E4 region. The first, designated Clone # 2, results from the transfection of the plasmid pORF6Gen; the second, designated Clone # 4, was isolated after transfection of the plasmid pE4Gen. Stable clones, capable of transcomplementing for the E4 region, and highly inducible by giucocorticoids were also obtained after transfection of the 293 cells with the plasmid pJY2. Furthermore, other stable clones, capable of effectively propagating viruses defective for the E4 region, and highly inducible by a non-steroid compound have also been prepared. These clones were obtained by co-transfection of 293 cells with the plasmid pJY2 and by a plasmid expressing an artificial transactivator composed of a transactivator region (VP16), of the region which binds DNA from the glucocorticoid receptor, and of a C-terminal truncated part of the progesterone receptor, such so that this hybrid receptor is capable of transactivating the GRES promoter in the presence of RU486 and not of steroids. The clones obtained are effectively capable of effectively propagating E4-defective viruses in the presence of RU486.

 2.3. Ability to propagate adenoviruses deficient for El.

 The capacity of the prepared lines to complement the E1 region was verified after infection with the Ad-RSVBGal adenovirus. This first generation adenovirus (deficient in E1 only) comprises the LacZ gene of E. coli under the control of the LTR promoter of the RSV virus (Stratford-Perricaudet et al., J. Clin. Lnvest. 90 (1992) 626). The cells of clones # 2, # 4 and cells obtained with fY2 were infected with the Ad-RSVBGal virus and viral spread was observed for each clone.

 These results show that the capacity of the cells to transcomplement the E1 region was not affected by the additional introduction of the distal part of the E4 region (clone # 2, pJY2 cells) or of the complete M region (clone # 4).

 2.4. Analysis in Southem. Northern blot and RT-PCR to verify the integration of a functional E4 unit in the genome.

The cells of clones # 2 and # 4 were analyzed in Southern blot to verify the expression of the viral proteins. More specifically, the analysis in
Southern blotting (analysis of genomic DNA hybridizing with a radioactive probe originating from the adenoviral region M) was carried out according to the protocol described by
Maniatis et al. For this purpose, the genomic DNA of cells 293 and # 2 was prepared.

2 g of this DNA were used as a template in a PCR reaction carried out in the presence of Taq polymerase, oligo 1 of sequence SEQ ID n "l (corresponding to nucleotides 52 to 71 of the promoter MMTV) and oligo 2 of sequence SEQ ID No. 2 (corresponding to positions 32921-32940 of the Ad5 genome). These oligo amplify a 2617 bp fragment of the plasmid pORF6Gen.

The amplification was carried out under the following conditions: denaturation at 940C for 5 min, 30 cycles of amplification by denaturation at 94 "C for 1 min, hybridization at 60" C for 2 min, and extension at 70 "C for 3 min, the extension during the last cycle being prolonged for 10 min The amplification products were then analyzed by SDS 1% agarose electrophoresis and identified in
Southern blotting and hybridization with a labeled probe covering the region (ORF6 +
ORF7) of the adenovirus or the MMTV region.

The analysis in Northern Blot and RT-PCR (analysis of the cellular RNAs of clones 2 and 4 hybridizing with a radioactive probe originating from the adenoviral E4 region) was carried out according to the protocol described by Maniatis et al., The polyadenylated cellular RNAs having prepared according to the protocol described by RE Farrell
Jr. "RNA isolation strategies". in: RNA Methodologies; a Laboratory Guide for
Isolation and Characterization. Academic Press Inc. (San Diego, CA, USA). p4692). For RT-PCR, 500 ng of the polyA + RNAs were treated with 0.5 unit of
DNAse I then subjected to reverse transcription with an oligo primer (dT). One tenth of the single-stranded cDNA preparation thus obtained was used as template in a PCR reaction carried out using oligo 2 (SEQ ID n "2) and oligo 3 (SED ID ne3), corresponding to nucleotides 227-246 relative to the cap site of the MMTV promoter (see FIG. 4). These oligo were constructed to amplify a 1255 bp fragment of the ORF6 non-spliced mRNA and a 545 bp fragment of ORF6 / 7 spliced mRNA The amplification products were analyzed in 1% SDS agarose gel and identified by Southern blot and probe hybridization (ORF6 + ORF7) marked.

 These analyzes made it possible to show that these 2 clones have their respective functional E4 unit integrated at the rate of a few copies per cell. In addition, these studies demonstrate that these two clones express the protein of the adenovirus fiber after infection with the deletion mutants Ad5d11004, Ad5dllO11 and Ad5dl1014 (Figure 5). This protein is a late protein of the replicative and infectious cycle of the adenovirus, the synthesis of which involves the expression of E4. The presence of this protein in cells infected with E4- mutants confirms that these cells indeed express functional E4 activity.

Southern blot analyzes more particularly indicate that clone # 2 contains a copy of the MMTV- cassette (ORF6 + 0RF7) integrated into its genome. The integrity of this cassette has also been demonstrated by amplification by means of oligos 1 and 2 which generates an expected 2.6 Kb fragment, which can be specifically detected by a radiolabelled probe corresponding to the unit (ORF6 + ORF7) or to the promoter MMTV (Figure 4). The occurrence of correct alternative splicing in the cells of the invention has also been demonstrated by RT
PCR. Thus 2 main signals were detected specifically with the radiolabelled probe (ORF6 + ORF7) in the uninfected clone # 2, cultured in the presence of dexamethazone (inducing conditions). The most important signal is a fragment of approximately 1.3 kb , size which corresponds perfectly to a non-spliced product derived from ORF6 / ORF7. The other signal is a fragment of about 0.6 kb, size in agreement with the excision (during splicing) of the intron of 712 nucleotides generating the messenger.
ORF6 / 7. These results clearly show that a correct alternative splicing occurs in the cells of the invention, and that the two products ORF6 and ORF6 / 7 of the region
E4 are well expressed in these cells.

The ability of the cells of the invention to express a functional product of the ORF6 region has also been demonstrated by immunodetection of the fiber protein. The results obtained show that the 293 cells infected with the adenovirus
Ad5 dl1007 does not produce fibers. On the contrary, a fiber-specific signal is detected in the cells of the invention (clone # 2 in particular) after infection by this mutant, and not in the other non-infected cells. The presence of the fiber has also been demonstrated in the cells of the invention infected with the mutants dl808, dl1004 (ORF1 +), dIlOîl or dl 1014 (ORF4 +) in the presence of dexamethazone.

2.5. Beach formation
This analysis clearly shows the particularly advantageous properties of the lines according to the invention. Indeed, while the two clones (clone # 2 and clone # 4) are capable of transcomplementing the E4 region and of propagating with comparable efficiency the mutants Ad2d1808 or Ad5d11004 for example, they present a very significant difference as regards the formation of virus plaques after infection with the mutants Ad2d1808, Ad5dl1004, Ad5d11007, Ad5dllO11 or Ad5d11014.

 The ability to form virus patches is an essential property of production lines. It is indeed under this condition that recombinant virus clones can be isolated, then amplified and purified. The results obtained clearly show that the formation of virus plaques is always observed with the clone # 2, while this rarely occurs with the clone # 4. These results clearly demonstrate the very superior properties of the lines of the invention in which only one particular functional unit of the E4 region is integrated.

2.6. Regulated expression of E4 activity
Another advantageous property of the # 2 clone according to the invention resides in the regulated and inducible character of the expression of the E4 activity. Thus, the results obtained show that the formation of virus plaques is observed only in the presence of dexamethazone. Likewise, in clone # 2, the expression of the adenovirus fiber protein after infection with the mutant Ad5dll007 is significantly increased under the induction conditions (FIG. 6). The same results were obtained with the mutants Ad5dl808, Ad5dl1004, Ad5dllO11 and Ad5dll0l4. On the other hand, the expression of the E4 activity in the clone # 4 is constitutive.

 All of these results clearly demonstrate the advantages of the cell lines of the invention in which only one particular functional unit of the E4 region is integrated. These advantages reside in particular in the capacity to form plaques of virus and to allow the amplification of the defective viruses in liquid medium. These advantages are also in the regulated character of the expression of the E4 activity, unlike the lines in which larger functional units of E4 are present.

Example 3 Production of Defective Viruses for the E1 and E4 Functions
This example describes the use of cell lines according to the invention for the production of deficient recombinant viruses in the El and E4 regions. These adenoviruses were produced by homologous recombination, after co-transfection, in the cells of the invention, of two DNA fragments, one bringing the left part of the genome of the recombinant virus (having a deletion in the E1 region) , the other bringing the right part of the genome of the recombinant virus (having a deletion in the M region).

More specifically, the 293M cells (clone # 2 and # 4) were cotransfected with 10 mg of DNA from the Ad-RSVBGal virus (Stratford-Perricaudet et al.) Digested with
Srfl (or 5 mg of DNA of the plasmid used for the construction of this virus and digested with Xmnl), and 10 mg of the DNA of the virus providing the functional deletion of the E4 region (for example Ad2dl808, Ad5dl1004, Ad5dl1007 or Ad5dl1014) digested with the enzyme Clal. After the cytopathic effect has appeared, the viruses are purified by at least two consecutive solid spreading cycles to form plaques on clone 2. The plaques corresponding to the infection of the virus sought (DNA analysis demonstrating the double deletion E1 and E4) are then amplified by consecutive infection cycles. High titer stocks are prepared by purification on a cesium chloride gradient. Viruses are stored at -800C according to conventional techniques of those skilled in the art.

 In addition to the ability of clone 2 to make viral ranges, it allows propagation in a liquid medium which is particularly effective for the AD5dl1014 virus (E1 + E4- but ORF4 +) or for the E1-E4- virus constructed from the dl1014 virus.

 On the other hand, clone 4 obtained after transfection of the plasmid pE4Gen is not very efficient in making plaques because it is difficult to maintain the cell confluence for a time long enough for the viral lysis plaques to be easily identifiable (and especially if the recombinant virus sought does not code for bgalactosidase).

 An alternative production method is based on the clonal construction of the viruses according to the invention. More particularly, according to this method, the lvE1hE4 adenoviruses are produced by homologous double-recombination in vivo after cotransfection of 3 overlapping DNA fragments, each providing a part of the virus genome.

More particularly, the following 3 overlapping fragments, derived from the AdRSVI3gal and Ad dl1014 genomes, were purified by electroelution (Figure 7):
i) Fragment I: This fragment is a NarI fragment of 6.8 kb coding for I3gal corresponding to the left part Ĕl) of the genome of AdRSVgal. Its contamination by an uncut (and therefore replicative) AdRSVssgal genome is highly improbable because complete digestion with NarI generates this fragment among 25 others ranging from 26 nucleotides to 3.8 kb.

 ii) Fragment II: This fragment is a 9.4 kb DraI fragment also derived from the genome of AdRSVgal, and which overlaps with fragment I on 1509 nucelotides (cf. FIG. 7). Contamination of this fragment with an infectious genome is also impossible since this fragment has been purified from 10 additional fragments of size between 494 nucleotides and 4.8 kb, after total digestion with DraI and Afl II.

 iii) Fragment III: This fragment is a 21.3 kb NsiI fragment derived from the genome of Ad5 d101014. It overlaps fragment II on 1652 nucleotides (Figure 7).

This fragment provides the right part of the genome of the recombinant virus, containing the modified E4 region (# E4, ORF4 +). Its contamination is once again more than improbable since it was purified after complete digestion by NsiI generating 7 fragments of size between 178 nucleotides and 4 kb.

The purified fragments were co-transfected into clone # 2 cells according to the protocol described for 293 cells, in the presence of 1 FM of dexamethazone in the medium (added every 4 days for 3 weeks). At the end of this culture, the cells were harvested, frozen and thawed 3 times in an ice / ethanol bath, then centrifuged at 3000 g for 20 min. The cell lysate was then added to a fresh culture of clone # 2 cells (also designated IGRP2) in the presence of dexamethazone (1 M). After 5 days, a cytopathic effect was observed, demonstrating the production of viruses. A stock of this recombinant virus AdhE1, AFI,
ORF4 + was obtained after gradual amplification of the mixture inducing the cytopathic effect on 100 10 cm dishes containing clone # 2 cells at under confluence, in the presence of 1> M dexamethazone. After purification on a cesium chloride gradient and dialysis at 4 ° C., the viral stock was titrated on monolayers of clone # 2 cells supplemented with dexamethazone (1> M), before staining in vitro with X-Gal. As long as all the plaques are positive, the titer can be expressed either in pfu / ml or in viral plaque expressing the frugal. According to this procedure, a stock of 1010 pfu was prepared. The absence of RCA in this stock was then checked by restriction and southern analyzes. For this, the viral DNA of a recombinant from the stock was prepared according to the Challberg technique (Virology 114 (1981) 196). 2> g of this DNA were subjected to a restriction analysis and 1 TB agarose gel. The fragments were transferred to a Hybond-N membrane (Amersham) and hybridized with a radioactive probe corresponding to the ITRs of the adenovirus to specifically detect the fragments located at the ends of the viral genome.

Restriction analysis with the enzymes SmaI, AflH or StuI gave the expected profiles, for preparations not contaminated with E1 + or
E4 + as evidenced by the relative stoichiometry of the different restriction fragments.

Southern analysis after transfer to membranes shows that digestion with StuI generates only 2 fragments hybridizing with the ITR probe: One of these fragments has a mobility corresponding to that of the 1125 bp fragment of AdRSVgal coding for (3gal, l another migrates, such as the 2673 bp StuI fragment of Ad5d101014 carrying the E4 deletion. Prolonged exposure of the autoradiogram does not reveal any additional band having a size corresponding to the E1 + (3158 bp) or E4 + fragment (3980 bp). a fragment corresponding in size (3267 bp) to the introduction of the functional E4 unit (ORF4 + ORF6 +
ORF7) in the recombinant genome was not detected, demonstrating that there was no double recombination event during production between the viral genome and the E4 unit integrated into the cell. These results therefore demonstrate that the cells of the invention can be used to efficiently produce batches of virus E1, hE4 devoid of RCA.

SEQUENCES LIST
SEO ID N01 (oligo 1)
AAGCAGCCAAGGGGTTGTTT
SEO ID N02 (oligo 2)
ACCCTAGTATTCAACCTGCC
SEO ID N03 (oligo 3)
ATCATCACAAGAGCGGAACG
SEO ID N04 CATCCTCTTA CACTTTTTCA TACATTGCCC AAGAATAAAG AATCGTTTGT GTTATGTTTC 60
PolyA add site de E4 AACGTGTTTA TTTTTCAATT GCAGAAAATT TCAAGTCATT TTTCATTCAG TAGTATAGCC 120
CCACCACCAC ATAGCTTATA CAGATCACCG TACCTTAATC AAACTCACAG AACCCTAGTA 180
stop ORF7
TTCAACCTGC CACCTCCCTC CCAACACACA GAGTACACAG TCCTTTCTCC CCGGCTGGCC 240
TTAAAAAGCA TCATATCATG GGTAACAGAC ATATTCTTAG GTGTTATATT CCACACGGTT 300
d1808 TCCTGTCGAG CCAAACGCTC ATCAGTGATA TTAATAAACT CCCCGGGCAG CTCACTTAAG 360
> d11011,1014,1004
TTCATGTCGC TGTCCAGCTG CTGAGCCACA GGCTGCTGTC CAACTTGCGG TTGCTTAACG 420
GGCGGCGAAG GAGAAGTCCA CGCCTACATG GGCCTAGAGT CATAATCGTG CATCAGGATA 480
stop ORF6
GGGCGGTGGT GCTGCAGCAG CGCGCGAATA AACTGCTGCC GCCGCCGCTC CGTCCTGCAG 540
GAATACAACA TGGCAGTGGT CTCCTCAGCG ATGATTCGCA CCCCCCGCAG CATAAGGCGC 600
CTTGTCCTCC GGGCACAGCA GCGCACCCTG ATCTCACTTA AATCAGCACA GTAACTGCAG 660
CACAGCACCA CAATATTGTT CAAAATCCCA CAGTGCAAGG CGCTGTATCC AAAGCTCATG 720
> d11007
GCGGGGACCA CAGAACCCAC CTGGCCATCA TACCACAAGC GCAGGTAGAT TAAGTGGCGA 780
CCCCTCATAA ACACGCTGGA CATAAACATT ACCTCTTTTG GCATGTTGTA ATTCACCACC 840
TCCCGGTACC ATATAAACCT CTGATTAAAC ATGGCGCCAT CCACCACCAT CCTAAACCAG 900 CTGGCCAAAA CCTGCCCGCC GGCTATACAC TGCAGGGAAC CGGGACTGGA ACAATGACAG 960
d11014 <TGGAGAGCCC AGGACTCGTA ACCATGGATC ATCATGCTCG TCATGATATC AATGTTGGCA 1020
CAACACAGGC ACACGTGCAT ACACTTCCTC AGGATTACAA GCTCCTCCCG CGTTAGAACC 1080
ATATCCCAGG GAACAACCCA TTCCTGAATC AGCGTAAATC CCACACTGCA GGGAAGACCT 1140
CGCACGTAAC TCACGTTGTG CATTGTCAAA GTGTTACATT CGGGCAGCAG CGGATGATCC 1200 TCCAGTATGG TAGCGCGGGT TTCTGTCTCA AAAGGAGGTA GACGATCCCT ACTGTACGGA 1260
Stop ORF4
GTGCGCCGAG ACAACCGAGA TCGTGTTGGT CGTAGTCTCA TGCCAAATGG AACGCCGGAC 1320 GTAGTCATAT TTCCTGAAGC AAAACCAGGT GCGGGCGTGA CAAACAGATC TGCGTCTCCG 1380
ATG ORF6
GTCTCGCCGC TTAGATCGCT CTGTGTAGTA GTTGTAGTAT ATCCACTCTC TCAAAGCATC 1440
CAGGCGCCCC CTGGCTTCGG GTTCTATGTA AACTCCTTCA TGCGCCGCTG CCCTGATAAC 1500
ATCCACCACC GCAGAATAAG CCACACCCAG CCAACCTACA CATTCGTTCT GCGAGTCACA 1560
CACGGGAGGA GCGGGAAGAG CTGGAAGAAC CATGTTTTTT TTTTTATTCC AAAAGATTAT 1620
ATG ORF4 Stop ORF3
CCAAAACCTC AAAATGAAGA TCTATTAAGT GAACGCGCTC CCCTCCGGTG GCGTGGTCAA 1680
ACTCTACAGC CAAAGAACAG ATAATGGCAT TTGTAAGATG TTGCACAATG GCTTCCAAAA 1740
GGCAAACGGC CCTCACGTCC AAGTGGACGT AAAGGCTAAA CCCTTCAGGG TGAATCTCCT 1800
CTATAAACAT TCCAGCACCT TCAACCATGC CCAAATAATT CTCATCTCGC CACCTTCTCA 1860
ATATATCTCT AAGCAAATCC CGAATATTAA CTCCGGCCAT TGTAAAAATC TGCTCCAGAG 1920
CGCCCTCCAC CTTCAGCCTC AAGCAGCGAA TCATGATTGC AAAAATTCAG GTTCCTCACA 1980
Stop ORF2 ATG ORF3
GACCTGTATA AGATTCAAAA GCGGAACATT AACAAAAATA TCGCGATCCC GTAGGTCCCT 2040
TCGCAGGGCC AGCTGAACAT AATCGTGCAG GTCTGCACGG ACCAGCGCGG CCACTTCCCC 2100
GCCAGGAACC ATGACAAAAG AACCCACACT GATTATGACA CGCATACTCG GAGCTATGCT 2160 AACCAGCGTA GCCCCGATGT AAGCTTGTTG CATGGGCGGC GATATAAAAT GCAAGGTGCT 2220
GCTCAAAAAA TCAGGCAAAG CCTCGCGCAA AAAAGAAAGC ACATCGTAGT CATGCTCATG 2280
d1808 <CAGATAAAGG CAGGTAAGCT CCGGAACCAC CACAGAAAAA GACACCATTT TTCTCTCAAA 2340
d11004 <
CATGTCTGCG GGTTTCTGCA TAAACACAAA ATAAAATAAC AAAAAAACAT TTAAACATTA 2400
ATG ORF2 Stop ORF1
GAAGCCTGTC TTACAACAGG AAAAACAACC CTTATAAGCA TAAGACGGAC TACGGCCATG 2460
CCGGCGTGAC CGTAAAAAAA CTGGTCACCG TGATTAAAAA GCACCACCGA CAGCTCCTCG 2520
GTCATGTCCG GAGTCATAAT GTAAGACTCG GTAAACACAT CAGGTTGATT CACATCGGTC 2580
AGTGCTAAAA AGCGACCGAA ATAGCCCGGG GGAATACATA CCCGCAGGCG TAGAGACAAC 2640
d11007,1011,1014 <
ATTACAGCCC CCATAGGAGG TATAACAAAA TTAATAGGAG AGAAAAACAC ATAAACACCT 2700
GAAAAACCCT CCTGCCTAGG CAAAATAGCA CCCTCCCGCT CCAGAACAAC ATACAGCGCT 2760
TCCACAGCGG CAGCCATAAC AGTCAGCCTT ACCAGTAAAA AAGAAAACCT ATTAAAAAAA 2820
CACCACTCGA CACGGCACCA GCTCAATCAG TCACAGTGTA AAAAAGGGCC AAGTGCAGAG 2880
+1 RNA E4 <
CGAGTATATA TAGGACTAAA AAATGACGTA ACGGTTAAAG TCCACAAAAA ACACCCAGAA 2940
AACCGCACGC GAACCTACGC CCAGAAACGA AAGCCAAAAA ACCCACAACT TCCTCAAATC 3000
GTCACTTCCG TTTTCCCACG TTACGTCACT TCCCATTTTA AGAAAACTAC AATTCCCAAC 3060
ACATACAAGT TACTCCGCCC TAAAACCTAC GTCACCCGCC CCGTTCCCAC GCCCCGCGCC 3120
<ITR right
ACGTCACAAA CTCCACCCCC TCATTATCAT ATTGGCTTCA ATCCAAAATA AGGTATATTA 3180
TTGATGATG 3189

Claims (30)

 1. Cell usable for the production of defective adenoviruses characterized in that it comprises, inserted into its genome, part of the E4 region of an adenovirus genome carrying the reading phase ORF6 under the control of a functional promoter .  2. Cell according to claim 1 characterized in that the part of the region E4 includes the reading phases ORF6 and ORF6 / 7.  3. Cell according to claim 1 or 2 characterized in that the part of the E4 region comes from a genome of human adenovirus of group C.  4. Cell according to claim 3 characterized in that the E4 region is derived from the genome of an Ad2 or Ad5 adenovirus.  5. Cell according to one of the preceding claims, characterized in that the promoter is an inducible promoter.  6. Cell according to claim 5 characterized in that the promoter is chosen from the MMTV promoter and its derivatives.  7. Cell according to one of the preceding claims, characterized in that it derives from a cell which transcomplements for the El region.  8. Cell according to claim 7 characterized in that it derives from the cell line 293.  9. Cell according to one of claims 1 to 6 characterized in that it is derived from KB, Hela, MDCK, Véro or gmDBP6 cells.  10. Cell according to one of claims 1 to 6 characterized in that it derives from a culture of primary cells.  11. Cell usable for the production of defective adenoviruses characterized in that it comprises, inserted into its genome, a BglII-BglII fragment corresponding to nucleotides 34115-32490 of the Ad5 genome.  12. Cell according to claim 11 characterized in that it is a cell of line 293.  13. Cell according to claim 1 1 or 12 characterized in that it is a cell of the line 293 transformed by the plasmid pORF6Gen.  14. Cell usable for the production of defective adenoviruses characterized in that it comprises, inserted into its genome, a BglII-PvuII fragment corresponding to nucleotides 34115-33126 of the Ad5 genome.  15. Plasmid comprising a part of the E4 region of an adenovirus genome carrying the ORF6 reading phase under the control of an inducible promoter.  16. Plasmid according to claim 15 characterized in that the part of the E4 region of the adenovirus genome carries the reading phases ORF6 and ORF6 / 7.  17. Plasmid according to claim 16 characterized in that it is the plasmid pORF6Gen.  18. Use of a cell according to one of claims 1 to 14 for the production of recombinant adenoviruses defective at least for the E4 region.  19. Method for producing defective recombinant adenoviruses at least for the E4 region, characterized in that a cell culture according to one of claims 1 to 14 is transformed with one or more plasmids providing the different regions of the genome of said adenovirus defective recombinant and then the viruses produced are harvested.  20. The method of claim 19 for the production of recombinant adenoviruses defective for the El and E4 regions.  21. The method of claim 19 or 20 characterized in that the cell culture is a cell culture according to one of claims 1 1 to 14.  22. Stock of purified defective recombinant adenovirus obtained according to the method of claims 19 to 21.  23. Defective recombinant adenovirus dE1, ORF3-, ORF6- comprising a deletion of all or part of the E1 region and nucleotides 34801-34329 and 3411533126 of the M region.  24. Defective recombinant adenovirus / vE1, AE4,0RF1 + comprising a deletion of all or part of the E1 region and a deletion of the E4 region with the exception of the reading phase ORF1.  25. Defective recombinant adenovirus according to claim 24 characterized in that it comprises a deletion in the E1 region and a deletion of a fragment whose 5 ′ end is included in the reading phase ORF7 and whose 3 ′ end is located in the reading phase ORF2.  26. Defective recombinant adenovirus according to claim 25 characterized in that it comprises a deletion in the E4 region covering nucleotides 33093 to 35053.  27. Defective recombinant adenovirus hE1, AE4,0RF4 + comprising a deletion of all or part of the E1 region and a deletion of the E4 region with the exception of the reading phase ORF4.  28. Defective recombinant adenovirus according to claim 27 characterized in that it comprises a deletion in the El region, a deletion of a fragment whose 5 'end is included in the reading phase ORF7 and whose 3' end is located in the reading phase ORF6, and a deletion of a fragment whose 5 'end is included in the reading phase ORF3 and whose 3' end is located in the reading phase ORF1 or in the promoter region from E4.  29. Defective recombinant adenovirus according to claim 28 characterized in that it comprises a deletion in the El region, a deletion covering nucleotides 33093 (SmaI) -33695 and a deletion covering nucleotides 34634 35355 (5maI).  30. Defective recombinant adenovirus hE1, AE4 comprising a deletion of all or part of the E1 region and a deletion covering the entire E4 region, chosen from the following deletions: nucleotides 32720-35835, or 33466-35355 or 33093-35355.