FR2743818A1 - DNA CONSTRUCTS AND EXPRESSION VECTORS DERIVED FROM ADENOVIRUS VA I RNA GENE - Google Patents

Abstract

DNA constructs including sequences derived from the adenovirus VA RNA I gene, and recombinant vectors including said constructs, are disclosed. Said constructs and vectors are useful for increasing the production of proteins of interest in host cells.

Description

 The invention relates to expression vectors derived from adenoviruses, to obtaining them, and to their use for increasing the level of expression of genes of interest.

 Adenoviruses are linear double-stranded DNA viruses; their genome, whose complete sequence of certain types is known [eg CHROBOEZEK et al.

Virology, 186, 280-285 (1992)], comprises approximately 36,000 bp and has repeated inverted sequences (ITR) at its ends.

Host cell infection by an adenovirus comprises two phases
an early phase during which 4 transcription units, called E1, E2, E3 and E4, are expressed, and in which viral DNA replication factors are synthesized in particular, as well as proteins regulating the expression of certain viral and cellular genes; among the genes transcribed during the early phase, mention will in particular be made of the El genes (Ela, and
Elb) which are located at the left end (5 'end) of the genome of the adenovirus, and which are essential for viral replication
a late phase, during which the late genes L1 to L5 are expressed; the genes coding for the virion structure proteins are transcribed under the control of the strong MLP promoter (Major Late
Promoter).

 Adenoviruses can be functional vectors in cells for the expression of genes of interest. Their use has thus been advocated for the production of recombinant live vaccines, for gene therapy, and also for the production of heterologous proteins in mammalian cell cultures. Numerous expression systems using adenoviruses have thus been described.

To obtain these vectors, the heterologous DNA sequences that it is desired to express are inserted in place of genomic sequences of the adenovirus: sequences located in the E1 (E1A and E1B) E3 regions and
E4 have in particular been used for this purpose.

 When a heterologous sequence is inserted into E3, which is not an essential region for replication, the adenoviruses can be replicated in any permissive cell line. Permissive cell lines for adenoviruses are of human or animal origin (mammals, birds, fish).

 On the other hand, if a heterologous sequence is inserted in the E1 region, the adenoviruses obtained are incapable of replication in the usual host cells, where they remain blocked in the early phase; such adenoviruses, so-called "defective", are devoid of pathogenic effects, therefore they are particularly advantageous for use in gene therapy and for vaccine use.

Replication of defective adenoviruses for
El should be performed on cells such as 293 cells [GRAHAM et al. J. Gen. Virol., Vol. 36, p.

59-72 (1977)] these cells are derived from a human embryonic kidney line, in the genome of which is integrated the left part of the genome of the human adenovirus Ad5; they complement in trans for the El region and allow the replication of the defective viruses for this region El.

 Generally, the adenoviruses used as expression vectors comprise at least: the ITR sequences, located at each end of the viral genome (the left ITR sequence of Ad5 comprises, for example, nucleotides 1 to 103 of the genome) a packaging sequence, ( called Psi sequence), located between the left ITR and the El region, at the same location as the activating signals of the transcription of the E1A gene (Elt I and II). They also include those genes essential for the replication of adenovirus that are not provided by the host cell line and / or by another adenovirus used as an auxiliary.

 They further comprise other sequences, the nature of which varies according to the use that is envisaged for the vector, and which are adenovirus sequences and / or heterologous sequences.

 These other sequences comprise in particular, in addition to the gene of interest which it is desired to express, signals for regulating the expression of said gene, such as promoters.

A wide variety of promoters can be used to control the expression of heterologous genes cloned into an adenovirus. They may be tissue-specific or non-inducible cell promoters, viral promoters of adenovirus or other viruses, synthetic promoters, etc.
A large variety of recombinant adenoviruses, designed for various uses, have thus been obtained; by way of illustration, the vectors described in the PCT International Applications published under the numbers WO 94/08026 of April 14, 1995, in the name of RHONE-POULENC
RORER SA et al .; WO 95/02697 of January 26, 1995, in the name of RHONE-POULENC RORER SA; WO 95/14101 of May 26, 1995, in the name of RHONE-POULENC RORER SA et al .; WO 95/16772 of June 22, 1995, in the name of CORNELL RESEARCH FOUNDATION, INC.

US.

 During the early phase, or during the late phase, most of the adenovirus genome is transcribed by RNA polymerase II of the host cell.

 However, a short region of the genome between nucleotides 10160 and 10574 contains two genes (VA I and VA II), which are transcribed mostly during the late phase of infection, by RNA polymerase III to give rise to RNAs called VA RNA (for "Associated Virus"), which accumulate in the cell in large quantities. The genes of the VA RNAs comprise intragenic promoter sequences, recognized by the RNA polymerase III, and which are denominated respectively box A and box B.

 In the context of the following description, the term "endogenous" VA RNA will be referred to as VA I or VA II RNA resulting from the transcription of an unmodified VA I or VA II RNA gene, which is located in its natural transcriptional context, ie its usual position in the adenovirus genome, and which is flanked by the sequences that surround it naturally. On the other hand, VA VA "exogenous" will be designated VA I or VA II RNA resulting from the transcription of a modified gene, and / or located outside of its natural transcription context.

 The most represented VA RNA species is VAI RNA which is synthesized very actively, and accumulates during the late phase to an amount greater than 10 molecules per cell. The VA II RNA is synthesized in an amount approximately 10 times less.

 It has been shown that, in adenovirus-infected cells, VA I RNA was required to enhance mRNA translation during the late phase.

VA RNA I acts essentially by blocking the activation of the PKR enzyme (also called DAI), [For review, cf. MATHEWS MB, Enzyme, 44, p. 250-264, (1990); MATHEWS and SHENK, J. Virol., 65, p. 5657-5662, (1991)]
This PKR enzyme is associated with the ribosome, in a complex that combines all the factors of translation. Its synthesis is induced by interferon, and the enzyme is normally activated by double-stranded RNA (dsRNA). This activation results in autophosphorylation of the enzyme, followed by phosphorylation of the translation initiation factor eIF-2 (Eukaryotic Initiation Factor 2). The phosphorylated eIF-2 factor can not be recycled, which leads to an inhibition of the translation initiation of the mRNAs.

 Blockade of PKR activity by endogenous VA I RNA is exerted after the transition to the late phase of the viral cycle, and reverses inhibition of translation of late viral mRNAs.

 It has also been observed in transient expression experiments that RNA VA I could stimulate the expression of reporter genes introduced into cells in the absence of adenovirus infection. It is not necessary that other viral sequences are present on the construct bearing the reporter gene, for this effect to occur.

Thus in 1985, SVENSSON and AKUSJÂRVI [EMBO J. 4, p. 957-964] have demonstrated that the increase in expression efficiency is not limited to viral mRNAs. In particular, these authors cotransfected cells with a plasmid carrying the gene.
CAT, and a plasmid carrying the VA I region. They showed under these conditions a significant stimulation (6.5x) in the 293 cells, which complement in trans for the E1A gene, but not in the HeLa and CV-1 cells. (about 2x). According to these authors, these results are due to poor gene transcription efficiency
VA I in these last two cell types.

 KAUFMANN [Proc. Natl. Acad. Sci. USA, 82, p.

689-693, (1985)] also showed increased expression of a reporter gene by the VA I gene provided in cis or trans. According to this author, this effect is especially marked for reporter genes placed under the control of the MLP and its three untranslated leader sequences located 5 'of the gene.

VA RNA I has a complex structure. The structure of the VA I RNA of Ad2 adenovirus is shown in Figure 1 [from the MA and MA publication
THEWS J. Virol., 67, 6605-6617 (1993)]. This structure comprises a terminal region (nucleotides 0 to 18 forming an imperfect duplex with nucleotides 138 to 160) and an apical region (nucleotides 42 to 90, also forming a duplex structure), which are separated by a central domain (nucleotides 19 at 41 and 91 to 137).

Various studies have made it possible to describe the VA I-PKR interaction mechanism and the sites involved [MELLITS and MATHEWS, EMBO J. 7, p. 2849-2859, (1988)
Mellits et al., Cell. 61, p. 843-852, (1990); Mellits et al., J. Virol., 66, p. 2360-2377, (1992); MA and MATHEWS, 67, p. 6605-6617, (1993), PE'ERY et al., J. Virol. 67, p. 3534-3543, (1993)].

 The study of deletion mutants showed that the end of the apical duplex (nucleotides 54-77 in Ad2) of VA I RNA intervenes in the first binding phase between VA I and PKR, without activation of PKR. .

In a second time, an interaction is created between the central domain of VA I and PKR, which results in the activation of pKR.

 It has been shown that mutations in VA I RNA that alter the apical end without destroying its secondary structure do not destroy its function. In contrast, mutations that affect the structure of the central domain inactivate the function of VA RNA I.

 Although it has been observed that VA RNA can stimulate gene expression by increasing mRNA translation, this property has so far not found applications in the use of adenovirus vectors the fact that this stimulation only occurs in the late phase of the replication cycle (when the level of endogenous VA I RNA is sufficient) removed much of its potential practical interest, particularly in the case of the adenovirus vectors used. for gene therapy or vaccination, which are blocked in the early phase of the infection.

 On the other hand, it has not been proposed before to seek to increase the efficiency level of the VA VA I.

 Now, the inventors have now obtained recombinant DNA constructs that make it possible to express the adenovirus VA I RNA at a high level during the early phase of the viral infection. They also obtained modified VA I RNAs, which when introduced into the same cell as a heterologous gene coding for a protein of interest make it possible to increase the synthesis of said protein.

The subject of the present invention is a recombinant DNA construct making it possible to obtain a functional expression cassette in mammalian cells, and which comprises at least the following elements in the 5'-3 'direction:
an S1 DNA sequence comprising at least block A and block B of a promoter recognized by polymerase III
an S2 sequence whose transcription product can form a structure similar to that of the apical duplex end of an adenovirus VA I RNA;
an S3 DNA sequence,
S1 S2 and S3 being fused to form a sequence different from the natural sequence of the gene of a
VA I rNA of adenovirus.

 S1 may for example be the adenovirus VA RNA gene promoter, the transfer RNA gene promoter, or the EBER RNA gene promoter of the Epstein-Barr virus.

 The sequence S2 may, for example, comprise a sequence whose transcript consists of nucleotides 54-72 of an adenovirus Ad2 VA1 RNA; however, S2 may also include any other sequence whose transcript may adopt the same structure as that portion of adenovirus VA I RNA.

 The sequence S3 is advantageously chosen so that the transcripts of the recombinant DNA constructs in accordance with the invention are mutants of VA I RNAs in which the central domain of VA I is at least partially deleted or substituted by a different sequence.

 According to a preferred embodiment of the present invention S3 comprises, in place of the sequence of the central domain of VA I, a linker comprising at least one restriction site for cloning a heterologous DNA sequence (VAemp construct). . According to a preferred arrangement of this embodiment, it is a multisite linker.

 According to yet another preferred embodiment of the present invention S3 further comprises a DNA sequence which constitutes a transcription termination signal recognized by the RNA polymerase III.

End-of-transcription signals that can be used to obtain a construct according to the invention are those recognized by the RNA polymerase III, such as, for example, the end-of-transcription signals of transfer RNAs, or well those of ARNs
VA I or VA II of adenovirus, or the end of transcription signal of the EBER I gene of the Epstein-Barr virus.

Constructions according to the invention, called VArib and VAie, comprise respectively
the sequence represented in the attached sequence listing, under the number SEQ ID NO: 1, which contains the sequence of a ribozyme of the mRNA of the CAT gene, and
the sequence represented in the attached sequence listing, under the number SEQ ID NO: 2, which contains an antisense sequence of the AUj mRNA of the Aujeszky's disease virus (immediate early) gene.

 The sequences of constructions VArib and VAie are also represented in FIG.

When recombinant DNA constructs according to the invention are introduced into the same cell as a hotérologue gene coding for a protein of interest, it is possible to obtain, in a manner similar to that observed with the VA I RNAs of wild type, increasing the synthesis of said protein. This effect is unexpected, since the central area of the
VA I was generally considered indispensable for the inhibition of PKR activation.

 In addition, the inventors have observed this increase in the level of expression of the heterologous gene both in cases where the central domain of VA I is substituted by sequences unrelated to the initial functional domain (VArib form), or in the case the deletion of the central domain of VA I (VAemp form) without the insertion of replacement sequences; in the latter case, however, the effect is less intense and only occurs under certain conditions of cotransfection.

 The inventors have furthermore found that, surprisingly, the combination of a transcription activator element by polymerase II with at least block A and block B of a VA I promoter recognized by polymerase III allows to express at a sufficiently high level the wild-type, or recombinant, VA RNA during the early phase of the viral infection. This is of particular interest, insofar as it thus becomes possible to stimulate the expression of heterologous genes, via VA I RNA, during this early phase.

The subject of the present invention is therefore a recombinant DNA construct which comprises the following elements in the 5'-3 'direction.
at least one DNA sequence which constitutes a PolII transcription activator element
a DNA sequence comprising at least block A and block B of a promoter recognized by polymerase III and at least one sequence whose transcription product can form a structure similar to that of the end of the apical duplex of an adenovirus VA I RNA (it is in particular of any sequence whose transcript can adopt the same structure as the nucleotides 54-72 of the gene of a VA I RNA); and
at least one DNA sequence which constitutes an end-of-transcription signal recognized by the RNA polymerase III.

"PolII transcription activator element" is understood to mean a sequence which usually activates transcription by polymerase II. Many activating elements of the PolII transcription are known in themselves; they may be, for example, activating elements of the CMV immediate viral gene or other viral genes, or else activating elements of cellular genes (immunoglobulin, albumin, etc.)
Advantageously, it will be an activating element for the transcription of the adenovirus E1A gene.

The constructs in accordance with the invention, comprising a polymerase II transcription activating element, make it possible to express, in the early phase of the viral infection, both wild type VA I RNAs and VA I-derived RNAs.
According to a preferred embodiment of this provision, a recombinant DNA construct conforming to the Invent ion comprises at least
nucleotides 0 to 352 of the adenovirus
Ad5 or a homologous region of another human or animal adenovirus;
nucleotides 1 to 77 of the VA I gene of Ad2 adenovirus
the signal of end of transcription of the gene
EBER I of the Epstein-Barr virus.

Constructions according to the invention may comprise in particular one of the sequences represented in the attached sequence list under the numbers SEQ
ID NO: 1, and SEQ ID NO: 2.

 The present invention also relates to recombinant vectors comprising a construction according to the invention as defined above.

 These recombinant vectors allow the introduction and the expression of said constructs in the host cells; it may be in particular plasmids, or viruses, and in particular or recombinant adenovirus blocked in the early phase of the cycle (infection).

 According to a preferred embodiment of a vector according to the invention, it is a recombinant adenovirus.

 This recombinant adenovirus can be obtained from any type of adenovirus usually used for obtaining vectors, whether it be a human, animal or mixed adenovirus.

According to a preferred arrangement of this embodiment, said recombinant adenovirus results from the cloning of a construct according to the invention in an adenovirus which already comprises a copy of a VA I gene.
The subject of the present invention is the use of a recombinant DNA construct as defined above, for obtaining vectors making it possible to increase the expression of a gene of interest in a host cell of mammal.

 To increase the expression of a gene of interest in a mammalian host cell, a DNA construct comprising said gene of interest under control of an appropriate promoter is simultaneously introduced and expressed in said host cell. and a DNA construct according to the invention.

The gene of interest whose expression level is desired to be increased can be introduced into the cells in a transient expression plasmid, in a replicative plasmid in the extrachromosomal position (constitutive cell line), in a plasmid capable of integrating to cell chromosomes, or in a recombinant virus, which may be in particular an adenovirus, human, animal, or mixed,
The DNA construct comprising said gene of interest, and the DNA construct according to the invention may be carried by the same vector, or by two different vectors.

 The present invention also encompasses vectors comprising a DNA construct according to the invention, and a DNA construct comprising a gene of interest that is desired to express under the control of a suitable promoter.

 The increase in expression is independent of the sequence of the gene of interest and the nature of the 5 'and 3' regulatory sequences associated with it.

 The inventors have found that the increase in the expression observed with the constructs in accordance with the invention is greater than that observed with endogenous VAI.

 The inventors verified that this increase in expression was manifested for different heterologous genes, varying as well by the promoters used, as by the coding regions, or the untranslated sequences of the messenger RNA, and also in different lines. cellular (HeLa and Vero).

 The constructs according to the present invention may be used in combination with other means for increasing or regulating the level of gene transcription. For example, they may be associated with tissue-specific promoters or with inducible promoters.

 The field of gene or cell therapy by adenovirus vector is therefore a preferred but not unique field of application. The constructs in accordance with the present invention may also be used to obtain vaccines, or for the in vitro production of proteins of interest in mammalian cells.

 The present invention will be better understood with the aid of the additional description which follows, which refers to examples of obtaining vectors in accordance with the invention.

 It should be understood, however, that these examples are given solely by way of illustration of the subject of the invention, of which they in no way constitute a limitation.

CELLS AND VIRUSES USED
Adenoviruses were multiplied and titrated on 293 human embryonic kidney cells.

 Different cells (Vero simian cells, human Hela cells) were also used to measure the expression level of exogenous proteins.

 Hela cells are derived from a line of human epithelial carcinoma; they possess an ElA-like activity, and are therefore capable, with a high multiplicity of infection, of partly complementing the absent E1A gene.

 Vero cells are derived from a monkey strain; they do not allow the replication of the defective viruses for the E1A region.

 All these cells were maintained in DULBECCO modified EAGLE medium, supplemented with 10% fetal calf serum and antibiotics.

Plasmids
The different plasmids were constructed according to standard procedures known to those skilled in the art, such as those described by SAMBROOK et al [Molecular cloning A Laboratory Manual; Second Edition, Cold Spring Harbor Laboratory, 1989].

 The plasmid pMLPluc comprises the luciferase gene preceded by the leader sequences of the late adenovirus mRNAs under the control of the adenovirus MLP promoter.

 Plasmid pCMVcat expresses the CAT gene under the control of the cytomegalovirus immediate early (IE) gene promoter.

 The construction of the plasmids according to the invention expressing sequences derived from VA I is described in more detail in the examples which follow.

CONSTRUCTION OF RECOMBINANT ADENOVIRUSES
Adenoviruses carrying different modified VA-RNAs were constructed by ligation between
1) Plasmids integrating the left ILR of the Ad5 adenovirus, the encapsidation signals, the activating signals of the ElA gene, the modified VA I gene, and
2) the right part of the Ad5 genome digested with ClaI enzyme. This part contains the wild-type gene of the VAI RNA (also hereinafter referred to as VAI endo gene).

 The ligation products were transfected into 293 cells. The lysis plaques were isolated 10 to 15 days later. After amplification, the light DNA was extracted by the HIRT technique [GLUZMAN et al., J. Virology, 45, p. 91-103, (1983)] and the conformity of the construction was verified by restriction analysis. By construction, these adenoviruses therefore have an Ela-, E1B + phenotype.

ASSAYS OF LUCIFERASE AND CAT ACTIVITY
The assay of the CAT activity was performed by an ELISA (BOEHRINGER) test. The luciferase activity assay was performed according to a standard procedure (Kit
Luciferase Assay System; PROMEGA BIOTECH) using a scintillation counter.

EXAMPLE 1 CONSTRUCTION OF PLASMID pVAemp AND VIRUSES
Ad-VAemp.

A pVAemp plasmid was constructed as follows
A plasmid (pMLP-gI) similar to plasmid pMLP10-gD (ELOIT et al., J. Gen. Virol., 71, 2425-2431, 1990) was used. The EcoRI site at position 0 of pMLPgI was removed by digestion, filling of the ends with the Klenow fragment of RNA polymerase II, and religation. The sequences of this plasmid between the SacII site (nucleotide 352) and ClaI site (nucleotide 2498) were deleted. Region 0-352 comprises ITR and encapsidation signals (nucleotides 0-352) of Ad5 virus. These are inseparable from the transcriptional activating signals of the E1A gene (Elt I and II). Downstream of the SacII site have been cloned
the 5 'part of the VA I gene (nucleotides 1 to 77), comprising the two intragenic promoter sequences A and B,
- a polylinker and
the end-of-transcription signals of the gene
EBER I of the Epstein-Barr virus. These sequences (222 bp) were isolated by NsiI cleavage of the plasmid VApIEBER (T. Ragot Origin Unit of Oncogenic Viruses, CNRS,
Villejuif; this plasmid is similar, as regards the region comprising the EBER I sequences, to that described in the publication by VENTURA et al., [Nucl. Acid Res.

21, 14, 3249-3255 (1993)]).

 The plasmid pVAemp is shown schematically in FIG.

Legend of Figure 2
ITR: left inverted terminal sequence of Ad5
Elt I, Elt II: activating signals of the E1A gene
AI to AV: encapsidation signals of adenovirus type 5
TTTT end of transcription signal of EBER I gene of Epstein-Barr virus
The non-circled numbers correspond to the sequence of the Ad5. The figures circled refer to the sequence of the
VA I (nucleotide 1 initiation of transcription).

 The plasmid pVAemp contained in the DH5 strain of E. coli was deposited on January 16, 1996, under number I-1655 with the CNCM (National Collection of Microorganism Cultures) held by INSTITUT PASTEUR, 25 rue du Docteur Roux. , in Paris.

The Ad-VAemp virus was constructed by digesting the plasmid pVAemp with AatII and AccI and ligation with the right fragment of the Ad-gD adenovirus genome (ELOIT et al., J. Gen. Virol., 71, 2425-2431, 1990) digested at ClaI site. The ligation product is transfected into 293 cells, and the recombinant viruses are isolated as described above, in the "Materials and Methods" section.
Methods".

EXAMPLE 2: CONSTRUCTION OF PLASMID n-VArib AND VIRUSES
Ad-VArib
The plasmid p-VArib was constructed by cloning the ribozyme sequence of the mRNA of the CAT gene (shown in FIG. 3, as well as in the attached sequence listing under the number SEQ ID NO: 1). EcoRI-HindIII site of the multi-site linker of pVAemp.

 The Ad-VArib virus was constructed by digesting plasmid p-VArib by NarI-DraI, and ligation of the 1061 bp NarI-DraI fragment with the right fragment of the Ad5 adenovirus genome digested at the ClaI site.

Legend of Figure 3
Bold: sequences inserted into the multi-site linker of pVAemp
Italic characters. sequences or complementary sequences of the primers used to carry out the RT
PCR for the detection of gene expression
Boxes A and B: Intragenic promoter sequences of VA I
Restriction site sequences used for construction are underlined.

 The functionality of the VArib RNA expression vector was verified by RT-PCR (retrotranscription followed by PCR amplification) in HeLa cells infected with Ad-VArib.

 A check was made using the Ad-gD virus as a control. This last virus is defective for the E1A gene, and integrates in the left part, instead of sequences derived from VA I, the gD gene of the pseudorabies virus.

The primers used are as follows (these primers are also indicated in FIG. 3)
Left: 5 'AGCGGGCACTCTTCCGTGGTCTG 3
Right: 5 'AAAACATGCCGACCACCAGGGGT 3'
These primers allow the amplification of all 198 bases of Varib RNA.

 An amplification product of 198 bp is indeed observed for the recombinant Ad-VArib. On the contrary, the Ad-gD virus gives a negative result. A control performed by omitting the retrotranscription phase was negative, which makes it possible to verify that the signal obtained for Ad-VArib does not result from an amplification of the sequences of the viral DNA.

EXAMPLE 3: CONSTRUCTION OF PLASMIDE P-VAie AND VIRUSES
Ad-Vaie
The plasmid p-VAie was constructed by cloning an antisense sequence of Aujeszky's disease virus (immediate early) gene mRNA (shown in FIG. 3, and in the attached sequence listing under the number SEQ ID NO: 2) between the SmaI and HindIII sites of the multi-site linker of pVAemp.

The Ad-VAie virus was constructed by digestion of the plasmid p-VAie by AatII-AccI and ligation of the fragment
AatII-AccI of 1204 bp with the right fragment of the Ad5 adenovirus genome digested at the ClaI site.

EXAMPLE 4: AUGATION OF THE LEVEL OF EXPRESSION OF HETEROLOGOUS GENES BY THE AD-VARIB VIRUS
In a first study, the level of expression of the CAT gene in cells infected with Ad-VArib was quantified. Insofar as it was initially expected that cleavage of CAT mRNA synthesized after infection with Ad-VArib virus was achieved, the following strategy was used a Hela cell line expressing the CAT gene under the control of an inducible promoter. that is, the murine metallothionin (mMT) promoter was constructed, and a hygromycin-resistant cell clone was isolated. Cells of this clone were trypsinized and then infected at a multiplicity of infection of 100 TCID50 / cell, either by Ad-VArib or by Ad
VAemp used as a control.

 Sixteen hours after infection (TO), CAT synthesis was induced by addition of heavy metals (final concentration: 100 μM ZnCl2, 1 μM CdCL2).

 CAT synthesis was monitored over time and compared to that of the same cells in the absence of viral infection. Figure 4 shows the results obtained.

 There is clearly an increase in CAT synthesis level of 12.5x in Ad-VArib infected cells compared to uninfected cells.

Under the same conditions, the Ad-VAemp virus containing only the first 77 nucleotides of VA I causes a synthesis increase of 7.5x.

 In the absence of heavy metal induction, the Ad-VArib and Ad-VAemp viruses respectively increased the level of synthesis by 29x, and by 5x.

 It is therefore apparent that Ad-VArib viruses and, to a lesser extent, Ad-VAemp, are capable of increasing protein synthesis.

EXAMPLE 5: INCREASE IN THE EXPRESSION LEVEL OF HITIROLOGUIS GENES BY THE CONSTRUCTION AVENUE OUTSIDE A
VIRAL CONTEXT.

 To determine the sequences necessary to increase the level of expression of heterologous genes, 2x106 HeLa cells were cotransfected with the plasmid pMLP-luc containing the luciferase gene under the control of the MLP promoter, and the different plasmids pVArib, pVAemp, and pMLPCAT control. 72 hours later, the cells were removed and luciferase activity was quantified.

 The results are shown in Table I below.

TABLE I

<tb><SEP> Plasmids <SEP> Luciferase
<tb><SEP> (pg / 106 <SEP> cells)
<tb> pVArib <SEP> + <SEP> pMLP-luc <SEP> 5000
<tb> pVAemp <SEP> + <SEP> pMLP-luc <SEP> c60 <SEP>
<tb> pMLPCAT <SEP> + <SEP> pMLP-luc <SEP> 1560
<Tb>
These results show a significant increase (3.2x) in the level of synthesis of luciferase by the plasmid pVArib, whereas the plasmid pVAemp induces an inhibitory effect.

EXAMPLE 6 INFLUENCE OF ENDOGENOUS VA I AND
EXOGENOUS SEOUENCES OF VA I ON THE INCREASE IN
PROTEIN SYNTHESIS
The inventors performed comparative tests, using various constructs of different genotypes co-infected with an adenovirus (Ad-MLPluc) defective for the ElA / ElB region, and coding for luciferase under the control of the MLP promoter.

For this experiment, two types of cells were used 293 cells, which allow the replication of defective viruses for the region
E1A (and therefore endogenous VA I expression), and Vero cells, do not allow virus replication
E1A-.

200 to 250,000 Vero cells or 293 cells were either infected with 100 TCIDs0 of Ad-MLP-luc virus or coinfected with 100 TCIDs0 of Ad-MLP-luc virus and 100
TCID50 of one of the following viruses. Ad-GD, Ad-VAemp,
Ad-VAie Ad-VArib. The Ad-gD virus, which lacks exogenous VA I sequences, makes it possible to evaluate the effect induced by endogenous VA I.

 The 293 cells were harvested 24 hours after infection, at a time when the cytopathic effect is complete. Vero cells were harvested 4 days after infection.

 The results obtained are shown in Table II below.

TABLE II

<tb><SEP> Ad- <SEP> Ad- <SEP> Ad- <SEP> Ad
<tb><SEP> Ad- <SEP> MLPluc <SEP> + <SEP> MLPluc <SEP> + <SEP> MLPluc <SEP> + <SEP> MLPluc <SEP> +
<tb><SEP> MLPluc <SEP> Ad-gD <SEP> Ad-VAemp <SEP> Ad-VAie <SEP> Ad-Varib
<tb> VA <SEP> I <SEP> endogenous <SEP> + <SEP> + <SEP> + <SEP> + <SEP> +
<tb> VA <SEP> I <SEP> exogenous <SEP> - <SEP><SEP> - <SEP> + (emp) <SEP> + (ie) <SEP> + (rib)
<tb> Cells <SEP> 293 <SEP> 7560 <SEP> 10160 <SEP> 1260 <SEP> 3400 <SEP> 3600
<tb> Cells <SEP> Vero <SEP><0.05<SEP> 1075 <SEP> 2025 <SEP> 2975 <SEQ> 10450
<Tb>
The + or - signs on the second and third lines of the table indicate the existence, in the transfected cells, endogenous VAI or exogenous VAI (here means by exogenous VA I VA I sequences cloned in the left part of the virus, and which are not in the usual location of the VA I sequences).

 The numbers in the fourth and fifth rows indicate the amount (in ng) of luciferase synthesized for 106 cells.

These results show that
In 293 cells, the presence of the exogenous VA I sequences does not have a positive effect on luciferase synthesis. This can be explained by the fact that the endogenous VA I (in this case that of the Ad-MLP-luc virus), which is expressed mainly in the late phase of the infection, is sufficient to increase the level of translation of
MRNA.

On the contrary, the three viruses Ad-VAemp, Ad
VAie and Ad-VArib appear to have a negative effect (perhaps due to deregulation of the viral cycle stages) on luciferase production.

 In Vero cells, exogenous VA I sequences have a net positive effect on luciferase expression.

 The Ad-VAemp and AD-VAie constructs allow a doubling of luciferase synthesis (1.9 to 2.8x) compared to Ad-gD. Comparison of the results between the control virus Ad-gD and Ad-VArib shows an increase in luciferase synthesis of about 10-fold in favor of the latter.

 It should be noted that the results illustrating Ad-MLP luc + Ad-gD co-infection already show a significant positive effect on luciferase synthesis, although both Ad-MLP-luc and Ad-MLP-gD viruses have a strictly positive effect on luciferase synthesis. the same VA I gene, which is expressed only very weakly in the early phase.

Several hypotheses can explain this effect
- Co-infection by both viruses would lead to better internalization efficiency in the cell: indeed, adenovirus is internalized by a receptor mediated endocytosis mechanism (integrins) that interacts with the penton-base protein .

This mechanism is sufficient to allow the co-internalization of molecules (for example DNA) delivered in association with the adenovirus. It is therefore possible to consider that the internalization of a virion would allow the internalization of other virions not directly linked to the cellular receptor.

- Alternatively, the expression of the E1B gene (which is functional in the Ad-gD, Ad constructs
VArib, Ad-VAemp and Ad-Vay but deleted in the Ad-MLP-luc construct) could increase the early-phase transcription of endogenous VA I of the different viruses involved in co-infection experiments [SOLLERBRANT et al., J. Virol., 67, p. 4195-4204, (1993)]. Protein
E1B would also stabilize the introduced DNA, with an indirect effect on the measured level of expression [HERRMANN and MATHEWS, Mol. Cell. Biol., 9, p. 5412-5423, (1989)].

On the other hand, since the E1B protein has no known activating effect on the MLP, it is unlikely that the transcription of the luciferase gene has been increased [HERRMANN et al., Oncogene, 2, p. 25-35 (1987)].

 - Finally, it is possible that the VA I-RNA is more effective when it is delivered in trans rather than in cis.

EXAMPLE 7: STUDY OF THE INFLUENCE OF THE PROMOTER AND
LEADING SEOUENCES ON INCREASING THE EXPRESSION OF A
GENE IN PRESENCE OF SEQUENCES DERIVED FROM VAI RNA
The experiments reported in Examples 4 to 6 above make it possible to conclude that the effect of increasing the synthesis of proteins does not depend on the coding region since comparable results have been obtained for luciferase and CAT. It has also been investigated whether the effect of increasing protein synthesis was dependent on the promoter controlling transcription of the heterologous gene and / or the presence of untranslated leader sequences in late viral mRNAs.

 The plasmid pCMV-CAT contains the CAT gene under the control of the promoter of the "immediate early" gene (IE) of the cytomegalovirus (and therefore in the absence of the adenovirus leader sequences). 2x106 HeLa cells were cotransfected with the plasmid pCMV-CAT, and one of the plasmids pVArib, pVAemp, or as a control, pMLP-luc.

72 hours later, the cells were removed and luciferase activity was quantified.

The results are shown in the table
III below.

Table III

<tb><SEP><SEP> CAT <SEP> Plasmids (pu / 106 <SEP> cells)
<tb><SEP> pCMV-CAT <SEP> + pVArib <SEP>> 500
<tb><SEP> pCMV-CAT <SEP> + pVAemp <SEP> 185
<tb> pCMV-CAT <SEP> + pCMV-luc <SEP> 65
<Tb>
There is a significant increase (greater than 7.7x) in the level of protein synthesis
CAT by the plasmid pVArib, while the plasmid pVAemp induces a more limited effect (2.8x). These results demonstrate that the effect observed is not dependent on the presence of the MLP promoter or that of the three untranslated leader sequences of the late adenovirus mRNAs.

SEQUENCE LIST
INFORMATION FOR SEQ ID NO: 1:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 194 base pairs
(B) TYPE: nucleotide
(C) NUMBER OF BRINS: simple
(D) CONFIGURATION: linear
(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 1:
GGCACTCTTC CGTGGTCTGG TGGATAAATT CGCAAGGGTA TCATGGCGGA CGACCGGGGT 60
TCGAACCCCG GATCCCCCGG GCAAAATTCG AGCAACTCTG ATGAGTCCGT GAGGACGAAA 120
CTGAAATGGA TCCTCTAGAG TCGACCTGGA GCCCAAGCTT ATCGATTTCG AACCCCTGGT 180 GGTCGGCATG TTTT 194
INFORMATION FOR SEQ ID NO: 2:
(i) CHARACTERISTICS OF THE SEQUENCE:
(A) LENGTH: 217 base pairs
(B) TYPE: nucleotide
(C) NUMBER OF BRINS: simple
(D) CONFIGURATION: linear
(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 2:
GGCACTCTTC CGTGGTCTGG TGGATAAATT CGCAAGGGTA TCATGGCGGA CGACCGGGGT 60 TGGAACCCCG GATCCCCCGA CTGCAGGCCG CGCGCCGGGA GCCCTGGCTG CCGCCGTCGG 120 GGCCGGACGC GATGCCCTCT TCCTCGGCCG GGGCGGCGGC CGCCAGGAGC TGGTTCGAAG 180
CTTATCGATT TCGAACCCCT GGTGGTCGGC ATGTTTT 217

Claims (17)

 1) Construction of recombinant DNA which comprises at least the following elements, in the 5'-3 'direction:  an S1 DNA sequence comprising at least block A and block B of a promoter recognized by polymerase III  an S2 sequence whose transcription product can form a structure similar to that of the apical duplex end of an adenovirus VA I RNA;  an S3 DNA sequence,  S1 S2 and S3 being fused to form a sequence different from the natural sequence of the gene of a VA I rNA of adenovirus.  2) recombinant DNA construct according to claim 1 characterized in that S3 comprises at least one restriction site for cloning a heterologous DNA sequence.  3) recombinant DNA construct according to claim 2 characterized in that S3 further comprises a DNA sequence which constitutes a transcription termination signal recognized by the RNA polymerase III.  4) Construction of recombinant DNA characterized in that it comprises at least the following elements in the 5'-3 'direction  at least one DNA sequence which constitutes a transcription activator element PolII;  a DNA sequence comprising at least block A and block B of a promoter recognized by polymerase III and at least one sequence whose transcription product can form a structure similar to that of the end of the apical duplex of an adenovirus VA I RNA (it is in particular of any sequence whose transcript can adopt the same structure as the nucleotides 54-72 of the gene of a VA I RNA); and  a DNA sequence which constitutes an end of transcription signal.  5) Construction of recombinant DNA according to claim 4, characterized in that it comprises, as a transcription activator element Polit, the activating signals of the transcription of the adenovirus E1A gene.  6) recombinant DNA construct according to any one of claims 1 to 5, characterized in that it comprises at least  nucleotides 0 to 352 of adenovirus Ad5  the nucleotides 1 to 77 of the VA I gene of adenovirus Ad2  the signal of end of transcription of the gene EBER I of the Epstein-Barr virus. 7) recombinant DNA construct according to claim 4 characterized in that it comprises a sequence selected from the group consisting of the sequences represented in the attached sequence listing, under the numbers SEQ ID NO: 1, and SEQ ID NO: 2.  8) recombinant vector characterized in that it comprises a DNA construct according to any one of claims 1 to 7.  9) Recombinant vector according to claim 8, characterized in that it is the plasmid pVAemp filed January 16, 1996 with the CNCM under the number I-1655.  10) Recombinant vector according to claim 8 characterized in that it is a recombinant adenovirus.  11) Recombinant vector according to claim 10, characterized in that it results from the cloning of a construct according to any one of claims 1 to 7, in an adenovirus which already comprises a copy of a gene VA I  12) Recombinant vector according to claim 10 characterized in that it results from the cloning of a construction according to any one of claims 1 to 7, in a defective adenovirus for the gene VA I.  13) Use of a recombinant DNA construct according to any one of claims 1 to 7, for obtaining a vector for increasing the expression of a gene of interest in a host cell.  14) A vector for increasing the expression of a gene of interest in a mammalian host cell, characterized in that it comprises a DNA construct according to any one of claims 1 to 7, and a DNA construct comprising the gene of interest that it is desired to express, placed under the control of a suitable promoter.  15) DNA construct according to any one of claims 1 to 7 for use as a medicament.  15) Vector according to any one of claims 8 to 12, or according to claim 14, for use as a medicament.  16) Use of a DNA construct according to any one of claims 1 to 7 for the in vitro production of proteins of interest in cell cultures.  17) Use of a vector according to any one of claims 8 to 12, or according to claim 14, for the in vitro production of proteins of interest in cell cultures.