WO2004011489A2

WO2004011489A2 - Tropism-modified adenoviral vectors, preferably for targeting b-lymphocytes or ovarian cells

Info

Publication number: WO2004011489A2
Application number: PCT/FR2003/002315
Authority: WO
Inventors: Jean Claude D'halluin; Laurence Renaut; Morvane Colin
Original assignee: Institut National De La Sante Et De La Recherche Medicale
Priority date: 2002-07-25
Filing date: 2003-07-22
Publication date: 2004-02-05
Also published as: FR2842823A1; AU2003273463A8; WO2004011489A3; AU2003273463A1

Abstract

The invention concerns recombinant adenoviruses whereof the tropism has been modified to enable B-lymphocytes or ovarian cells to be infected thereby. The inventive recombinant adenoviruses exhibit a reduced tropism compared to that of the native adenovirus. The invention also concerns methods for preparing said adenoviruses, as well as their uses, in particular for transferring DNA sequences into B-lymphocytes or ovarian cells in vitro, ex vivo or in vivo, for experimental, industrial, vaccination or therapeutic purposes. The invention more specifically concerns the modification of the gene of the adenovirus fiber for targeting B-lymphocytes or ovarian cells, in particular tumor cells, as well as other modifications and/or constructs enabling the viruses to be provided with a character specific to said cells. The invention is particularly characterized either by insertion into the fiber of the sequence of a peptide identifying a receptor expressed at the surface of B-lymphocytes, or by replacing the Mastadenovirus adenovirus fiber bud with a fiber bud of a phylogenetically distant adenovirus, preferably of the bovine adenovirus serotype 4 (BAV4).

Description

Adenoviruses modified to change their tropism, preferably for targeting B cells or ovarian cells

The present invention relates to recombinant adenoviruses whose tropism has been modified to allow them to infect B lymphocytes or ovary cells. The recombinant adenoviruses according to the present invention exhibit a reduced tropism compared to that of the native adenovirus. It also relates to methods for the preparation of such adenoviruses, as well as their uses, in particular for the transfer of DNA sequences into B lymphocytes or ovary cells in vitro, ex vivo or in vivo, for an experimental purpose, industrial, vaccine or therapeutic. The invention more specifically describes the modification of the radenovirus fiber gene with the aim of targeting B lymphocytes or ovarian cells, in particular tumor cells, as well as other modifications and / or constructs enabling the viruses to be given a specific character for these cells. The invention is notably characterized either by the introduction into the fiber of the sequence of a peptide recognizing a receptor expressed on the surface of B lymphocytes, or by the replacement of the fiber button of an adenovirus Mastadenovirus by a button fiber from a phylogenically distant adenovirus, preferably from an adenovirus of the Atadenovirus family, more particularly from bovine adenovirus serotype 4 (BAV4).

Adenoviruses are widely used as gene vectors. These viruses have in fact many qualities such as easy production at high titer, their genome does not integrate into the genome of the host cell, large inserts can be introduced therein and they can infect quiescent cells and dividing cells. . These advantages make these viruses interesting candidates in the context of gene transfer for gene therapy or for experimental studies (gene transfer in animals, production of recombinant cells, analysis of gene expression, etc.).

There are multiple serotypes of adenoviruses, infecting humans or animals. The adenoviruses currently used are mainly from subgroup C and of serotype 2 and 5. Mention may also be made of canine, simian or bovine adenoviruses, as well as human adenoviruses of serotypes 7 or 12, for example.

The most serious limitations for the use of adenoviral vectors are their immunogenicity, the suboptimal distribution of adenoviral particles in vivo, the lack of vector specificity for diseased tissue, and low infectivity for a number of target cells.

For example, a limitation of adenoviral vectors however lies in the fact that they do not infect hematological cells very much. However, within the framework of a gene therapy protocol against a pathology involving B lymphocytes, for example tumor pathologies such as leukemias and lymphomas, it is necessary to allow their infection to be effective. This also applies in the case of an in-vivo or ex-vivo gene therapy protocol, immunotherapy or a suicide gene strategy. In addition, in a gene therapy approach, it is important to infect the target cells most effectively while limiting the spread of the virus in other (non-target) cells. In addition, such a gene vector can be used in experimental approaches, for example to efficiently transfect lymphocytes

B with a view to testing the action of various genes or promoters.

Vectors having the capacity to preferentially infect the target cells would make it possible to significantly reduce the doses of therapeutic vectors, which would reduce their toxicity and increase their efficiency.

The part of the virus which is responsible for the recognition of the natural receptor, the hCAR (human Coxsackie- Adenovirus Receptor) (Bergelson et al, 1997), is a capsid protein, the fiber, and more precisely, its C-terminal part called "the button" (Louis et al., 1994). This part of the fiber is also responsible for initiating the trimerization of the protein (Hong and Engler 1996). This conformation is essential for its interaction with the base of the penton and its incorporation into the capsid. To modify the tropism of the adenovirus, several strategies have been developed in the prior art. The first consists in the use of bi-specific compounds. They consist of a part recognizing a domain of an adenovirus capsid protein (the fiber, the base of the penton or the hexon) and of a part which can interact with a target receptor. In this way cells were infected via the EGF receptor (Epidermal Growth Factor) (Watkins et al., 1997) or via the FGF receptor (Fibroblast Growth Factor) (Goldman et al., 1997). Many other membrane components have thus been targeted (Haisma et al., 1999; Kelly et al., 2000; Schneider et al., 2000; Yoon et al., 2000). This technique is effective but it is difficult to envisage it in a gene therapy protocol. Indeed, there are two major problems which are (i) the stability of the bispecific compound and (ii) the use of a two-component system which can only be produced separately, which makes the notion of essential reproducibility difficult. for therapeutic trial protocols.

The second strategy used to modify the tropism of adenoviruses is to graft on the fiber, in a genetic way, a peptide allowing the recognition of a cellular receptor. The addition of this peptide sequence should not hinder trimerization in order to obtain a correct assembly of the virus. Many studies have been carried out in this direction, with in particular the use of a poly-lysine sequence (K ₇ ) or of an RGD sequence at the C-terminal end of the fiber (Wickham et al, 1997). These modifications allow correct assembly of the virus and infection of the cells via the interaction of poly-lysine / heparan sulfates or RGD / integrins of the αvβ _3-5 type. Other work has been done with the insertion of RGD sequence in the HI loop, which is presented on the surface of the button. Such viruses can thus infect a large number of cell types into which it naturally enters with low efficiency (Biermann et al., 2001; Cripe et al., 2001; Grill et al., 2001; Kasono et al., 1999; Nakamura et al., 2002; Vanderkwaak et al., 1999, WO96 / 26281; WO94 / 10323; O95 / 05201; WO95 / 26412). These studies therefore show that the addition of peptides in the fiber button does not hinder its conformation and makes it possible to direct the infection to a predetermined receptor. The genetic modifications of the fiber described to date allow the infection of cell types which are not natural targets. However, the fact that the peptides used (poly-lysine and RGD) recognize receptors which are strongly expressed in many cell types only increases the tropism of adenoviruses. Furthermore, no adenovirus having a preferential tropism for B lymphocytes has been described in the prior art.

The third approach is based on the use of a trimerization domain, which can be heterologous or come from the fiber of an adenovirus that does not recognize the hCAR receptor. Among the heterologous domains, let us mention the fibritin of bacteriophage T4 (Krasnykh et ah, 2001), a trimerization domain of the envelope glycoprotein of MoMuLV (vanBeusechem et ah, 2000), a peptide of 36 amino acids derived from the NRP domain ( Neck Region Peptide) of the surfactant protein D of the lungs (Magnusson et al., 2001). The first use of the C-terminal end of a fiber of an adenovirus not recognizing hCAR was carried out with that of adenovirus 3 of subgroup B (Krasnykh et al., 1996). This hybrid virus has the same cell recognition properties as adenovirus 3 with an even wider tropism than that of adenoviruses of subgroup C.

The present invention describes the possibility of modifying the natural tropism of an adenovirus to allow good infection of cells little or not infected with the natural adenovirus, preferably B lymphocytes or ovary cells, without increasing the natural spectrum of host cells of this virus, preferably with a decrease in the natural spectrum of host cells of this virus. The natural spectrum of the native adenovirus is already very important because the natural adenovirus receptor is present on the surface of a large number of cell types.

The present application now describes the construction and production of adenoviral vectors capable of infecting B lymphocytes, via a well-defined peptide recognizing a specific B receptor. The present application also describes recombinant adenoviral vectors exhibiting a modified and restricted tropism for B lymphocytes. B lymphocytes not being natural targets for adenoviruses, the The present invention shows that it is possible to develop a tool for targeting these cells.

A first object of the invention lies more particularly in a recombinant adenovirus, characterized in that it comprises a modified fiber, the sequence of which comprises a targeting peptide specific for a CD21 receptor.

The present application further describes the construction and production of adenoviral vectors capable of specifically infecting ovarian cells. The present application also describes recombinant adenoviral vectors exhibiting a modified and restricted tropism for ovarian cells. The present invention shows that it is possible to develop a specific targeting tool for these cells. The adenovirus according to the present invention weakly infects human epithelial cells, which are the target cells of adenoviruses of subgroup C. On the other hand, this hybrid virus more effectively infects tumor cells originating from ovarian cancer, such as the SKOV3 line.

A second object of the invention lies more particularly in a recombinant Mastadenovirus adenovirus, characterized in that it comprises a modified fiber, the fiber button of which has been replaced by the fiber button of an adenovirus of the Atadenovirus family, preferably bovine adenovirus 4 (BAV4) or the virus responsible in chicken for "Egg Drop Syndrome" (EDS), more particularly bovine adenovirus 4 (BAV4).

Having a virus preferably infecting a particular cell type considerably reduces the risk of dissemination in vivo. In addition, the dose of virus to be used becomes smaller, which limits the risk of having a strong immune response and is beneficial in an in vivo gene therapy approach. Another aspect of the invention resides in a process for the preparation or production of a recombinant adenovirus as defined above, as well as in the tools and constructions which can be used for this purpose (vectors, chimeric genes, cells, etc.) .

Another aspect of the invention resides in a pharmaceutical composition comprising at least one recombinant adenovirus as defined above, and in its use for the transfer of genes into B lymphocytes or ovary cells, in particular for the treatment of pathologies associated with a dysfunction of these cells or affecting these cells.

Another object of the invention resides in the use of a recombinant adenovirus as defined above for the preparation of a composition intended for the transfer of genes into B lymphocytes or ovary cells in vivo, ex vivo or in vitro.

Another aspect of the invention relates to a modified adenovirus fiber protein as defined above, any nucleic acid encoding such a protein, as well as their uses.

The invention therefore relates, in general, to recombinant adenoviruses having a modified tropism, more particularly having a tropism for B lymphocytes or ovary cells.

The term recombinant adenovirus designates, within the meaning of the invention, a modified viral particle comprising a viral genome contained in a capsid.

The adenoviral genomes are double stranded linear DNA of approximately 36kb. they include two terminal regions, the ITR (Inverted Terminal Repeat) which are the origins of replication of the viral genome and an encapsidation sequence (Ψ). In addition, several regions (E1 to E4) called early encode elements necessary for the transcription and replication of the viral genome, and regions called late (L1 to L5) code the structural proteins of the virus. The recombinant adenoviral genomes constructed for gene therapy are deleted from (or defective for) El a and / or Elb from the El region, the products of these genes being essential for viral production. This deletion (or this defective character) prevents possible dissemination of the vector in the organism. The sequence of interest is generally introduced in place of this region.

Given the strong immunogenicity of the adenovirus and to prevent the risk of the emergence of RCA (Competent Adenovirus Replication) forms, other viral genomes deleted from other genes have been described. Thus, defective recombinant adenoviruses for the following regions: El A; E1 A and E1B; E1 and E3; E1 and E4 (in particular ORF3 or ORF6); E1 and E2; E1 and E2 and E3; E1 and E2 and E4; El and E3 and E4 were built. In the same vein, recombinant genomes lacking all the viral genes and comprising only the ITRs, the packaging sequence and the DNA sequence of interest have also been described. In a particular variant, the recombinant adenoviruses of the invention comprise a recombinant adenoviral genome comprising two ITR terminal regions, an encapsidation sequence (ψ) and a DNA sequence of interest, the transfer or expression of which in a determined host is desired. Preferably, they comprise an adenoviral genome defective for the El region at least.

Adenovirus with tropism for B cells

An essential characteristic of the recombinant adenoviruses of the invention lies in the presence of a modified fiber, which gives these viruses a particular tropism, and in particular the capacity to infect B lymphocytes. In this context, the invention now describes the construction of the gene encoding a chimeric fiber comprising a peptide specifically recognizing the CD21 receptor.

The CD21 receptor is a surface marker for B lymphocytes (Nemerow et al., 1989). The CD21 (or CR2) glycoprotein is the EBV (Epstein Barr Virus) receptor, which is also recognized by the complement C3dg. In order to allow a preferential infection of B lymphocytes, the inventors have developed adenoviruses having, in their fiber, a peptide specifically recognizing the CD21 receptor.

The peptide chosen was defined on the basis of the sequence of the part of the glycoprotein GP350 / 220 (EBV envelope protein) responsible for the recognition of CD21. In 1987, the glycoprotein GP350 / 220 of the EBV envelope was defined as being responsible for the recognition of the CD21 receptor (Nemerow et al., 1987; Tanner et ah, 1987). In addition, the comparison of the peptide sequence of this protein to that of the complement C3dg revealed two regions of strong homology: EDPGFFNVE for GP350 / 220 and EDPGKQLYNVE for C3dg, the latter being responsible for the recognition of C3dg in CD21 ( Lambris et al., 1985).

This is how the EDPGFFNVE region was defined as being responsible for EBV / CD21 recognition. In addition, experiments have demonstrated that this peptide sequence is capable of inhibiting the infection of B lymphocytes by this virus (Nemerow et al, 1989).

Different peptides and different locations in the fiber were selected in order to have an optimal conformation of the sequence of interest on the surface of the fiber, and to allow a good interaction with the receptor.

More particularly, the modified fiber according to the invention comprises a ligand peptide of a CD21 receptor comprising the sequence EDPGFFNVE (SEQ ID No 3) or a functional part thereof. Other targeting peptides are the peptides of sequences GEDPGFFNVE (SEQ ID No 4), GEDPGFFNVEIP (SEQ ID No 5), GEDPGFFNVEIPEFP (SEQ ID No 6) and EDPGFFNVEIPEFPF (SEQ ID No 7), which have been used in order to have an optimal conformation for the recognition of CD21. Targeting peptides according to the invention include any peptide comprising between 7 and 20 amino acids, preferably between 10 and 18, even more preferably between 11 and 17, of synthetic, natural or mixed origin, capable of binding the CD21 receptor to the surface of a B cell, preferably selectively. The term "so selective ”indicates that the binding to the CD21 receptor is more refined than the binding to other cellular markers, even if such non-specific binding cannot be completely excluded. The term “functional part” designates any fragment of a sequence defined above, or any derivative of such a sequence, which retains the ability to interact selectively with a CD21 receptor.

The targeting peptide can be introduced into different positions in the adenovirus fiber, either as a replacement for existing sequences, or as a supplement. Preferably, the sequence encoding the targeting peptide is introduced at the 3 ′ end of the fiber gene (and the targeting peptide is therefore found at the C-terminal end of the fiber protein) or in the sequence of the HI loop (the HI loop being between the 535 ^th and the 547 ^th residue in the fiber sequence of the serotype 5 adenovirus).

Furthermore, the targeting peptide can be linked directly to the fiber protein, or via a spacer sequence. Such a sequence is used primarily when the targeting peptide is introduced at the C-terminus of the fiber. The spacing sequence does not affect the functionality of the targeting peptide and allows for greater flexibility thereof. By way of example, there may be mentioned in particular a sequence (SG) i, in which i is an integer between 1 and 7, etc. A preferred spacer sequence is the (Ser-Gly) s-Ser sequence.

Specific constructs according to the invention are fibers modified at the C-terminal end by adding a targeting peptide via a spacer sequence. The sequence of the C-terminal end of the fiber is for example the following:

- AQE- (SG) ₅ -S-targeting peptide.

In a particular embodiment, the fiber further comprises one (or more) additional alteration reducing or blocking its interaction with the hCAR receptor, preferably in the button of the fiber. Such alterations may understand for example mutations in the DG loop of the fiber button, which does not alter the trimerization but significantly reduces the interaction of the virus with its hCAR receptor (Kirby et al, 1999). Alternatively, the adenovirus fiber button can be replaced by the domain that allows trimerization of fibritin from bacteriophage T4 (Krasnykh et al, 2001). Another possible alteration consists in replacing the fiber button of serotypes 2 and 5 (HAdV2, HAdV5) by the fiber button of a non-Mastadenovirus adenovirus.

Such an alteration makes it possible to restrict the tropism of the recombinant adenovirus, and therefore to increase its specificity for B lymphocytes. Such specificity is of course particularly advantageous for use in gene therapy because it makes it possible to reduce the doses to be administered. This is an important advantage because the adenovirus is very immunogenic and can induce a strong undesirable immune reaction.

Such an exchange was carried out using the button of the adenovirus BAV4 (Bovin Adeno Virus 4). The viruses were constructed, amplified and purified and initial tests made it possible to observe that the adenovirus thus modified infects human epithelial cells in a reduced manner (by a factor of 10-50).

In this regard, another object of the invention resides in an adenovirus fiber protein comprising a targeting peptide specific for a CD21 receptor. In a preferred mode, the fiber further comprises a modification reducing the interaction with the hCAR receptor.

Adenovirus with tropism for ovarian cells

An essential alternative characteristic of the recombinant adenoviruses of the invention resides in the presence of a modified fiber, which confers on these viruses a particular tropism, and in particular the capacity to specifically infect ovarian cells, more particularly tumor cells originating from ovarian cancer.

In particular, the recombinant Mastadenovirus adenoviruses are characterized by the presence of a chimeric fiber which confers on these viruses an abolition of the interaction with the hCAR receptor. In this context, the invention now describes the construction of the gene encoding a chimeric fiber comprising a fiber button substituted by a fiber button of an adenovirus having a low sequence homology with those of adenoviruses of the subgroup C, more particularly with that of the fiber button of adenoviruses 2 and 5. Preferably, the virus used for the substitution of the fiber button also has a low or an absence of infectivity of human cells. The adenovirus, the fiber button of which is introduced into the recombinant virus, belongs, for example, to the families Aviadenovirus, Atadenovirus or Siadenovirus. Preferably, the fiber button of an Atadenovirus adenovirus is used. Among the Atadenovirus adenoviruses, bovine adenovirus 4 (BAV4) or the EDS adenovirus constitutes a preferred embodiment. The use of the BAV4 fiber button in adenovirus 2 makes it possible to obtain a specific tropism for ovarian cells.

The junction between the two fibers to form a chimeric fiber can be carried out at different positions in the fiber gene of the adenovirus 2. The most easy junctions are in the stems of the fibers. These consist of a variable number of repeated structural patterns. It is the number of repeating patterns that determines the length of the fiber, so there are 21 patterns for the adenovirus 2 fiber, 20 patterns for BAV4 but only 5 for the adenovirus 3. These different junctions can vary the length of the chimeric fiber. This length can influence the targeting efficiency of the adenoviral vector. In one embodiment, the junction was made in the stem of the two fibers, between the repeated patterns 7 and 8 for the fiber of adenovirus 2 and between the patterns 7 and 8 for that of BAV4. In a particular embodiment, the chimeric fiber has the sequence SEQ ID No 2 and can be encoded by the polynucleotide of sequence SEQ ID No 1.

An object of the invention resides in a nucleic acid encoding a fiber protein as defined above. It may be DNA or RNA, preferably DNA. Another object of the invention resides in a vector comprising such a nucleic acid, this vector possibly being a plasmid, virus, phage, cosmid, etc. The modified fibers can be constructed by genetic engineering, according to techniques known to those skilled in the art, such as for example by artificial synthesis, cloning, ligation, enzymatic cleavage, amplification, site-directed mutagenesis, junction of oligonucleotides, etc.

In a particular embodiment, the adenovirus according to the invention is produced from an adenovirus of serotype 2 or 5.

The recombinant adenovirus comprising the modified fiber can be produced by various methods. Thus, the gene encoding the modified fiber can be introduced into the adenoviral genome, or introduced, in integrated or extra-chromosomal form, into the genome of the virus-producing cell.

In this context, another subject of the invention relates to a process for the production of a recombinant adenovirus as defined above, comprising (i) the construction of a gene encoding the modified fiber, in particular encoding the fiber whose sequence comprises a targeting peptide specific for a CD21 receptor or encoding the fiber, the sequence of which comprises the button of the fiber of another adenovirus according to the present invention, (ii) the introduction of this gene into an adenoviral genome, ( iii) introduction of the adenoviral genome into an packaging cell, (iv) amplification of the viruses and (v) purification of the viruses produced.

The packaging cell used can be any permissive cell comprising or expressing the defective adenoviral proteins of the recombinant genome. In the case of an adenoviral vector defective for the El region, any cell expressing the El region of an adenovirus is used, such as cells HEK 293, PER.C6, etc. It is also possible to use cells co-transfected with a plasmid or a helper virus providing the necessary functions.

In the context of the invention, the packaging cell for preparing the recombinant adenoviruses having a fiber button substitution must also express a wild fiber to complement the chimeric fiber defective for its interaction with the hCAR receptor. To obtain high fiber expression, the adenovirus 2 fiber gene was inserted into a plasmid derived from pCDNA3 (Invitrogen), the sequence of exons 2 and 3 of the TPL (Tri Partite Leader) of the adenovirus. 2 was inserted between the CMV promoter and the fiber gene (Figure 7). The sequence in the vicinity of the translation initiation codon was modified by PCR, with specific oligonucleotides, to obtain the consensus defined by KOZAC ((Kozak 1997); consensus favoring the start of translation.

Another subject of the invention relates to a viral particle comprising an adenovirus fiber as defined above.

Another subject of the invention relates to a method for the transfer of a nucleic acid into a B lymphocyte in vitro, ex vivo or in vivo, comprising bringing an organism, tissue, biological sample or cells comprising lymphocytes into contact B with a recombinant adenovirus, said recombinant adenovirus comprising said nucleic acid and comprising a modified fiber comprising a targeting peptide specific for a CD21 receptor.

Another subject of the invention relates to a method for the transfer of a nucleic acid into ovarian cells in vitro or in vivo, comprising bringing an organism, tissue, biological sample or cells comprising cells into contact. ovary with a recombinant Mastadenovirus adenovirus, said recombinant adenovirus comprising said nucleic acid and comprising a chimeric fiber having a button substitution of the fiber according to the present invention.

Another subject of the invention relates to a pharmaceutical composition comprising a recombinant adenovirus as defined above and a pharmacologically acceptable vehicle. The vehicle or excipient can be any solution, suspension, gel, powder, etc., compatible with pharmaceutical use, such as in particular an isotonic, buffered, saline solution, etc. The invention can be used for the transfer and expression of nucleic acids of interest in B lymphocytes or ovary cells, in experimental or therapeutic approaches. The nucleic acid can be a suicide gene, that is to say any nucleic acid encoding a protein toxic to the cell, either directly or conditionally (eg, TK, cytosine deaminase, etc.), a nucleic acid encoding an anti-tumor factor, a cytokine, an antisense, an antigen, a marker, etc. (such as H2, 1112, anti bcr / abl anti-sense RNA). The invention can be used in the therapeutic field, for the preventive or curative treatment of pathologies involving or affecting B lymphocytes or ovary cells, such as tumor pathologies (leukemias, lymphomas, ovarian cancer, etc.), diseases immune, inflammatory, etc.

In a particular embodiment relating to recombinant adenoviruses which have lost the recognition capacity of the hCAR receptor, the E1 region can also be inserted into the vector with the aim of obtaining an adenovirus competent for replication but with a cell dependence for it. this. This effect can be obtained by placing the El A region under the control of a specific promoter of ovarian cancer tumor cells for example, and / or by using mutants in one or other of the proteins encoded by the region E1B. Such a replication-competent virus could specifically lyse tumor cells and not spread to other tissues due to the loss of recognition of the hCAR receptor.

Other aspects and advantages of the invention will appear on reading the examples which follow, which should be considered as illustrative and not limiting.

Legend of Figures

Figure 1: Principle of the last stage of construction of viral genomes having a fiber gene modified by homologous recombination in E. coli (after Renaut, L et al, 2002). Figure 2: Shuttle vector allowing the insertion of fibers modified by molecular cloning between the Mlul and Sali sites and the homologous recombination with the vector pRECad.

Figure 3: Diagram of pRECad, its digestion by Swαl releases the viral genome.

Figure 4: Tropism of adenoviral vectors. The genetically modified vector has a fiber with the CD21 targeting peptide in the HI loop. Figure 4 A: Study of the binding of the labeled vector to FAM. Figure 4B: Expression of the lacZ reporter gene. A549, control epithelial cells; Daudi and Raji, B lymphocyte cell lines; HSB2, T lymphocytes; Ad-CD21HI, adenoviral vector with a fiber modified by genetic insertion of the peptide EDPGFFNVEIPEFPF in the HI loop of the fiber. The values indicate the gain (> 1) or the reduction (<1) of tropism of the modified vector compared to the vector having a wild fiber.

Figure 5: Comparison of HAdV-2 and BadV-4 fiber proteins. In the tail domain, the HAdV-2 sequence involved in an interaction with the base of the penton is indicated in bold; only part of this sequence (PVYP) has been preserved in BadV-4. The stem domain repeats are numbered and appear to be well preserved in the BadV-4 fiber. The P and GXG residues responsible for the elbow are in italics. The arrow indicates the position in the rod used to prepare the protein of the chimeric fiber. Codons K and L (AAR CTN) can correspond to a HindUl restriction site.

Figure 6: Construction of an adenoviral genome with a chimeric fiber gene. The plasmid ρ5Shut / HadV2 / BadV4 containing the chimeric fiber gene between nucleotides 31041 and 32788 was prepared. PRECad has been linearized with Pacï and p5Shut / ΗadV2 / BadV4 with Notl and Kpnl. The fragments were co-introduced into an electrocompetent E. coli ToplOF 'strain. The positions of the deletion in the E3 region, of the fiber gene and of the restriction sites are indicated with reference to the HAdV5 sequences. The Sali site which has been inserted into the fiber gene, upstream of the polyadenylation signal, is indicated in italics. Figure 7: Diagram of construction of the vector ρC3-TPL23-fb allowing the synthesis of the fiber in the packaging cells. The fiber gene is under the control of the CMV early promoter. Exons 2 and 3 of the TPL of adenovirus 2 were inserted between the promoter and the fiber gene. The neomycin resistance gene is under the control of the S V40 promoter, this gene allows the selection of cells which have integrated this vector.

Figure 8: Diagram of pRECad2 / BAV4, its digestion by Swαl releases the viral genome.

Figure 9: In vitro synthesis of fiber proteins. Fiber proteins were synthesized in vitro and isolated by SDS-PAGE. The modification in the neighboring sequence of the initiation codon (Lines 3 and 5) and the presence of the TPL exons are indicated. A complete fiber cDNA was used as a line control 6. The arrows indicate the fiber protein synthesized in the absence of TPL and without the ATG modification.

Figure 10: Analysis of trimerization of fiber proteins. Figure 10A: the fiber proteins were synthesized in vitro and analyzed on a 12.5% non-denaturing gel on PAGE. The arrows indicate the monomeric (62 kDa) and trimeric (186 kDa) forms of HAdV-2 fiber proteins. Figure 10B: In vivo analysis. COS cells were transfected with pC3fbAd2 and pC3fbAd2 / BadV4. The proteins of the transformed cells were prepared 24 h after transfection and separated by SDS-PAGE after (D) or before (N) denaturation. Fiber proteins were revealed by immunodetection with a monoclonal antibody.

Figure 11: Immunodetection analysis of viral particles produced in HEK-293 cells. Ad vectors were produced in HEK-293 cells and purified. Viral proteins were separated by SDS-PAGE and the proteins were transferred to a membrane. Fiber proteins were revealed with a monoclonal antibody against the N-terminal part of the fiber. Line 1, HAdV5 control virus; Line 2, no virus; Line 3, HAdV5-βgal; Line 4, HAdV2 / BadV4. Figure 12: Study of the cellular tropism of the modified adenoviral vectors. Figure 12A: HeLa cells were infected with an increasing amount of viral particles, 0, 0.5, 1, 2, 4 and 8 10 ³ PP per cell from front to back, respectively. 24 h after infection, the β-galactosidase activity was determined by FACS (flow cytometry). FIG. 12B: the percentage of HeLa positive cells, determined in FIG. 12A, was expressed as a function of the quantity of initial virus. Figure 12C: HepG2 cells were infected and analyzed under conditions similar to Fig 12 A. The results were expressed as a percentage of positive cells. Figure 12E: Daudi (B lymphocytes) and Jurkat (T lymphocytes) cell lines were infected with 2 × 10 PP per cell of HAdV2 and HAdV2 / BadV4 virus as indicated in FIG. 12A. The results are expressed as a percentage of positive cells. Fig 12C to E: Open bar = vector with HAdV2 fiber; Solid bar = vector with HAdV2 / BadV4 fiber. The results are averages of at least 3 independent experiments carried out in triplicate, except for FIG. 12A which is experimentally significant.

Figure 13: Infection of hCAR-independent CHO cells with a hybrid Ad vector with a HAdV2 / BadV4 chimeric fiber. CHO cells expressing or not expressing the hCAR receptor were infected with 1 10 ³ (white) or 3 10 ³ (black) PP per parental or hybrid vector cell. 24 h after infection, the activity of the β-galactosidase reporter was determined by FACS and is indicated as a percentage of positive cells.

Figure 14: Study of the cell tropism of the modified Ad vectors on the SKOV3 cell line. The cells were infected with increasing amounts of viral particles, 0, 0.5, 1, 2, 4 and 8 10 ³ PP per cell. 24 h after infection, the activity of the β-galactosidase reporter was determined by FACS. The percentage of SKOV3 positive cells was expressed as a function of the amount of initial virus. Example 1. Construction of chimeric fibers comprising a peptide targeting B cells.

1. Selection of targeting peptides The targeting peptides chosen include the sequence GEDPGFFNVE (SEQ

ID No 4) or a functional part of it. In order to verify that the peptide produced is capable of binding and then being internalized in B lymphocytes, its internalization in different cell types was tested, after fluorescent labeling of the peptides by confocal microscopy. The results obtained demonstrate that the peptide is capable of fixing and being internalized in B lymphocytes.

2. Construction of genes encoding chimeric fibers

In order to effect the modifications of the fiber, the gene encoding the adenovirus 2 fiber (HAdV2) was cloned into pBluescript-ïï-SK (Stratagene) between the restriction sites NotI and Sαfl. A PCR was carried out on the genome of HAdV2 with the primers 5'-AggAAAAAAgCggCCgCATgAAACgCgCCAgAC-3 '(SEQ ID Νo 8) in 5' and 5'-AggAAAAAAggTCgACTTATATCgATTCCTgggCAATgTAg-3 '(SEQ ID ID 3'). The second primer contains a ClaI site immediately before the stop codon.

The oligonucleotides 5'-CgggTTCAggATCCggAgAggATCCCgggTTTTTCAACgTTg AATgTTAACg-3 '(SEQ ID Νo 10) and 5'-TcgACGTTAACATTCAACGTTGA AAAAC short between the Clal and Sali sites. A spacer sequence was also introduced between the sequence encoding the fiber and that encoding the EBV peptide. This sequence makes it possible to have no bulk and thus to keep an optimal conformation of the fiber and of the peptide. The C-terminus of the fiber has the sequence: AQE (SG) ₆ EDPGFFΝVEC (SEQ ID No 12).

As for the long peptide, the primers 5'- AggAAAAAACgTCgACgTTAgAACgggAATTCgggAATTTCAACgTTgAAAAACC Cggg-3 '(SEQ ID No 13) and 5'-CCCCCTggggTACTCTCTTTACgCgTATCCgA ACCTCTAgTTACC-3' (SEQ ID No 14) were used. The first hybridizes with the 3 ′ end of the fiber gene with the short peptide and makes it possible to extend the latter and the second hybridizes at the M site located 147 bp from the 5 ′ end of the gene for the fiber. This PCR fragment was cloned in place of the MluVSatt fragment. wild fiber cloned into pBs-sK. The C-terminus of the resulting fiber has the sequence: AQE (SG) ₆ EDPGFFNVEIPEFP (SEQ ID No 15).

With regard to the insertion of the peptides at the level of the HI loop, oligonucleotides were inserted into a site S ^ el located at 1615 bp from the 5 'end of the gene of the cloned fiber in pBluescript-fl-SK . For the short peptide, the oligonucleotides 5'-CTAgCggCgAAgATCCCgggTTTTTCAACgTTgAAATTC-3 '

(SEQ ID No 16) and 5'CTAggAATTTCAACgTTgAAAAACCCggGATCTTCgCCg-3 '(SEQ ID No 17) 3 '(SEQ ID No 19) were used.

3. Expression of chimeric fibers and functionality The genes encoding the modified fibers were transferred into a plasmid which contains, at 5 'to the gene of interest, the element of bacteriophage T7 allowing transcription in vitro. Thus, in order to demonstrate that the modified fibers are capable of trimerizing, in vitro syntheses were carried out with the in vitro transcription / translation kit from Promega and their products separated on non-denaturing polyacrylamide gel.

Example 2. Construction and Production of Recombinant Adenovirus Comprising a Chimeric Fiber Comprising a B Cell Targeting Peptide and Functionality

The genes encoding the modified fibers were then cloned into a shuttle vector to allow their introduction into a viral genome previously constructed (Renaut et al, 2002), in place of the gene encoding the wild fiber. This step was carried out by homologous recombination in E. coli (Chartier et al, 1996). The shuttle vector used contains 5502 bp from the right end of the PHAdV5 genome which were amplified with the primers 5'-TTgTATAAAAAgC ^ CggCC ^ CAACTACCTTGCCTACCACTC- 3 '(SEQ ID No 20) which hybridizes to 25690 bp in the genome viral and the primer 5'- TTgTATAAAAAgCgrC ^ [CCCTCCCgTgTgTgACTCgCAg-3 '(SEQ ID No 21) which hybridizes to 34322 bp in this same genome. This fragment was amplified from pBHG11 (Graham et al, 1989) which is a plasmid containing the entire genome of HAdV5, in the part which interests us, a fragment of 3130 bp containing the E3 region between 27865 bp and 30,995 bp had been deleted. This fragment was cloned between the NotI and Xhό sites in pBS-SK, and an M1 site, absent in the HAdV5 fiber, was added with the complementary primers 5'- CCCCCTggggTACTCTCTTTACgCgTATCCgAACCTCTAgTTACC-S '(SEQ ID Νo 22) and 5'-ggTAACTAgAggTTCggATACgCgTAAAgAgAgTACCCCAggggg-3 '(SEQ ID Νo 23). Similarly, an Sαfl site was inserted by mutagenesis at the 3 'end of the fiber gene, upstream of the polyA addition site of the L5 region using the primers 5'- CTTACACTTTTTCATACATT ^ rCg4CgAATAAAgAATCgTTTgTgTTATg-3' (SEQ ID Νo 24) and 5'-CATAACACAAACgATTCTTTATTC ^ rCg <4CAATgTATgAAA AAgTgTAAg-3 '(SEQ JJJ Νo 25).

At this stage, the various genes encoding the modified fibers have been cloned into the shuttle vector in place of the gene encoding the wild fiber by Ml MllSaï. After a homologous recombination step in E. coli, we obtained the recombinant genomes carrying the genes encoding the modified fibers (figurel).

After digestion with Swαl, thus releasing viral genomes from plasmids, these were introduced into HEK293 cells (Graham et al, 1977) expressing the adenovirus 2 fiber by lipofection. These cells allow the production of recombinant viruses because they express E1 which allows transcomplementation since this gene is deleted in the genomes of the viruses previously obtained.

A recombinant adenovirus was thus constructed and produced. The apical proteins of the capsid are fibers of HAdV2 with, at their C-terminal end, the peptide of targeting. This virus was produced with a titer equivalent to that of the virus carrying wild fiber (control virus), and it infects epithelial cells with the same efficiency as the control virus. These results demonstrate that the fact of having added this peptide does not hinder either the assembly of the virus or its intracellular traffic which is important for the transport of viral DNA and therefore of the gene of interest to the nucleus.

A second construct was obtained with a targeting sequence of the

CD21, derived from GP350 / 220 of EBV and having the sequence:

EDPGFFNVEIPEFPF which has been inserted into the HI loop of the adenovirus 2 fiber via the insertion of an oligonucleotide into a single restriction site

(Spe l).

The studies carried out with these viruses give good results with regard to the permissiveness of the cell lines expressing CD21, this both at the level of the attachment of the viruses to the cells and at the expression of the transgene (see FIG. 4). In addition, the inventors observed a reduction in the binding of viral particles and in the expression of the transgene in the cell lines expressing the hCAR receptor and not expressing CD21. The percentage of positive cells is equivalent for a B lymphocyte cell line (Daudi) to that observed with the control epithelial cells, which represents a gain in tropism by a factor of approximately 30.

Example 3. Construction and Production of Recombinant Adenovirus Comprising a Chimeric Fiber Comprising a Button of the EPS or BAV4 Fiber, and Functionality

1- Amplification of EPS and BAV4 adenovirus fiber genes. In order to effect the modifications of the fibers, the genes coding for the fiber of adenovirus 2 (HAdV2), those of EDS and of BAV4 were cloned in pBluescript-II-SK (Stratagene) between the restriction sites NotI and Sali . A PCR was carried out on the genome of HAdV2 with the primers 5'-

AggAAAAAAgCggCCgCATgAAACgCgCCAgAC-3 '(SEQ ID Νo 8) in 5' and 5'- AggAAAAAAggTCgACTTATATCgATTCCTgggCAATgTAg-3 '(SEQ ID Νo 9) in 3 '. Likewise, a PCR was carried out on the EDS genome with the primers 5'- AggAAAAAAggCggCCgCCATggCgAAgCgACTACggTTggACCCTgATCC-3 '(SEQ ID No 26) in 5' and 5'-AggAAAAAAggTCgACTACTgTgCTCCAACATATgTAAA 3 ' and on the plasmid ρVM404, containing the region encoding the fiber of BAV4, with the primers 5'-AggAAAAAAgCggCCgCATgAAAAgAgCACgTTg-3 '(SEQ ID No 28) in 5' and 5'-AggAAAAAAggTCgACTTATATCgATTgCgTgCgATT 3CgTgG 3gAgAT 3) '(The second primer contains a ClaI site immediately before the stop codon). The Htwdlïï site, present in the gene of the fiber of adenovirus 2 was modified, by site-directed mutagenesis, using the following complementary primers: 5'- gAgCgggTTTAAgTTTTgACAACTCAgg-3 '(SEQ ID No 30) and 5'- CCTgAgTTgTCAAAACTTAAACCCg 3 '(SEQ ID No 31); this mutation does not affect the sequence of the fiber. In the same way, H dli sites were introduced into the genes of the fibers of adenovirus 2, EDS and BAV4, using the following pairs of complementary primers:

5'-gTCAgATggAAAgCTTgCCCTgCAAACATC-3 '(SEQ ID No 32) and 5'-TTTgCAgggCAAgCTTTCCATCTgACACTg-3' (SEQ ID No 33); 5'-gTTAAAATTggCCgATggCAAgCTTggTgTAAATgTgggCCTTggg-3 '(SEQ ID No 34) and

5'-CCCAAggCCCACATTTACACCAAgCTTgCCATCggCCAATTTTAAC-3 '(SEQ ID No 35);

5'-CCCggAgggAAAgCTTTTTATACAACTATC-3 '(SEQ ID No 36) and 5'-gTTgTATAAAAAgCTTTCCCTCCggggTgg-3' (SEQ ID No 37), respectively.

2. Construction and expression of chimeric fiber genes and functionality.

The genes of the chimeric fibers were obtained by replacing the 3 ′ end of the gene of the adenovirus 2 fiber with that of EDS and BAV4 using the restriction sites H dïl and Sαfl.

The genes encoding the chimeric fibers were transferred into a plasmid which contains, at 5 'to the gene of interest, the element of bacteriophage T7 allowing a in vitro transcription. Thus, in order to demonstrate that the chimeric fibers are capable of trimerizing, in vitro syntheses were carried out with the in vitro transcription / translation kit from Promega and their products separated on non-denaturing polyacrylamide gel.

Unlike hAdV2, the chimeric protein synthesized in vitro migrates only at the predicted molecular weight as a monomer (61 kDa, HAdV2 / BAdV4) (Figure 10A). Surprisingly, the BadV4 control fiber protein was also observed only as a monomer in this in vitro test (Figure 10, line 3) although the BadV4 fiber protein in the viral capsid is probably in the form of a trimer. To evaluate the homotrimerization of the chimeric fiber protein HAdV2 / BAdV4 in mammalian cells, transient expression was carried out in COS cells after transfection with pC3-TPL23-Fb-HAdV2 / BAdV4. Fiber proteins were visualized by immunodetection after electrophoresis under non-denaturing conditions. Fiber proteins appeared as trimer (Figure 10B) when synthesized in vivo, although a significant portion of the proteins synthesized are in monomeric form. These results made it possible to construct and produce recombinant adenoviruses with a chimeric fiber protein HAdV2 / BAdV4.

3. Production of recombinant viruses.

The genes encoding the chimeric fibers were then cloned into a shuttle vector to allow their introduction into a viral genome previously constructed (Renaut et a, 2002) in place of the gene encoding the wild fiber. This step was carried out by homologous recombination in E. coli (Chartier et al, 1996). The shuttle vector used was described in Example 2 above.

At this stage, the various genes encoding the chimeric fibers have been cloned into the shuttle vector in place of the gene encoding the wild fiber by MlullSaK. After a homologous recombination step in E. coli, we obtained the recombinant genomes carrying the genes encoding the chimeric fibers (Figure 8). After digestion with Swαl, thus releasing viral genomes from plasmids, these were introduced into HEK293 cells expressing the adenovirus fiber by lipofection. These cells allow the production of recombinant viruses because they express E1 which allows transcomplementation since this gene is deleted in the genomes of the viruses previously obtained.

Several recombinant adenoviruses have thus been constructed and produced. The apical proteins of the capsid are of two types: the wild fiber of adenovirus 5 and one of the chimeric fiber Ad2 / EDS or Ad2 / BAV4. These viruses are then used to infect HEK293 cells. The apical proteins of the viral particles thus obtained are only of chimeric type.

4. Obtaining a cell line expressing the adenovirus fiber 2. The polylinker present in the vector pCDNA3 (Invitrogen) was replaced by a multiple cloning site using the following two complementary oligonucleotides: 5'-CCCgAATTCgAAgCTTCgCggCCgCAATTgTCgACggTCTAgAC -3 '(SEQ ID No 38) and 5'-CCgggTCTAgACCgTCgACAATTgCggCCgCgAAgCTTCgAATTCgg gAgCT-3' (SEQ ID No 39). The adenovirus 2 fiber gene, after amplification by PCR, using the following primers 5'- AggAAAAAAgCggCCgCCACCATggCgAAACgCgCCAgACCgTC-3 '(SEQ ID No 40) in 5' and 5 * -AggAAAAAAggTCgACCATgCAACAggTTCACg-3 No 41) in 3 ', was inserted between the Notl and Sali sites. The 5 'primer was designed to modify the sequence in the vicinity of the translation initiation codon (Kozak consensus).

Finally, the ADΝc of exons 2 and 3 of the TPL of adenovirus 2 was inserted between the HmdlII and Notl sites of the vector. This ADΝc was obtained by PCR amplification after retrotranscription of the ARΝ extracted from HeLa cells 24 hours after infection with the wild strain of adenovirus 2. The primers used have the sequence: 5'- AggAAAAAAgAAgCTTCTCgCggTTgAggACAAACTCTTCgC-3 '(SEQ ID Νo 42) in 5 'and 5'-AggAAAAAAggCggCCgCTTgCgACTgTgACTggTTAgACgCC-3 (SEQ ID Νo 43) in 3'.

The plasmid obtained was transfected by lipofection into the cell line HEK293 (Graham et al, 1977), the cell clones resistant to Geneticin were analyzed for the expression of the adenovirus fiber. The clone with the highest expression (247 ^E ) was used for the transfection of viral genomes and the first production cycles of recombinant adenoviruses having a chimeric fiber.

The stage of maturation and the protein content of all the recombinant viral particles were compared by SDS-PAGE analysis of virus preparations. The adenoviruses were isolated by isopycnic gradient ultracentrifugation of cesium chloride so as to purify the population of infectious virus at a density of 1.34 g mL. SDS-PAGE analysis of the viruses has shown that the maturation of the viral particles is not altered by the presence of chimeric fiber proteins. The various precursor proteins were cleaved into mature proteins, in particular the pVH protein. The viral proteins were transferred to the membrane and the fiber proteins were revealed with a monoclonal antibody. The fiber protein appears at the expected size (Figure 11 A, line 4).

5- Cell tropism

A set of human cell lines were tested for their sensitivity to the vector presenting a chimeric fiber by determining the level of activity of β-galactosidase (FIG. 12). The vector having the HAdV2 / BAV4 fibers showed a reduced capacity to infect human cells. To obtain a similar level of reporter activity, the amount of initial virus was increased 5 to 10 times compared to a natural virus (Figure 12A, B). For Daudi and Jurkat non-permissive cells, the adenoviral vector presenting a chimeric fiber showed reduced infectivity compared to the vector presenting a HAdV5 fiber (FIG. 12E). In order to analyze the interaction of the vector with hCAR, the infectivity of cells

CHO expressing or not hCAR was compared. Unlike the natural vector, no difference in infectivity was observed with the vector having an HAdV2 / BAV4 fiber in the two types of CHO cell lines (Figure 13). Surprisingly, this vector with a chimeric fiber very effectively infects parental CHO cells, suggesting the presence of a specific unidentified receptor on these cells. These results also confirm the normal maturation of the modified vectors, since these hybrid vector particles effectively infect the lines. CHO cell phones. The infectivity of CHO cells prompted the inventors to analyze the tropism of the vector presenting the chimeric fiber on human ovarian cancer cells. The SKOV3 cell line was infected with increasing amounts of the two vectors and expression of the reporter gene was determined 24 h after infection. The SKOV3 cell line (FIG. 14) appeared more permissive to the vector presenting the chimeric fiber than to the control vector. These results suggest that the adenoviral vector presenting the chimeric fiber HAdV2 / BAV4 recognizes a receptor expressed on the surface of ovary cells. This adenoviral vector devoid of interaction with hCAR and having a tropism for ovarian cells is a very interesting candidate for the development of a therapeutic gene vector for in vivo therapy.

Bibliography

Bergelson JM, Cunningham JA, Droguett G., Kurt- Jones EA, Krithivas A., Hong JS, Horwitz MS, Crowell RL, and Finberg RW, 1997. Isolation of a common receptor for Coxsackie B viruses and adenoviruses 2 and 5. Science 275, 1320-1323.

Biermann V., Volpers C, Hussmann S., Stock A., Kewes H., Schiedner G., Herrmann A., and Kochanek S., 2001. Targeting of high-capacity adenoviral vectors. Hmm. Gene Yesterday. 12, 1757-1769.

Chartier C, Degryse E., Gantzer M., Dieterle A., Pavirani A., and Mehtali M., 1996. Efficient generation of recombinant adenovirus vectors by homologous recombination in Escherichia coli. J. Virol. 70, 4805-4810.

Cripe TP, Dunphy EJ, Holub AD, Saini A., Vasi NH, Mahller YY, Collins MH, Snyder JD, Krasnykh V., Curiel DT, Wickham TJ, DeGregori J., Bergelson JM, and Currier MA, 2001. Fiber knob modifications overcome low, heterogeneous expression of the coxsackievirus-adenovirus receptor that limits adenovirus gene transfer and oncolysis for human rhabdomyosarcoma cells. Cancer Res. 61, 2953-2960.

Goldman C.K., Rogers B.E., Douglas J.T., Sosnowski B.A., Ying W., Siegal G.P., Baird A., Campain J.A., and Curiel D.T., 1997. Targeted gene delivery to Kaposi's sarcoma cells via the fibroblast growth factor receptor. Cancer Res. 57, 1447-1451. Graham F.L., Rudy J., and Brinkley P., 1989. Infectious circular DNA of human adenovirus type 5: regeneration of viral DNA termini from molecules lacking terminal sequences. EMBO J.. 8, 2077-2085.

Graham F.L., Smiley J., Russell W.C., and Nairn R., 1977. Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J. Gen. Virol. 36, 59-74. Grill J., Van Beusechem VW, Van D., V, Dirven CM., Leonhart A., Pherai DS, Haisma HJ, Pinedo HM, Curiel DT, and Gerritsen WR, 2001. Combined targeting of adenoviruses to integrins and epidermal growth factor receptors increases gene transfer into primary glioma cells and spheroids. Clin. Cancer Res. 7, 641-650.

Haisma HJ, Pinedo HM, vanRijswijk A., vanderMuelenMuileman I., Sosnowski BA, Ying W., vanBeusechem VW, Tillman BW, Gerritsen WR, and Curiel DT, 1999. Tumor-specific gene transfer via an adenoviral vector targeted to the pan- carcinoma antigen EpCAM. Gene Therapy. 6, 1469-1474.

Hong JS and Engler JA, 1996. Domains required for assembly of adenovirus type 2 fiber trimers. J. Virol. 70, 7071-7078. Kasono K., Blackwell JL, Douglas JT, Dmitriev L, Strong TV, Reynolds P., Kropf DA, Carroll WR, Peters GE, Bucy RP, Curiel DT, and Krasnykh V., 1999. Selective gene delivery to head and neck cancer cells via an integrin targeted adenoviral vector. Clin. Cancer Res. 5, 2571-2579. Kelly FJ, Miller CR, Buchsbaum DJ, Gomez-Navarro J., Barnes MN, Alvarez RD, and Curiel DT, 2000. Selectivity of TAG-72-targeted adenovirus gene transfer to primary ovarian carcinoma cells versus autologous mesothelial cells in vitro. Clin. Cancer Res. 6, 4323-4333. Kirby L, Davison E., Beavil AJ, Soh CPC, Wickham TJ, Roelvink PW, Kovesdi L, Sutton BJ, and Santis G., 1999. Mutations in the DG loop of adenovirus type 5 fiber knob protein abolish high-affinity binding to its cellular receptor CAR. J. Virol. 73, 9508-9514.

Krasnykh V., Belousova N., Korokhov N., Mikheeva G., and Curiel D.T., 2001. Genetic targeting of an adenovirus vector via replacement of the fiber protein with the phage T4 fibritin. J. Virol 75, 4176-4183.

Lambris J.D., Garni V.S., Hirani S., and Muller-Eberhard H.J., 1985. Mapping of the C3d receptor (CR2) -binding site and a neoantigenic site in the C3d domain of the third component of complement. Proc. Natl. Acad. Sci. U. S. A 82, 4235-4239. Louis N., Fender P., Barge A., Kitts P., and Chroboczek J., 1994. Cell-binding domain of adenovirus serotype 2 fiber. J. Virol. 68, 4104-4106.

Nakamura T., Sato K., and Hamada H., 2002. Effective gene transfer to human melanomas via integrin-targeted adenoviral vectors. Hmm. Gene Ther. 13, 613-626.

Nemerow G.R., Houghten R.A., Moore M.D., and Cooper N.R., 1989. Identification of an epitope in the major envelope protein of Epstein- Barr virus that mediates viral binding to the B lymphocyte EBV receptor (CR2). Cell 56, 369-377.

Nemerow GR, Mold C, Schwend VK, Tollefson V., and Cooper NR, 1987. Identification of gp350 as the viral glycoprotein mediating attachment of Epstein-Barr virus (EBV) to the EBV / C3d receptor of B cells: sequence homology of gp350 and C3 complement fragment C3d. J. Virol. 61, 1416-1420.

Renaut L., Bernard C, and D'Halluin J.C., 2002. A rapid and easy method for production and selection of recombinant adenovirus genomes. J. Virol. Methods 100, 121-131.

Schneider H., Graves M., Muhle C, Reynolds PN, Knight A., Themis M., Carvajal J., Scaravilli F., Curiel DT, Fairweather NF, and Coutelle C, 2000. Retargeting of adénoviral vectors to neurons using the Hc fragment of tetanus toxin. Gene Therapy. 7, 1584-1592.

Tanner J., Weis J., Fearon D., Whang Y., and Kieff E., 1987. Epstein-Barr virus gp350 / 220 binding to the B lymphocyte C3d receptor mediates adsorption, capping, and endocytosis. Cell 50, 203-213.

Vanderkwaak TJ, Wang M., Gomez-Navarro J., Rancourt C, Dmitriev L, Krasnykh V., Barnes M., Siegal GP, Alvarez R., and Curiel DT, 1999. An advanced generation of adenoviral vectors selectively enhances gene transfer for ovarian cancer gene therapy approaches. Gynecol. Oncol. 74, 227-234.

Watkins S.J., Mesyanzhinov V.V., Kurochkina L.P., and Hawkins R.E., 1997. The 'adenobody' approach to viral targeting: specify and enhanced adenoviral gene 5 delivery. Gene Therapy. 4, 1004-1012.

Wickham T.J., Tzeng E., Shears L.L., Roelvink P.W., Li Y., Lee G.M., Brough D.E., Lizonova A., and Kovesdi L, 1997. Increased in vitro and in vivo gene transfer by adenovirus vectors containing chimeric fiber proteins. J. Virol. 71, 8221-8229.

Yoon S.K., Mohr L., ORiordan C.R., Lachapelle A., Armentano D., and Wands J.R., 10 2000. Targeting a recombinant adenovirus vector to HCC cells using a bifunctional Fab-antibody conjugate. Biochem. Biophys. Res. Common. 272, 497-504.

Claims

1. Recombinant adenovirus characterized in that it comprises a modified fiber whose sequence comprises a targeting peptide specific for a CD21 receptor.

2. Adenovirus according to claim 1, characterized in that the targeting peptide comprises the sequence GEDPGFFNVE, GEDPGFFNVEIP, EDPGFFNVEIPEFPF or GEDPGFFNVEIPEFP, or a functional part thereof.

3. Adenovirus according to claim 1 or 2, characterized in that the targeting peptide is introduced at the C-terminal end of the fiber or in the sequence of the HI loop.

4. Adenovirus according to any one of the preceding claims, characterized in that the targeting peptide is linked directly to the protein of the fiber, or via a spacer sequence.

5. Adenovirus according to claim 4, characterized in that the spacer sequence comprises an amino acid sequence (SG) j in which i is an integer between 1 and 7.

6. Adenovirus according to any one of the preceding claims, characterized in that the fiber further comprises one (or more) additional alteration in the button of the fiber reducing or blocking its interaction with the CAR receptor.

7. Adenovirus according to claim 6, characterized in that the additional alteration is chosen from a mutation in the DG loop of the fiber button, the replacement of the fiber button by the domain which allows the trimerization of the bacteriophage fibritin T4 and replacement of the fiber button with the fiber button of a non-Mastadenovirus adenovirus.

8. Recombinant Mastadenovirus adenovirus, characterized in that it comprises a modified fiber, the fiber button of which has been replaced by the fiber button of an adenovirus of the Atadenovirus family.

9. Adenovirus according to claim 8, characterized in that said adenovirus of the Atadenovirus family is bovine adenovirus 4 (BAV4) or of the virus responsible in chicken for "Egg Drop Syndrome" (EDS).

10. Adenovirus according to claim 9, characterized in that said adenovirus of the Atadenovirus family is bovine adenovirus 4 (BAV4).

11. Adenovirus according to any one of the preceding claims, characterized in that it comprises a recombinant adenoviral genome comprising two ITR terminal regions, an encapsidation sequence (ψ) and a DNA sequence of interest, the transfer of which or expression in a specific host is desired.

12. Adenovirus according to claim 11, characterized in that it comprises an adenoviral genome defective for the El region.

13. Adenovirus according to any one of the preceding claims, characterized in that it is produced from an adenovirus of serotype 2 or 5.

14. Method for producing a recombinant adenovirus according to one of claims 1 to 13, comprising (i) the construction of a gene encoding the modified fiber,

(ii) the introduction of this gene into an adenoviral genome, (iii) the introduction of the adenoviral genome into an packaging cell, (iv) amplification of the virus and (v) purification of the viruses produced.

15. Adenovirus fiber protein, characterized in that it comprises a specific targeting peptide for a CD21 receptor.

16. Protein according to claim 15, characterized in that it also comprises a modification of the button of the fiber reducing the interaction with the CAR receptor.

17. Fiber protein of an adenovirus Mastadenovirus, characterized in that the fiber button has been replaced by the fiber button of an adenovirus of the Atadenovirus family.

18. Protein according to claim 17, characterized in that said adenovirus of the Atadenovirus family is bovine adenovirus 4 (BAV4).

19. Nucleic acid encoding a fiber protein according to one of claims 15 to 18.

20. Vector comprising a nucleic acid according to claim 19.

21. Method for the transfer of a nucleic acid into a B lymphocyte in vitro or ex vivo, comprising bringing an organism, tissue, biological sample or cells comprising B lymphocytes into contact with a recombinant adenovirus, said recombinant adenovirus comprising said nucleic acid and comprising a modified fiber comprising a targeting peptide specific for a CD21 receptor.

22. Method for the transfer of a nucleic acid into an ovary cell in vitro or ex vivo, comprising bringing an organism, tissue, biological sample or cells comprising ovary cells into contact with a recombinant adenovirus Mastadenovirus , said recombinant adenovirus comprising said nucleic acid and comprising a modified fiber whose fiber button has been replaced by the fiber button of an adenovirus of the Atadenovirus family.

23. Pharmaceutical composition comprising a recombinant adenovirus according to one of claims 1 to 13 and a pharmacologically acceptable vehicle.

24. Use of a recombinant adenovirus according to one of claims 1 to 7 for the preparation of a composition intended for the transfer of genes into B lymphocytes.

25. Use of a recombinant adenovirus according to one of claims 8 to

10 for the preparation of a composition intended for the transfer of genes into ovarian cells.