FR2674537A1 - Protein with cytokine type activity, recombinant DNA encoding this protein, transformed animal cells - Google Patents

Abstract

The present invention relates to a protein with cytokine type activity which comprises a subsequence of at least 69 amino acids of the following amino acid sequence (a1): (a1): or a sequence having a high degree of homology with the sequence (a1).

Description

Protein with cytokine-like activity, recombinant DNA coding for this protein, transformed animal cells.

The subject of the present invention is a new protein, the genetic engineering tools for producing it, namely a recombinant DNA, an expression vector carrying this recombinant DNA, the prokaryotic microorganisms and the eukaryotic cells containing this recombinant DNA as well as '' a drug, useful in particular as an anticancer or immunomodulating agent, containing this protein as an active ingredient
It is well known that the immune system includes cellular elements and soluble proteins secreted by them, called cytokines. These are proteins that ensure communication between an emitting cell and a target cell belonging either to the immune system or to another biological system in the body. Cytokines generally have a so-called pleitropic biological activity: they can have multiple actions on the target cell: proliferation, differentiation, cytolysis, activation, chemotaxis, etc. Several of these molecules have already found applications in therapy: for example, interleukin-2 or interferon- used for treatment certain tumors by immunotherapy and myelopoetic factors such as GCSF (Granulocyte Colony Stimulating Factor) or GMCSF (Granulocyte Monocyte Colony Stimulating
Factor) which stimulate the growth and differentiation of blood cells and thus allow the enrichment in the latter of the blood depleted in them, following, for example, chemotherapy.

In particular, we have the following knowledge about cytokines:
1) These correspond to secreted proteins. The secretion of a protein, therefore in particular of a cytokine, is most often effected by a mechanism which comprises the cleavage of a hydrophobic aminoterminal region of the translated protein, called pre peptide sequence or signal peptide, during l excretion of the mature protein in the medium (Von Heijne G. 1986,
Nucl. Ac. Res., 14, 4683-4690). Most of the peptide sequences of known cytokines do indeed include a signal peptide.

 2) Cytokines generally correspond to inducible proteins, either by other cytokines (K. Matsushima et al., 1988, J. Exp. Med., 167, 1883-1893 - Shimizu H. et al., 1990, Mol.

Cell. Biol., 10, 561-568), either by chemical agents activating proliferation and cell differentiation such as lipopolysaccharides, calcium ionophores for example calimicine, cyclic dibutyryl AMP, dimethyl sulfoxide,
Retinoic acid, concanavalin A, phytohemaglutidine (PHA-P) and phorbol esters, for example phorbol myristate2 acetate-3 (PMA) (Muegge K. and Durun SK 1990 Cytokine 2, 1-8
CB Thompson et al., 1989, Proc. Natl. Acad. Sci., 86, 1333-1337), either by antibodies against surface molecules, such as the surface antigens CD2, CD3, CD28 and CD40 (Thomson CB et al., Reference above and Rousset F. et al ., 1991, J. Exp. Med., 173, 703-710).

 3) As the induction of cyokines is transient, the messenger RNAs of cytokines are unstable. Most of the cytokines have the AUUUA sequence, a consensus instability sequence demonstrated by D. Caput et al., 1986, Proc. Ntl. Acad.

Sci. USA, 83, 1670-1670; G. Shaw et al., 1986, Cell, 46 659-667 as well as K. Peppel et al., 1991, J. Exp. Med., 173, 349-355.

 4) The vast majority of known cytokines are synthesized by cells of the immune system, in particular by monocytes and helper T lymphocytes of peripheral blood (Ullman KS et al., 1989, Ann. Rev. Imm., 8, 421-452 and The book "Macrophage derived cell regulatory factors" by C. Sorg, pub linked in 1989 by Karger-Basel-Switzerland). Their synthesis is induced by the inducing agents mentioned in 2).

 It is also known that we are able to construct from peripheral blood mononuclear cells, consisting mainly of lymphocytes and monocytes, cultured and stimulated using various inducing agents such as phytohemaglutinin, phorbol myristate-2 acetate-3 and The anti-CD2 monoclonal antibody, a complementary DNA library subtracted from ubiquitous complementary DNA sequences in animal cells, and therefore enriched in complementary DNA coding for cytokines (HC Chang et al., 1989, 19, 1045-1051, PF Zipfel et al., 1989, Mol. Cell. Biol, 9, 1041-1048).

We also know that the production of cytokines (called lymphokines) by T lymphocytes is greater, therefore corresponds to larger quantities of messenger RNA, with stimulation using the binary combination: phorbol myristate- 2 acetate-3 and phytohemaglutinin or phorbol myristate-2 acetate-3 and the anti-CD28 antibody only with phorbol myristate-2 acetate-3 only and with the binary combination: phorbol myristate-2 acetate-3 and phytohemaglutinin with the tertiary combination: phorbol myristate-2 acetate-3, phytohemaglutinin and cyclosporin A, cyclosporin A apparently having an inhibiting effect on the transcription of messenger RNAs of cytokines (Thompson et al., 1989, Proc. Ntl. Acad. Sci. , 86, 1333-1337 and Lindsten
T. et al., 1989, Science, 244, 339 and Mattila et al., 1990, EMBO
J., 9, 4425-4433).

This differential expression of cytokine messenger RNAs under different stimulation conditions can be used for screening, called differential screening, of a complementary DNA library containing sequences coding for cytokines in
The purpose of selecting these last sequences (cf. in particular
Dworkin et al., 1980, Dev. Biol., 76, 449-464, Cochran BM et al., 1983, Cell, 33, 939-947 and Zipfel PF et al., 1989, Mol. Cell.

Biol., 9, 1041-1048). It is indeed possible to construct from two messenger RNAs corresponding to two stimulation states of the cells, here called stimulation state 1 and stimulation state 2, stimulation state 2 being supposed to be richer in messenger RNA coding for a cytokine that State 1, two radioactive probes called probe 1 and probe 2 respectively, which are transcripts obtained using the reverse transcriptase of these two messenger RNAs. These two probes are hybridized with bacterial colonies containing DNA sequences complementary to the bank. The bacterial colonies containing a complementary DNA whose messenger RNA changes in abundance between the two activation states will give differential signals with the two probes, Hybridization being more important for the clones retained (which correspond to inducible proteins ) for probe 2 that pushes probe 1.

 It is also known that your COS cells, monkey kidney cells expressing the T antigen of the SV40 virus (Gluzman, Y.

Cell, 23, 1981, 175-182), which allow the replication of vectors containing the origin of replication of the DNA of the SV40 virus, constitute hosts of choice for the study of gene expression in animal cells. and secretion of the expressed proteins. The secretion of a protein in these cells indicates that this protein is secreted by the cell which produces it naturally (HC Chang et al., 1989, 19, 1045-1051 and WY Weiser et al., 1989, Proc. Ntl. Acad. Sci. USA, 86, 7522-7526).

The subject of the present invention is a protein with cytokine-type activity, characterized in that it comprises a subsequence of at least 69 amino acids from one of the amino acid sequences (a1), (a2) or (a3) below: (al)
Thr Val Ile Ala Leu Thr Cys Leu Gly Gly Phe Ala Ser Pro Gly Pro Val
Pro Pro Ser Thr Ala Leu Arg Glu Leu Ile Glu Glu Leu Val Asn Ile Thr
Gln Asn Gln Lys Ala Pro Leu Cys Asn Gly Ser Met Val Trp Ser Ile Asn
Leu Thr Ala Asp Met Tyr Cys Ala Ala Leu Glu Ser Leu Ile Asn Val Ser
Gly Cys Ser Ala Ile Glu Lys Thr Gln Arg Met Leu Ser Gly Phe Cys Pro
His Lys Val Ser Ala Gly Gln Phe Ser Ser His His Arg Arg Asp Thr Lys Ile Glu Val Ala Gln Phe Val Lys Asp Leu Leu Leu His Leu Lys Lys Leu
Phe Arg Glu Gly Arg Phe Asn (a2)
Leu Thr Cys Leu Gly Gly Phe Ala Ser Pro Gly Pro Val Pro Pro Ser Thr
Ala Leu Arg Glu Leu Ile Glu Glu Leu Val Asn Ile Thr Gln Asn Gln Lys
Ala Pro Leu Cys Asn Gly Ser Met Val Trp Ser Ile Asn Leu Thr Ala Asp
Met Tyr Cys Ala Ala Leu Glu Ser Leu Ile Asn Val Ser Gly Cys Ser Ala Ile Glu Lys Thr Gln Arg Met Leu Ser Gly Phe Cys Pro His Lys Val Ser
Ala Gly GLn Phe Ser Ser Leu His Val Arg Asp Thr Lys Ile Glu Val Ala
Gln Phe Val Lys Asp Leu Leu Leu His His Lys Lys Leu Phe Arg Glu Gly
Arg Phe Asn (a3) ::
Ser Pro Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Glu Leu Ile Glu Glu
Leu Val Asn Ile Thr Gln Asn GLn Lys Ala Pro Leu Cys Asn Gly Ser Met
Val Trp Ser Ile Asn Leu Thr Ala Asp Met Tyr Cys Ala Ala Leu Glu Ser
Leu Ile Asn Val Ser Gly Cys Ser Ala Ile Glu Lys Thr Gln Arg Met Leu
Ser Gly Phe Cys Pro His Lys Val Ser Ala Gly Gln Phe Ser Ser Leu His
Val Arg Asp Thr Lys Ile Glu Val Ala Gln Phe Val Lys Asp Leu Leu Leu
His Leu Lys Lys Leu Phe Arg Glu Gly Arg Phe Asn or of a sequence having a high degree of homology with the sequences (a1), (a2) or (a3).

 This subsequence of at least 69 amino acids can originate from a carboxy- and / or amino-terminal cleavage of one of the sequences (a1), (a2) or (a3) or of a sequence having a degree of high homology with One of the sequences (a1), (a2) or (a3). It can also be One of the sequences (a1), (a2) or (a3) or a sequence having a high degree of homology with One of the sequences (a1), (a2) or (a3).

 A high degree of homology here signifies identity homology (ratio between identical amino acids and the total number of amino acids) of at least 80%, and preferably at least 90%, of the sequences of amino acids, when aligned according to maximum homology, according to the optimal sequence alignment method of Needleman and Wunsch, 1970, J. Mol. Biol., 48, 443-453. This algorithmic method, which considers all possible alignments and creates an alignment in which the most possible identical amino acids are matched and the number of holes in the aligned sequences is minimal, is notably used in the UWGCG software of l 'University of Wisconsin: Devereux et al., 1984, Nucl. Ac. Res., 12, 8711-8722 - GAP option.

 The peptide sequence already known closest to that of the sequence (a3) of 114 amino acids is that of 132 amino acids deduced from the cDNA of the mouse protein P600, expressed in a subclass of mouse T lymphocytes: Th2 cells activated with concanavalin A (KD Brown et al., 1989, J. Imm., 142, 679-687). A comparison of these peptide sequences using the method of Needleman and Wunsch, (cf.

Figure 3) shows that 64 amino acids are identical out of 114, i.e. an identity homology of approximately 56%.

 The protein of the present invention is a protein secreted in particular by T lymphocytes and inducible in the latter by phorbol myristate-2 acetate-3, this induction being - as expected for a cytokine (see text above) amplified by phytohemaglutinin or the monoclonal antibody CD28 with an inhibitory effect of this increase in the case of stimulation by phytohemaglutanine in the additional presence of cyclosporin A. It has a cytokine type activity and may be useful in particular in cancerology as well as in treatment by immunomodulation of certain infectious states.

 This protein is preferably in a form which has an apparent molecular mass, determined by electrophoresis on polyacrylamide gel in the presence of SDS of 9.0 + 1.5 or 17.0 + 1.5 kDa. When it is in a molecular mass form of 17.0 + 1.5 kDa, it is advantageously n-glycosylated.

 The subject of the invention is also a recombinant DNA characterized in that it codes for the protein with cytokine-type activity defined above.

 The complementary DNA corresponding to this protein was isolated from a complementary DNA library constructed from human peripheral blood mononuclear cells stimulated with phytohemaglutinin and phorbolmyristate-2 acetate-3, subtracted from the sequences. of complementary DNA from unstimulated COS cells, this complementary DNA library having a richness of at least 10% in clones which contain a complementary DNA coding for an already known cytokine, by differential screening using four constructed probes from messenger RNAs corresponding to the following states of stimulation of peripheral blood mononuclear cells: a) in the presence of phorbol myristate-2 acetate-3, b) in the presence of phorbol myristate2 acetate-3 and of the monoclonal antibody CD28, c ) in the presence of phorbol myristate-2 acetate-3 and phytohemaglutinin, d) in the presence of phorbol myristate-2 acetate-3, of phytohemaglutinin and of cyclosporin A. The isolated complementary DNA comprises a sequence coding for a signal peptide and the ATTTA sequence corresponding to the consensus instability sequence of the AUUUA cytokines mentioned above.

 This recombinant DNA preferably comprises, upstream of the sequence coding for the subsequence of at least 69 amino acids of one of the sequences (a1), (a2) or (a3) or of a sequence having a degree of high homology with One of the sequences (a1), (a2) or (a3), a signal sequence, chosen according to the host cell, which has the function of allowing the export of the recombinant protein outside the cytoplasm, which allows the recombinant protein to take a conformation close to that of the natural protein and considerably facilitates its purification. This signal sequence codes for a peptide sequence which can be cleaved, either in a single step by a signal-peptidase which releases the mature protein, the eliminated sequence is usually called pre or peptide-signal sequence, or in several stages when this peptide sequence comprises in addition to the sequence eliminated by the signal-peptidase, called the pre sequence, a sequence eliminated later during one or more proteolytic events, called the pro sequence.

In the case where the sub-sequence of at least 69 amino acids is the sequence (a3) or the sequence exhibiting a high degree of homology with the sequence (a3), the signal peptide encoded by the signal sequence may be either immediately upstream of the sequence (a3) or of the sequence having a high degree of homology with the sequence (a3), either to be separated from it by one or more amino acids, in particular by the amino acid sequence ( C1) next
Leu Thr Cys Leu Gly Gly Phe Ala
For expression in prokaryotic microorganisms, such as for example Escherichia coli, this signal sequence can be either a sequence derived from the sequence coding for a natural precursor of a protein exported by a prokaryotic microorganism (for example the signal peptide OmPA CGhrayeb et al. 1984, EMBO Journal, 3, 2437-24427 or the signal peptide of alkaline phosphatase EMichaeLis et al., J. Bact., 1983, 154, 366 374), i.e. a non-endogenous sequence originating from a sequence coding for a eukaryotic precursor (for example the signal peptide of one of the natural precursors of human growth hormone), ie a sequence coding for a synthetic signal peptide (for example that described in French patent application n 2 636 643, sequence: Met Ala Pro Ser Gly Lys Ser Thr Leu Leu
Leu Leu Phe Leu Leu Leu Cys Leu Pro Ser Trp Asn Ala Gly Ala).

For expression in eukaryotic cells such as ascomycetes, for example Yeast Saccharomyces cerevisiae or the filamentous fungus Cryphonectria parasitica, this signal sequence is preferably a sequence derived from a sequence coding for a natural precursor of a protein secreted by these ceLLuLes, for example for yeast, the precursor of invertase (patent application EP 0 123 289) or the precursor of the prepro sequence of the alpha pheromone (patent application
DK 2484/84), or for Cryphonectria parasitica, the precursor of the endothiapepsin prepro sequence, of sequence ::
Met Ser Ser Pro Leu Lys Asn Ala Leu Val Thr Ala Met Leu Ala Gly Gly
Ala Leu Ser Ser Pro Thr Lys Gln His Val Gly Ile Pro Val Asn Ala Ser
Pro Glu Val Gly Pro Gly Lys Tyr Ser Phe Lys Gln Val Arg Asn Pro Asn
Tyr Lys Phe Asn Gly Pro Leu Ser Val Lys Lys Thr Tyr Leu Lys Tyr Gly
Val Pro ILe Pro Ala Trp Leu Glu Asp Ala Val Gln Asn Ser Thr Ser Gly
Leu Ala Glu Arg
For expression in Les anima cells, the signal sequence used is either a signal sequence of an anima cell protein known to be exported - for example a sequence coding for the signal peptide of one of the natural precursors of L human growth hormone, already known to allow the secretion of interleukin-2 (cf. French patent application 2 619 711) -; either one of the three signal sequences explained below.

A signal sequence appreciated for expression in animal cells is that which codes for the following amino acid sequence (b1):
Met Ala Leu Leu Leu Thr Thr Val Ile Ala Leu Thr Cys Leu Gly Gly Phe
To the
This signal sequence is for example the following nucleotide sequence (Nb1):
ATGGCGCTTT TGTTGACCAC GGTCATTGCT CTCACTTGCC TTGGCGGCTT TGCC
Another signal sequence appreciated for expression in animal cells is that which codes for the following sequence (b2).

Met His Pro Leu Leu Asn Pro Leu Leu Leu Ala Leu Gly Leu Met Ala Leu
Leu Leu Thr Thr Val Ile Ala Leu Thr Cys Leu Gly Gly Phe Ala for example the following nucleotide sequence (Nb2)
ATGCATCCGC TCCTCAATCC TCTCCTGTTG GCACTGGGCC TCATGGCGCT TTTGTTGACC
ACGGTCATTG CTCTCACTTG CCTTGGCGGC TTTGCC
Another signal sequence appreciated for an expression in your animal cells is that which codes for the following sequence (b3):
Met His Pro Leu Leu Asn Pro Leu Leu Leu Ala Leu Gly Leu Met Ala Leu
Leu Leu Thr Thr Val Ile Ala for example the following sequence (Nb3):
ATGCATCCGC TCCTCAATCC TCTCCTGTTG GCACTGGGCC TCATGGCGCT TTTGTTGACC
ACGGTCATTG CT
The nucleotide sequence coding for the amino acid sequence (a3) is for example the following sequence (Na1):
TCCCCAGGCC CTGTGCCTCC CTCTACAGCC CTCAGGGAGC TCATTGAGGA.GCTGGTCAAC
ATCACCCAGA ACCAGAAGGC TCCGCTCTGC AATGGCAGCA TGGTATGGAG CATCAACCTG
ACAGCTGACA TGTACTGTGC AGCCCTGGAA TCCCTGATCA ACGTGTCAGG CTGCAGTGCC
ATCGAGAAGA CCCAGAGGAT GCTGAGCGGA TTCTGCCCGC ACAAGGTCTC AGCTGGGCAG
TTTTCCAGCT TGCATGTCCG AGACACCAAA ATCGAGGTGG CCCAGTTTGT AAAGGACCTG
CTCTTACATT TAAAGAAACT TTTTCGCGAG GGACGGTTCA AC
The invention also relates to an expression vector which carries, with the means necessary for its expression, the recombinant DNA defined above.

 For expression in prokaryotic microorganisms, in particular in Escherichia coli, the recombinant DNA must be inserted into an expression vector comprising in particular an effective promoter, followed by a ribosome binding site upstream of the gene to be expressed. , as well as an efficient transcription stop sequence downstream of the gene to be expressed. This plasmid must also include an origin of replication and a selection marker. All these sequences must be chosen according to the host cell.

 For expression in eukaryotic cells, the expression vector according to the invention carries the recombinant DNA defined above with the means necessary for its expression, for its replication in eukaryotic cells and for the selection of the transformed cells. Preferably, this vector carries a selection marker, chosen for example to complement a mutation of the eukaryotic receptor cells, which allows the selection of cells which have integrated the recombinant DNA into a high copy number either in their genome or in a multicopy vector.

 For expression in eukaryotic cells such as yeast, for example Saccharomyces cerevisiae, the recombinant DNA should be inserted between, on the one hand, sequences recognized as an effective promoter, on the other hand, a transcription terminator. The promoter-coding-terminator assembly, called the expression cassette, is cloned either into a single-copy or mimeographed plasmid vector for yeast, or integrated into the yeast genome by multicopy.

For expression in eukaryotic cells such as those of filamentous fungi, of the group of ascomycetes, for example those of the genera Aspergillus, Neurospora, Podospora,
Trichoderma or Cryphonectria, the expression vector according to the invention carries the recombinant DNA defined above with the means necessary for its expression, and optionally a selection marker and / or telomeric sequences. It is indeed possible to select the transformants having integrated DNA of interest using a selection marker located either on the same vector as DNA of interest, or on another vector, these two vectors being then introduced by cotransformation. The recombinant DNA of the invention can either be integrated into the genome of filamentous fungi, or conserved in extrachromosomal form thanks to sequences allowing replication and partitioning of this DNA.

For expression in anima Les cells, in particular in Chinese hamster ovary CHO cells, the recombinant DNA is inserted into a plasmid (for example derived from pBR322) comprising two expression units, a first unit in which is inserted Recombinant DNA in front of an effective promoter (for example the SV40 early promoter). The sequence around the initiation ATG is preferably chosen according to the consensus sequence described by KOZAK (M. KOZAK (1978) Cell., 15, 1109-1123). An intronic sequence, for example of the intron mouse -globin, can be inserted upstream of the recombinant DNA as well as a sequence comprising a polyadenylation site, for example a polyadenylation sequence of SV40, downstream of the recombinant gene. The second expression unit comprises a selection marker, for example a DNA sequence coding for dihydrofolate reductase (enzyme hereinafter abbreviated DHFR). The plasmid is transfected into anima Les cells, for example cells
CHO DHFR (unable to express DHFR). A line is selected for its resistance to methotrexate: it has integrated into its genome a high number of copies of recombinant DNA and expresses it at a high level.

The invention also relates to prokaryotic microorganisms which are transformed by the expression vector defined above and to eukaryotic cells which contain, with the means necessary for its expression, the recombinant DNA defined above. This may have been introduced by transformation by the expression vector previously or by the recombinant DNA of
The invention itself, which can sometimes be integrated directly into the genome at a locus that allows its expression.

 Advantageous eukaryotic cells are Les anima cells.

 The recombinant DNA may, for example, have been introduced into the cells by transfection with the expression vector above, by infection using a virus or a retrovirus carrying it, or by micro-injection.

 The invention also relates to the recombinant protein with cytokine activity capable of being obtained by a method which comprises a stage of culture of these anima Les cells, followed by the isolation and purification of the recombinant protein.

 A subject of the invention is therefore also the medicament, useful in particular in oncology and in the treatment of certain infectious states, during which the immune defenses are weakened, following for example the presence of certain parasites (for example leishmaniasis, leprosy or Chagas disease), which contains as active ingredient the protein defined above in a pharmaceutically acceptable excipient. These can be used alone or in combination with other active agents: for example one or more other cytokines.

 The invention will be better understood with the aid of the following discussion, divided into sections, which includes experimental results and a discussion of these. Some of these sections relate to experiments carried out with the aim of carrying out the invention, others to examples of carrying out the invention given, of course, purely by way of illustration.

A large part of the set of techniques described in these sections, well known to those skilled in the art, is described in detail in The work by Sambrook Fritsch and Maniatis: "Molecular cloning: a Laboratory manual" published in 1989 by Cold editions
Spring Harbor Press in New York (2nd edition).

 The description below will be better understood with the aid of FIGS. 1 to 4.

FIG. 1 represents an assembly map of the plasmid pSE1, plasmid for cloning in E. coli and for expression in
Animal cells, the sites having disappeared by ligation being noted in parentheses. The symbols used in this figure will be specified during the description of this plasmid (section 2).

FIG. 2 represents the nucleotide sequence of the cDNA NC30 and vis-à-vis the deduced amino acid sequence, the two Met likely to initiate translation being underlined, the two probable sites of cleavage of the signal peptide being indicated by two vertical arrows and the four possible sites of
N-glycosylation being underlined in dotted lines.

FIG. 3 and FIG. 4 respectively represent the alignment according to the maximum homology according to the method of
Needleman and Wunsch, 1970, J. Mol. Biol., 48, 443-453 of the deduced amino acid sequence of the cDNA NC30 (upper line) and of the deduced sequence of the cDNA of the mouse protein P600 (lower line) and the alignment according to this method of the coding part of the NC30 cDNA (Upper line) and of the P600 protein cDNA (lower line).

SECTION 1: CULTURE and stimulation using PMA and PHA-P
Mononuclear cells from peripheral blood. Prep
ration of this messenger RNA used to make the bank
of complementary DNA
1) Culture and stimulation of peripheral blood mononuclear cells:
From peripheral blood bags (taken from three healthy volunteers in a blood transfusion center), having previously undergone cytapheresis and a Ficoll gradient (Gauchat et al., 1989, Eur. J. Imm. 19, 1079) we draws a fraction of cells enriched in peripheral blood mononuclear cells (PBMNC) with the following approximate composition: 70% lymphocytes, 25% monocytes and 5% granulocytes (counting of cells using the cell counter Coulter-Model S-Plus IV).

 the cells are collected in a 250 ml flask, then centrifuged at 1500 rpm for 10 min at 37 C. The supernatant is removed and the cell pellet is rinsed with 50 ml of medium based on glucose, mineral salts, amino acids and vitamins, called RPMI medium (RPMI 1640 medium from Gibco BRL), then centrifuged again under the same conditions.

The cell pellet is then taken up with 500 ml of RPMI medium supplemented with 10% fetal calf serum (Gibco BRLref. 013-06290H), supplemented with 10 units of penicillin and 10 μg of streptomycin (penicillin / streptomycin solution
Gibco ref. 043-05140D) per ml of medium as well as L-glutamine (Gibco BRL-ref. 043-05030D) up to 2 mM final.

 Part of the cell suspension is distributed for the separation of adherent cells and non-adherent cells, at a rate of approximately 100 ml per bottle, in four large square culture stubs (245 x 245 x 20 mm-Nunc - ref .

166508) and incubated for 1 h at 370C. It is known that most of the monocytic cells adhere to the culture dish while Most of the lymphocyte cells remain in suspension.

 The non-adherent cells are aspirated using a pipette and cultured in culture flasks of the Falcon type of 2 surface 175 cm in the presence of RPMI medium supplemented as described above, supplemented with 10 ng / ml of phorbol myristate -2 acetate-3 (PMA) (Sigma-ref. P8139) and 5, ug / ml of phytohemaglutinin (PHA-P) (Sigma-ref. L8754), at 370C in the presence of 5% of CO 2 for 24 h.

100 ml of medium are added to the adherent cells
RPMI supplemented as described above supplemented with 10 ng / ml of PMA and of 5, ug / ml of PHA-P. The cells are incubated at 370C in the presence of 5% (v / v) of CO2 for 5 h.

 The rest of the cell suspension, hereinafter called the total cells, is distributed into four square culture boots and incubated in the presence of RPMI medium supplemented as described above, supplemented with 10 ng / ml of PMA and 5 g / ml of PHA -P at 37 C in the presence of 5% (v / v) of C02 for 5 h for the first two boxes and 24 h for the other two.

 2 h before the end of the incubation, 10 μg / ml of cycloheximide (Sigma-ref. C6255) (translation inhibitor which increases the stability of the cytokine RNAs) is added to the culture medium for these different cells. et al., 1989, Science 244, 339) and The incubation is continued for 2 h at 370C.

2) Preparation of the messenger RNA: a) Extraction of the messenger RNA
The cells are recovered as follows:
- the adherent cells are washed twice with PBS buffer (phosphate buffered saline) then scraped with a rubber scraper and centrifuged. This gives a cell pellet called pellet A;
- for non-adherent cells, after shaking the bottle containing the cell suspension, the cell suspension is removed and centrifuged. This produces a cell pellet called the NA cell pellet;
- for total cells, the adherent fraction is washed twice with PBS buffer and scraped off as above and then centrifuged. The non-adherent fraction is centrifuged. The two cell pellets obtained will be combined subsequently. Their union is called cell pellet T (5 h) for the total cells incubated for 5 h and T (24 h) for the total cells incubated for 24 h.

 The cell pellets A, NA, T (5 h) and T (24 h) are frozen and stored at -800C.

Each frozen cell pellet is suspended in the lysis buffer of the following composition: guanidine-thiocyanate 5 M; tris- (hydroxymethyl) -aminomethane 50 mM pH 7.5 EDTA 10 mM. The suspension is sonicated using an Ultra o sonicator
Turax n 231 256 (Janke and Kunkel) at maximum power during four cycles of 20 s. -Mercaptoethanol is added up to 0.2 M and a sonication cycle of 30 s is repeated. Lithium chloride is added up to 3 M. The suspension is cooled to 4 C and allowed to stand at this temperature for 48 h. The RNA is then isolated by centrifugation at 9,000 rpm for 60 min. The RNA pellet is washed once with a 3M lithium chloride solution, recentrifuged, then taken up in a buffer of the following composition: SDS 1 %, 5 mM EDTA and 10 mM Tris HCL pH 7.5, supplemented with 1 mg / ml of proteinase K (Boehringer Mannheim, GmbH). After incubation at 40 ° C. for 1 hour, the RNA solution is extracted with a phenol / chloroform mixture. The RNA contained in the aqueous phase is precipitated at -200C using a final 0.3 M ammonium acetate solution and 2.5 volumes of ethanol. Centrifuge at 15,000 xg for 30 min and keep the pellet.

b) Purification of the poly A fraction of RNA
The pellet is taken up in 1 ml of composition buffer
Tris 10 mM pH 7.5 1 mM EDTA, called TE buffer and suspended by vortexing. The oligo dT-cellulose type 3 (marketed by Collaborative Research Inc, Biomedicals Product Division) is prepared according to the manufacturer's recommendations. The RNA is deposited on the oligo dT-cellulose, stirred gently to suspend the beads, then heated for 1 min at 650C.

 The suspension is adjusted to 0.5 M NaCl and then stirred gently for 10 min. The suspension is then centrifuged for 1 min at 1000 g, the supernatant is removed, the pellet is washed twice with 1 ml of TE buffer containing 0.5 M NaCl. The supernatants are eliminated. The elution of the polyaldenylated fraction of the RNAs (consisting of the messenger RNAs) is obtained by suspending the beads in 1 ml of TE buffer, then heating this suspension at 60 ° C. for 1 min, followed by stirring for 10 min on a plate. tilting. Then centrifuged for 1 min at 1000 g, which allows the supernatant containing free messenger RNA in solution to be recovered. All of the above operations (from the elution) are repeated twice. The supernatants thus obtained are combined, the residual beads are removed by centrifugation and the supernatant is precipitated with 3 volumes of ethanol and a solution of NaCL at 0.3 M final.

We thus obtain, from cell pellets A, NA,
T (5 h) and (24 h), four samples of RNA-poly A, hereinafter called RNA-poly A ± A, RNA-poly A ± NA; RNA-poly A ± T 85 h) and RNApoly A-T (24 h).

SECTION 2: Preparation of an enriched complementary DNA library
in specific sequences of the mononuclear cells of the
peripheral blood
1) Construction of the pSEI cloning vector:
The strategy implemented uses fragments obtained from pre-existing plasmids accessible to the public and fragments prepared by synthesis using the techniques now commonly used. The cloning techniques used are those described by T. Maniatis, EF. Fritsch and J.

Sambrook in "Molecular Cloning, a Laboratory manual" (Cold Spring
Harbor Laboratory, 1984). The oligonucleotides are synthesized using a Biosearch 8700 DNA synthesizer.

 The description below will be better understood with reference to FIG. 1.

sur la figure 1 de 1060 pb de L'ADN d'adénovirus type 5 entre les positions 11299 (site de restriction PvuII) et 10239 (site de restriction HpaI) (DEKKER et VAN ORMONDT, Gene 27, 1984, 115-120) contenant L'information pour les ARN VA-I et VA-II. Le site franc HpaI disparaît par ligation avec le site franc PvuII (qui disparaît également) du fragment décrit en c). Le site ApaI en position 11 218 a été enlevé par clivage à L'aide de L'enzyme ApaI, traitement à L'aide de ltexonucléase : ADN polymérase T4 et religation.This plasmid was constructed by successive ligations of the following elements: b) - a PvuII-HpaI fragment - symbolized by

in FIG. 1 of 1060 bp of adenovirus type 5 DNA between positions 11299 (restriction site PvuII) and 10239 (restriction site HpaI) (DEKKER and VAN ORMONDT, Gene 27, 1984, 115-120) Information for RNA VA-I and VA-II. The free HpaI site disappears by ligation with the free site PvuII (which also disappears) from the fragment described in c). The ApaI site at position 11 218 was removed by cleavage using the ApaI enzyme, treatment using ltexonuclease: T4 DNA polymerase and religation.

sur La figure 1 - de 344 pb, issu de L'ADN du virus SV40 obtenu par digestion complète à L'aide des enzymes de restriction PvuII et HindIII. Ce fragment comporte L'origine de réplication et le promoteur précoce de L'ADN du virus SV40 (réf. B.J. BYRNE et al. Proc. Ntl. Acad.c) - a PvuII-HindIII fragment - symbolized by

in FIG. 1 - 344 bp, derived from the DNA of the SV40 virus obtained by complete digestion using the restriction enzymes PvuII and HindIII. This fragment contains the origin of replication and the early promoter of DNA from the SV40 virus (ref. BJ BYRNE et al. Proc. Ntl. Acad.

Sci. USA (1983), 80, 721-725).

 The HindIII site disappears by ligation with the HindIII binding site of the fragment described in d).

sur la figure 1 - de 419 pb dont la séquence donnée ci-après contient une séquence proche de La séquence 5' non traduite du virus HTLVI (R. WEISS et al., "Molecular Biology of
Tumor Vireuses - part 2-2eme ed - 1985 - Cold Spring Harbor Laboraa) - un fragment PvuII-PvuII - symbolisé par +++++++ sur La figure 1 - de 2525 pb, obtenu par digestion complète du plasmide pTZ18R (Pharmacia) à L'aide de l'enzyme de restriction PvuII. Ce fragment contient l'origine de réplication du phage f1 (notée ORI f1 sur la figure 1), un gène (noté AmpR sur la figure 1) portant la résistance à l'ampicilline et L'origine de réplication (notée ORI pBR322 sur la figure 1) permettant la réplication de ce plasmide dans E. coli.Le premier site franc PvuII disparaît par Ligation avec le site franc EcoRV (qui disparaît également) du fragment décrit en g). d) - a synthetic fragment 'site binding to HindIII "-HindIII symbolized by

in FIG. 1 - 419 bp, the sequence of which given below contains a sequence close to the 5 'untranslated sequence of the HTLVI virus (R. WEISS et al., "Molecular Biology of
Tumor Vireuses - part 2-2eme ed - 1985 - Cold Spring Harbor Laboraa) - a PvuII-PvuII fragment - symbolized by +++++++ in Figure 1 - of 2525 bp, obtained by complete digestion of the plasmid pTZ18R (Pharmacia ) using the restriction enzyme PvuII. This fragment contains the origin of replication of phage f1 (denoted ORI f1 in FIG. 1), a gene (denoted AmpR in FIG. 1) carrying the resistance to ampicillin and the origin of replication (denoted ORI pBR322 in the Figure 1) allowing the replication of this plasmid in E. coli. The first free site PvuII disappears by Ligation with the free site EcoRV (which also disappears) of the fragment described in g).

tory - p. 1057) and the distal intron of the mouse oc-globin gene (U. Nishioka et al., 1979, Cell, 18, 875-882).

Site linking to HindIII VAGCTGGCTCGCATCTCTCCTTCACGCGCCCGCCGCCCTACCTGAGGCCGCCATCCACGCC
1 60
CCGAGCGTAGAGAGGAAGTGCGCGGGCGGCGGGATGGACTCCGGCGGTAGGTGCGG
GGTGAGTCGCGTTCTGCCGCCTCCCGCCTGTGGTGCCTCCTGAACTGCGTCCGCCGTCTA
61 120
CCACTCAGCGCAAGACGGCGGAGGGCGGACACCACGGAGGACTTGACGCAGGCGGCAGAT
GGTAGGCTCCAAGGGAGCCGGACAAAGGCCCGGTCTCGACCTGAGCTCTAAACTTACCTA 121 180
CCATCCGAGGTTCCCTCGGCCTGTTTCCGGGCCAGAGCTGGACTCGAGATTTGAATGGAT
GACTCAGCCGGCTCTCCACGCTTTGCCTGACCCTGCTTGCTCAACTCTACGTCTTTGTTT 181 240
CTGAGTCGGCCGAGAGGTGCGAAACGGACTGGGACGAACGAGTTGAGATGCAGAAACAAA
CGTTTTCTGTTCTGCGCCGTTACAACTTCAAGGTATGCGCTGGGACCTGGCAGGCGGCAT 241 300
GCAAAAGACAAGACGCGGCAATGTTGAAGTTCCATACGCGACCCTGGACCGTCCGCCGTA
CTGGGACCCCTAGGAAGGGCTTGGGGGTCCTCGTGCCCAAGGCAGGGAACATAGTGGTCC 301 360
GACCCTGGGGATCCTTCCCGAACCCCCAGGAGCACGGGTTCCGTCCCTTGTATCACCAGG
CAGGCCGGGGAGCAGAGGCATCAGGGTGTCCACTTTGTCTCCGCAGCTCCTGAGCCTGCA 361 420
GTCCTTCCCCTCGTCTCCGTAGTCCCACAGGTGAAACAGAGGCGTCGAGGACTCGGACGT
GA CTTCGAÂ
HindIII e) - a synthetic HindIII fragment - "BamHI binding site" - symbolized by XXXXXXX in FIG. 1 - containing the promoter of
RNA - phage T7 polymerase as well as a polylinker containing in particular the cloning sites ApaI and BamHI.

sur la figure 1 -, petit fragment obtenu par digestion complète à L'aide des enzymes BclI et BamHI du virus SV40 qui contient le site de polyadénylation tardif de ce dernier. (M. FITZGERALD et al., Cell, 24, 1981, 251-260). Les sites BamHI et BclI disparaissent par liga- tion avec respectivement le site liant à BamHI du fragment décrit en e) et le site BamHI (qui disparait égaLement du fragment décrit en g).f) - a BamHI-BclI fragment of 240 bp - represented by

in FIG. 1 -, small fragment obtained by complete digestion using the enzymes BclI and BamHI of the SV40 virus which contains the late polyadenylation site of the latter. (M. FITZGERALD et al., Cell, 24, 1981, 251-260). The BamHI and BclI sites disappear by ligating with the BamHI binding site of the fragment described in e) respectively and the BamHI site (which also disappears from the fragment described in g).

g) - a BamHI-EcoRV fragment - symbolized by 000000 in FIG. 1 - of 190 bp, a small fragment derived from the plasmid pBR322 after complete digestion using the enzymes EcoRV and BamHI. The EcoRV and BamHI sites disappear by ligation with the site respectively
PvuII of the fragment described in a) and the BclI site of the fragment described in f).

 The plasmid pSEI therefore contains the elements necessary for its use as a cloning vector in E. coli (origin of replication in E. coli and ampicillin resistance gene, originating from the plasmid pTZ18R) as well as as an expression vector in the animal cells (promoter, intron, polyadenylation site, origin of replication of the SV40 virus), and for its single-strand copy for the purpose of sequencing (origin of replication of phage f1).

2) Constitution of a complementary DNA bank enriched in specific sequences of peripheral blood mononuclear cells
The cloning technique used is that described by
Caput et al., (Primer-adapter technique: (Caput et al., Proc. Natl. Acad. Sci. (USA) (1986) 83, 1670-1674)).

On the one hand, it consists in digesting the vector pSEI by
ApaI, add a tail of polydC on the protruding 3 ′ end, then to digest the plasmids thus obtained by the endonuclease
BamHI. The fragment corresponding to the vector is purified on a Sepharose CL4B column (Pharmacia). It therefore comprises a polydC tail at one end, the other end being cohesive, of the BamHI type.

On the other hand, the poly A RNAs obtained at the end of Example 1 are subjected to reverse transcription from a primer whose sequence is as follows:
5 '<GATCCGGGCC CTTTTTTTTT TTT <3'
Thus, the cDNAs present at their 5 ′ end the GATCC sequence complementary to the BamHI cohesive end.

 The RNA-DNA hybrids obtained by the action of reverse transcriptase are subjected to alkaline hydrolysis which makes it possible to get rid of the RNA. The single-stranded cDNAs are then subjected to a termina transferase treatment so as to add 3 'polydG and purified by two cycles on a Sepharose CL4B column.

 These cDNAs are hydridized with RNA-poly A originating from cells of the COS3 line (monkey kidney cell line expressing the T antigen of the SV40 virus: cf. Y. Gluzman, 1981, Cell, 23, 175- 182).

The non-hydridized cDNAs are isolated (fraction enriched in
DNA complementary to messenger RNA specific for peripheral blood mononuclear cells).

These cDNAs are inserted in single-stranded form into the vector pSEI. A second oligonucleotide (the adapter) complementary to the primer is necessary to generate a BamHI site at
The 5 'end of the cDNAs. After hydridation of the vector, the cDNA and the adapter, the recombinant molecules are circularized by
The action of phage T4 ligase. The single-stranded regions are then repaired using DNA polymerase from phage T4. The pool of plasmids thus obtained is used to transform the strain MC 1061 (Casabadan and S. Cohen, J. Bact. (1980) 143, 971-980) by electroporation.

Protocol for the preparation of the complementary DNA library a) Preparation of the complementary DNA
From 5 g of poly A RNA from peripheral blood mononuclear cells obtained at the end of Example 1 of the following composition: RNA-poly A + A: 0.5 g, RNA-poly A + NA: 2 g , RNA-poly A + T (5h): 2 g and RNA-poly A + T (24h): 0.5 g, the complementary single-stranded DNA labeled with 32p-dCTP is prepared (the complementary DNA obtained has a specific activity of 3000 dpm / ng) with the synthetic primer of following sequence (comprising a BamHI site):
GATCCGGGCC CTTTTTTTTT TTT in a volume of 100 pl. After 30 min of incubation at 460C with 100 units of the enzyme reverse transcriptase (Genofit-El 022), 4 μl of 0.5 M EDTA is added. First extracted with phenol (saturated in TE buffer) then a second time with chloroform. 10 µg calf liver transfer RNA, 1/10 volume of 10 M ammonium acetate solution and 2.5 volume ethanol are added to precipitate the complementary DNA. Centrifuge, dissolve the pellet in 30 μl of TE buffer and then remove the small molecules such as salts, phenol and chloroform by exclusion chromatography on a column of polyacrylamide P10 (Biogel
P10-200-400 mesh, ref. 1501050-Biorad).

b) Alkaline hydrolysis of the RNA matrix
4.6 g of a 2N NaOH solution are added, the mixture is incubated for 30 min at 68 ° C., then 4.6 g of 2N acetic acid is added and the solution obtained is passed through a polyacrylamide column
P10.

c) Homopolymeric addition of dG
The complementary DNA is extended in 3 ′ with a “tail” of dG with 66 units of the enzyme terminated the transferase (Pharmacia 27073001). Incubate for 30 min at 37 ° C., then add 4 g of 0.5 M EDTA.

d) Purification on a Sepharose CL4B column
In order to eliminate the synthetic primer, the complementary DNA is purified on two successive columns of 1 ml of Sepharose
CL4B (Pharmacia) balanced in 30 mM NaOH / 2 mM EDTA
The first three radioactive fractions (approximately 80 μl each) are combined and precipitated with 1/10 volume of an ammonium acetate solution and 2.5 volumes of ethanol. The amount of complementary DNA is 1 pg.

e) Hybridization
The complementary DNA pellet is suspended in 25 μl of TE buffer, 15 μg of RNA-poly A extracted from cells of the COS line are added, then 1/10 by volume of a 3M NaCl solution. , 5 volume of ethanol and allowed to precipitate at -20 C.

 Centrifuge, wash with 70% ethanol, dry, dissolve the pellet in 5 l of buffer with the following composition: Tris 0.1 N pH 7.5, 0.3 M NaCl, 1 mM EDTA, put the solution obtained in a calillary tube which is sealed and then incubated at 65 C for 40 h.

The content of the capillary is diluted in 100 μl of buffer
TE to which 300 μl of 50 mM sodium phosphate buffer pH 6.8 are added. The solution obtained is passed through a hydroxyapatite column (BIOARD ref. 130.0520) at 60 ° C., equilibrated with this phosphate buffer. The single strand (non-hydridized complementary DNA) and the double strand (COS messenger RNA hydrated with complementary DNA) are separated by a phosphate buffer gradient of 0.1 M to 0.2 M through the column d Hydroxyapatite. The fractions corresponding to the complementary single-stranded DNA (25% by weight of the eluted cDNA, which corresponds to an enrichment of approximately four times in specific sequence of peripheral blood mononuclear cells) are added together. 20 μg of transfer RNA, the total volume is precipitated with 1/10 volume of a 10 M ammonium acetate solution and 2.5 volumes of ethanol. Centrifuged, the pellet is dissolved in 200 μl of TE, the residual phosphate is removed on polyacrylamide P10, again precipitated 1/10 by volume of a 10 M ammonium acetate solution and 2.5 volumes of ethanol.

 The pellet is dissolved in 30 l of a 30 mM NaOH solution; 2 mM EDTA. The complementary DNA is loaded onto a 1 ml Sepharose CL4B column (Pharmacia), equilibrated with a 30 mM NaOH solution; 2 mM EDTA to remove the rest of the synthetic primer. The first three radioactive fractions of approximately 80 μl are grouped together. The cDNA contained in these fractions is precipitated with 1/10 volume of a 10 M ammonium solution and 2.5 volumes of ethanol. The amount of complementary DNA thus recovered is 20 ng.

f) Pairing of the pSEI cloning vector and the complementary DNA in the presence of the adapter
Centrifuged, pellet dissolved in 33 µl buffer
TE, 5 pL (125 ng) of pSEI cloning vector, 1 p1 (120 ng) of the following sequence adapter (comprising a site
ApaI),
5'AAAAAAAAAA AAAGGGCCCG3 '10 l of a 200 mM NaCl solution, the mixture is incubated for 5 min at 65 ° C. and then the reaction mixture is allowed to cool to ambient temperature.

g) Ligation
The cloning vector and the single-stranded cDNA are ligated in a volume of 100 μl with 32.5 units of the enzyme DNA ligase from phage T4 (Pharmacia ref .: 270 87002) overnight at 150C.

h) Synthesis of the second strand of the cDNA
The proteins are eliminated by extraction with phenol followed by extraction with chloroform, then 1/10 of a volume of a 10 mM ammonium solution and then 2.5 volumes of ethanol are added. Centrifuged, the pellet is dissolved, the second strand of complementary DNA is synthesized in a volume of 30 l with 30 units of the DNA polymerase enzyme phage T4 (Pharmacia) for 1 h at 370C. Extraction is carried out with phenol and the traces of phenol are removed by a column of polyacrylamide P10.

i) Transformation by electroporation
E. coli MC1061 cells (Clontech) are transformed with
The recombinant DNA previously obtained by electroporation using the Biorad Gen Pulser device (Biorad) used at 2.5 kV under the conditions prescribed by the manufacturer, then the bacteria are grown for 6 h 30 in said medium. LB medium (Maniatis, op cited) of composition: bactrotryptone 10 g / l; yeast extract 5 g / l; NaCl 10 g / l, supplemented with 100, ug / ml of ampicillin.

 The number of independent clones is determined by spreading a 1/1000 dilution of the transformation before amplification on a box of LB medium supplemented with 1.5% agar (w / v) and 100 μg / ml of ampicillin, later called agar medium. The number of independent clones is 500,000.

SECTION 3: Screening of the subtracted complementary DNA bank
and selection of the clone NC30
1) Making replicas of bacterial colonies from the cDNA bank on a nylon filter
Approximately 40,000 recombinant bacteria from the cDNA library are distributed on Petri dishes (245 × 245 mm) containing agar medium (approximately 2,000 colonies / dish).

From each of these boxes, colonies are transferred to a Nylon membrane (CHybond N-Amersham) by depositing the membrane on the surface of the boot and setting marks by piercing the membrane using a needle. The membrane is then removed and placed on the surface of a new can
Petri dish containing agar medium. It is left for a few hours at 370C to obtain the regrowth of the colonies. From this first membrane, four replicas are made on new membranes (previously deposited on agar medium to moisten them) by successive contacts with the first membrane. The replicas on membrane obtained are finally deposited on plates of agar medium and incubated overnight at 300C.

The membrane replicas are deposited with the colonies upwards, on a sheet of Whatman 3 MM saturated with a solution of composition: 0.5 M NaOH; 1.5 M NaCl, for 5 min, which allows the bacteria to lyse and fix the DNA. The replicas on the membrane are then placed on a second sheet of
Whatman 3 MM saturated this time with a neutralizing solution of composition: 1.5 M NaCl; 0.5 M Tris-HCl pH 8, for 5 min. The replicas on the membrane are then immersed in a solution of 2 x SSC (composition of the SSC solution: 0.15 M NaCl; 0.015 M sodium citrate) and the bacterial debris is partially removed by gently rubbing with cotton wool. of cleaning.

 The replicas are then treated on a membrane with proteinase K (Boehringer Mannheim GmbH) at 100 μg / ml in a solution of composition: Tris-HCL 10 mM pH 8; 10 mM EDTA; 50mM NaCl; 0.1% SDS at a rate of 20ml per membrane. Incubate 30 min at 37 ° C with shaking. The membrane replicas are again immersed in a solution of 2 x SSC to permanently eliminate all traces of bacterial debris. They are finally put to dry on filter paper for a few minutes and then for 30 min under vacuum at + 800C. There are thus obtained, for each dish, four replicas on membrane, hereinafter called replica 1, replica 2, replica 3 and replica 4.

2) Preparation of the RNA used for the manufacture of the cDNA probes a) Culture and stimulation of the mononuclear cells of the peripheral blood using PMA, (PMA and anti-CD28), (PMA, PHA-P and cyclosporin A ) or (PMA and PHA-P)
Non-adherent cells are prepared as described above (section 1.1). They are cultivated for 5 h in 2 flasks of the Falcon type with a surface of 175 cm in the presence of the medium
RPMI supplemented with 10% fetal calf serum (Gibco BRL-ref. 01306290H), supplemented with 10 units of penicillin and 10 μg of streptomycin (penicillin / streptomycin solution from Gibco-ref.

043-05140D) per ml of medium as well as L-glutamine (Gibco BRLref. 043-05030D) up to 2 mM final. The cells are stimulated for 5 h under one of the following stimulation conditions 1), 2), 3) and 4):
1) in the presence of 10 ng / ml of phorbol myristate-2 acetate-3 (PMA) (Sigma, ref. P8139)
2) in the presence of 10 ng / ml of PMA and 1 g / ml of the anti-CD28 monoclonal antibody (Reagents and SA Systems ref. ACM0280NC050)
3) in the presence of 10 ng / ml of PMA, of 5 pg / ml of phytohemaglutinin (PHA-P) (Sigma, ref. L8754) and of 1 pg / ml of cyclosporin-A (Sandoz)
4) in the presence of 10 ng / ml of PMA and of 5, ug / ml of PHA-P
It is indeed known that the addition of the anti
CD28 increases the quantity of messenger RNAs of several cytokines, in particular IL2, llIFNy, TNFa and GMCSF by an increase in the stability of their messenger RNAs (Lindsten T. et al. (1989)
Science, 244, 339) in T lymphocytes, and that the cyclosporin-A immunosuppressant inhibits the increase in messenger RNAs of cytokines induced by activation with PMA and PHA-P in T lymphocytes (Thompson CB et al (1989) PNAS 86, 1333-1337).

 The culture media are then centrifuged (conditioned by non-adherent cells) under the above stimulation conditions and the cell pellets, called respectively, cell pellet 1, cell pellet 2, cell pellet 3 and cell pellet 4 are retained.

b) Preparation of RNA-poly A
From the above cell pellets, the RNA is extracted and the poly A fraction is purified as described in section 1-2 a) and b). Four RNA-poly fractions are thus obtained
A +, respectively called poly fraction A + 1, poly fraction A + 2, + + poly fraction A 3 and poly fraction A 4.

3) Preparation of the radiolabelled cDNA probes:
The radiolabelled cDNA probes, respectively called probe 1, probe 2, probe 3 and probe 4, are synthesized from the four RNA-poly A + fractions above prepared as described below.

1 μg of RNA-poly A + is hybridized with 200 ng of oligo dT (Pharmacia) in 2 to 3 μl by incubation for 2 min at 650 ° C. and cooling to ambient temperature. The synthesis of the radiolabelled cDNA is carried out in a reaction volume of 10 g in composition buffer: 50 mM Tris-HCl pH 8.3; 5 mM MgCl2; 10 mM dithiotreitol, containing 10 µM of each of the four deoxynucleotide triphosphates (Pharmacia), 15 pCi of dCTP x32P (3000 Ci / mmol Amersham) and 40 units of RNasine (inhibitor of
RNAse-Genofit). The reaction is carried out at 46 ° C. for 30 min in the presence of 10 to 20 units of reverse transcriptase (Genofit).

This synthesis is followed by alkaline hydrolysis of the RNA by a 0.3 M NaOH solution in a final volume of 20 μl for 30 min at 65 ° C. Neutralized by adding 3 M acetic acid. The volume is adjusted to 50 μl with TE medium. An extraction is carried out with the same volume of phenol followed by a second extraction with the same volume of a chloroform / isoamyl alcohol mixture (in the respective proportions 24/1). The unincorporated dCTP a is eliminated during the synthesis of the cDNA strand by exclusion chromatography on a column of polyacrylamide P10 (Biogel-200-400 mesh-Biorad).

 The amount of cDNA is 60 to 100 ng having a specific activity of 1 x 109 dpm / ug.

4) Hybridization of replicates of bacterial colonies with cDNA probes
The membrane replicas are prehybridized for 2 h at 420C in a buffer of composition: 50% formamide; 6 x SSC; 5 x Denhardt's solution; 0.12 SDS and 100 yg / ml DNA of sonicated salmon sperm, added after denaturing 10 min at 1000C. The membrane replicas are hybridized for two days: replica 1 with probe 1 and replica 2 with probe 2, replica 3 with probe 3, replica 4 with probe 4 these probes being used at a concentration of 4 ng / ml in the above buffer. Denhardt's 5 x solution (cf. Maniatis, op.

cited) has the composition: Ficoll (type 400-Pharmacia) 1 g / l, polyvinylpyrrolidone 1 g / l and bovine serum albumin (BSA) 1 g / l.

 The prehybridization and hybridization are carried out in tubes in a hybridization oven (Hybaid) with respectively 25 ml and 10 ml of buffer per membrane.

 Then the replicas on the membrane are successively washed several times for 15 min at 20 ° C. in the 2 x SSC composition buffer; 0.1% SDS, then twice for 15 min in a solution 0.1 x SSC, 0.1% SDS at 550C dried on Whatman 3 MM paper and autoradiographed on Kodak XAR5 films.

5) Hybridization with a mixture of oligonucleotides corresponding to most of the known cytokines
To identify the clones which contain DNA complementary to the messenger RNAs of known cytokines, another series of membrane replicas, prepared as described above, with a mixture - called mixture C - of 28 oligonucleotides each comprising 20 nucleotides, corresponding to DNA complementary to the following cytokines: Interleukin-1 cx (Furutani Y. et al., 1985, Nucl. Ac. Res., 13, 5869-5882), Interleukin-1 D (Auron P. et al., 1984, Proc. Natl Acad. Sci. USA, 81, 7907-7911), Interleukin-2 (Degrave W. et al., 1983, EMBO J., 2, 3249-3253), Interleukin-3 (Yang YC et al., 1986, 47, 3-10), Interleukin-4 (Yokoto T. et al., 1986, Proc. Ntl. Acad.Sci., 83, 5894-5898),
Interleukin-5 (Hirano T. et al., 1986, Nature, 324, 73-75), Interleukin-6 (May L. et al., 1986, Proc. Natl. Acad. Sci. USA, 83, 8957-8961 ), Interleukin-7 (Namen A. et al., 1988, Nature, 333, 571-573), Interleukin-8 (Matsushima K. et al., 1988, J. Exp. Med., 167, 1883-1893) , Interleukin-9 (Yang YC et al., 1989, Blood, 74, 1880-1884), TNFa (Pennica D. et al., 1984, Nature, 312, 724-729), TNFss (Gray P. et al. , 1984, Nature, 312, 721-724), G-CSF (Nagata S.

et al., 1986, 319, 415-418), M-CSF (Kawasaki E. et al., 1985,
Science, 230, 291-296), GM-CSF (Wong G. et al., 1985, Science, 228, 810-815), LIF (Gough N. et al., 1988, Proc. Natl. Acad. Sci. USA, 85, 2623-2627), Interferon oc (Goeddel D. et al., 1981, Nature, 290, 20-26), Interferon p1 (Taniguchi T. et al., 1980, Gene, 10, 11-15) ,
Interferon y (Gray P. et al., 1982, Nature, 295, 503-508), TGFx (Derynck R. et al., 1984, Cell., 38, 287-297), TGFp1 (Derynck R. et al. , 1985, Nature, 316, 701-705), bFGF (Prats H. et al., 1989,
Proc. Natl. Acad. Sci. USA, 86, 1836-1840), Erythropoietin (Jacobs
K. et al., 1985, Nature, 313, 806-810), BCGF (Sharma S. et al., 1987, Science, 235, 1489-1492), MIF (Weiser W. et al., 1989, Proc.

Natl. Acad. Sci. USA, 86, 7522-7526), MCP-1 (Yoshimura T. et al.,
FEBS Lett., 244, 487-493), Oncostatin-M (Malik N. et al., 1989,
Mol. Cell. Biol., 9, 2847-2853) and EDF (Murata M. et al., 1988,
Proc. Natl. Acad. Sci. USA, 85, 2434-2438).

These oligonucleotides, produced using the Biosearch 8700 DNA synthesizer, are coupled with horseradish peroxidase
EC 1.11.17 (Boehringer Mannheim-ref. 814-407) according to the following protocol: *
the oligonucleotides are reacted on the synthesis column with carbonyl-diimidazole (Aldrich - 11, 553-3) and diamino-1,6-hexane (Aldrich - H1.169.6) according to the method of Wachter et al., 1986, Nucl. Ac.Res., 14, 7985-7994;
after deprotection of the bases and cleavage of the support by ammoniacal treatment, the oligonucleotides are purified on an ion exchange resin (Quiagen - Diagen 500051) with change of the ammonium counterion to lithium ion; *
the 5 '-amino-oligonucleotides are coupled to horseradish peroxidase (Boehringer Mannheim-814407) according to the method of
M. Urdea et al., Nucl. Ac. Res., 1988, 16, 4937-4956.

 The mixture of oligonucleotides hybridizes with approximately 10% of the clones of the library.

 Clones giving a stronger autoradiographic signal with probe 2 than with probe 1, stronger with probe 4 than with probe 1 and stronger with probe 4 than with probe 3 and - do not hybridize not with mixture C were partially sequenced as described in section 4 below. One of these clones, subsequently called clone NC30, was retained.

SECTION 4: Expression of messenger LIARN from cLone NC30 in
mononuctuaries of peripheral blood
Non-adherent cells (consisting mainly of lymphocytes) are prepared as described in section 1-1) and stimulated as described in section 3-2) -a) with, in addition, non-stimulated control cells (stimulation conditions 0)) . The
Messenger RNAs of these cells under five stimulation conditions are prepared as described in Example 1-2) -a) and analyzed by electrophoresis on 1% agarose gel in the presence of formaldehyde (Sambrook, op. City), followed by '' transfer to a nylon membrane (Hybond N ± Amersham) and hybridization according to the protocol described above.

This membrane is hybridized with a radiolabelled probe with dCTPa32P made from cDNA NC30 (Amersham) by partial cleavage of the latter using DNAse I, followed by polymerization using the enzyme DNA polymerase I (nick-translation technique), as described by Sambrook et al., Op. cited. Hybridization is carried out at 420C for 16 h in an aqueous medium containing 50% formamide, 1 M NaCl, a solution of 5 x Denhardt and 0.1% SDS. The membranes are washed several times at room temperature with a 2 × SSC solution containing 0.1% SDS, then washed twice at 50 ° C. for 15 min with a 0.1 × SSC solution containing 0.1% SDS. The 5 x Denhardt solution has the following composition: Ficoll (type 400
Pharmacia) 1 g / l, polyvinylpyrrolidone 1 g / l and BSA 1 g / l. The 1 x SSC solution contains 0.15 M NaCl and 0.015 M sodium citrate.

 For non-stimulated cells and for cells stimulated under conditions 1), 2), 3) and 4), there is an autoradiographic band corresponding to an RNA of approximately 1.4 kb.

The expression of this RNA is increased in the presence of PMA (stronger intensity band for the stimulation condition 1) than for the stimulation condition 0)), this increase being amplified with the additional presence of PHA-P or d '' anti-CD28 (higher intensity bands for stimulation conditions 2) and 4) than for stimulation condition 1)) and not changed with the additional presence of PHA-P and cyclosporine (bands of similar intensity for stimulation conditions 1) and 3)).

SECTION 5: Sequencing and analysis of the clone cDNA sequence
NC30
1) Sequencing of the cDNA of the NC30 clone a) preparation of the single-stranded DNA
The clone NC30 contains the vector pSE1, which carries a
CDNA between the ApaI and BamHI sites, hereinafter called cDNA NC30.

 The vector pSE1, which contains the origin of replication of the f1 phase, makes it possible to produce single-stranded DNA by culture of the clone NC30 in the presence of the bacteriophage M13K07 (Pharmacia - ref.

27-1524) as follows
The clone NC30 is cultured, in a 15 ml tube, with stirring at 370C in 2 ml of medium 2 x YT of composition: bacterotryptone 16 g / l, yeast extract 10 g / l, NaCl 5 g / l (described in Maniatis et al., Op. Cited), supplemented with 0.001% thiamine and 100 μg / ml of ampicillin up to an optical density at 660 nm of approximately 0.60.

 - 100 p1 of this culture are infected with bacteriophage M13K07 (Pharmacia - ref. 27-1524) with a multiplicity of infections of the order of 10 in a 15 ml tube. The culture is stirred at 370C.

 - After 1 hour, 2 ml of medium are added. The culture is then incubated for approximately 16 h at 370C with shaking.

 - 1.5 ml of the culture is centrifuged, in a microtube, at 15,000 g for 2 min.

 - 1 ml of supernatant is transferred to a microtube and added with 250 μl of a polyethylene glycol solution of molecular weight 6000, 20% containing 2.5 M NaCl. The mixture is incubated for 5 min at 40C to facilitate the precipitation of the phage, then centrifuged for 5 min at 15,000 g. The supernatant is eliminated and the phage pellet is resuspended in 500 μl of 10 mM Tris composition buffer, pH 8, 1 mM EDTA.

 - The suspension is extracted once with saturated phenol with 100 mM Tris pH 8, then twice with chloroform.

 - The preparation is then precipitated by adding 1/10 of a volume of a 3M sodium acetate solution pH 4.8 and 2.5 volumes of ethanol. The precipitation is carried out at -200C for a minimum of 20 min. The DNA is centrifuged for 10 min at 15,000 g, the pellet is washed with a 70% ethanol solution and then resuspended in 30 μl of buffer of composition: 10 mM Tris pH 8, 1 mM EDTA.

b) Sequencing
The sequencing reactions are carried out using the United States Biochemical sequencing kit (ref: 70770), which uses the method of Sanger et al., Proc. Ntl. Acad. Sci. USA, 1977, 14, 5463-5467. The primers used are oligonucleotides of 18 nucleotides, complementary either to the vector pSE1 in the region immediately 5 ′ of the cDNA NC30, or to the sequence of
CDNA NC30.

2) Analysis of the NC30 cDNA sequence
The description below will be better understood using FIGS. 2, 3 and 4.

Analysis of the NC30 cDNA sequence (1) The NC30 cDNA contains 1297 nucleotides and ends in a poly A sequence.

(2) This number of nucleotides is in agreement with the size of the corresponding messenger RNA (approximately 1.4 kb) (cf. section 4).

(3) At position 1264-1269 the sequence AATAAA, which corresponds to the consensus sequence described by M. Birnstiel et al., 1985, Cell., 41, 349 is a polyadenylation signal. At positions 855-861, 872-878, 1133-1139 and 1152-1158 there are sequences of 7 nucleotides: TATTTAT, TATTTAA, AATTTAT and TATTTAA, containing the consensus motif of instability ATTTA described by G. Shaw et al., 1986, Cell, 46, 659-667. Most known cytokines have this consensus pattern of instability.

(4) The DNA sequence includes an open reading phase for the translation of a protein from ATG at position 15-17 to the TGA at position 453-455 which corresponds to a stop codon. of the translation. In this reading phase there are two codons
ATG at positions 15-17 and 57-59, capable of initiating translation, corresponding respectively to proteins of 146 and 132 amino acids. Among these, the nucleotide environment of ATG at positions 57-59 is that which most closely resembles the consensus sequence described by Kozak M., 1978, Cell, 15, 11091123, for the initiation of translation in eukaryotic cells.

(5) Signal peptide research software has been developed by the Applicant according to the method and the information described by
Von Heijne, 1986, Nucl. Ac. Res. 14, 483-490. This software provides in this reading phase a hydrophobic region resembling a signal peptide and three probable protein cleavage sites, at positions 74-75 (between Thr and Thr), at positions 86-87 (between Ala and Leu) and 110- 111 (between Ala and Ser). The expected signal peptide is between one of the two Met capable of initiating translation and one of these three cleavage sites. He therefore understands (cf.

Figure 2) 32, 24, 21, 18, 10 or 6 amino acids. Signal peptides of 10 or 6 amino acids, too short for a eukaryotic signal peptide (cf. "Protein targeting" by P. Pugsley, 1989,
Academic, Press, San Diego-California-USA) will not be considered. The expected mature protein (translated protein cleaved from its signal peptide) therefore comprises a sequence of 126, 122 or 114 amino acids.

Comparison to other known sequences
The peptide sequence already known closest to that of the 114 amino acid sequence of the mature protein is that of the 131 amino acid protein deduced from the cDNA of the mouse P600 protein described by KD Brown et al., 1989 , J.

Imm. 142, 679-687. This protein is expressed in a subclass of mouse T lymphocytes: Th2 cells, activated using concanavalin A.

A comparison of these peptide sequences using the method of Neediman and Wunsch, 1970, J. Mol. Biol. 48, 443-453, implementation in the UWGCG software of the University of Wisconsin: Devereux et al., 1984, Nucl. Ac. Res. 12, 8711-8721, option
GAP, shows that 64 amino acids are identical out of 114, i.e. an identity homology of approximately 56%. This algorithmic method considers all possible alignments and creates an alignment, shown in Figure 3, in which as many identical amino acids are matched and the number of holes in the aligned sequences is minimal.

 A comparison of the nucleotide sequences by this method shows an identity homology of approximately 70% between the coding sequence of the cDNA NC30 and the cDNA of the mouse protein P600 (cf. FIG. 4).

SECTION 6: Analysis of Secretion in La COS cells
protein encoded by cDNA NC30
COS cells are monkey kidney cells expressing the SV40 virus T antigen (Gluzman, Y. Cell, 23, 1981, 175-182). These cells, which allow the replication of the vectors containing the origin of replication of the DNA of the SV40 virus (case of the vector PSE1), constitute hosts of choice for the study of the expression of genes in animal cells.

1) Transfection of COS cells and transient expression of the protein encoded by the cDNA NC30
5 x 105 COS cells are seeded in a box
6 cm diameter petri dish (Corning) in 5 ml of medium modified from Eagle according to Dubelcco hereinafter called DMEM (Dulbecco's Modified
Eagle medium by Gibco ref. 041-01965), which contains 0.6 g / l glutamine, 3.7 g / l NaHC03 and is supplemented with fetal calf serum (Gibco) at a rate of 5%. After approximately 16 h of culture at 370C in an atmosphere containing 5% carbon dioxide, the culture medium is removed by suction and the cells are washed with 3 ml of PBS buffer (Phosphate Buffered Saline from GIBCO). then the following mixture: 1,000 p1 of (DMEM + 10% fetal calf serum (Gibco)), 110 pI of diethylaminoethyl-dextran of average molecular weight 500,000 (Pharmacia), at a concentration of 2 mg / ml, 1, 1 μl of 100 mM chloroquine (Sigma) and 6 μg of plasmid DNA from the NC30 clone, prepared according to the alkaline lysis technique followed by purification of the plasmid DNA on a cesium chloride gradient (Sambrook et al. , op. cited). After 5 h of incubation at 37 ° C. in an atmosphere containing 5% of carbon dioxide, the mixture is removed from the cells. 2 ml of PBS buffer containing 10% dimethyl sulfoxide (spectroscopy quality, Merck) is then added thereto. After 1 min of incubation at room temperature, the mixture is removed and the cells are washed twice with
PBS and are incubated in DMEM medium containing 2% fetal calf serum. Incubation is continued for 40 to 37 ° C. under an atmosphere containing 5% of carbon dioxide.

 On the other hand, control COS cells were prepared by carrying out the operations described above with the DNA of the plasmid pSE1.

2) Protein labeling
All the operations described below are carried out with COS cells transfected with the plasmid DNA of clone NC30 and control COS cells.

 The culture medium is removed by suction and the cells are washed twice with 3 ml of PBS buffer. 5 ml of MEM medium (Minimal Eagle's Medium) without methionine are added (Gibco - ref. 041-01900H), supplemented with 3 g / ml of glucose and 4 mM of glutamine. Incubate for 2 h at 370C. The culture medium is removed and 2 ml of the same medium added with 200 μCi of 35S methionine (ref. SJ1015 Amersham) are added. Incubate for 6 h at 370C. The culture medium is removed, centrifuged for 5 min to remove cell debris and suspended cells, and the supernatant is kept.

3) Analysis of radiolabelled proteins from COS cells transfected by polyacrylamide gel electrophoresis
1 ml of the supernatant of the transfected COS cells and 9 ml of acetone are precipitated at -200C. Centrifuge and recover the protein pellets. They are taken up in a composition buffer:
Tris 0.125 M pH 6.8, SDS 4%, glycerol 20%. An aliquot of the suspension obtained corresponding to a radioactivity of 200,000 cpm is analyzed by electrophoresis on a 15% polyacrylamide gel in the presence of SDS according to the technique described by UK

Laemmli, Anal. Biochem., 1977, 78, 459. The gel is dried under vacuum.

The radiolabelled proteins are revealed by autoradiography.

 The autoradiogram shows the presence of two supernumerary bands for the cells transfected with the plasmid DNA of the clone NC30 compared to the control cells: a clear band of high intensity corresponding to an apparent molecular mass of 9.0 + 1.5 kDa and a low intensity diffuse band corresponding to an apparent molecular mass of 17.0 + 1.5 kDa.

The NC30 clone therefore codes for a secreted protein. The apparent molecular mass for the form of the protein of the invention corresponding to the band of 9 + 1.5 kDa is less than the molecular mass calculated for the mature protein of 114 amino acids of 12,586 Da.

 This difference, of at most about 5 kDa, can be caused either by an unexpected electrophoretic mobility of this form of the protein of the invention, or by a carboxy and / or aminoterminal cleavage of at most 45 amino acids of the sequence ( a1), the cleaved protein then comprising a subsequence of at least 69 amino acids of the mature protein sequence of 114 amino acids.

 The apparent molecular mass band 17.0 + 1.5 kDa can correspond to an N-glycosylated form of the protein of the invention. This indeed presents (cf. FIG. 2) four possible sites of N-glycosylation.

Claims (25)

 1. Protein with cytokine type activity, characterized in that it comprises a subsequence of at least 69 amino acids of the following amino acid sequence (a1) (a1) Thr Val Ile Ala Leu Thr Cys Leu Gly Gly Phe Ala Ser Pro Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Glu Leu Ile Glu Glu Leu Val Asn Ile Thr Gln Asn Gln Lys Ala Pro Leu Cys Asn Gly Ser Met Val Trp Ser Ile Asn Leu Thr Ala Asp Met Tyr Cys Ala Ala Leu Glu Ser Leu Ile Asn Val Ser Gly Cys Ser Ala Ile Glu Lys Thr Gln Arg Met Leu Ser Gly Phe Cys Pro His Lys Val Ser Ala Gly Gln Phe Ser Ser Leu His Val Arg Asp Thr Lys Ile Glu Val Ala Gln Phe Val Lys Asp Leu Leu Leu His Leu Lys Lys Leu Phe Arg Glu Gly Arg Phe Asn or a sequence with a high degree of homology with the sequence (a  2.Protein with cyokine-like activity, characterized in that it comprises a subsequence of at least 69 amino acids of the following amino acid sequence (a2) (a2) Leu Thr Cys Leu Gly Gly Phe Ala Ser Pro Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Glu Leu Ile Glu Glu Leu Val Asn Ile Thr Gln Asn Gln Lys Ala Pro Leu Cys Asn Gly Ser Met Val Trp Ser Ile Asn Leu Thr Ala Asp Met Tyr Cys Ala Ala Leu Glu Ser Leu Asn Island Val Ser Gly Cys Ser Ala Ile Glu Lys Thr Gln Arg Met Leu Ser Gly Phe Cys Pro His Lys Val Ser Ala Gly Gln Phe Ser Ser Leu His Val Arg Asp Thr Lys Ile Glu Val Ala Gln Phe Val Lys Asp Leu Leu Leu His His Lys Lys Leu Phe Arg Glu Gly Arg Phe Asn or a sequence with a high degree of homology with the sequence (a2).  3. Protein with cytokine type activity, characterized in that it comprises a subsequence of at least 69 amino acids of the following amino acid sequence (a3): Ser Pro Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Glu Leu Ile Glu Glu Leu Val Asn Ile Thr Gln Asn Gln Lys Ala Pro Leu Cys Asn Gly Ser Met Val Trp Ser Ile Asn Leu Thr Ala Asp Met Tyr Cys Ala Ala Leu Glu Ser Leu Ile Asn Val Ser Gly Cys Ser Ala Ile Glu Lys Thr Gln Arg Met Leu Ser Gly Phe Cys Pro His Lys Val Ser Ala Gly Gln Phe Ser Ser Leu His Val Arg Asp Thr Lys Île Glu Val Ala Gln Phe Val Lys Asp Leu Leu Leu His Leu Lys Lys Leu Phe Arg Glu Gly Arg Phe Asn or of a sequence having a high degree of homology with the sequence (a 3).  4. Protein according to any one of claims 1 to 3, characterized in that it comprises one of the sequences (a1), (a2) or (a3) or a sequence having a high degree of homology with the one of the sequences (a1), (a2) or (a3).  5. Protein according to any one of claims 1 to 4, characterized in that it has an apparent molecular mass of 9 + 1.5 kDa.  6. Protein according to any one of claims 1 to 4, characterized in that it has an apparent molecular mass of 17 + 1.5 kDa.  7. Protein according to claim 4, characterized in that it is N-glycosylated.  8. Recombinant DNA, characterized in that it codes for a protein according to any one of claims 1 to 7.  9. Recombinant DNA according to claim 8, characterized in that it comprises, upstream of the subsequence of at least 69 amino acids of the sequence coding for one of the sequences (a1), (a2) or ( a3) or of a sequence having a high degree of homology with one of the sequences (a1), (a2) or (a3), a signal sequence.  10. Recombinant DNA according to claim 9, characterized in that it comprises, upstream of the sequence coding for one of the sequences (a1), (a2) or (a3) or of a sequence having a degree of high homology with one of the sequences (a1), (a2) or (a3), a signal sequence.  11. Recombinant DNA according to claim 10, characterized in that the signal peptide encoded by the signal sequence is separated from the sequence (a3) or from the sequence having a high degree of homology with the sequence (a3)  Leu Thr Cys Leu Gly Gly Phe Ala  12. Recombinant DNA according to claim 11, characterized in that the signal sequence codes for the following amino acid sequence (b1) = Met Ala Leu Leu Leu Thr Thr Val Ile Ala Leu Thr Cys Leu Gly Gly Phe To the  13. Recombinant DNA according to claims 11, characterized in that the signal sequence codes for the following amino acid sequence (b2): Met His Pro Leu Leu Asn Pro Leu Leu Leu Ala Leu Gly Leu Met Ala Leu Leu Leu Thr Thr Val Ile Ala Leu Thr Cys Leu Gly Gly Phe Ala  14. Recombinant DNA according to claim 11, characterized in that the signal sequence codes for the following amino acid sequence (b3): Met His Pro Leu Leu Asn Pro Leu Leu Leu Ala Leu Gly Leu Met Ala Leu Leu Leu Thr Thr Val Ala Island  15. Recombinant DNA according to one of claims 9 to 14, characterized in that the nucleotide sequence coding for the amino acid sequence (a3) is the following sequence (Nal): TCCCCAGGCC CTGTGCCTCC CTCTACAGCC CTCAGGGAGC TCATTGAGGA GCTGGTCAAC ATCACCCAGA ACCAGAAGGC TCCGCTCTGC AATGGCAGCA TGGTATGGAG CATCAACCTG ACAGCTGACA TGTACTGTGC AGCCCTGGAA TCCCTGATCA ACGTGTCAGG CTGCAGTGCC ATCGAGAAGA CCCAGAGGAT GCTGAGCGGA TTCTGCCCGC ACAAGGTCTC AGCTGGGCAG TTTTCCAGCT TGCATGTCCG AGACACCAAA ATCGAGGTGG CCCAGTTTGT AAAGGACCTG CTCTTACATT TAAAGAAACT TTTTCGCGAG GGACGGTTCA AC  16. Recombinant DNA according to claim 12, characterized in that the signal sequence is the following sequence (nabi): ATGGCGCTTT TGTTGACCAC GGTCATTGCT CTCACTTGCC TTGGCGGCTT TGCC  17. Recombinant DNA according to claim 14, characterized in that the sequence is the following nucleotide sequence (Nb2) ATGCATCCGC TCCTCAATCC TCTCCTGTTG GCACTGGGCC TCATGGCGCT TTTGTTGACC ACGGTCATTG CTCTCACTTG CCTTGGCGGC TTTGCC  18. Recombinant DNA according to claim 14, characterized in that the signal sequence is the following sequence cob3): ATGCATCCGC TCCTCAATCC TCTCCTGTTG GCACTGGGCC TCATGGCGCT TTTGTTGACC ACGGTCATTG CT  19. Expression vector, characterized in that it contains, with the means necessary for its expression, a recombinant DNA according to one of claims 8 to 18.  20. Animal cells, characterized in that they contain, with the means necessary for its expression, a recombinant DNA according to one of claims 8 to 18.  21. Animal cells according to claim 20, characterized in that they contain an expression vector according to claim 19.  22. A method of preparing a protein according to one of claims 1 to 7, characterized in that it comprises a step of culturing animal cells according to one of claims 19 and 20, followed by isolation and purification of the recombinant protein.  23. Recombinant protein with cytokine type activity, capable of being obtained by a method comprising a step of culturing animal cells according to one of claims 20 and 21, followed by the isolation and purification of the recombinant protein.  24. Medicament, characterized in that it contains a protein according to one of claims 1 to 7.  25. Medicament, characterized in that it contains a protein according to claim 23.