FI105103B - DNA molecule and its use - Google Patents

Abstract

The invention relates to a genetic unit, which is optionally in multicopy form, for the inhibition of RNA. The unit contains the transcription units necessary for transcription by polymerase III, and a DNA which codes for inhibiting RNA and which is arranged within the unit in such a way that the transcribed RNA is part of the polymerase III transcript. These units can be used to achieve increased stability of the inhibiting RNA, which can be in the form of ribozymes or antisense RNAs, while there is no reduction in the activity. The invention furthermore relates to a process for introducing the genetic units into the cell, to the use of these units and to pharmaceutical formulations containing them.

Description

DNA molecule and its use - DNA molecule och dess användning 1 105103

The present invention relates to a DNA molecule, preferably in a multicopy form, containing sequences of a gene transcribed by polymerase III and a DNA sequence encoding an inhibitory RNA molecule.

Specific inhibition of the gene by oligonucleotides, e.g. with a view to therapeutically effective blocking of unregulated tumor factors or viral genes, is based on the ability of such complementary RNA or DNA sequences, the so-called "nonsense" or non-oligonucleotide, pre-mRNA sequences and thus interrupt the transfer of knowledge from genes to proteins.

Using non-DNA results in cleavage of the complementary target RNA by cleavage of the formed hybrid RNase H, resulting in irreversible destruction of the respective complementary RNA.

When using non-information RNA, there is a so-called "hybrid stop" of translation or processing, whereby the RNA / RNA hybrid is represented by this structural barrier.

• I I

'· "Set hybrids accumulate in cells, * their subsequent point • *' authorization has not been studied so far. To the best of our knowledge, this mechanism is expected to have a substantially reversible event. Non-RNA molecules it is preferred that these molecules may be either synthesized in vitro and introduced into cells or the genes encoding them may be introduced into cells to produce inhibitory RNA therein.

However, to date, * * * such genes have not been successfully transformed into a form that allows efficient production of non-* RNA information in cells.

••••••• ««

Subsequently, a third principle was invented to inhibit RNA *, whereby the in vitro use made possible by this principle is based on the ability of RNA molecules, called "ribozymes", to recognize, bind to, and cleave certain RNA sequences. them. This was derived from the in vivo autocatalytic cleavage reaction of RNA molecules in plant viroids and satellite RNA.

Based on specific structural requirements for ribozyme-catalyzed RNA cleavage, it is now possible to construct de Novo ribozymes that exhibit in-trans-endonuclease activity on a particular target sequence. Because such ribozymes, which to date have been studied most extensively because of their structure, are referred to as "hammerhead" ribozymes, are capable of affecting a wide variety of sequences, virtually any desired RNA substrate can be prepared in a "tail-worked" manner. This makes ribozymes an interesting and highly versatile tool for inhibiting specific genes, as well as promising alternatives to non-data structures that have hitherto shown therapeutic potential.

One of the known and most thoroughly studied ribozyme models comprises three structural domains, - this model; * has been successfully used to construct anti-CAT mRNA '· * · ribozymes (Haseloff et al., 1988; Uhlenbeck et al., 1987): • · ·

These three regions comprise: (a) a highly conserved nucleotide region flanking the cleavage: ***; center in the 5 'direction. In this case, you will usually be able to · · ·. · **. GUC, but the modification ··· • # GUA or GUU, however, showed a substantially reduced cleavage activity. Cleavage also occurred after the sequence · · · CUC and, to a lesser extent, the sequences AUC and UUC (the requirements for efficient cleavage have not yet been fully elucidated).

• · 3 105103 b) The cleavage sites naturally occurring in ribozymes contain highly conserved sequences that form a kind of base pair.

c) Areas flanking the cleavage center on either side, which allow the precise organization of the ribozyme with respect to the cleavage center and the substrate and enzyme to remain in contact with each other (8 bases were selected on each side in the experiments so far).

This model allows the construction of RNA enzymes that have already been shown to be capable of efficient and specific cleavage of RNA sequences in vitro (Haseloff et al., 1988).

Other types of autocatalytic RNA cleavage activity suitable for site-directed RNA inhibition were subsequently discovered. One such model is the so-called "hairpin" ribozyme, whose active center is derived from the minus strand of the satellite "RNA" of the tobacco "ringspot" virus (Hampel, S 'and Tritz, 1989). Other autocleavage RNA activities are associated with hepatitis delta virus (Kuo et al., 1988; Sharmeen] [et al., 1988; Wu et al., 1989) and RNase P (Altman et al., 1988).

Before the present invention, experiments were conducted to compare the effect of non-knowledge DNA and ribozymes on RNA. These experiments were performed using snRNP-U7 dependent: ***; histone-pre-mRNA processing reaction and in vitro system • · ·. · * ·. mass, which specifically processes U7-dependent histone precursor mRNA (Mowry et al., 1987; Soldati et al., 1988). In this case, it was found that non-knowledge RNA exhibits the strongest inhibition, it? ... · which is reversible in nature. The inhibitory effects of non-DNA and hammerhead ribozymes, both of which are irreversible, were of the order of 4105103, requiring approximately 10000x excess of substrate RNA for complete inhibition.

While previous experiments on ribozymes with naked RNA in protein-free systems, the preliminary experiments of the present invention were the first experiments to show that synthesized ribozymes targeted to a specific sequence also show cleavage activity in a proteinaceous environment. This fact gave the first indication of in vivo availability.

One factor limiting the use of ribozymes to inhibit expression of specific genes would appear to be to achieve a ribozyme concentration sufficient to effectively exclude a given biological reaction; the reason for this would obviously be as with non-knowledge RNA e.g. Too low stability of RNA.

It was an object of the present invention to provide a system for using mRNA as an in vivo inhibitor of mRNA that would overcome the limitations associated with the use of RNA to date. and providing an effective concentration of inhibitory activity in the cell

• I I

RNA.

According to the invention, this task was solved by including the transcription units of the tRNA gene necessary for transcription by polymerase III, including the sequences that determine the secondary structure of the tRNA and that inhibit the RNA molecule. The DNA sequence is thus arranged in DNA. ** ·. in the molecule that the inhibitory RNA molecule is a transcript • · ·. ·· ♦. part.

To solve this problem, it was assumed that: ... · using an inhibitory RNA-producing gene instead of RNA as such would presumably result in a significant enhancement of RNA and thus a sufficient RNA pool to prevent biological reaction. .

The inhibitory RNA may be any desired ribozyme or other mRNA inhibitory RNA, e.g., non-information RNA.

In principle, RNA or the DNA sequence encoding it could be thought to be efficiently transported by viruses or viral vectors, e.g. retroviruses.

However, such a system has some crucial drawbacks, such as mobilization of endogenous Viruses, integration with endogenous retroviruses, activation of endogenous genes through integration, and host and tissue species limitations.

In contrast to the above, therefore, carrier genes which do not have these disadvantages were prepared according to the invention.

The genes presented as carrier genes for RNA genes within the scope of the present invention have the following advantageous properties: they are dense in structure, are smaller in size due to their smaller size, exhibit high transcriptional * 1 · '·' ♦ thi tissues, * 1 but they are expressed evenly, that is, in almost all cell types »·» · ... ·.

«· · T« «•

Another advantage of the polymerase III genes is the presence of a very strong transcription termination signal. Thereby, the likelihood of an unwanted activation of a cellular gene in the vicinity is substantially reduced.

• · '· «· M»' · t

The genes transcribed by polymerase III exhibit the following characteristics of "i": in these genes, the promoter is not located upstream of the gene but in the region of the gene itself (Geiduschek et al. ., 1988) The structure of these internal regulatory regions necessary for the binding of polymerase III is discontinuous and consists of two so-called "boxes" (Box A and Box B) which are essential for identification by transcription factors and a length of gel between them. is critical (Hofstetter et al., 1981) In tRNA genes, this sequence is 31 to 74 base pairs (Clarkson).

These genes transcribed by polymerase III are represented by tRNA genes, 5S-RNA and a number of other small nuclear and mucosal RNA genes: 7SK, 7SL, M, U6 and 4,5S-RNA, as well as the adenoviral genes VAI and VA2 ( Geiduschek et al., 1988). Common to these genes is their small size, dense structure, high transcription density, and uniform transcription.

Surprisingly, it has been found that the genetic units of the invention can achieve higher stability of inhibitory RNA without providing reduced activity in terms of activity.

'Jennings and Molloy, 1987, showed that specific,'. The promoter known from pol yerase -111 is capable of directing the synthesis of non-"·" · information RNA. To this end, the VA1 gene

The XbaI / BamHI fragment containing such a promoter was cloned 5 'upstream of the non-DNA, which is a customary principle in the use of polymerase II promoters. Efforts were made to obtain a short transcript as compared to polymerase II transcripts. The transcript only covers. ···. minor modification that allows base pairing of the ends to protect the ends prior to cleavage by single-stranded. exonucl eaasei 11 a. 1

Contrary to this suggestion that only the promoter sequence of the specific 7105103 polymerase III gene is used (region positions -30 to 73, with the wild-type VA1 gene extending to the stop sequence at positions +160 to +200), the present invention is further used to deliberately stabilize inhibitory RNA sequences. sequences of the polymerase III gene which determine the secondary structure of the transcript. In contrast to the above-described proposal, the gene sequence encoding the inhibitory RNA in the gene transcribed by polymerase III is organized such that a "gene cassette" is obtained according to the invention. In addition, the carrier genes used in the present invention are not toxic, unlike the viral VA1 gene.

Within the scope of the invention, the genes transcribed by polymerase III are flexibly selectable. In view of their carrier gene function for RNA inhibitory sequences, the following criteria must be taken into account when selecting or modifying native genes or constructing synthetic genes: 1) Boxes A and B are highly conserved.

. 2) 5 to 7 pieces of T residue downstream of box B are responsible for transcription termination.

*; 3) The distance between box A and box B cannot be arbitrarily increased, and the associated maximum is assumed to be about 90 ··· • · · ··· ”base pair.

* 1 · • «· 4) In some systems, the 5 'flanking sequence affects transcription.

5) There are indications that an intact anticodon backbone is essential for transcript stability.

* 1 1 ·· .: tRNA genes are particularly well suited as carrier genes for the preparation of the genetic unit of the invention. In addition, due to their clover-like structure, the RNAs encoded by these genes are particularly capable of increasing the stability of inhibitory RNA. They can be used to produce dense RNA-producing gene units by inserting the inhibitory RNA coding sequence between segments A and B (Figure 1 schematically depicts the tRNA ribozyme gene).

The assays of the present invention were performed using the start methionine tRNA comprising the Apal restriction site in the anticodon backbone / pull region between the A and B segments (all higher eukaryotic start methionine tRNAs contain this restriction site in an anticodon solution ).

In addition to the region between the A and B segments, other insertion centers in the carrier DNA sequences (tRNA genes or other polymerase III genes) are possible, provided that care is taken to maintain the transcriptional activity of the polymerase III and the transcript stability.

i * ·

However, the genetic units of the invention may be l '. basically prepared using any tRNA; if necessary, a suitable restriction site may be constructed, whereupon the sequence encoding the inhibitory RNA will be inserted.

• · * ··· * During insertion, it is only necessary to ensure that the · · · * · * * anticodon backbone region does not undergo base pairing that would adversely affect the transcription density of the gene or the stability of the resulting tRNA (Folk et al. , 1983). In addition, it should be noted that inserts longer than 60 base pairs may adversely affect transcription (· Ciliberto et al., 1982).

· ;;; In selecting suitable carrier genes, the principle of '···' should be to use non-toxic, species-specific tRNA genes or other genes transcribed by polymerase III.

9 105103

The assays of the present invention were performed by introducing ribozyme sequences into normal tRNA genes. However, if the tRNA ribozyme transcribed from the gene in question is predominantly located in the cytoplasm, there are applications, e.g., inhibition of nuclear-specific RNA sequences, e.g., snRNP particle RNA sequences, in which it is desirable to insert the tRNA ribozyme or tRNA ribozyme information RNA to the nucleus; mutants which are predominantly located in the nucleus, e.g., the meti-tRNA gene described by Zasloff et al., 1982, and Zasloff, 1983, comprising a single base pair exchange can be used.

For example, the genetic units of the invention may be prepared as follows:

A copy of a polymerase III transcribed gene, e.g., a tRNA gene contained in a bacterial plasmid, is digested with a suitable restriction enzyme at the site of interest, e.g.

A double-stranded DNA encoding inhibitory RNA prepared by conventional methods is ligated between the A and B segments, and ligated at the intersection. The product is transformed into appropriate host organisms, selected, propagated and harvested with amplified plasmid DNA. Plasmids are tested according to the invention. : presence of the appropriate genetic unit; this can be accomplished by restriction enzyme digestion, sequence analysis, or detection of a functional in-vitro transcript of plasmid DNA.

The genetic units thus obtained can be used as a ring-shaped plasmid, or as a plasmid-cleaved gene unit containing everything for polymerase III transcription; *: Necessary information.

The choice of mode of use will generally depend on the context in which the gene is used to transfer the unit to the cell, as well as the transport system selected. aia «10 105103 from.

The genetic units of the invention may also exist in multiple copies (in this case, tandem structures in which a plurality of said genetic units are sequentially sequenced, whereby the inhibitory inserts may be identical or different).

Due to the presence of promoter and termination signals present in each individual unit, transcription of such a tandem results in distinct RNA units. Because of this feature of the fragments - that they always appear as complete transcription units - the orientation of the individual units is also irrelevant. To prepare such tandems, plasmids containing multiple copies of inhibitory units from the coding region are used as starting material. Vectors containing multiple tRNA ribozyme genes can be prepared, for example, by starting from the erbB fragment set described in Example 1 and ligating individual fragments using T4 DNA-1 ligase as polymers, followed by cloning the polymeric genes into the appropriate restriction site in a plasmid.

* · I

vector. Such tandems can be manufactured due to the small size of the units of the invention, preferably 200 to 350 base pairs. With such a "tandem inhibitor", 12: one experiment can be used to test the effect of a series of inhibitors, · 3: when a heteromeric complex is prepared from non-RNA m * sequences or ribozymes. For example, in this way, a mixture of 5 to 10 ribozymes can be introduced into the cellular system, and once inhibition by the mixture has occurred, the effect of the individual ribozymes can be studied. This is advantageous ... especially since the criteria for selecting target RNA sequences to be inhibited have not yet been finally clarified.

• i a * t · · 1 «• · a« * 1 a i · · 2

East a | 3 • «a • a n 105103

Good target sequences include, for example, regions that do not have a secondary structure, regions close to the cleavage signals, regions after the start codon, regions that do not contain centers for specific proteins (such as the Sm-binding center in snRNAs). The present invention, especially in its tandem embodiment, makes it possible to detect these target sequences and then to effectively inhibit them.

The use of tandem units is also advantageous when RNA, e.g. viral RNA, has to be cleaved at more than one site to inactivate biological processes. Multi-center cleavage can be achieved, for example, by constructing a plurality of different ribozymes and introducing into the cells a vector containing the genetic units in addition to the DNA sequences encoding them. In the transcription of these sequences, ribozyme units are aligned on their respective target sequences, whereby the mRNA is cleaved into small pieces.

Multiple copies may be used when, in certain contexts, for example, using a transferrin-polycation transport system, larger quantities of low molar equivalents of ribozyme are required.

Plasmids comprising multiple copies of a genetic unit containing a DNA sequence encoding this ribozyme improve fragment production by increasing the multiplication yield.

• · ·

Tandem units can also be advantageously used when it is desired to simultaneously produce RNA sequences which inhibit different RNA species.

«· ·

When using non-information RNA in accordance with the invention, it should be noted that, in the case of tRNA genes, the insert has a limited size.

· ": · For efficient transcription, the order of magnitude is about 12,105,103,60 bp; thus, when using larger non-RNA constructs, consideration should be given to using other genes with higher capacity for transcription of longer sequences by polymerase III.

The carrier genes useful in the invention can also be produced synthetically, whereby the products must satisfy the condition that the transcription units necessary for the polymerase III transcription must be present. The use of such synthetic genes provides the following advantages: a) Aminoacyl synthetases and ribosomes do not recognize such genes, thereby preventing interference with the cellular translation machinery.

b) By creating synthetic constructs, it is possible to produce inhibitory RNA sequences with better stability and higher transcription density than when using the native gene.

c) The cloning process can be made more flexible by forming synthetic sequences.

In the context of the present invention, it was found that the stability of ribozyme-tRNA-: 'j molecules can be increased by extending the anticodon backbone of the carrier tDNA. It could be shown that extending the 5 bp antigen coding region of the Viltype tRNA gene to 9 bp can result in a 6-fold increase in the transcript of the murine Vtype tRNA gene, which can be attributed to the improved stability and consequent ease of processing.

It was further found that an improvement in the stability of the genetic units of the invention, which are in the form of tRNA ribozyme genes or tRNA non-13105103 information genes, can also be achieved if the DNA sequences encoding the inhibitory RNA function are part of the intror. which in the case of ribozymes are called "ribintrons"). It was then assumed that naturally occurring introns do not alter the secondary structure of the tRNA precursor molecules and that no sequences are present in the tRNA introns, whereby cloning the ribozyme or non-data sequences into the intron can minimize the structural alteration of the resulting tRNA precursor and thus. The tyrtRNA gene used in the present invention, where the cleavage of tRNA precursor molecules is slow, demonstrated that using tDNA molecules containing "ribintron" sequences can effectively increase ribtRNA activity. It is then possible to exert a more potent effect on the RNA sequences located in the cell mucosa. This system allows, in a simple manner, the incorporation of suitable moieties to increase the stability of "ribintrons" against cleavage by exonucleases. This can be achieved, for example, by further base pairing or by using larger hairpin regions bordering ribozyme sequences. Modifications of this type should be noted that the intron cleavage structures are crucial. : to be retained.

Native intron sequences may be modified, for example, by inserting suitable restriction sites for cloning oligonucleotides, or, if not in the naturally occurring gene, by inserting nucleotides that allow base pair pairing with an anticodon triplet to further stabilize the structure. ; ... ·.

A According to the present invention, it could be demonstrated that the expression of ribozymes as a constituent of introns does not substantially interfere with the secondary structure of tRNA-14 510103, whereby the resulting transcript can accumulate at high concentration and be properly processed. Unless the intron released during processing proves to be sufficiently stable, the structure may be provided with appropriate structural markers which enhance stability against degradation by exonulases.

Several methods can be used to introduce the genetic units of the invention into cells:

According to a standard method, the co-precipitation of DNA with potassium phosphate is utilized to introduce DNA into tissue cells (Graham et al., 1973). The precipitate is added to the cells that take up a portion of it, possibly via the pynocytosis mechanism. A similar method uses positively charged material, DEAE-dextran, which facilitates cellular uptake of DNA. Methods have also been developed for introducing DNA into cells by electroporation (here temporarily forming pores using a pulsating electric field; Langridge et al., 1987, Fromm et al., 1987). Similarly, microspray. ; ·. ankles are useful for large cells (Kressmann et al., 1980) or tissue culture cells (Pepperkok et al., 1988); in this case. However, these methods are only applicable '! for laboratory or in vitro use. Recently, a synthetic cationic peptide (DOTMA) was developed which spontaneously forms liposomes with DNA and thus facilitates delivery to cells (Feigner et al., 1987). In principle, as mentioned above, retroviral vectors are also suitable for transfer of genetic material to cells (Stewart et al., 1986, 1987); however, these systems have the aforementioned: disadvantages.

• · ·

• · I

Further, the following transport mechanism is based on the utilization of "disarmed" toxins as a means of transport.

• · 15 105103

The problem with all the transport methods used so far is that they cannot deliver enough inhibitory nucleic acid to the cells. The present invention now makes it possible, due to the small size and compactness of the molecules in question, to increase the number of active inhibitor units with respect to their transport capacity. Due to the small size and compact structure of the genetic units of the invention, minor modifications can also be made to dispense with the transport system altogether by minor modifications, e.g., conjugation to cholesterol, lipophilic counter-ions or nuclear positioning peptides.

Preferably, in accordance with the present invention, a soluble system is used for delivery, the mechanism of which is receptor-mediated endocytosis. Particularly preferably, the transferrin-polycation conjugate is complexed with the genetic unit of the invention; the complex is transferred into the cell via the transferrin receptor, which is found in virtually all growing cells.

The scope of the present invention is wide: e.g. . ·. transgenic animals due to the presence of the genetic units of the invention in the genetic material! . intracellular resistance to viruses such as foot-and-mouth disease virus, Newcastle disease virus, bovine papilloma virus, pseudorabies disease, or infectious gastric and intestinal inflammation. Similarly, in transgenic plants, · · · V · can also be conferred an intracellular resistance, for example against potato virus PVX.

Further, the genetic units of the invention may be exported · “1. somatic cells to use disease-causing viruses such as ribozymes * · · or HIV-related retroviruses or non-RNA sequences to fight these viral stimuli.

• · «« · • · ♦ I 1 t • · »· ·«, 6 105103

The next area of use is in gene therapy using RNA constructs that clump up tumor factors or other key genes that regulate cell growth and / or differentiation. Crucial to such uses is the high specificity of RNA inhibition effectively achieved by the present invention, which makes it possible, e.g., to distinguish between pre-tumor factor and tumor factor transcripts.

Further, the genetic units of the invention may be used to prevent expression of specific genes in plants and animals to achieve desirable traits in this manner.

The inhibitory effect of RNA can also be utilized to combat disease by suppressing the production of undesired gene products, e.g., the production of the major plaque protein in Alzheimer's disease or proteins present in autoimmune diseases.

The invention may also be used in cases where:. . ·. It is desired to exclude the RNA interacting regulatory protein by attachment to RNA.

'; Pharmaceutical preparations containing the genetic units of the invention as active ingredients, for example, in the form of isoforms, are likewise within the scope of the present invention.

• · «: Their indications cover the above mentioned indications.

The transcriptional activity of the tDNA ribozyme gene was demonstrated in the experiments of the present invention. This means · ***; The tDNA ribozyme gene structure was constructed by inserting the · · ·. ·: ·. a 53 base pair DNA sequence encoding the anti-snRNA-U7 • a · · _ · ribozyme at the Apal restriction site between A- ••• box 1 and B box in start-methionine tDNA (A- • 4 1 «« |17510103 and box B are the two recognition sequences present in the polymerase; transcription starts 15 base pairs upstream of box A and ends in the oligo T sequence downstream of box B). Following microinjection of this gene, transcription could be detected; The concentration of the tRNA / ribozyme hybrid was 10-20% of the tRNA content of the wild-type tRNA gene injected, respectively.

RNA molecules synthesized from an in vitro tRNA ribozyme gene cleave a target RNA site. Attachment of the tRNA construct to the ribozyme sequence does not block ribozyme activity. The tRNA-ribozyme molecules synthesized by genes injected into ova cleave the target RNA at the same predicted site and as efficiently as the in vitro-synthesized ribozymes, which do not comprise the tRNA structure. This indicates that there are no modifications in the in vivo synthesis and processing of the tRNA ribozyme that would inhibit ribozyme function.

This invention first demonstrated ribozyme activity in vivo. With this in mind, tDNA / ribozyme genes were co-injected with • * · · * labeled GTP into ova. After 8 hours of incubated ribozyme synthesis for 11e, • · ·; ··· radiolabeled substrate RNA (U7-RNA). * ··. was injected into the mucous membrane of the ova. After a further 2 hours, nucleic acid was isolated from the ova: no unreacted substrate RNA could be detected from the ova which had undergone ribozyme synthesis. In contrast, substrate RNA was stable in ova that had not been injected with the tDNA / ribozyme gene or in cells where the gene had not reached the nucleus.

»'·«

It was also within the scope of the invention to demonstrate that the * t · «. ··· tDNA ribozymes of the invention can inhibit the transforming effect of the tumor factor * · • ·« «· 18 105103. Chicken erythrocytes transformed with ErbB tumor factor showed tRNA ribozyme activity induced by inhibition of erbB expression by initiating cell differentiation in erythrocytes.

The effect of the genetic units of the invention may also be demonstrated by monitoring the resistance of mouse cells to infection, for example polyoma infections, treated with genetic units of the antiviral (optionally more than one viral region) of the invention, e.g., papillomavirus.

Example 1 Construction of tRNA Ribozyme Genes (a) Construction of pSPT18metl in pBR322 Cloned 284 bp EcoRI fragment (Hinfl-HG fragment (Hofstetter et al., 1981, Tellford et al., 1979)). The methionine starter-1 tRNA gene was isolated by EcoRI digestion from the pBR322 vector and · · ·. was purified by gel electrophoresis (2% agarose / TBE-

• I I

'! gel), followed by ligation to the EcoRI site of the bacterial plasmid pSPT18 >> t '(Boehringer Mannheim) such that transcription of the plasmid • · * ··· 1 with the SP6 polymerase yielded the transcript of the tRNA- * · *. *'. The standard cloning methods described by Maniatis were used here. The main advantage of the tRNA gene being subcloned back into pSPT18 is the presence of the opposing SP6 and T7 RNA polymerase promoters in the plasmid.

; ***; In this case, specific RNA ··· transcripts containing either the tRNA ribozyme sequence 4 l · / or its blunt-ended sequence can be obtained by in vitro transcription (Melton et al., 1984). These «ti ···! transcripts are useful for testing the activity of RNA cleavage activity or to detect the presence of tRNA ribozymes in cell extracts expressing tRNA ribozyme "RNase -suojakartoituksella ".

b) Construction of tRNA ribozyme genes The tRNA gene in pSPT188l was cleaved at a single Apal site in the anticodon skeleton / drop region (see Figure 2). This figure shows plasmids containing sequences encoding tRNA ribozyme. pSPT13-metl contains a 284 bp EcoRI fragment comprising the Xenopus laevis starter tRNA gene. This is a G-H fragment (Hofstetter et al., 1981), which has been cloned into the EcoRI site of the pSPT18 polylyser. Clumping oligonucleotides encoding anti-U7snRNA risozymes [CD33 and both sequences of erbB mRNA (ES13, ES53)] are shown. The cloning strategy used herein removed the overhangs of the Apal center in the tRNA gene. The ribozyme-encoding portion of the insert, as well as the dimeric regions (anti-U7 and anti-erbB) of the target RNA, are labeled as well as the A and B boxes, the 5 T residue fragment (termination signal), and transcription initiation sites. The plasmid contains the ColEI origin of replication, the ampicillin resistance marker, and promoters T7 and SP6 RNA polymerase 11e.

To prepare double-stranded synthetic DNA oligonucleotides encoding the viroid digestion sequence of the coding sequence for the mRNA of the target mRNA (Haseloff et al., 1988), the single-stranded oligonucleotide was first prepared and standard methods (Applied Biosystems manufactured by DNA synthesizer). Conjunctival oligonucleotides were phosphorylated, annealed, and ligated to the ApalI digested pSPT18metl using standard methods (Maniatis).

. ·· 1

E. coli strain HP101 was transformed with the ligation mixture 1a, bacterial clones containing the new plasmid were isolated and confirmed by the presence of active ribozyme sequences in the bacterial plasmid. were studied in two ways: φ 20 105103 1) RNA molecules obtained from in vitro transcription of cloned DNA plasmids by SP6 were incubated with radioactively labeled RNA containing the target ribozyme sequence, followed by a specific cleavage of the target RNA. (see Figure 4).

2) The presence of properly inserted DNA sequences was confirmed by dideoxy DNA sequencing of the insertion center.

Figure 4 shows the in vitro ribozyme activity of tRNA ribozymes. Plasmid DNA molecules containing the erbB-piece tRNA ribozyme-ES13 and -ES53 were digested with PvuII, followed by transcription with SP6 RNA polymerase 11a. This transcription yielded 230 nucleotides. length RNA molecules containing, in addition to the tRNA ribozyme sequence, 5 'and 3' flanking sequences derived from flanking Xenopus sequences and flanking bacterial plasmid sequences (Figure 2). Ribozyme transcripts were incubated at 20,000 scintillation per minute (20 µM) with an Rb '· / ·' · molecule containing the erbB mRNA region, including the control codon. The RNA molecule contains target sequences for both ES13 and ES53 (see Figure 3). After ribozyme and? 1 target RNA were incubated for 2 hours at 37 ° C. sponges in the presence of 10 mK MgCl2, 20 mM Tris-HCl, pH 7, 5, and 150 mM NaCl, · EDTA was added to 15 mM, the sample · · · dried and dissolved in 80% formamide / TBE, heated seconds at 95 ° C and separation on a 9.5% acrylamide / 8.3 M urea / TBE gel. After electrophoresis, the labeled RNAs were detected by car radio picture.

«« · ♦ · i • · · Spot M: mol ecolabel: pBR322-DNÄ, digested ··. HpaII and radioactively labeled? 1? 32? -CT? 11 using the K enow fragment of DNA polymerase (Maniatis).

21 105103

The molecular weight markers were dissolved in the 80% formamide / TBE mixture just before addition to the gel and heated for 3 minutes at 95 ° C. The molecular weights of a few fragments (as nucleotides) are indicated to the left.

Spot 1: erbB target mRNA (20,000 scintillation / min, 20 fM), no incubation.

Spot 3: erbB target mRNA (20,000 scintillation / min, 20 fM) incubated with MgCl2 at 37 ° C without ribozyme.

Spot 4: erbB target mRNA (20,000 scintillation / min, 20 fM) incubated with ES13 RNA (1 fM).

Spot 5: erbB target mRNA (20,000 scintillation / min, 20 fM) incubated with ES53 RNA.

The right part of the figure shows both ribozyme cleavage sites of the erbB target mRNA and the 5 'and 3' cleavage products. molecular weights (in nucleotides) of the reaction (see also Figure 3).

* · 1: Figure 3 shows the cleavage activity between ribozymes and target RNA sequences: · CD33 (A) against U7snRNA (Cotten et al., 1988); ES13 (C) and ES53 (3) against erbB mRNA-:: (Venustrom et al., 1980).

The tRNA portion of tRNA ribozymes is not shown for illustrative purposes. Ribozyme cleavage centers are labeled as well as ··. the start codon of the erbB mRNA.

»· • · * · · ·« «· · · ♦ ·« 22 105103

Example 2 Transcription of tRNA Ribozyme in Xenopus Oocytes The tRNA ribozyme genes were microinjected into Xenopus ova, followed by transcription in Kressmann et al., 1978, Hofstetter et al., 1981, Kressmann et al., 1980, tDNA. method. The procedure was as follows: Stage VI ova were obtained from HCG (human chorionic gonadotropin) stimulated adult Xenopus laevis females. The ova were centrifuged slightly to bring the nucleus to the edge of the ovum. About 50 nanoliters of a solution containing 0.3 micrograms / microliter of supernatant plasmid DNA (containing the tRNA ribozyme gene of Example 1) and 2 microcurie units / microliters of 32? -GTP were injected into each nucleus. After 5 to 8 hours of incubation at 20 ° C, individual injected ova were digested in a solution containing 1% SDS, 1 mg / ml proteinase K, 300 mM NaCl, 20 mM Tris, pH 8, 20 mM SDTA (400 microliters / egg), at 37 ° C: 45 min, after which the mixtures were extracted once with phenol solution and once with phenol / chloroform and precipitated, then with ethanol. The ethanol precipitates were combined and dissolved in ·: ··· 80% formamide / TBE, the solutions were heated to 95 ° C for rapid denaturation, and then the products were · · · · electrophoretically separated with 10% acrylic 1 amide / 8.3 M urea / TBE gel and visualized by taking a car radio picture. In all experiments performed with the tRNA ribozyme gene, injection solutions contained the wild-type metRNA gene at a concentration of 1/6 of the concentration of the tRNA ribozyme gene. TBE buffer (Tris, borate, EDTA) was prepared by Maniatis • · «; .

The results of these experiments are shown in Figure 5: 23 105103 Spot m: molecular weight marker: as in Figure 4. The molecular weights (in nucleotides) of some fragments are shown in the figure to the left.

Spots 1,2,3: nucleic acids from single ova injected with Met-tRNA gene and Met-tRNA ribozyme gene metribo 33. The figure to the right shows Met-tRNA (met, 77 nucleotides in length) and tRNA-ribozyme (meth). ribo, 123 nucleotides in length).

Example 3

Determination of the ribozyme activity of the ova synthesized tRNA ribozyme compared to the in vitro synthesized ribozyme which does not contain tRNA sequences The anti-U7 tRNA ribozyme synthesized by microspraying of the ova was obtained by electrophoretic separation, was removed from the polyacrylamide gel and eluted by overnight incubation in an Eppendorf vibrator in HEP-1 run.

; # ("Heidelberg Extraction Buffer": 0.75 M ammonium acetate, lo mM

Magnesium acetate, 1% (v / v) phenol, 0.1% (w / v) SDS, 0.1 mM

'' EDTA). The eluted RNA was extracted once with phenol / chloroform and · · · · · once with chloroform, followed by ethanol precipitation with · · · · · · · * 10 micrograms of E. coli as a carrier. The precipitate was harvested and quantitated using the 32? -Label Cerenkov-1 calculation and the values for specific activity (Kressmann et al., 1982). tRNA-ribozyme. ···. min samples were incubated with 32P-1 unlabeled RNA containing · · “** U7 sequence (10,000 scintillation / min / sample, 10 µM plus the indicated amounts of unlabeled U7 RNA) for 2 hours. At 37 ° C in the presence of the following concentrations: 150 mM NaCl, 10 mM MgCl 2 and 20 mM Tris-HCl, pH 7.5. Reactions were stopped by addition of EDTA. . ·. at a concentration of 15 mM, the samples were dried and dissolved in 80% · 105% formamide / TBE, followed by heating at 95 ° C for 30 seconds and isolating the products in pre-heated 9.5% acrylamide / 8.3 M urea / TBE gel. Radiolabeled RNA species were visualized by taking an autoradiograph at -8 ° C using a Dr. Göös special amplifier membrane.

Ribozyme CD32 was obtained from a T7 polymerase transcription from a plasmid containing the CD33 insert (see Figure 2) and cloned into the HindIII / SalI centers of pS? T19 (Boehringer Mannheim). This transcript contains only the ribozyme sequence as well as U7 blunting sequences flanked by short vector sequence fragments. The cleavage activity of this ribozyme was compared with that of the CD33 synthesized tRNA ribozyme in ova to determine the secondary structure of tRNA and the effect of in vivo synthesis and modification on ribozyme activity. It was found that both ribozymes (CD32 and CD33) cleave the U7-containing RNA (94 nucleotide sequence) to 25 nucleotides by 5 * restriction. product and a 69 '3'-cleavage product.

'·' 'The results of these experiments are shown in Figure 6: • · Spot m: molecular weight label as in Figure 5.

Spot 1: U7 RNA (10,000 scintillation / min, 10 fM), incubation without ribozyme.

Spot 2: U7 RNA (10,000 scintillation / min, 100 fM), incubated at 10 ···. tMNA ribozyme CD33 synthesized in fM ova.

• · »·· • · · · · *. . Spot 3: U7 RNA (10,000 scintillation / min, 1 pM) incubated with 10 fM ovarian-synthesized tRNA ribozyme CD33.

V Spot 4: U7 RNA (10,000 scintillation / min, 100 fM) incubated with 10 x 10 6 x 10 510 10 3 fM in vitro T7 polymerase synthesized ribozyme CD32.

Spot 5: U7 RNA (10,000 scintillation / min, 100 fM) incubated with 1 fM in vitro T7 polymerase synthesized ribozyme CD32.

Example 4

Determination of ribozyme substrate cleavage in ova

A mixture of 32? -GT? Was injected into the ova, the -tRNA-Ribot enzyme gene and Met-tRNA gene were injected. The injected ova were incubated as described in Example 2 at 2 ° C for 8 hours to obtain transcription. Then, radiolabeled U7 RNA (50 nanoliters, 100,000 scintillation / min / micro-liter, 100 fM / microliter) was injected into the mucous membrane, followed by incubation for 2 hours. Nucleic acids were prepared from single egg cells and then separated by gel electrophoresis as described above.

I 1 1 t | »·, The results of these experiments are shown in Figure 7: • · · ·» • 1 .11. Spots m: Molecular weight label as in Figure 5.

Spot 1: nucleic acids from an egg cell that had been injected with the Met and Metribo genes.

,, t Spots 2 and 3: Oocytes injected with Met and '· ..1 Metribo and then U7 RNA.

• · · • t · • ♦ • · ··· Spots 4 and 5: Oocytes injected with U7 only. '···. RNA.

26 105103 Spot 6: U7 RNA sample used for injection.

Spot 7: U7 RNA (10 µM) incubated with ribozyme CD32 (10 µM) for 2 hours at 37 ° C in the presence of 150 mM NaCl, 10 mM M5Cl2 and 20 mM Tris-HCl, pH 7.5. Due to the gel running conditions, only the 3 'cleavage product (69 nucleotides) is present.

Example 5 Transcriptional Activity of tRNA Ribozymes in Chicken Cells Plasmid DNA molecules containing tRNA ribozyme genes were introduced into chicken cells to determine the transcriptional activity of the genes. It was shown that the tRNA ribozyme gene (derived from the Xenopus tRNA gene) is efficiently transcribed in chicken cells. This was done as follows: 1C6 primary chicken embryo tissue formation cell (Zenke et al., 1988) was inoculated into each 10 cm diameter dish according to standard procedures and left to grow overnight. The next morning, each plate was transfected with 10 micrograms of plasmid DNA (containing either erbB-pala-13 or erbB-pala-53)

• I I

V · using a co-precipitation method (Graham et al., 1973).

The cells were exposed to the precipitate overnight, followed by the following: "In the morning, they were washed twice in fresh medium and incubated for 48 hours in fresh medium.

IM

The medium was then removed, the cells were slurried in PK / SDS buffer (see above) and the nucleic acids were harvested.

Nucleic acids were then subjected to "RNase protection screening" using 22P-labeled non-information-erbB? Ala-13 or non-information-erbB piece-53 probes to detect the presence of tRNA ribozyme transcripts ψ · '···'. Labeled was added to the dried ethanol precipitate

IM

'. * * RNA (10,000 scintillation / min / 10 µM non-information RNA per sample • · • j <), then samples were again dried and solubilized ···. was then added to 10 microliters of de-ionized 80% formamide solution containing 400 mM NaCl, 20 µl · 105103 inM PIPES, pH 6, 5, 10 mM EDTA. The samples were overlaid with sterile paraffin oil and heated for 3 minutes at 95 ° C, then rapidly transferred to a water bath at 45 ° C where they were incubated overnight. The following morning, 0.3 ml of ice-cold NaCl solution (300 mM) containing 30 mM Tris, pH 7.5, 1 mM EDTA, 0.05 mg / ml RNase A was added with rapid but gentle shaking. 80 units / ml RNase T1, followed by incubation of the samples at room temperature for 45 minutes. Proteinase K and SDS were added to the samples at concentrations of 1 mg / ml and 0.5%, respectively, followed by further incubation at room temperature and finally at 56 ° C for 20 minutes each. Samples were added with 10 micrograms of tRNA and ethanol precipitated. The recovered precipitate was slurried in 80% formamide / TBE and the products were separated on a pre-heated 9.5% acrylamide / 8.3 M urea / TBE gel. The result of this experiment is shown in Figure 8: Spots m: Molecular Weight Label as in the previous examples.

: Spot 1: Non-ES13 probe hybridized to E. coli tRNA (10 micrograms).

Spot 2: non-ES53 probe hybridized with E. coli ... tRNA.

Spots 3 and 4: Map of nucleic acids obtained from 10,000 and 100,000 cells not transfected with plasmid DNA hybridized to the ES13 probe.

%: Spots 5 and 6: Map of nucleic acids obtained from 10,000: 100,000 cells transfected with ES13 hybridized to the ES13 probe.

Spots 7 and 8: Map of nucleic acids obtained from 10,000-23,105,103 and 100,000 cells transfected with ES53 hybridized to the ES53 probe.

Example 6 Attenuation of the effect of v-erb-3 tumor factor by tDNA ribozyme gene introduced into poly-lysine transferrin conjugates into v-erb-S transformed early red blood cells This example demonstrated that anti-erb-3 tumor erb-B transformed chicken erythrocytes using polylysine-transferrin conjugates and their ability to attenuate the transforming effect of the tumor factor.

Preliminary Examination 1

Preparation of Transferrin-Polylysine Conjugates · '··' Coupling was performed by methods known in the literature: (cf. G. Jung, W. Köhnlein and G. Lueders, Biochem.3iophys.Res.

Commun. 101, 599 (1981)) by first modifying succinimidyl pyridyl: ridyl dithiopropionate IIa and then forming the disulfide. bridges.

«· • · ·« · ·

Pyridyldithiopropionate-modified transferrin-1: 6, any solution filtered with Sephadex-G-25 gel containing 120 mg (1.5 micromoles) of transferrin (egg protein).

of. Sigma, Conalbumin Type I, does not contain iron) 0.1 M

4 · 4 · sodium phosphate buffer (pH 7.8), 200 microliters of 15 mM ethanol in succinimidyl pyridyldiopropionate (SPDP, Pharmacia) was added with vigorous stirring. the mixture was allowed to react for 1 hour at room temperature 29105103 with occasional stirring. A gel column (Sephadex-G-25, 14 x 180 mm, 0.1 M sodium phosphate buffer, pH 7.8) separated the low molecular weight reaction products and reagent residues to give a 7 mL product fraction; The concentration of pyridyldithiopropionate-bound transferrin was obtained by determining the amount and concentration of pyridine-2-thione released photometrically from a sample reduced with dithiothreitol and about 2.6 micromoles.

Mercaptopropionate-Modified Polylysine-2:

A solution of 18 mg (about 1.0 micromoles) of poly-L-lysine hydrobromide (Sigma, labeled with fluorescein isothiocyanate (FITC), molecular weight about 18,000, corresponding to an average degree of polymerization of about 90) in 3 ml 0, 1 M sodium phosphate buffer (pH 7.8) was filtered with Sephadex-G-25. The polylysine solution was diluted by addition of water to 7 ml, after which 270 microliters of SPDP 15mM ethanol solution was added with efficient shaking and the mixture was allowed to react for 1 hour in the dark at room temperature then. ... then stirring. To the mixture was added 0.5 ml of 1 M sodium acetate buffer (pH 5.0) followed by low molecular weight. It was filtered with Sephadex * * * G-25 (eluent: 20 mM sodium acetate buffer, pH 5.0).

The product fraction (ninhydrin staining, fluorination) was evaporated in vacuo, the pH of the residue was adjusted by adding buffer to about · · · · · · * 7 and a solution of 23 mg (150 micromoles) of dithiothreitol in 200 microlitres of water was added. , after which the mixture was left for one hour at room temperature in a dark argon barrier. For repeated gel filtration (Sephadex-G-25, 14 x 130, ···. Mm column, 10 mM sodium acetate buffer, pH 5.0) an excess of reductin was removed and 3.5 ml of a product containing fluorine was obtained. the wall-labeled polylysine contained 3.8 moles of .. 'j' mercapto groups (photometric assay using Ellman's reagent, 5,5 '-dithiobis (2-nitrobenzoic acid)).

• i «30 105103

Trans f errin-Pol ylysine Jugate-3:

A solution of modified transferrin-1 (7 ml in 0.1 M sodium phosphate buffer, pH 7.8, about 1.5 micromoles of transferrin with about 2.6 micromoles of pyridyldithiopropionate residues) obtained as described above was purged with argon gas; 2.0 ml of the above solution of mercapto-modified polylysine-2 (in 10 mM sodium acetate buffer, pH 5.0, corresponding to about 0.6 micromoles of polylysine with about 2.2 micromoles of mercapto groups) were added to the solution, argon and shaken, after which the mixture was left to react for 18 hours at room temperature with dark argon gas. The reaction mixture was diluted to 14 ml with water and separated by ion exchange chromatography (Pharmacia Mono S column HR 10/10, gradient elution: buffer A - 50 mM HEPES, pH 7.9, buffer B - A + 3 M sodium chloride, 5 ml / min). The non-conjugated transferrin was eluted first and the product fractions at a concentration of about 0.66 to 1.5 M sodium chloride. Conjugated products (ninhydrin staining, UV 280 nm protein absorption and fluorescence) were collected in 6 fractions, each with a transferrin concentration of about 10 mg. Fractions were dialyzed against 100 mM iron (3) citrate solution (adjusted to pH 7.8 with sodium bicarbonate 11a) and then twice with 1 mM HEPES buffer (pH 7.5).

• I

After pre-treatment with 2-mercaptoethanol 11a, sodium dodecyl sulfate gel electrophoresis (10% SDS, 8% polyacrylamide) showed approximately the same concentration of transferrin in all 6 fractions, whereas no detectable concentrations were observed in the non-reduced samples. · ... · transferrin bands, but only a small amount • · ·: Conjugates and.

Preliminary Test 2 31 105103

Transport of transferrin-polylysine conjugates to living cells

To demonstrate that the transferrin-polylysine conjugates described in Preliminary Experiment 1 are efficiently translocated into living early red blood cells, these conjugates were labeled with FITC. As is known (Schmidt et al., 1986), FITC-labeled transferrin may have been detected (fluorescence microscopy) in intracellular vesicles in previously eradicated transferrin cells after incubation of the cells for several hours with transferrin.

In this example, early red blood cells (transformed with EGF receptor retrovirus, Kahazaie et al., 1988) were incubated for 13 hours in transferrin-free differentiation medium (composition in Zenke et al., 1988) at 37 ° C (1.5 x 10 6 cell concentration). / mL). Different transferrin-polylysine conjugates (or a comparable amount of sterile water (aq bidest)) were added to the cells, followed by incubation. at 37 ° C, 10 ng / ml EGF (to maintain the transformed state). After 24 and 48 hours, about 5x was taken. 1C5 cells, which were washed once with phosphate buffered saline (P3S, pH 7.2), were then fixed using 50x volume of a mixture of · · * ·· * 3.7% formaldehyde and 0.02% glutaraldehyde? SS: (10 · · · · · * * min, 40 ° C), washed once with? 3S and then transferred

Elvanol and examined under a fluorescence microscope (Zeiss Axiophot, thin-band FITC and TRITC excitation).

Simultaneously, j ***: growth rate of cells was determined from other samples of different mixtures. For this purpose, 100 • · · microliters of a cell suspension was taken to determine the uptake of 3H-thymidine (8 microcurie units / ml, 2 hours) as described in Leutz et al., 1984. that early red blood cells incubated with transferrin-polylysine 32 after 10 hours contained 2-10 highly fluorescent vesicles which were not found in the controls. Table A shows that virtually all cells except for fraction 6 took up all conjugates.

The fact that cells grow at the same rate in all samples (as measured by uptake of tritiated thymidine (3H-TdR); Table A) indicates that the polylysine structures do not damage the cells in the absence of nonspecific migration (e.g., through permeable cell membranes).

Preliminary Exam 3

Polylysine-transferrin structures are capable of functionally replacing the native transferrin-iron complex in in vitro-induced maturation of chicken erythrocytes into red cells. This assay was intended to demonstrate that the with similar power. The test system here is particularly well suited to early red cells that transform transforming tumor cells by "excluding" t% ··· 'can be induced to mature into normal red cells (Beug * IV. Et al., 1982). cells normally require high concentrations of the transferrin iron complex (100-200 micrograms / ml, 3x lower concentrations to prevent cell maturation and lead to cell death within a few days) (Kowenz et al., 1986).

• ♦ ·

Similarly, it could be demonstrated (Schmidt et al., 1986) that "re-recycling", that is, re-utilizing transferrin receptors and thereby transferring the transferrin cycle at an optimum rate, to normal in vitro diffusion II • 4 »• »I • *« • 4

'44 '«I

33 105103 essential.

Early red cells (transformed with EGF receptor retro virus) were induced to differentiate by removal of EGF and addition of an optimal amount of partially purified chicken erythropoietin (Kowenz et al., 1986, transferrin-free). The incubations were performed at 1 x 10 6 cells / ml and performed in transferrin-free differentiation medium at 42 ° C and 5% carbon dioxide. At the start of the incubation, either native transferrin-iron complex (Sigma, 100 micrograms / ml) or iron-saturated transferrin-polylysine conjugate (concentration of 100 micrograms / ml) was added. After 24 and 48 hours, cell growth and maturation were analyzed as follows: 1. Cell count assay (Coulter counter, Model ZM, Beug et al., 1984); 2. Cell Size Measurement (Coulter Channelyzer Model 256); and ·.:. · 3. Photometric measurement of the hemoglobin content of cells (Kowenz v: ', et al., 1986).

* ·

• »I

• ♦ t * · *: ··· In addition, the mixture samples were centrifuged after 72 hours · ** ·. In Cytozentrifuge-1 (Shandon), object 1 was 11a and a histochemical determination of hemoglobin (staining with neutral benzidine and Diff-Quick staining on blood cells, Beug et al., 1982) was performed.

It is clear from the results in Table B that ··· '·· ♦ cells induced to di f erect in the presence of polylysine-· «transfer transferrin conjugate fractions 1-5 matured just as efficiently and at the same rate as« ««. , cells incubated with native trans ferrin iron.

• 4 • 1 «•« · «• · • •« «34 1 05 1 03

In contrast, cells in transferrin-free controls showed strongly retarded cell growth and accumulated only small amounts of hemoglobin. Examination of the cell phenotype by stained cytospin preparations showed that cells incubated with polylysine-transferrin conjugates had matured into late reticulocytes (Beug et al., 1982), as did cells treated with native transferrin, whereas non-transferrin soluble et al., 1986). Only cells treated with transferrin-polylysine fraction 6 contained a lower hemoglobin concentration and a higher percentage of immature cells (Table B). This indicates that the particularly high polylysine-conjugated fraction 6 performs poorly in the transferrin cycle. At the same time, this result demonstrated the sensitivity of the test method.

Preliminary Examination 4

Polylysine Transferrin Conjugates Enable DNA Uptake in Early Red Rabbit Cells · · · · · · · · · · · · · · · ·; transported to cells. In this example, tDNA containing the following insert was used: · · ·

* · * * CGTTAACAAGCTAACGTTGAGGGGCATGATATCGGGCC

CCGGGCAATTGTTCGATTGCAACTCCCCGTACTATAGC with a molecular weight of about 300,000 and end-labeled with '···' 32? -AT? (Maniatis). About 0.3 micrograms of this DMA. · · Mixed with 20 microliters of TE buffer dissolved in either 10 micrograms of native transf errin, 10 micrograms · · 35105103 transferrin-polylysine conjugate fraction 3, each dissolved in 50 microliters of water (aq bidest) in addition to 400 micrograms / ml bovine serum albumin (Beug et al., 1982), or 50 'microlitres To each DNA-protein mixture was added 2 ml of transferrin-free differentiation growth medium and 4 x 10 6 chicken erythrocytes (transformed with EGF receptor retrovirus and preincubated for 18 hours in transferrin-free medium with EGF). ., 1988)), after which the mixtures were incubated for 8 hours at 37 ° C in a 5% carbon dioxide atmosphere. the supernatant was separated and the cells were washed 3 times with transferrin-free medium. The cell pellet and culture medium were slurried in a solution of 1% SDS, 1 mg / ml proteinase K, 300 mM NaCl, 20 mM Tris, pH 8.0, 10 mM EDTA (PK / SDS buffer) and incubated for 30 minutes. At 37 ° C, the solutions were then extracted with phenol / chloroform and the DNA isolated by ethanol precipitation. Isolated DNA having a total radioactivity of 2000 scintillation / min was separated on a non-denaturing 3.5% acrylamide gel (TBE,

Maniatis) and DNA were detected by taking an autoradiograph. The corresponding figure shows the fluorescence measurement results for early chicken. . ·. red cells incubated for 24 hours in the absence of conjugates (A) or FITC-labeled transferrin-polylysine-1. . conjugates IIa (B, C). When triggered by blue light '* (B, to indicate FITC), more fluorinating vesicles are clearly detectable in each cell. The specificity of this fluorescence resin is demonstrated by the fact that it is not obtained by blister fluorescence when subjected to green light (C) (in this case, a similar non-specific fluorination of the cells can be observed as in A).

*** This figure shows that in cell samples treated with transferrin-polylysine 11 cells take up about 5 to 10 times more DNA than control samples containing 36,105,103 native transferrin or no transferrin at all.

Two tRNA ribozyme genes against the erbB transcription initiation region were constructed (cf. Figures 2 and 3; Example 1). Approximately 100 micrograms of each gene-containing plasmid was digested with EcoRI to release the tRNA ribozyme gene as a 225 bp fragment. The digestion products were terminated using the Klenow fragment and purified by gel electrophoresis on a 2% agarose / TBE gel. The vector fragment and the tRNA ribozyme gene fragments were localized by ethidium bromide staining and excised, followed by recovery by electroelution, phenol / chloroform extraction and chloroform extraction, and ethanol precipitation. Purified, radiolabeled DNA fragments were then used using a transferrin-polylysine delivery system to determine uptake and inhibition of erbB RNA. The vector pSPT18 was used as control DNA.

Chicken early red blood cell

line transformed with avian early red cell virus AEV

With a heat sensitive mutant (i.e., 34, Graf et al., 1978) (Beug: :: et.ai., 1982 b). (ErbA tumor cell expressed similarly in these cells can be inhibited by a specific protein kinase inhibitor (H7). It was found that both protein in vivo and in vitro (i.e., protein expression in bacteria). CAMP-dependent protein kinase phosphorylates the v- • ErbA tumor factor at two sites, namely Ser28 and • · · Ser29. -erbA-v-erbB-containing early red blood cells to selectively eliminate the changes caused by v-ErbA (e.g.

::: differentiation blocking)).

37 105103

It is known that the erbB tumor factor in early red blood cells is inactivated and consequently induced - for example, by raising the temperature in the case of heat-sensitive erbB mutants to mature into red cells. One of the first signs of this sequence is the induction of hemoglobin synthesis, which can be detected at the individual cell level by a sensitive method (acid benzidine staining, Orkin et al., 1375, Graf et al., 1978). Thus, as a phenotype effect of the anti-ErbB ribozyme in this assay system, a specific increase in the number of benzidine-positive cells would be expected.

The assay series underlying this example was performed as follows: The various DNA preparations (see above and Table C), each dissolved in 30 microliters of TE buffer, were each mixed with 10 micrograms of native transferrin-iron complex or transferrin-polylysine conjugate (dissolved in 50 microliters of water) for one minute at 37 ° C.

In the case of vector DNA (10 micrograms), correspondingly more (100 micrograms) transferrin preparations were used. DNA-transferrin-DNA mixtures were each added to 1: 1 ml of transferrin-free differentiation medium (Zenke ?: et.ai., 1333). Test wells (3 per batch: <106) were incubated for 60 minutes in a transferrin-free ·: *: diff eration medium at 42 ° C (this enhances transferrin uptake) and then added to DNA-containing · · · transferrin-containing mixtures. After six (6), 18 and 68 hours ♦ · · (cell treatment as below), as described, samples were separated and separated into supernatant and cell pellet, which were then slurried in PK / SDS buffer and analyzed for DNA. (Figure 9)

At the end of the incubation (6 hours), the cells were centrifuged and transferred to transferrin-containing differentiation media 4 x 10 10, 2 ml per batch containing erythropoietin and insulin (Kowenz et al., 1986, Zenke et al. ., 1988), and. were incubated at 37 ° C in the presence of active v-erbB protein for a further 72 hours.

The following results were obtained: 1. As in Preliminary Experiment 4, enhanced (up to 5x) uptake of DNA could be detected in cell samples treated with transferrin-polylysine from the size of the erb piece DNA sequences.

2. Transfection of chicken connective tissue-forming cells with erb piece DNA could indicate that erb piece ribozyme tDNA would be expressed in chicken cells (see Example 5).

3. Table C shows that in all cases where erb-βα-ribozyme tDNA was introduced into erbB transformed early red cells using polylysine transferrin constructs, the percentage of benzidine-positive cells was significantly increased (approximately 2-fold). samples that had been treated with vector DNA and where the use of polylysine-transferrin conjugates did not: presumably result in benzidine-positive cells

I t I

increase).

»· ·

Example 7 • * • · · * "Extending the Anticodone Backbone Increases RibtRNA Yield»

The human met-tRNA gene (cloned as a BamHI / Rsal fragment delimited by the EcoRI-1 splitter, to the EcoRI site of the blue copy vector) was cleaved from its only Apal site in the · · · anticodon backbone. Single-stranded end residues were removed by treatment with T4 DNA polymerase 11a, followed by insertion of oligonucleotides containing ribozyme sequences.

39 1 05 1 03

The ribozyme insertion according to the previous examples resulted in a single ribtRNA molecule containing a three base backbone (Figure 11 shows the wild type tRNAmet and the tRNArib with a truncated anticodon backbone). In the second construct, an oligonucleotide differing from the first wild-type sequence in the GGTTAT sequence at the 5 'end was used. The wild type backbone was then prepared and extended by 4 additional base pairs (Fig. 12 shows construction of a tRNArib with an amplified anticodon backbone. Ribozyme sequences are shown in Fig. 13; 13 further shows the sequence of the met-tRNA gene). Both ligation products were transformed

According to standard methods described by Maniatis, an E. coli strain

HB101, followed by selection of appropriate clones, plasmid DNA

were isolated and sequenced to determine the correct structure.

The transcriptional activity of each of the resulting ribtRNA genes and the accumulation of ribtRNA molecules were examined in the presence of 32P-GT? By microinjection of the cloned DNA into Xenopus ova as described in Example 2 or 3. The wild-type tRNA gene was co-injected at 10x lower concentration. The injected ova were incubated: for 7 hours at 20 ° C, after which the RNA was collected (cf. Example 2), electrophoresed (10 ·; ···% acrylamide / 8.3 M urea / TBE gel) and RNA-mol ecyliters were made. * ··. view by taking an autograph image (2 day exposure at -7 ° C) • · • · · (Figure 14). The truncated ribtRNA gene generates about 1/10 of the amount of RNA transcribed by the vi11 type gene, while the gene encoding the ribtRNA molecule with the extended backbone produces 6x the amount of RNA.

• · · • · • · «« «r« «« t «« <<I «« I 1 <I «« «40 105103

Example 8

Expression of ribozyme genes as intron structural component Xenopus laevis tRNAtyrC-geer.i (egg cell type), comprising a 13 nucleotide intron, was selected as starting material. The native intron sequence was modified as follows: first, a suitable restriction site (Apal, GGGCCC) was inserted to allow subsequent cloning of the oligonucleotides, followed by the addition of anticodon triplet cumbersome nucleotides to obtain extra stabilization of the intron sequence. The size of the intron in the modified gene is increased from 13 nucleotides to 15 nucleotides (Figure 15).

The polymerase chain reaction (PCR, Ho et al., 1989) was used to modify the intron sequence. For this purpose, four primers were synthesized, two containing a modified intron sequence (mutant mutant) and the other two targeting the 5 'or 3' end of the gene, for the insertion of an EcoRI or Sal I restriction site, respectively. The wild-type pigen was a HhaI fragment (258 bp) in pBR327 «* !. cloned (Stutz et al., 1989). The resulting PCR product was purified on an agarose gel followed by digestion with the said restriction enzymes and the restriction enzyme 11 *: · 1: introduced into the vector pAALM (pSP64 + T7 promoter; Vieira and; ***; Messing, 1982). The construct transformed E. coli strain IT1 • T. HB101 and clones containing the desired insert were identified by sequence analysis.

The activity of the modified gene (tEXAtyrM) was compared to that of the vi11 type gene in Xenopus oocytes by · · * ··· 'microinjection, whereby the internal standard •' i '**' was co-injected with the 5S RNA gene (50x lower). · Concentration) contained in plasmid pUC-10-5S (Carroll and

• IM

♦ # ♦ «« «» 41 105103 3rown, 1976), in the presence of 32? -GT ?. The injected ova were incubated for 20 hours at 20 ° C, after which RNA was separated on an 8% acrylamide / 8.3 M urea / TBE gel and an autoradiograph was taken (Figure 16). Along with 5S RNA at 120 nt (nucleotide a), the primary t ?. "A-y trans transcript at 100 (102) nt, 5 'and 3' processed precursor form at 90 (92 ) nt, as well as the pre-processed tyrosine tRNA at 76 nt, 90 nucleotide precursor form cleavage is apparently the limiting factor that the majority of the transcript formed (about 80%) is in. It was not expected that biological activity was reduced by the modification.

The second experiment examined the system performance. Two oligodeoxyribonucleotides containing ribozyme sequences were synthesized which, including the Apal terminus, could be cloned directly into the intron sequence of the modified tRNA-γ gene. In one oligonucleotide, 12 nucleotides were added at each end to provide stable "hairpins" to ribintrons to counteract degradation by exonucleases. The total size of the introns thus obtained was 89 nucleotides (ribozyme-HP), in contrast to: the size of the unprotected ribozyme sequence (ribozyme-C) is 65 nt. Figure 17 shows the sequences of ribozymes as well as. : cloning strategy.

... In analogy to the above described Xenopus egg cell injections, a third structure containing the ribozyme-HP in dimeric form was used in addition to the two structures described, thereby raising the intron size to 163 nucleotides (ribozyme-D). In the case of structures HP and D, the concentration of the co-injected 5S standard was 1:20, which was 1: 1: ***: for structure C (Figure 18). The experiment shows that, despite substantially increased introns, structures H? and C are highly transcribed and processed as efficiently as the tRNA ^ yr gene of the viii type. For structure D, only a very small amount of the transcript can be detected, since apparently the long intron sequence has destroyed the secondary structure necessary for the formation of the Pol 111-1 transcriptional complex.

It could be shown that the expression of ribozymes as tRNA intrins does not substantially damage the secondary structure of the tRNA, whereby the resulting transcript can accumulate at high concentration and be properly processed.

• · · · · 1 1 · · · • · · · 105103 * HJ - sesssEse so αααααααο.

g £ oooooooo '^ !? · ^ οοοοοοοο SI OOOOOOOO- ά k a q o o ο ο o o o 3 ^ · · · · · · · S g o ^ c ^^ OfHcntn

O ^ TfCSOOlOiniOO

• H K

rH Γ0 W - + + + + + + + + + + + rt + + + + + + H <#> dfi <*> <*> <*> <#>

Xl £ <#> <*> _ _ .h o o o o o o 3 Qi-tiHCTvOlOClCr'C'i TJIVVAAAAAA '

O + J

rt Z ++ ++ a 3, c ++ O »rH O ++ + <#» <# »<#» 75

• H · n <#> <#> <* »O O O -H

rd 2 3 .s <* *> a vo ^ o> 3 rt {—l O O O · · ·>

W rv u_i r * rH rH 0% Φ Φ {O {O fO

<Ö C4VVAAA.0 0 0 rt

> '-P

<M * H

O 5 3 ^ Φ Φ

> * i? <D

3 iH - Ij • H 3 rt 3 Ai 3

5 rt rH N O Tf tn O W

. · ^ 5 U lH Vl iH U <H

• · · 'd bt {h h Cu b 6u 3

• .. C -H

· '· * · I I J iJ iJ iJ J 1-3 3 ·. ·· C -h o a a a a a. Ο ς

. . rl 3 O] IM «m IM« m {M IM 'H

:. ··: »5 B M = Kt.t.Ke.E. 2 ·: ··: 'S Ö' -h 3 b d) w> i * m

. ***. m: $ ιηιηιτ> ιηιηιηιη JS

..., G> - «^ * r <**** £ 5 En Λ '-H 3

3 <D M

W

3 <d> 3

P rt a) H

w jj ω> ω 4J Jö

··· »H, J 4J

«T ^ kj * .jj rt εεεεεεεε m <u ... rt QJ a:

·. · '> CNCNCNOJCMCNCNCH g -H

y s + 3 .... * x "

'* I

I o::: o: rt + * ... o m + * t * jQ) ^ (sn'Tinvor ^ o 44 105103: <β Ή

P

P

o ^ P w ..

C »O * P

w ω z> _ ° * »3 ** m3.

,, _ | v - ¢ 0 <* »·•• VO - e eH ο ο λ ο ώ λ I ® btu {S ap rH a · co · · o [j £ W <U> avvaCaCCO ^ a O * n> 1> < o λ: ^ * cn 33 £ 3 'Sd -h ^^ cncncip ^ mc'-nd q. ^ cc ^ cNPvommm ^ cri ^ d -Η P PCNCO {NiN <N {NCNr-t °

'Ο P »3 rH

C P 0 \ P P Ρ O '

I O g1 CN ZL

op gci ^ amovomcoc ^ H · ^ · ρω S '* σ) <τ> <ησ! Ρΐηιτ) Ν · ρ o pc o ........... o

Ρ <β P O O P P P P P I — I CN

> P

P P

C 0

• H C P

. P P

C rH U, CJ {0 {Ö

n <0 P

Z) £ -. * P

rH p Äcomcs ^^ Tpmm i oo Λ mm ^ 'qtf'jmmcs · ^ pj m wc p o - a

O c C EH

£ 3 ui m x a m - ° zJ ω E 3 p p

H H «^ ZL

Z) {fl {ö 3 Ji m fd Λ> Pw.cajiNOO'PCNama p

Eh p p «csvomc ^ mc ^^ cn.m ^ {T30 P rjt».,, X *, O '> ^ 5 o cscncNcNcncncncjcncn 3.

::: ο) -π o Q) P o. ·: ·. C ω cn ... cuo p ^ ω c

. . ·>, P ιζ1 P

·. ·: X p. Tj c. «U · Η ***** p cd ..>, p

c c n 3 P P

• * * μ-I Ο Λ, rt. - * _ _ M

• ·. ^ J W Cfl H CS 0Π ΙΠ vO / n Qs P p> 1 C rn .H, Η fn * <P p

β ** · # μ ^ <0 U * Cl * Ci * Cs * Cs * -HW

·. * · O C ω u --.-, -PC

u_ (HP p 'p ^ tCjidcd yj4 - (. t-3 I OC * C »C * C * C * C4; (jjj ^ d O (NPPPPPPpi)

id cd bi33 & * E »ppb> b · I

P W P o PM Ob I p p c ·· ·· C C Ό Id Ä. ** ·. p p <fl

··· '[j 9 jn PPPPHPPPH

. ·: ·. >, 33 sistesssse

*. P E ^ CNCNCNCNCNCNCNCNCN

P P 3 ': * ο ω> cp ω • · · id ..... t * i ...

·.:. · O; '·. · 2 PCNcn ^ mmc ^ co® »45 105103 w d

d I

W X

o ί *: id c> P · η '-rt Ρ JS C: m rH w <U>

.. d -n -H

m 3 d c ΰ M rH -H n / M · Η O · Η.

I O W Ό {η «- * rt * rt * rt» λ λ

> 'P -H ^ ΓΗ CH ΓΗ CS CS ΓΗ CS

h d ia h v w w w w w s ** -. ft <u -K ** ο p 'd t! en en ^ <n -rH n es ch es

lrH d W Φ d, λ | I I I I I I I

o 'cj ^ S + + + + + + + + ε' rf ^ -S LO pv ID ΓΗ en CH rH o M 'S' Ί H n 'ΓΗ -e CH CH CH CO.

rt O -H IdrH

MJ rH P g: m

Tn θ '-H <3 · π e o w ft § ε o o. e>.

U a »Λ id <l> * ·,

il X ÄM - rH i-H rH rH rH rH rH rH

rt “V V V V V V V VV

e o ^ O Ci m eicicici3.3.cici o · s. a a. a. · a. 3.

• rn O O

ooooo o oo

*. fH f-4 <H rH iH rH ^ «H

* · Η

w S

d d 'p «m in in n n S MP M Sh 4H U. Cb & 4 t *. ! 0'ämÖ j * J- * 3 'J' $ g ^ 2 -rl in M Ή M Ή lp 'P ^ erö ^ 4-h <Eh · "> 6 ·· & · 6« 6 «& · 6 * d -H 55 JS g • rH Λ Q tH d:: doi - ci ci * ....

* * * {ti rH -rH 2t 3, ^. ·: ·. h o> ε <- * ·. * · o - ^ n in.

. . ε> i * * e: ·.: 2 „o cj o o 2 • - o 1. a.2. m tn i «rt θ: ¾ O O * - £

Sm ^ H ^ ° O -H

* · | S M

· * · H «: ¾. ·: ·. E Λ --g *. · ·> 1 SH ε ia 0) ft I e>? > tn in ό 2 * jj .O o o · TJ -ä

s »<§ · * ΐ *«. I

£ 3 z N N N «S

d P Q P id

. · ". RH rH * E

O: <d d w ia & td -h ft

• C ω ^ ^ 00 -H

. . 3 (0 <d m m -h .S. Ft <d rtj rH + + pc ;, ίη V rH rH Π Π • · -H + j ro ro n m -H: «d -H:« d rH 1 i -H ...

, ···, {do 'rH rH m m {d -H Id -rl; Q

·, Ä-r-i> E> ε P 1 P

,, p id 'id id' pi · & id 'id

, rn cd i rH rH i— | rH Ή S Ή ix rH rH

··· i> -r-i -riididid'idMoiSHWidid -ro ft ft ft ft O P OP ft ft. . (d ί ι'ι ί p o P Ο ί ί ΡϊΛΛ ΛΛ ^ ίΛΛίΛΛΛ ·· ΡΡΡΜφ-Ηφ.ΗΜΡ a) <v <u <v> u> μ α> <u o 46 105103

References:

Altmann et al. Oh. (1988), "Structure and Function of Major and Minor Small Nuclear Ribonucleoprotein Particles" ed., Bimstiel, Springer Verlag, Berlin, 183-195.

Beug et. al. (1982a), J. Cell Physiol. Suppl.1, 195-207 Beug et al. (1982b), Cell 28, 907-919 Beug et al. (1984), Cell 36, 963-972 Cairo 11 and Brown (1976), Cell 7, 477-486 Ciliberto et al. al. (1982), Proc.Natl.Acad.Sci.79, 1921-1925

Clarkson, '' Eukaryotic Genes. Their Structure, Activity and Regulation *. ed. McLean et al.,

Butterworth (1983), 239-261 Cotten et al. al. (1988) EMBO J., 7-1801-808 Feigner et al. al. (1987), Proc.Natl.Acad ♦ Sci ♦ 84, 7413-7417

Folk at. al. (1983) Cell 33, 585-593 Fromm et al. (1987) Methods in Enzymol. 153, 351-366 Geiduschek et al. (1988) Ann.Rev.Biochem. 57, 873-914. Graf et al. (1978), Nature 275, 496-501, Graham et al. al. (1973), Virology 52, 456-467! . Hampel Tritz (1989), Biochemistry 28, 4929-4933; Haseloff et al. al. (1988) Nature 334, 585-591 / Ho et al. al. (1989), Gene 77, 51-59 * ··· * Hofstetter et. al. (1981), Cell 2 £ 573-585: Jennings et al. al. (1987), EMBO J. Vol.6, 10, 3043-3047

Jung et al. al. (1981), Biochem.Res.Commun.101, 599 Kahazaie et al. (1988) EMBO J. 10, 3061-3071 Kowenz et al. al. (1986), fMod.Trends in Human Leukemia VII, 1 Springer Verlag, 199-209 Kressmann et al. (1978), Proc.Natl.Acad.Sci. 75, 1176-1180

Kressmann et al. (1980), Series 31, 383-407 Kuo et al. al. (1988) J. Virol. 62. 4439-4444 47 105103

Langridge et al. (1987), Methods Εηζγτηοΐ. 153, 336-351 Leutz et al. (1984), EMBO J. 3, 3191-3197 Maniatis et al. Oh. (1982) / 'Molecular Cloning1 Cold Spring Harbor

Melton et al. (1984), Nucleic Acids Res. 12, 7035-7056 Mowry et al. (1987) Science 238, 1682-1687 Orkin et al. (1975), Proc.Natl.Acad.Scl. 72, 98-102 Pepperkok et.al. (1988), Proc.Natl.Acad.Sci.85, 6748-6752

Schmidt et al. (1986), Call 46, 41-51 Sharmeen et al. (1988) J. Virol.62, 2674-2679 Soldati et al. (1988) Mol.Call.Biol.8, 1518-1524 Stewart et.al. (1987), EMBO J.6, 383-388 - Stutz et al. (1989), Genes & Development Vol.3, 8, 1190-1198

Tellford et.al. (1979), Proc.Acad.Sci. 76, 2590-2594 Uhlenbeck et.al. (1987) Nature 328, 596-600 Vennstrom et al. (1980) J. Virol. 36, 575-585 Viera and Messing (1982), Gene 19. 259-268 Wu et al. (1989J, Proc.Natl.Acad.Sci. 86. 1831-1835 Zasloff et al. (1982), Nature 300. 81-84: Zasloff et al. (1983), Proc.Acad.Sci. 80, 6426-6440

Zenke et al. al. (1988), Cell 52, 107-119 * · · · · · ·

Claims (18)

48 105103 1. A DNA molecule, preferably in a multi-copy form, comprising sequences of a gene transcribed by polymerase III and a DNA sequence encoding an inhibitory RNA molecule, characterized in that it contains the transcription units of the tRNA gene, including the transcription units of the tRNA gene: and that the DNA sequence encoding the inhibitory RNA molecule is so arranged in the DNA molecule that the inhibitory RNA molecule is part of the transcript. DNA molecule according to claim 1, characterized in that the inhibitory RNA molecule is a ribozyme. DNA molecule according to claim 2, characterized in that the ribozyme is a ribozyme of the "hammerhead" type. DNA molecule according to claim 1, characterized in that the inhibitory RNA molecule is antisense RNA. * · 1 1 5. A DNA molecule according to claim 1, characterized in that it contains transcriptional units of the initiating Met tDNA. • 1 · • · • «· DNA molecule according to claim 1, characterized in that it contains the transcription unit · · · of tyr-tDNA. units. • · • «· · · • • • *! 1 A DNA molecule according to any one of claims 1 to 6, characterized in that it contains a DNA sequence encoding an inhibitory RNA-Mole as an insert between the A-segment and the B-segment of the t-RNA gene. 49 105103 8. A DNA molecule according to claim 5 or 7, characterized in that it contains a DNA sequence encoding an inhibitory RNA-Mole as an insert at the native Apal restriction site between the A and B segments. A DNA molecule according to claim 6, characterized in that it contains a DNA sequence encoding an inhibitory RNA molecule as an intron insert. A DNA molecule according to any one of the preceding claims, characterized in that it contains an oligonucleotide sequence such that the anti-codon backbone region of the tRNA transcript is longer than that of the wild-type tRNA transcript. 11. A DNA molecule according to claim 9 or 10, characterized in that it contains a DNA sequence encoding an inhibitory RNA molecule as an insert at a synthetically linked restriction site. 12. A DNA molecule according to any one of claims 9 to 11, characterized in that the intron is modified such that the secondary structure of the precursor tRNA is stabilized, thereby maintaining the cleavage-critical structures. • · · • • • • • • «» * .1 1 13. A DNA molecule according to any one of claims 1 to 12, characterized in that the inhibitory RNA is directed against viral RNA. • · · · · · · · · · 14. A DNA molecule according to any one of claims 1 to 12, characterized in that the inhibitory RNA is targeted to oncogene. or other key genes that regulate cellular growth and / or differentiation. A DNA molecule according to any one of claims 1 to 14, characterized in that it is in a multi-copy form, wherein t · '. : identical or different subunits containing the DNA sequences encoding the inhibitory RNA molecule are present as complete transcription units. A method of introducing the DNA molecules of any one of claims 1 to 15 into superior eukaryotic cells in vitro. characterized in that the DNA molecule is modified such that its transfer to the cell is mediated by receptor-mediated endocytosis and contacting the cells with the DNA molecules. 17. The method of claim 16, wherein the DNA molecules are complexed with a transferrin-polycation cationic conjugate and the cells are contacted with the complex. Use of the DNA molecules of any of claims 1 to 15 for the production of transgenic plants, wherein the DNA molecules are constitutively expressed. · • 9 9 9 M M M M M M M M:::::::: * · * an an an an an an an »·« · · • • • · · · 1 · ♦ • «51 105103