JP2003511025A - Modification of gene expression by ssDNA produced in vivo - Google Patents

Abstract

(57) Abstract: A method for modifying the expression of a target nucleic acid sequence in a target cell by producing a single-stranded cDNA (ss-cDNA) in vivo in the target cell. Target cells are transfected with a cassette containing the sequence of interest, the inverted tandem repeat and the 3 ′ primer binding site for the inverted tandem repeat. Transcription of the cassette by the target cell produces an RNA template, which is reverse transcribed to produce a specific sequence of ss-cDNA. The reverse transcriptase / ribonuclease H coding gene can also be transfected into target cells. By modifying the ss-cDNA and utilizing the "stem-loop" structure of the ss-cDNA, the entire flanking vector sequence is removed (provided that the above structure is an inverted tandem that folds the ss-cDNA back to itself). (As a result of repetition), a double stranded DNA stem is formed. The double-stranded stem comprises one or more restriction endonuclease recognition sites and loops (remaining as ssDNA) and is composed of a sequence of interest that can be any desired nucleotide sequence. With this design, the double-stranded stem of the stem-loop intermediate is cleaved by the desired corresponding restriction endonuclease (s), and then the loop portion, or sequence of interest, is converted to a linear single-stranded fragment. Released as DNA. This released (or cleaved) piece of ssDNA contains minimal sequence information, if any, 5 ′ upstream or 3 ′ downstream from the double-stranded stem. The resulting ssDNA binds to an endogenous target nucleic acid sequence, thereby inactivating the gene using duplex or triplex binding of the nucleic acid, site-directed mutagenesis, disrupting cell function by binding to specific cellular proteins, and Alter the expression of the sequence for therapeutic purposes, such as disrupting RNA splicing function.

Description

Detailed Description of the Invention

TECHNICAL FIELD The present invention relates to a nucleic acid sequence as a template for producing the sequence after its modification in a prokaryotic or eukaryotic host cell and without (or with minimal flanking sequences). It concerns the modification of gene expression by a stable DNA construct, conveniently referred to as a cassette, which is incorporated for use as a system for expressing the sequence in eukaryotic host cells. The construct or cassette is a single-stranded DNA (ssDNA) sequence that functions in vivo to bind to or otherwise interact with a target gene to alter the expression of that gene,
It includes inverted tandem repeats that form the stem of a stem-loop intermediate that induces expression of a sequence referred to as the sequence of interest. According to the expression system of the present invention, most or all of the contiguous plasmid (or other vector) sequences are removed from ssDNA by stem loop formation followed by termination of the reverse transcription reaction by the stem or cleavage of the stem loop intermediate. . The ssDNA produced by this method is designed to target a desired gene by being complementary to and / or otherwise binding to an endogenous nucleic acid sequence target.

BACKGROUND ART Antisense gene therapy has been successfully used in various indications to down-regulate gene function. Jain, KK, Handbook of Gene Therapy,
New York: Hof Grefe and Hoover Publishing (1998).
However, to date, the above therapies have been characterized by some disadvantages and limitations, including in some cases severe ones, that have reduced the usefulness of this treatment type, resulting in a short half-life of the antisense molecule, Non-specific effects, uncertainty regarding the mode of action of antisense sequences, and potential toxic effects in animal studies are included. For example, antisense oligonucleotides (ODNs) and their analogs must be administered intravenously, causing problems in cellular uptake and distribution (Cossum, PA et al. ¹⁴ C-labeled phosphorothioate after intravenous administration to rats. Arrangement of oligonucleotides ISIS 2105, 267 J.Pharmacol.Exp.Ther.1181-1190
(1993), Sands, H. et al., Biodistribution and metabolism of internal ³ H-labeled oligonucleotides II.3 ′, 5′-blocking oligonucleotides, 47 Mol. Pharmacol. 636-64.
6 (1995)) and toxicity problems due to high blood levels (Henry, SP et al., Evaluation of toxicity of ISIS 2302, phosphorothioate oligonucleotide in 4-week test in CD-1 mice, 7 Antisense Nucleic Acid Drug Dev. 473-). 481 (
1997), Henry, SP et al., Comparison of toxicity profiles of ISIS 1082 and ISIS 2105, phosphorothioate oligonucleotides after subacute intradermal administration in Sprague-Dawley rats, 116 Toxicology 77-88 (199).
7)).

By far the most used antisense ODN analogues in antisense therapy are phosphorothioates or methylphosphonates. However, phosphorothioate ODNs tend to bind nonspecifically to serum and intracellular proteins (C
Rooke, ST et al., Pharmacokinetic properties of some novel oligonucleotide analogs in mice, 227 J. Pharmacol. Exp. Ther. 923-937 (1996), Gao, WY et al., Phosphorothioate oligonucleotides are human DNA polymerases and ribonucleases. Inhibitors of H: Implications for Antisense Technology, 41 Mol.Pha
rmacol.223-229 (1992)), which inhibits ribonuclease H activity at high concentrations (Crooke, ST et al. Escherichia coli ribonuclease H kinetic properties: cleavage of various antisense oligonucleotide-RNA duplexes. 312 Biochem. J. 599-608 (1995)). Phosphorothioate ODN has a lower Tm for RNA (0.5 per base pair than for DNA).
℃ average) (Crooke, ST and B. LeBleu, Antisense research and app
lication, Boca Raton: CRC Press (1993)). This low Tm requires that the phosphorothioate ODN be generally longer than the phosphodiester DNA oligonucleotide for efficient binding. However, increasing the length of the ODN can induce a loss of hybridization specificity (Toulme, JJ et al., Antise).
nse technology: A practical approach, C. Lichtenstein and W. Nellen (ed.)
, New York: IRL Press, pp. 39-74 (1997)). Furthermore, methylphosphonate ODN does not activate ribonuclease H enzyme activity (Maher, LJ et al., Inhibition of DNA binding protein by oligonucleotide directed triple helix formation,
245 Science 725-730 (1989), Miller, PS, Oligodeoxynucleoti.
des: Antisense inhibitors of gene expression, JS Cohen (ed.), Vocaleton: CRC Press, p. 79 (1989)), and is rapidly eliminated (Chen, TL et al., oligodeoxynucleoside methylphosphonate after a single intravenous injection in mice). And Metabolism, 18 Drug Metab. Dispos. 815-818 (1990)).

Another method of gene therapy involves administering a molecule that has catalytic activity for a gene and / or a transcript of a gene. Ribozymes contain only RNA molecules and can catalyze the cleavage of specific mRNA sequences and are considered potentially more effective than antisense ODNs due to their catalytic ability (Woolf, TM, To cleave or not to cleav
e: Ribozymes and antisense, 5 Antisense Res. Dev. 227-232 (1995)
)). Ribozymes are used as inhibitors of gene expression and viral replication
(Jain, supra (1998)). Unlike antisense ODNs, ribozymes can be delivered endogenously or exogenously, for example by using viral vectors.
However, ribozymes are limited in stability because they are degraded by ribonucleases in vivo (Jain, supra (1998)).

By using in vitro selection methods, some small single-stranded DNAs have recently been demonstrated to catalyze the cleavage of RNA (Breaker, RR, Catalytic DNA: Intr).
aining and seeking employment, 17 Nature Biotechnology 422-423 (
1999)), which provided the promise of targeted activity for specific genes. The patent and scientific literature reports on some of these short deoxynucleic acid sequences shown to have catalytic activity (Breaker, RR and
GFJoyce, 1 Chem. Biol. 223-229 (1994), Cuenoud, B. and JWSz.
ostak, 375 Nature 611-613 (1995), Santoro, SW and GFJo.
yce, 94 Proc. Natl. Acad. Sci. USA 4262-4266 (1997), Faulhamme.
r and M. Famulok, 269 J. Molec. Bio. 188-203 (1997), Carmi, N.
Et al., 95 Proc. Natl. Acad. Sci. USA (1998), Li, Y. and R Breaker, 96.
Proc. Natl. Acad. Sci. USA 2746-2751 (1999) and US Pat. No. 58.
07718 and 5910408), so-called "10-23 DNA.
Enzymes "and other ssDNA sequences that act, for example, as copper-dependent DNA ligases and calcium-dependent DNA kinases. The catalytic effectiveness of the above array is
Demonstration of cleavage of the mRNA target at 10 ⁹ m ⁻¹ / min ⁻¹ in the presence of divalent magnesium provided an opportunity for targeted destruction of substrate molecules (eg, RRBreaker, supra. (1999)). The art would recognize the potential use of this enzyme activity for therapeutic purposes, but to the best of our knowledge it is possible to produce in vivo therapeutic effects by producing these target-specific enzyme nucleic acid sequences. There is no system available for this.

Therefore, no system exists that takes advantage of the potential advantage of the effective catalytic activity of these enzymatic nucleic acid sequences to modify gene expression. Therefore, the object of the present invention is to
It is to provide a DNA construct that alters the expression of a gene that produces its target mRNA by directing the synthesis of ssDNA containing a sequence that specifically cleaves the mRNA target in vivo.

Since secondary structure folding can be crucial for the catalytic function of the enzymatic sequence of ssDNA, another object of the invention is the undesired intervention used to alter the expression of genes containing target nucleic acids. Also provided are methods and DNA constructs for preserving the enzymatic function of ssDNA for its target nucleic acid by producing ssDNA containing the above-mentioned DNA enzyme sequence having a desired nucleotide sequence in a eukaryotic cell without flanking nucleotide bases. It is to be.

Another object of the invention is ssDNA containing a DNA enzymatic sequence to overcome the significant problems faced by the use of standard oligonucleotide delivery methods for therapeutic purposes.
To provide a DNA construct used in the above method and a method for producing E. coli in a eukaryotic cell.

Another object of the invention is to bind to and for example bind to a protein which down-regulates a gene product or viral gene product of interest or binds to a nucleic acid sequence, eg by binding to mRNA in an antisense fashion. The present invention provides a method and a DNA construct for producing an ssDNA of a nucleotide sequence in vivo that functions as a non-limiting nucleic acid by inhibiting a specific cell function.

Another object of the present invention is a method for producing ssDNA designed to be suitable for binding to duplex (natural DNA) to form a triplex structure capable of interfering with normal gene transcription and regulation. And to provide a DNA construct.

Another object of the present invention is to produce ssDNA in eukaryotic cells to disrupt one or more cell functions.

Yet another object of the invention is that the ssDNA oligonucleotides bind and / or otherwise bind them to various cellular functions that rely on protein catalysis or nucleic acid protein interactions, such as transcription, translation and DNA replication. It is to provide a method and a DNA construct for producing ssDNA whose secondary structure is designed to inhibit or activate.

Another object of the invention is a method and DN for producing ssDNA in vivo for site-directed mutagenesis or gene knockout for therapeutic applications.
Providing the A construct.

Another object of the invention is to provide methods and DNA constructs for producing ssDNA having a precisely defined nucleotide composition compatible with site-specific insertion into the genome for therapeutic purposes. .

Yet another object of the present invention is a method and D for producing ssDNA complementary to an endogenous nucleic acid target for use in modifying the expression of a gene comprising the nucleic acid sequence target.
Providing NA constructs.

Another object of the invention is a catalyst for mRNA targets for transfection into eukaryotic cells that overcomes the difficulties of direct application delivery of ssDNA by lipofection, direct cell uptake and / or microinjection. It is to provide a method for the in vivo production of ssDNA containing sequences exhibiting activity, and the DNA expression used in such a method.

Another object of the invention is to provide all the enzymatic functions necessary for the in vivo production of ssDNA containing sequences with enzymatic activity towards selected target mRNAs in a single or dual plasmid expression system.

Another object of the invention is to provide methods and pharmaceutically acceptable compositions for delivering inhibitory nucleic acid sequences comprising sequences with enzymatic activity to target cells in a manner that produces a therapeutic effect. That is.

While this is a list of objects of the invention, this is not an exhaustive list of objects of the invention. Because of its shortness and utility, there are a vast number of other cellular functions not listed here and mediated by the cellular genome that are subject to regulation by in vivo production of ssDNA. For example, exonuclease is a double-stranded DNA (d
It digests ssDNA much more aggressively than sDNA). Therefore, another object of the present invention is to provide a ssDNA construct that is not as susceptible to degradation by natural exonucleases in cells as the dsDNA, and a method for in vivo production of that construct. It is clear from this description that this list of some of the objects of the invention is provided by way of illustration and is not intended to limit the scope of the invention.

[0020] These objectives are methods of modifying the expression of an endogenous nucleic acid target sequence in a target cell, wherein the sequence of interest is flanked by inverted tandem repeats and 3'primer binding sites (PBS). Is introduced into a target cell, and reverse transcription of the mRNA transcript of the cassette from PBS releases the single-stranded cDNA transcript in the cell. The sequence of interest is composed of nucleic acid sequences that alter the expression of the target sequence by producing a sequence of nucleic acids that binds to the endogenous target nucleic acid sequence upon reverse transcription.

Several aspects of the invention are illustrated in the drawings, and FIG. 1 is a diagram outlining the production of ss-cDNA in host cells according to the invention.

FIG. 2 is a schematic diagram of a stem-loop intermediate formed by the method outlined in FIG.

FIG. 3 is a schematic diagram of a pssXA plasmid containing the first component of the first aspect of the expression system of the present invention. To produce pssXA, the reverse transcriptase (RT) and MboII genes were subcloned into the mammalian expression vector pBK-RSV (Stratagene) and expressed as a single polypeptide. The RT and MboII domains are separated by a histidine-rich linker.

FIGS. 4A and 4B contain sequences of interest, including (1) MoMuLV reverse transcriptase promoter region, (2) NotI site, PacI and BamHI, and
(3) Schematic diagram of the pssXB plasmid containing the second component of the first embodiment of the expression system of the present invention comprising tandem repeats IR-L and IR-R (Fig. 4A), and the sequence of the insertion region of the pssXB plasmid (Fig. 4B). Is.

FIG. 5A is a schematic diagram of the pssXC plasmid containing the second embodiment of the expression system of the present invention, which includes the 10-23 DNA enzyme sequence outlined in FIG. 5B.

6A and 6B show the pssXD plasmid (including the third embodiment of the expression system of the present invention).
Figure 6A) and a schematic representation of the expanded part of the pssXD plasmid (Figure 6B).

FIG. 7 shows the results of a PCR assay for RT activity on pssXA-transfected cell lysates. Lanes 1 and 2: A549 cells transiently transfected with pBK-RSV vector, lanes 3 and 4: pssX.
A549 cells transiently transfected with A, lanes 5 and 5
: A549 cells stably transfected with pssXA (E10)
. Prior to PCR amplification, reverse transcription reactions were performed at 37 ° C for 10 (lanes 1, 3 and 5) or 30 minutes (lanes 2, 4 and 6), respectively.

FIG. 8 shows the result of ssDNA detection assay by PCR analysis. Total RNA was isolated from either E10 cells transiently transfected with pssXB vector, pssXB-I or pssXB-II. Prior to PCR amplification, total RNA was pretreated with S1 nuclease (lanes 1 and 3) or ribonuclease (lanes 2, 4 and 5) for 30 minutes at 37 ° C. Lanes 1 and 2:
pssXB-1, lanes 3 and 4: pssXB-II, lane 5: pssXB vector.

FIG. 9 shows the results of dot blot analysis for ssDNA detection. 1: ps
E10 cells transfected with sXB-I, 2: pssXB-II
Transfected with E10 cells, 3: E10 cells, 4: A549
cell.

FIG. 10 shows a bar graph quantifying Northern blots of ssDNA production vectors constructed according to the present invention producing antisense sequences for c-raf kinase. Lanes 1-3: cells harvested 24 hours after transfection,
Lanes 4-6: Cells harvested 48 hours after transfection. Lane 1
: E10 cells transfected with pssXB vector, lane 2
And 5: E10 cells transfected with pssXB-I, lanes 3 and 6: E10 cells transfected with pssXB-II.

FIG. 11: Control pssXD-I or pss containing c-raf DNA enzyme sequence.
2 shows the results of dot blot analysis for ssDNA detection in A549 cells transfected with XD-II. SsDNA by S1 nuclease
No detectable signal was generated in the presence of S1 nuclease due to the specific degradation of the enzyme.

FIG. 12 shows the results of quantitative RT-PCR to determine whether ssDNA expressed in A549 cells transfected with pssXD-II modified c-raf mRNA levels. Lane 1: control pssXD-I, lane 2: pssXD-II.

FIG. 13 shows the results of Western blot regarding suppression of c-raf protein expression in A549 cells transfected with pssXD-I or pssXD-II. Lane 1: pssXD-II, Lane 2: control pssX.
DI, lane 3: non-transfected cells.

FIG. 14 shows the results of Western blotting regarding the cleavage of genomic DNA for the induction of cell apoptosis by suppressing the expression of c-raf gene. Lane 1: pss
XD-II, lane 2: control pssXD-I, lane 3: untransfected cells.

FIG. 15 shows the result of Western blot regarding PARP cleavage for inducing cell apoptosis by suppressing c-raf gene expression. Lane 1: pssXD
-II, lane 2: control pssXD-I, lane 3: untransfected cells.

In this specification of the invention, in vivo in yeast, prokaryotic and / or eukaryotic cells, with or without flanking nucleotide sequences, used to modify the expression of target genes. Described are methods and nucleic acid constructs for producing single-stranded deoxyribonucleic acid (ss-cDNA) oligonucleotides having a virtually prespecified or targeted nucleotide base composition. Methods and constructs using biological synthesis rather than in vitro or artificial synthesis of ss-cDNA having the desired nucleotide base composition have been described. Since these methods use biological, ie enzymatic reactions, they are applicable to any in vivo system.

In one embodiment, the expression system of the invention is a vector designed to produce sequences of interest in ss-cDNA molecules in mammalian cells, preferably containing few flanking vector sequences. The term "vector" as used herein includes plasmids or modified viral or non-viral recombinant biological constructs used for the delivery and manipulation of synthetic and / or natural nucleic acid sequences). The vector system contains all of the enzymatic functions and signal generating means necessary to produce ss-cDNA in host cells. The host cell to which the vector of the present invention is delivered is driven by a eukaryotic promoter to produce an RNA transcript (FIG. 1),
That is, it is used as a template to direct the synthesis of the desired single-stranded DNA sequence (the "sequence of interest").

More particularly, the vector comprises two plasmids which are co-transfected into a suitable host cell, which may be yeast or a prokaryotic or eukaryotic cell, in order to modify gene expression in the cell. Described herein is a first expression system which produces the ssDNA sequence of interest. The target of interest in cells
A second expression system has also been described which modifies gene expression by containing a single plasmid containing the sequence of interest which is transfected into a suitable host cell for producing the sDNA sequence.

The ssDNA produced in vivo using the expression system described herein can be an inhibitory nucleic acid. The inhibitory nucleic acid can be ssDNA synthesized from the mRNA template or the mRNA template itself, and can specifically bind to complementary nucleic acid sequences. Upon binding to the appropriate target nucleic acid sequence, an RNA-RNA, DNA-DNA or RNA-DNA duplex or triplex is formed. More generally, since these nucleic acids are usually complementary to the sense or coding strands of a gene, they are often referred to as "antisense," although "sense" sequences are also used in cells for therapeutic purposes. It Thus, the term "inhibitory nucleic acid" as used herein includes both "sense" and "antisense" nucleic acids.

By binding to the target nucleic acid, the inhibitory nucleic acid modifies the function of the target nucleic acid.
This modification (usually an inhibitory effect) is induced, for example, by blocking DNA transcription, processing or poly (A) addition to mRNA, DNA replication, translation or promotion of cellular inhibitory mechanisms (eg, promotion of RNA degradation). . Thus, inhibitory nucleic acid methods encompass a number of different methods of altering gene expression. These different types of inhibitory nucleic acid technologies are described in Helene, C. and J. Toulme, 1049 Biochim. Biophys. Acta.
9-125 (1990), hereinafter referred to as "Helene and Toulme", which are incorporated herein by reference.

Briefly, inhibitory nucleic acid therapy involves (1) a method of targeting a DNA sequence, (2)
Method for targeting RNA sequence (including pre-mRNA and mRNA), (3) Method for targeting protein (sense strand method), and (4) Target nucleic acid such as ssDNA
It may be classified as a method of inducing the cleavage or chemical modification of an enzyme, eg the so-called “10-23 enzyme” described herein. The first method predicts several categories. Nucleic acids are designed to bind to the major groove of duplex DNA to form a triple helix or "triplex" structure. Alternatively, the inhibitory nucleic acid is a single-stranded DN that results from the opening of duplex DNA during replication or transcription.
It is designed to bind to the area A. More generally, the inhibitory nucleic acid is an mRNA
It is designed to bind to NA or mRNA precursors. Inhibitory nucleic acids are also used to block the maturation of pre-mRNA. Inhibitory nucleic acids can be designed to interfere with RNA processing, splicing or translation. In the second method, the inhibitory nucleic acid is targeted to the mRNA. In this method, the inhibitory nucleic acid is designed to specifically block translation of the encoded protein.
Using this second method, the inhibitory nucleic acid m encodes a critical protein.
Used to selectively inhibit certain cellular functions by blocking the translation of RNA. An example of such an inhibitory nucleic acid is a sequence complementary to a region of c-myc mRNA, which overexpresses the c-myc protooncogene, which results in c-myc protein expression in the human promyelocytic leukemia cell line HL60. Inhibit (Wickstrom EL et al.,
85 Proc. Natl. Acad. Sci. USA 1028-1032 (1988) and Harel-Bell.
an, A. et al., 168 Exp. Med. 2309-2318 (1988)). Helene and Toul
As described in me, inhibitory nucleic acids that target mRNA have been shown to act by several different mechanisms to inhibit translation of the encoded protein (s).

Inhibitory nucleic acids have also been described in Helene and Toulme in a third method of designing the "sense" strand of a gene or mRNA to trap or compete for enzymes or binding proteins involved in mRNA translation. Can be used. Finally, the use of inhibitory nucleic acids induces chemical inactivation or cleavage of the target gene or mRNA. Chemical inactivation can be achieved, for example, by inducing cross-linking between the inhibitory nucleic acid and the target nucleic acid in the cell and by the method envisaged here, ie by the enzymatically active sequences incorporated in the cassettes of the invention. It is performed by cleavage.

Briefly, in a first aspect, the present invention comprises the set of genetic elements adapted for delivery to a cell, thereby modifying ssDN to alter gene expression.
For producing A in vitro or in vivo, the expression system comprises a set of genetic elements and one or more stable transfected cell (s) containing the set of genetic elements. A set of genetic elements is incorporated into the expression system for delivery to the cell, (A) an RNA-dependent DNA polymerase (reverse transcriptase) gene, and (B) (1) inverted tandem repeats (IR), (2 ) (a) during inverted repeats (IR), (b) 3 ′ to IR, or (c) both 3 ′ to IR and IR, which are of interest 1
Include a cassette containing one or more sequences and (3) a primer binding site (PBS) for the reverse transcriptase located 3'to the IR as shown in Figure 2.

Although not required, the expression system also preferably includes functions and signal transduction means for in vivo transcription of these components and for translation of the reverse transcriptase (RT) gene. Additional elements, which may optionally be included in the set of genetic elements of the present invention, include ribonuclease genes, restriction endonuclease (RE) genes (for the purposes below), usually associated with RT genes,
A downstream polyadenylation signal sequence for expression in eukaryotic cells such that the mRNA produced by the sequence of interest contains a poly (A) tail (see Figure 1),
And the linearized ssDNA may include one or more DNA sequences that have enzymatic activity when folded into the appropriate secondary configuration. The invention is not so limited in one aspect of the set of genetic elements, regardless of whether the sequence of interest is located between inverted repeats (IR) or between the 3'side of IR and PBS. The DNA enzyme sequence is located within the sequence of interest.

In a first aspect of the expression system described herein, a vector system comprising two plasmids is provided and the above set of genetic elements suitable for delivery to a cell to produce ssDNA in vivo. Contains an RNA-dependent DNA polymerase (reverse transcriptase) gene, which further contains a ribonuclease H gene,
It is linked to the restriction endonuclease gene by a histidine-proline linker. These genes were constructed and inserted into a plasmid vector containing the necessary transcriptional and translational control elements along with polyadenylation tailing sequences. This plasmid is here the "A" plasmid, pssXA, as shown in FIG.
Is called. In the embodiment described herein, the above-listed three elements of the cassette are a reverse transcriptase (RT) matched primer binding sequence (PBS), a sequence of interest (SOI) and an inverted repeat (IR). A second "B" plasmid was constructed containing Typified by the plasmid pssXB shown in FIG.
In this second plasmid, the SOI is 5'between inverted tandem repeats or to PBS.
Position (relative to the mRNA transcript), PBS is located most 3'of the mRNA transcript. In other words, SOI is located between (1) IR, (2) IR and PBS, and / or (3) IR and between IR and PBS, and as described below B plasmid, that is, one (pssXB-I) is IR
Has SOI between (eg, NotI site), while (pssXB-II) has IR and PB
Those with an SOI between S (eg, cloned into the PacI / BamHI site) are described here. Like plasmid A, plasmid B also contains a combination of transcriptional control elements. However, in another preferred embodiment herein, the B plasmid does not contain (or require) translational control elements, as no protein product is produced from this construct.

In another aspect described herein, the expression system of the invention comprises a single plasmid vector, illustrated in FIGS. 5 and 6, and designated plasmids pssXC and pssXD, respectively, in which the genetic elements of The above set is incorporated. The components of the B plasmid, such as PBS, SOI and IR, reside in the untranslated 3'portion of the RT polyprotein in this C plasmid. In other words, when the RT-ribonuclease H component of the C plasmid is transcribed under the control of a suitable promoter (in the embodiments described herein, the RSV promoter was utilized),
The resulting mRNA transcript contains the coding region for the RT-ribonuclease H polyprotein and contains additional mRNA at the translation endpoint at the stop signal.
The transcript further contains elements from the B plasmid with a 3'downstream signaling event for the polyadenylation signal (3 'for this translated protein).
), They exist intact from the RT-ribonuclease H component.

The particular single plasmid expression system described here is based on the restriction endonuclease (R
E) Since it does not contain a gene, it does not digest the stem of the stem-loop intermediate formed by the inverted repeat. Therefore, SOI (including DNA enzyme) is 3'to IR
Since only the position inserts into the C or D plasmid, the transcript encounters the relatively stable stem of the stem-loop intermediate and is unable to continue transcribing the ss-cDNA from the mRNA transcript, thus undesired vector sequences are It is removed by immature truncation of the ss-cDNA product. More specifically, as will be apparent later, each SO
I was inserted only within the PacI / BamHI restriction sites of the pssXC and pssXD plasmids.

As will be apparent from the following description of the B, C and D plasmids, the plasmid contains a cloning site for SOI insertion. NotI site (located between IR)
Both the and PacI / BamHI (3 ′ to IR, eg between IR and PBS) sites are provided in the preferred embodiment of the B plasmid described herein. The C and D plasmids described here contain only PacI / BamHI sites for this purpose. However, those skilled in the art who have the opportunity to know the benefit of this disclosure will select these particular cloning sites for the particular system described herein, and other cloning sites would be equally useful for this same purpose. Should be admitted. A containing the two plasmid vector system described herein
The plasmid is not intended to include SOI, but one skilled in the art will appreciate that when using a two plasmid vector system, the elements of the set of genetic elements according to the invention, and in particular SOI, are convenient. It should also be appreciated that it can be inserted into either plasmid as can be

The nucleic acid sequence, referred to herein as the cassette, provides a template for the synthesis of ss-cDNA in target cells. It is this element that includes SOI, IR and PBS. As with the other elements of the genetic element set according to the invention, this genetic element is preferably a suitable broad-spectrum or tissue-specific promoter / enhancer, such as the CMV promoter, or a promoter / enhancer, located upstream of the genetic element. It is adjusted by the combination of.
Also, as with other genetic elements, the promoter / enhancer may be a constitutive or inducible promoter. Some other eukaryotic promoters may also be SV-4, if one of skill in the art has the opportunity to appreciate the benefit of this disclosure.
0, RSV (non-cell-type specific) or tissue-specific glans fibula acidic protein (GF
It should be appreciated that it can be used to advantage in controlling the expression of SOI, including AP).

Primer binding site (PBS) that initiates priming for cDNA synthesis
Is located between the 3'IR and the polyadenylation signal. PBS is a sequence complementary to transfer RNA (tRNA) present in eukaryotic target cells. The murine Maloney reverse transcriptase (M) described herein as used in connection with the present invention.
In the case of oMULV RT), PBS utilizes proline tRNA. The PBS used in connection with the presently preferred embodiment of the invention described herein was taken from the actual 18 nucleotide sequence of murine Marronie virus. Shinnick, TM
Et al., Nucleotide sequence of Moloney murine leukemia virus, 293 Nature
543-548 (1981). In the case of the RT gene from human immunodeficiency virus, which was also tested as described below, the PBS used was taken from the nucleotide sequence of HIV. Y. Li et al., 66, J. Virology 6587-6600 (1992). Briefly, any PBS compatible with a particular RT can be used for this purpose. PBS is exclusively recognized by the primer tRNA, which is endogenous to the target cell. Each tRNA has the ability to recognize a unique sequence (ie, codon) in an mRNA transcript that encodes an amino acid and has the ability to covalently bind to a specific amino acid (ie, a tRNA binds to a specific amino acid and becomes “charged”). It has been done.) However, when the primer tRNA is bound to the mRNA transcript rather than covalently bound to an amino acid (ie, "uncharged state"), R
It can be used to initiate ssDNA synthesis by T. For example, the MoMULV RT used in the example described here recognizes and uses an uncharged ricin tRNA, which in turn recognizes its unique sequence in PBS and binds to it. That is, each PBS incorporated in the expression system of the present invention must contain a unique sequence recognized by the primer tRNA, and the primer tRNA must be a primer tRNA recognized by the specific RT used. I won't.

Other retroviral RT / ribonuclease H genes may be used to advantage in the context of the present invention, wherein the RT / ribonuclease H gene is an upstream eukaryotic promoter / enhancer suitable for expression in human cells, eg It is preferably the RT / ribonuclease H gene regulated by the CMV or RSV promoter. RNA-dependent DNA polymerase / RT genes suitable for use with the present invention include retroviruses, hepatitis B, hepatitis C strains, bacterial retron components, and retrons isolated from various yeast and bacterial species. There is one. As found in reality, these RNA-dependent DNA polymerases usually have related ribonuclease H-component enzymes within the same coding transcript. However, the present invention does not require the native ribonuclease H gene for a particular RT. In other words, one of ordinary skill in the art, from this disclosure, will be able to perform various functions of the RT and ribonuclease H genes by splicing them together for use in connection with the present invention. And modified and / or hybrid versions of these two enzyme systems are available, and / or
Or it should be admitted to those skilled in the art that they are known to function in the manner intended. Also, one of ordinary skill in the art will recognize that the target cell may itself have sufficient endogenous ribonuclease H to perform this function. Similarly, if you are a skilled expert in the industry,
It should be appreciated that the target cell itself may have sufficient intrinsic RT activity to perform this function, eg, prior to retroviral infection.

The RT / ribonuclease H gene is also produced from the RT / ribonuclease H gene, preferably by including a downstream polyadenylation signal sequence.
RNA contains a 3'poly (A) tail for mRNA stability. As is known to those skilled in the art, numerous poly (A) tails are available and are commonly used in the production of expressed eukaryotic genes.

One of skill in the art will also appreciate that some tissue-specific or broad-spectrum promoter / enhancers, or promoter / enhancer combinations other than those listed above may also be used in RT / ribonuclease H gene, RE gene ( It should be acknowledged that they can be used to advantage in controlling the sequence of interest). A list of all available promoters / enhancers is not required to demonstrate the present invention, but as indicated above, promoters / enhancers can be constitutive or inducible and are listed here. CMV or RSV
It may include (non-cell type specific) or GFAP (tissue specific) promoters / enhancers and many other viral or mammalian promoters. Representative promoters / enhancers suitable for use with the cassettes of the present invention include HSVtk
(SLMcKnight et al., 217 Science 316 (1982)), human β-globulin promoter (R. Breathnach et al., 50 Ann. Rev. of Biochem. 349 (1981)), β.
-Actin (T. Kawamoto et al., 8 Mol. Cell Biol. 267 (1988)), rat growth hormone (PR Larsen et al., 83 Proc. Natl. Acad. Sci. USA8283 (1986)).
, MMTV (AL Huang et al., 27 Cell 245 (1981)), adenovirus 5E.
2 (MJ Imperiale et al., 4 Mol. Cell. Biol. 875 (1984)), SV40 (P. Ange.
l et al., 49 Cell 729 (1987)), α-2-macroglobulin (D. Kunz et al., 1).
7 Nucl. Acids Res. 1121 (1989)), MHC class I gene H-2 kb (M.
A. Blancar et al., 8 EMBO J. 1139 (1989)), and thyroid stimulating hormone (VK
.Chatterjee et al., 86 Proc.Natl.Acad.Sci.USA 9114 (1989)), but is not limited thereto.

RT produced in a cell synthesizes complementary DNA (cDNA) using a genetic element containing the following SOI as a template. The ribonuclease H activity of RT is
By degrading the mRNA template component of the A / cDNA hybrid, ss-c
DNA is produced in vivo.

The gene encoding RE, which is used in the two-plasmid expression system and is not an essential component of that system, is any of several genes encoding RE, and preferably one or more thereof. It may be controlled by the above constitutive or inducible broad spectrum and / or tissue specific promoters / enhancers, such as those listed above. The specific REs tested are MboII and FokI,
One of ordinary skill in the art having the opportunity to appreciate the benefit of this disclosure will recognize that any RE (type I, II, IIS or III) site can be included in the IR. These enzymes linearize the SOI as single-stranded DNA by "clipping" or digesting the stems of the following stem-loop intermediates.

Expression of the RE gene may be carried out using a suitable constitutive or inducible promoter / enhancer located upstream from the restriction endonuclease gene for expression in human cells.
The plasmid ps, which may be regulated by, for example, the CMV or RSV promoter,
In sXA, the RE gene (MboII) is linked to the RT-ribonuclease H polypeptide. The RE gene also preferably contains a downstream polyadenylation signal sequence so that the mRNA transcript from the RE gene has a 3'poly (A) tail.

The cassettes of the present invention also include inverted tandem repeats (IR). MRNA digestion from mRNA-cDNA heteroduplex by ribonuclease H and ss-
After the release of the cDNA, the ss-cDNA is folded back by IR and the stem
It forms a loop-structured stem, in which case RT / ribonuclease H produced in the cell after transcription of the cassette and by transcription of the gene
After producing the ss-cDNA sequence of interest from the RNA transcript, the stem structure is composed of double-stranded antiparallel DNA as shown in FIG. 2 as described in US Pat. No. 6,054,299. . One or more RE site (s) that are cleaved by the RE produced from the RE gene (in those plasmids containing the RE gene) are double-stranded forming the stem of the stem-loop intermediate. It can be designed in parts, ie IR. The ss-cDNA produced is transcribed by the encoded 5'and 3'regions flanking the loop containing the stem (constituted by IR) and SOI. The stem is then cleaved (also referred to as digestion or cleavage) by any of a number of RE enzymes that recognize a cleavage site designed in the stem to release the ss-cDNA loop (although the RE gene is not of the present invention). Although not included in the vector system, the endonuclease recognition site can be engineered into the stem) (
(See Figure 1). Since RE recognizes only double-stranded DNA as a target substrate, ss-c
Since the loop portion of DNA does not form an apparent duplex DNA,
No response to RE activity.

As mentioned above, the skilled artisan of ordinary skill in the art will appreciate that if it is desired to produce ssDNA from SOI located between PBS and IR, the RE site (s) may be present.
It should be appreciated that the transcription of the cassette does not have to be designed into the IR forming stem of the stem-loop intermediate, and that transcription of the cassette terminates at the stem formed by IR. Another option is to design the IR to contain a eukaryotic, prokaryotic or viral protein DNA binding site that can act to competitively titrate selected cellular proteins. Depending on the base pair composition selected for IR such that a linear or correctly cleaved stem-loop intermediate form of ssDNA is produced,
Combinations of restriction sites or other sequence-specific elements can be included in the IR. It is generally preferable to use synthetically constructed sequence-specific elements in the IR, as the natural inverted repeats do not appear to have properly aligned restriction sites.

As mentioned above, the cassette containing one of the elements of the genetic element set according to the invention may also comprise a DNA sequence with catalytic activity. The so-called "D
NA enzyme "(and in the embodiments described herein, DNA
The enzyme is located within the sequence of interest), the invention is particularly advantageously used when the sequence of interest serves as a template for the synthesis of inhibitory nucleic acids which are antisense sequences. It Therefore, in the example presented here, the enzyme activity against mRNA containing a c-raf cleaving enzyme specifically designed to bind to the 3'untranslated region of c-raf mRNA targeted by antisense ISIS 5132. The production of the antisense SOI shown in FIG. 5B, which comprises a sequence having: is described (Monia, BP et al., 2 Nature Medicine 668-675 (1996), incorporated herein by reference). The two 9 bp target-specific binding arms were flanked by 15 bp catalytic domains (Santoro, SW and GFJoyce, Mec).
hanism and utility of an RNA-cleaving DNA enzyme, 37 Biochemistry 13
330-13342 (1998), also incorporated herein by reference.
). By adding compatible restriction sites to the DNA enzyme oligonucleotides, they could be inserted into the NotI site or PacI and BamHI, and the resulting plasmids were designated pssXB-I and pssXB-II, respectively.

Those skilled in the art will appreciate that the present invention is not limited to antisense sequences, that antisense sequences need not necessarily include nucleic acid sequences having catalytic activity, and that inhibitory nucleic acid sequences are It should also be appreciated that it may be any of the other types of inhibitory nucleic acid sequences described above. C-ra in the A549 lung cancer cell line
Since f-kinase has been well characterized (Monia et al., supra (1996)), the above SOI was chosen to demonstrate the present invention. Raf protein is a serine / threonine protein kinase that has been shown to act as a direct downstream effector of ras protein in the MAP kinase signaling pathway, MEK1 / M
With downstream activation of EK2 and subsequent activation of ERK1 and ERK2 (Daum, G.
Et al., The ins and outs of raf kinases, 19 Trends Biol. Sci. 474-480.
(1994)). Some solid tumors and leukemias have been demonstrated to have mutations in ras or upregulation in the MAP kinase signaling pathway. Signal transduction pathways, such as c-raf associated tumors, are attractive targets for oncological therapy, and the phosphorothioate ODN ISIS 51 described above.
32 has been demonstrated to be a potent antisense inhibitor (Monia et al., Supra).
(1996)). In addition, ISIS 5132 has been shown to induce apoptosis (Lau, QC et al., 16 Oncogene 1899-1902 (1998), also incorporated herein by reference) and directed against the above tumors. It appears to represent a potentially effective treatment. This antisense ODN has recently entered the first clinical trial (O'Dwyer, PJ et al., C-raf-I depletion and tumor responses i
n patients treated with the c-raf-I antisense oligonucleotide ISIS 5132 (
CGP69846A), 5 Clinical Cancers Res. 3977-3982 (1999).
)), Which may prove useful in the treatment of c-raf associated tumors. Another SOI cloned into a plasmid for expression using the expression system of the present invention was the 10-23 DNA enzyme sequence (Santoro and Joy, inserted between the 5'and 3'complementary sequences.
ce, supra (1997)), a partial sequence of the 23rd codon of the h-ras antisense binding sequence with a 10-23 DNA enzyme sequence inserted between the 5'and 3'complementary sequences. Expressive) partial sequence of antisense binding sequence, and 5
It contains a partial sequence of the tat antisense binding region of the SIV sequence with the 10-23 DNA enzyme sequence inserted between the'and 3'complementary sequences. Each of these sequences is DN
Although including the A enzyme sequence, it should be appreciated from this disclosure that the skilled artisan in the art need not include the DNA enzyme sequence in association with these or any other SOI. .

The nucleic acid sequence having enzymatic activity used in the method of modifying gene expression described herein is a 10-23 DNA enzyme (Santoro and Joyce, supra (1997)).
The enzyme sequence is located in two configurations, for example (a) between the inside of IR and SOI (NotI site) or (b) inside of a second SOI located 3'to IR and 5'to PBS (PacI / BamHI site). ) Or both of them are inserted in the cassette. In any case, since the aptamer produced is specific to the target of SOI,
Used to inhibit or alter the DNA or mRNA splicing machinery or directly modify the cell genome in a specific manner by targeting other DNA sequences, mRNA sequences, and any other suitable substrate To be done.

It will be appreciated by those skilled in the art from this disclosure that enzymatically active DNA sequences will function to serve the purpose intended for insertion into the cassette of the present invention. Some nucleic acid sequences having enzymatic activity have been reported in the literature and include, for example: Sequences having ribonuclease activity, such as the so-called "10-23" and "
8-17 enzyme "(Santoro, SW and GFJoyce, supra (1997)) and other metal-dependent ribonucleases (Breaker, RR and GFJoyce, 1 Biol. Chem. 2).
23-229 (1994) and Breaker, RR and GF Joyce, 2 Biol. Chem.
655-660 (1995)) and histidine-dependent ribonuclease (Roth, A. et al.
And RRBreaker, 95 Proc. Natl. Acad. Sci. USA 6027-6031 (19).
98)), sequences having deoxyribonuclease activity, such as copper-dependent deoxyribonuclease (Carmi, N. et al. 3 Chem. Biol. 1039-1046 (1996), Carmi.
Et al., (1997) Sen, D. and CR Geyer, 2 Curr. Opin. Chem. Biol. 68.
0-687 (1998)) and a divalent metal ion as a cofactor or Faulhammer, D. and M. Famulok (269 J. Molec. Bio. 18-203 (199).
7)) Deoxyribonucleases that hydrolyze the substrate regardless of the divalent metal ion, sequences with DNA ligase activity, such as copper-dependent deoxyribonuclease (B
reaker, RR, 97 Chem. Rev. 371-390 (1997)) and zinc-dependent E.
47 ligase (Cuenoud, B. and JWSzostak, 375 Nature 611-613 (
1995)), sequences with DNA kinase activity, such as calcium-dependent DNA kinase (Li,
Y. and R Breaker, 96 Proc. Natl. Acad. Sci. USA 2746-2751 (19).
99)), and sequences with RNA kinase activity, such as calcium-dependent DNA kinase (Li,
Y., supra (1999)).

Generally preferred for use in connection with the cassettes of the present invention are those DNA sequences which have enzymatic activity derived from physiological conditions.

When the elements that make up the set of genetic elements of the invention are incorporated into a vector for the purpose of expression in target cells, the genetic elements that facilitate identification of the cells responsible for the vector and the cassette and / or that make up the cassette Preferably, the vector contains other specially defined genetic elements in order to enhance the expression level of the set. The specialized genetic element containing a selectable marker gene allows the vector to be transformed and amplified in a prokaryotic system. For example, the most commonly used selectable marker is a gene that confers resistance to antibiotics such as ampicillin, chloramphenicol, kanamycin (neomycin) or tetracycline to bacteria (e.g., E. coli). Is. The vector also preferably comprises genetic elements specialized for subsequent transfection, identification and expression in eukaryotic systems. For expression in eukaryotic cells, multiple confers resistance to antibiotics or other agents on the cell or alters the cell's phenotype, such as morphological changes, loss of contact inhibition, or increased growth rate. Selection strategies (eg Chinese Hamster Ovary: CHO) can be used. Selectable markers used in eukaryotic systems include, but are not limited to, resistance markers for zeocin, resistance to G418, resistance to aminoglycoside antibiotics, or phenotypic selection markers such as β-gal or green fluorescent protein. Not necessarily.

By incorporating these components into a plasmid containing the expression system of the invention, ssDN
Two convenient methods of removing the predetermined vector sequences after production of A are possible. In the first method, the cassette is reverse transcribed from PBS and the SOI between IRs is
The nucleotides that make up the IR pair make up the loop portion of the ssDNA stem-loop intermediate that is produced when forming the stem-loop vector, the stem contains the RE site, and after digestion with the appropriate RE, the loop becomes Without ranking sequence (
And / or minimally) as linear single-stranded cDNA. In the second method, the cassette is reverse transcribed from PBS and S contained 3'to the IR of the cassette.
OI is similarly transcribed, but reverse transcription is terminated at the stem of the stem-loop structure formed by IR nucleotide pairing. In any case, the generated ssD
NA is produced without (and / or with minimal flanking sequences). Where it is desired to produce ssDNA using the second method, a cassette with an IR that forms a more stable stem than is required by the stem when ssDNA is produced by digestion of the stem according to the first aspect of the invention. Are designed (eg R
(By designing the IR so that it does not contain the E site). By designing a cassette with an IR that forms a stem that is easily denatured according to the first aspect of the invention,
Reverse transcription proceeds straight through the second SOI (if actually designed into a cassette) to the SOI located between the IRs. Therefore, this "immature termination" of the reverse transcriptase cDNA transcript on the 3'side of the stem structure results in in vivo produced ss-cD.
A second method of limiting intervening vector sequences included with NA is provided. With the stem being a stable intermediate, both first and second SOI can be produced.

It should also be apparent to those skilled in the art from this disclosure that the intact stem-loop ss-cDNA structure can function in many applications as well as the linear ss-cDNA form. Is. Thus, the cassettes are also advantageously used without the restriction endonuclease gene and associated regulatory elements, and / or with sequences of interest lacking the corresponding restriction endonuclease site.

It will also be apparent to those skilled in the art from this description of the preferred embodiments of the present invention that cassettes encoding ss-cDNA with "trimmed" stem-loop structures can be produced. Should be. The IR-encoded RE sites flanking the ends of SOI remove a portion of the stem and associated flanking sequences by digesting the stem portion (after duplex formation) with the corresponding RE Is designed to cleave the dsDNA that makes up the stem in a manner that leaves sufficient duplex DNA to retain the stem-loop structure. The ss-cDNA structure has a double-stranded form of ssDNA.
Retaining the "end" of may allow greater resistance to intracellular nucleases.

In addition, a stem (duplex D) is included so that it contains a predetermined sequence (s), ie, aptamers, that are recognized and bound by a specific DNA binding protein.
It should be apparent to those skilled in the art from this description of the preferred embodiments of the invention that NA) can be designed. Among other uses, the stem structure is used in cells as a competitor to titrate the selected protein (s) that regulate specific gene function. For example, ss-cDNA stem loops containing binding sites for selected positive transcription factors, such as adenovirus E1a, are produced in cells according to the invention. Adenovirus E1a, like other oncogenes, modulates the expression of some adenovirus and cellular genes by affecting the activity of cell-encoded transcription factors, resulting in the conversion of normal cells into transformed cells. It Jones et al., 2 Genes Dev. 267-281 (1988). Therefore,
The duplex stem of the stem-loop intermediate produced according to the present invention functions to "wrap" this transcription factor, preventing the protein from binding to the promoter, ie, inhibiting the expression of certain deleterious genes. Designed to. It should be apparent to the skilled practitioner in the art that the duplex stem structure may optionally include multiple binding sites, such as those recognized by various transcription factors that actively regulate expression of a particular gene. . For example, adenovirus E1
a is a phorbol ester responsive element, ie 12-O-tetradecanoylphorbol 13-acetate (TPA), some other mitogen, and ra
It was found to repress transcription of the collagenase gene via promoter elements involved in transcription induction by the s, mos, src and trk oncogenes. This mechanism involves inhibition of the function of the transcription factor group AP-1. Offringa et al., 62 Cel
l 527-538 (1990). Any desired nucleotide sequence
Insertion into the genetic element encoding the “loop” portion of the loop intermediate may provide the desired inhibitory function, eg, antisense binding, down-regulation of genes, as described herein.

In another embodiment, as will be appreciated by those skilled in the art, the present invention provides a complex secondary ssDNA that confers a biological response on a cDNA transcript based on conformational secondary structure folding. Used to build structure. The secondary structure can perform any of several functions when subjected to genetic manipulation. For example,
The sequence of interest is found in so-called "cloverleaf-type" or "crucible" -like structures by incorporating in the loop part of the single-stranded cDNA transcript, eg the long terminal repeats or retrotransposons of adeno-associated virus. It may include sequences that form one. Under the right circumstances, the structure integrates into the host genome in a site-specific manner.

The cassettes of the present invention are compatible with incorporation into a number of commercially available delivery vectors for mammalian and human therapeutic purposes, so that a number of delivery routes are feasible with the vector selected for a particular target cell. . For example, viral vectors
Often used to transform patient cells and introduce DNA into the genome. In the indirect method, a viral vector carrying new genetic information is used to infect target cells excised from the body, and then the infected cells are reimplanted (ie, ex vivo). Direct in vivo gene transfer to post-natal animals has been reported for formulations of liposome-encapsulated DNA and DNA entrapped in proteoliposomes containing viral envelope receptor proteins. Nicolau et al., 80
Proc. Natl. Acad. Sci. USA 1068-1072 (1983), Kaneda et al., 243 Sc.
ience 375-378 (1989), Mannino et al., 6 Biotechniques 682-69.
0 (1988). In addition, positive results have also been reported with calcium phosphate co-precipitated DNA. Benvenisty and Reshef, 83 Proc.Natl.Acad.Sci.USA 9551-9
555 (1986). Other systems that have been used effectively to administer expression systems comprising the set of genetic elements of the invention include intravenous, intramuscular and subcutaneous injections, as well as direct intratumoral and intracavitary injections. Also, the cassette, when inserted into the selected expression system,
It is advantageously administered via topical, transmucosal, rectal, oral or inhalation delivery methods.

The cassettes of the present invention are antisense by splicing the specific sequence of interest into the cassette (between inverted tandem repeats or between PBS and inverted tandem repeats) using known digestion and ligation techniques. It is effectively used for delivery of triplex or any other inhibitory nucleic acid or single-stranded nucleotide sequence of interest. Also, one of ordinary skill in the art having the opportunity to know this disclosure will recognize that the signal used for expression in a eukaryotic cell may be determined by methods known in the art depending on the particular sequence of interest. It should be appreciated that it can be modified. For example, in a promising modification, changing the promoter confers advantageous expression characteristics to the cassette in a system where expression of the sequence of interest is desired. There may be so many possible promoters and other signals that they are very different depending on the particular target cell for which the sequence of interest is selected, so it may be preferred for the particular target cell and sequence of interest It is not possible to list all possible enhancers, inducible and constitutive promoter systems, and / or poly (A) tailing systems.

In one particularly preferred embodiment, the invention comprises a plasmid into which the RNA-dependent DNA polymerase and the RE gene have been cloned and a multiple cloning site (MCS) into which the user of the kit inserts a particular SOI. Take the form of a kit. The cloning site where the SOI is inserted is located between the IRs. The resulting plasmid is then purified from the cell culture in which it is maintained and lyophilized or otherwise stored for packaging and shipping to the user. The kit also includes a RE (for the MCS into which the SOI is preferably cloned, together with a suitable buffer for ligating the SOI into the plasmid, and a map of the plasmid.
More than one), ligase and other enzymes.

In the embodiments described herein, the SOI (s) are two plasmids designated A and B, each of which is designed and constructed to contain the above listed components. By co-transfection of cells or by single C
Alternatively, it is delivered to the host cell by the D plasmid. In the two-plasmid system, the B-plasmid contains the SOI within flanking sequences including the IR or integrated between the IR and PBS to provide post-translational processing signals that mediate the conversion of mRNA to ssDNA. The activity required to process the primary gene product of the B plasmid into ssDNA along with removal of the vector sequence and processing signal, specifically RT / ribonuclease H and RE (when used), was expressed from the A plasmid. To be done. The single-stranded DNA sequences released by the in vivo interaction of the transcripts of these components are free to bind intracellular targets such as mRNAs and DNA promoters in antisense and triplex strategies.

According to what is described here, as described above, the B plasmid is
It contains a cloning site (where the NotI site was used in the B plasmid described herein) in which the NA SOI is located (as described above, in the example described here, the SOI contains the 10-23 enzyme sequence). Antisense sequences for c-raf kinases, including, but as described above, other sequences produced in vivo using the expression systems described herein include "stuffer" or test sequences, telomere repeats, h-
ras, the region encoding the angiogenic growth factor pleiotrophin, and ta
including the region encoding t (from SIV)). Adjacent to both ends of the cloning site is the primary mR produced from the promoter (the CMV promoter was used in the B plasmid described here) to the desired single-stranded inhibitory nucleic acid.
It is a signal that directs the processing of NA transcripts. After cloning the desired SOI into the B plasmid, the A and B plasmids are co-transfected into cell lines selected for constitutive expression of ssDNA. Similarly, in the single plasmid expression system described herein, SOI is cloned into that plasmid and transfected into cell lines for further processing.
Regardless of the element distribution of the above set of genetic elements between two (or more) plasmids, or if the elements are all contained in a single plasmid, this processing proceeds in three steps after transcription of the single-stranded DNA region ( That is, SO
I, IR and PBS): (1) R expressed by the A, C or D plasmid in the embodiments described herein.
T (in the embodiment described herein, RT is MoMuLV RT), RT
Reverse-transcribes a plasmid RNA transcript with the exception of SO as shown in FIG.
I (SOI may optionally include a sequence having enzymatic activity), proceeds from the primer binding site 3'to IR and PBS, (2) either by ribonuclease H activity of the RT polyprotein or by endogenous Ribonuclease H digestion of the resulting heteroduplex with ribonuclease H activity releases a single-stranded DNA precursor from its RNA complement and (3) was formed during Watson-Crick base pairing of the IR-constituting bases. The flanking sequences are removed by premature termination of the cDNA transcript by digestion of the stem of the stem-loop intermediate or by formation of a stem-loop secondary structure by self-complementary IR.

Those skilled in the art will appreciate from this disclosure that SOI, especially RT, RE (
Specific cloning sites flanking the promoter, PBS and any other elements of the genetic element set according to the invention (if used)
It should be appreciated that the DNA will be selected for the particular SOI and / or system in which it is expressed.

Examples Unless otherwise stated, Seabrook et al. (1989) (J. Seabrook et al. Molecular Cloni
ng: A Laboratory Manual (2nd Edition), Cold Spring Harbor Press (19
89), hereafter referred to as "Maniatis et al. (1989)") and Ausubel et al. (1987) (FM).
Ausubel et al., Current Protocols in Molecular Biology, New York: John Willie & Sons (1987)), both incorporated herein by reference, are used in the examples below. Was done. Other methods of producing ssDNA, both by natural processes and artificial methods designed using various enzyme products or systems, may also be utilized in connection with the methods of the invention, and the practice presented herein. It should be understood that the examples are provided by way of illustration and are not intended to limit the scope of this disclosure or the invention described herein.

The plasmid pcDNA3.1Zeo + was constructed by Invitrogen Corporation (
Carlsbad, CA) and plasmid pBK-RSV from Stratagene (La Jolla, CA). Oligodeoxynucleotides (ODN) were synthesized by Midland Certified Reagent Company (Midland, Tex.). Polymerase chain reaction (
PCR) was performed with Taq DNA polymerase purchased from Boehringer Mannheim Corporation (Indianapolis, Indiana) on a Robo gradient thermocycler (Stratagene (La Jolla, CA)). Restriction endonucleases and T4 DNA ligase were obtained from Boehringer Mannheim Corporation (Indianapolis, Indiana). The ODN used are listed in the attached sequence listing.

Total ODN was 1 μl (5 μg in separate tubes incubated for 5 minutes at 70 ° C.
/ Μl, in water) and allowed to hybridize for 15 minutes at room temperature. Standard restriction endonuclease digestions were performed with 10 units of enzyme in a total reaction volume of 15 μl and the appropriate reaction buffer (EcoRI was used as a negative control).
The DNA fragment was separated and isolated from an agarose gel. Selection of positive clones on an ampicillin plate was performed after transformation into transforming XL1-Blue MRF cells (Stratagene) as described in Maniatis et al. (1989). After selecting positive clones, plasmid DNA was isolated using the above Qiagen plasmid isolation kit.

Construction of plasmids. The construction of four expression plasmids is described. First plasmid. PssXB (FIG. 3) was derived from pcDNA3.1Zeo (+) (Invitrogen Corporation) and contains the genetic elements that encode the ss-cDNA sequence of interest as used herein. pcDNA3.
1Zeo (+) was digested with the restriction endonucleases HindIII and NotI at positions 911 and 978, respectively. Synthetic single-stranded oligodeoxynucleotide ODN-5'-N / M (link) 2-H / N and ODN-3'-N / M (link)
A double-stranded linker region with compatible HindIII and NotI ends formed by annealing 2-H / N was transformed into SureII cells (Stratagene, Inc.) under standard conditions and the HindIII / NotI duplex was transformed. Ligation into digested pcDNA3.1 Zeo (+). ODNs were hybridized with 1 μl (5 μg / μl in water) in an Eppendorf tube incubated at 70 ° C. for 5 minutes and at room temperature for 15 minutes. Select the appropriate clone,
Sequencing ensured proper insertion of the linker region. The generated plasmid was named pssXB. pssXB is shown in Figure 4A and is the plasmid into which the sequence of interest (Figure 4B) is cloned. To clone the sequence of interest between the inverted tandem repeats, 935 and 97, respectively.
Two NotI sites at position 8 (see Figure 4A) were used. These two sites are contained within the inverted tandem repeat. Two convenient restriction endonuclease sites, PacI and BamHI, at positions 1004 and 1021, respectively were used to insert the sequence of interest between the inverted tandem repeats and the primer binding site.

The second plasmid is also a component of the two-plasmid vector system described here, pssXA (FIG. 3). This "A" plasmid is Mo-MuLV-
RT (Shinnick, TM et al., 293 Nature 543-548 (1981)) and a restriction endonuclease gene, and XL-1BlueMRF as a host cell.
Was derived from pBK-RSV (Stratagene). The mouse cell line expressing Moloney murine leukemia virus is an American type culture
Obtained from the collection (# CRL-1858). Viral RNA was analyzed by Chomczymski, P. and N. Sacchi (162 Anal. Using the Trizol reagent (Gibco BRL).
Biochem. 156-159 (1987)) and isolated from the cells according to the method described above. Primer 3'-RT-HindIII (5'-CTTGTGCACCAAGCTTTGCAGGTCT-3 ')
Was reverse transcribed. Then 35 cycles using the TaqPlus long polymerase system (Stratagene): 94 ° C., 1 min, 67 ° C., 1 min and 72 ° C., 2.
Transcripts were PCR amplified in 5 minutes. The primer used in the PCR reaction was 5'-
RT-SacI (5'-GGGATCAGGAGCTCAGATCATGGGAC
-CAATGG-3 ') and 3'-RT-HindIII, the same as used for reverse transcription. These primers are compatible with SacI and HindIII
Each part is included. The resulting 2.4 kb product contained the Mo-MuLV sequence between positions 2546 and 4908. The mature virus RT peptide is 2337
And encoded by a sequence between positions 4349 (Petropoulos, CJ, Retrovira
l taxonomy, protein structure, sequences and genetic maps, JMCoffin et al. (ed.
), Retroviruses, NY: Cold Spring Harbor Laboratory Press, pages 757-805 (1997)), but the amino-terminal truncated peptide retains full activity (Tanese, N. and SPGoff, 85). Proc.Natl.A
cad.Sci.USA 1777-1781 (1988)). The peptide encoded by this construct contains part of the integrase gene and follows RT in the MoMuLV polyprotein (Petropoulos, supra (1997)).

Restriction endonuclease MboII (Bocklage, H. et al., 19 Nucleic Acids Res.
1007-1013 (1991)) encoding the bacterium Moraxella bovis
xella bovis) was obtained from the American Type Culture Collection (ATCC # 10900). Genomic DNA was isolated from M. bovis using the Stratagene DNA extraction kit according to the manufacturer's instructions and used as template DNA in PCR. Two kinds of primers, 5'-
MboII-HindIII (5'-CAATTAAGGAAAGCTTTGAAAA
ATTATGTC-3 ′) and 3′-MboII-XmaI (5′-TAATGGCCCGG
GCATAGTCCGGGTAGGG-3 ′) was used to PCR-amplify the MboII gene from genomic DNA at 30 cycles: 94 ° C., 30 seconds, 58 ° C., 1 minute, 72 ° C. 1 minute. These primers were designed to contain HindIII and XmaI sites, respectively. The 1.2 kb product is a copy of the M. bovis genome between positions 888 and 2206 and contains the coding region for the MboII enzyme.

The pBK-RSV vector was digested with XmaI and NheI. Two annealed oligonucleotides, 5'-Nhe-Sac-link (5'-CTAGCGG
CAAGCGTAGCT-3 ') and 3'-Nhe-Sac-link (5'-AC
The NheI terminus is Sa using the linker formed by GCTTGCCG-3 ′).
It was converted to the cI end. The RT and MboII amplimers were ligated through the HindIII site followed by construction of the pBK-RSV SacI and XmaI.
By ligating between the sites, pBK-RSV-RT / MboII was obtained.

A pBK-RSV- between the AseI and BglII sites, encoding the 5 ′ end of the MboII gene and part of the integrase gene, for inserting a flexible linker between the RT and MboII domains of the polyprotein. RT / MboII
A fragment of the plasmid was excised and replaced with an insert containing a 6-His linker and a 5'-MboII DNA fragment deleted by double digestion. The insert consists of two types of templates, Rep (+) (5'-A, which have a complementary sequence of 17 bases at the 3'end.
TACTATTTAATTTTGGCAAATCATAGCGGTTTAGCGTG
ACTCAGGGTGAATGCCGCGATAATTTTCAGAATTGCAA
TCTTTTCATCAATGAATTTCAGTGATGAATTGCCAAG
ATTGATGTTTGC-3 ') and Rep (-) (5'-GACGAGATTCC
CTCCAGGAATTCTCGAGAATTCGGATCCCCCGCTCC
CCACCACCACACCACACCACCACCTGCCCCGCGGATGAA
AAATTATGTGAGGCAACATCAATCTTGGC-3 '). These two kinds of oligonucleotides are annealed and extended by a modified T7 DNA polymerase (USB),
The double-stranded oligonucleotide was then digested with AseI and BglII to give pB
By inserting into the K-RSV vector, pssXA was obtained (Fig. 3).

In a first embodiment of a single plasmid expression vector system constructed according to the invention, the generated plasmid is the ss-cDNA encoding sequence of interest,
Tandem inverted repeats, Mo-MuLV-RT gene, and restriction endonuclease
The pc3.1DNAZeo (+)-inducible "B" plasmid and p so that it encodes all elements of the genetic element set of the invention, including the (MboII) gene.
The BK-RSV derived "A" plasmid was fused. To produce the C plasmid,
The MboII gene was removed by digesting "plasmid pssDNA-Express-A" with SacI XmaI. Oligonucleotide 5 ′-(link) 2-Hind / X, which was annealed at 70 ° C. for 15 minutes and slowly cooled to room temperature.
ba (5'-CCGGATCTAGACCGCAAG-CTTCACCGC-3 ')
And 3 '-(link) 2-Hind / Xba (5'-GGTGAAGCTTGCG
The linker region consisting of GTCTAGAT-3 ') was ligated into the plasmid after digestion under standard conditions. The positive colonies were picked and the linker arrangement was verified by sequencing, then the plasmid was digested with Xba and HindIII.
The plasmid pssDNA-Express-B was then digested with HindIII and Xba and the corresponding 300 base pair DNA fragment containing the inverted tandem repeats, multiple cloning site and PBS as described above was cloned into the digested plasmid. , PssXC was obtained (FIG. 5A). Perform a standard ligation reaction, S
ureII cells (Stratagene, Inc.) were transformed. Transformation positive colonies were picked and positive colonies were identified by restriction analysis.

The sequence of interest was cloned into the multiple cloning site of pssXC by using the BamHI and PacI sites in the multiple cloning site (FIG. 5B). Four different sequences of interest were synthesized for these constructs as described above and a similar procedure was used to insert each of the four sequences of interest. Each construct was prepared by annealing the paired oligonucleotides at 70 ° C. for 15 minutes, cooling to room temperature and then ligating to the plasmid under standard conditions.
After transformation into Sure II cells, by sequencing for the individual inserts,
Selection was performed while confirming an appropriate colony.

A second plasmid, pssXD, was constructed for use in a single plasmid expression system by combining the two plasmids, pssXA and pssXB, in the following manner. pssXA contains Mo-MuLV reverse transcriptase (RT) and XmaI
And the resulting XmaI-BglII fragment digested with BglII
Seed oligo, XmaI-BglII-Stop 1 (5'-CCGGATCTAGAC
CGCAAGCTTCATTTAAA-3 ') and XmaI-BglII-stop2 (GATCTTTAAATGAAGCTTGCGGTCTCGAT-3') were replaced by double-stranded DNA adapters formed. This adapter includes a protein translation stop codon and a subcloning site,
Includes XbaI and HindIII. The resulting plasmid was named pssXD (Fig. 6A). The XbaI-HindIII fragment was labeled as pssXB and pssX.
It was cleaved from both B-II and then cloned into pssXD between XbaI and HindIII. These DNA fragments have 1) RT primer binding site (
PBS), 2) stem-loop structure, and 3) random control sequence (pssXB) or c-raf DNA enzyme sequence (pssXB-II). The resulting plasmids were designated as pssXD-I and pssXD-II, respectively. The RSV promoter regulates gene expression of all elements required for single-stranded DNA expression, and all elements are transcribed as a single mRNA molecule. Endogenous tRNA ^pro is ^3'of transcript
It is bound to PBS at the end and used as a primer for synthesizing single-stranded DNA (Marqu
et al., 77 Biochimie 113-124 (1995)). After reverse transcription of single-stranded DNA by RT, ssDNA is released when template mRNA is degraded by endogenous ribonuclease H or RT ribonuclease H activity (Tanase and Goff,
85 Proc. Natl. Acad. Sci. USA 1777-1781 (1988)).

Tissue culture test. Stable and transient transfections were performed by using DOTAP ribosome transfection reagent (Boehringer Mannheim Corporation, Indianapolis, Indiana) using the manufacturer's accompanying instructions. All plasmid constructs were treated with 10% fetal bovine serum
A549 lung cancer cell line (ATCC) maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with (FCS) (Gibco BRL, Gaithersburg, MD).
CCL-185) and HeLa cell lines. 24-48 hours after transfection, by PCR and dot blot analysis
Analysis for sDNA was performed. ss-cDNA is localized with total RNA (Mitrochnitchenko, O. et al., Production of single-stranded DNA in
mammalian cells by use of a bacterial retron, 269 J. Biol. Chem. 238
0-2383 (1994)), Trizol reagent (Gibco Life Technology, Gaithersburg, MD). Assays for specific ss-cDNAs were performed by both PCR-based assays for internal fragments and denaturing single-stranded gel electrophoresis followed by nylon blotting and probing with internal biotin-labeled probes.

More specifically, the RT-PCR assay developed by Silver, J. et al.
Reverse transcriptase activity was assayed using the method of ic Acids Res. 3593-3594 (1993)) with the following modifications. Lysis buffer for pssXA-transfected cells
(1% Triton ™, 1 mmol MgCl ₂ , 100 mmol NaCl,
Dissolved with 10 mmol Tris-HCl, pH 8.0 and 2 nmol DTT). After centrifuging at 18000g for 30 minutes, collect the supernatant and keep at -80 ° C until use.
Frozen in. Brom mosaic virus (BMV) RNA used as a template
Reverse transcription was performed by incubation with lysates containing RT activity for 10 or 30 minutes at 37 ° C. Then, the primer 5'-CGTGGTTGACACGCAG
ACCTCTTAC-3 'and 5'-TCAACACTGTACGGGCACCC
Reverse transcription was performed using GCATTC-3 ′ for 40 cycles: 94 ° C., 20 seconds, 56 ° C.
PCR amplification was carried out for 20 seconds at 72 ° C. for 20 seconds. RT-PCR products were analyzed on a 1.5% agarose gel shown in FIG.

This RT-PCR assay relies on RT activity in the cell lysates of transfected cells to produce cDNA transcripts for BMV RNA substrates. The replication cycle of this virus does not involve a DNA intermediate, thus eliminating the possibility that an amplification product could be produced without prior reverse transcription. A5 transfected with pssXA plasmid (lanes 3 and 4) and E10 clone
When the RT activity was measured with 49 cell lysate, relatively high expression was shown (
Lanes 5 and 6). RT activity was also measured from A549 cells transiently transfected with the control pBK-RSV plasmid (lanes 1 and 2). For transient transfections, lysates were produced 48 hours after transfection. Results are for both transient and stable transfections
Cell lysates from (E10) cells were shown to maintain production of a band of the expected size, 150 bp (lanes 3-6), whereas control lysates did not show any (lanes 1 and 2).

Ps when transfected into A549 cells (E10) with pssXA
ss expressed in mammalian cells by sXB-I and pssXB-II plasmids
PCR to detect DNA using T7 primer and c-raf DNA enzyme specific primer 5'-CTAGCTACACACACGAGACATGC-3 '
The reaction was carried out. The entire RNA fraction was used as template and either pretreated with S1 nuclease or ribonuclease A for 30 minutes at 37 ° C. or left untreated. Then, the pretreated RNA sample was subjected to 30 cycles: 94 ° C., 45 seconds, 5
PCR amplification was performed at 5 ° C. for 45 seconds and 72 ° C. for 30 seconds. As shown in Figure 7 (
PCR products were analyzed on lanes 1 and 3, S1 nuclease, lanes 2, 4 and 5, ribonuclease) 8% acylamide gel. Bands of the expected size were generated from both total RNA product (lanes 2 and 4) and untreated product (data not shown). Control products treated with S1 nuclease, a highly specific ssDNA endonuclease, did not produce any byproduct (lanes 1 and 3).

In addition, the presence of the c-raf DNA enzyme was determined by the presence of North 2 according to the manufacturer's instructions.
Confirmed by dot-blot detection of ssDNA using the South chemiluminescent nucleic acid hybridization and detection kit (Pierce). pssXA / pssX
Total R isolated from cells transfected or untransfected with BI or pssXA / pssXB-II, or pssXA
2 μg NA was used. The sequence of the c-raf-specific biotin-labeled probe is 5'-
GGCCGCACTAATCATCATTCTCGTTGTAGCTA-GCCC
AGGCGGGAAGTGC-3 '. As shown in FIG. 8, biotin-labeled c-raf-specific oligo probe was not transfected with E.
Only signals in RNA products isolated from E10 cells transfected with pssXB-I or pssXB-II but not 10 cells or A549 cells can be detected.

To determine whether the single-stranded c-raf DNA enzyme expressed in the pssXA / pssXB vector system of the present invention modifies c-raf mRNA expression in mammalian cells, Northern blot analysis was performed. did. E10 cell line pss
Transient transfection with XB-I or pssXB-II. 24
And after 48 hours, cells were harvested for total RNA product. 15 μg of total RNA
Separated on denaturing agarose gel for Northern blot analysis. After overnight transfer, membranes were fixed and probed with both ³² P-labeled c-raf DNA fragment and glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene. Using a random prime labeling kit from Boehringer Mannheim, the c-raf probe was cloned into an IMAGE ™ cDNA clone (ID645) containing the coding region of the c-raf kinase gene at positions 571-2028.
539, Research Genetics). G3PDH is also ³² P
Labeled and used for normalization of RNA blots. Membrane is 2 × SSC, 0.1% S
Wash with DS for 15 minutes and 0.1 × SSC for 5 minutes. The blot is then X
It was exposed to a linear film or quantified by a Molecular Dynamics Photoimager ™. The quantitative results of a representative experiment with phosphor imaging are shown in FIG.
In graph form. PssXB-II reduces c-raf mRNA levels by 81% at 24 hours and 66% at 48 hours when compared to controls transfected with pssXB containing unrelated sequences. pss
XB-I also has a similar effect, c-raf after 48 hours incubation.
mRNA levels were reduced by 35%. In addition, c-rafDN was compared to the control.
It was observed that the cells transfected with the pssXA / pssXB vector expressing the A enzyme had significantly more cell death (about 1/3). "
When only the remaining adherent cells were collected,
The extent of RNA reduction can be greater than the measured 34-36% reduction.

The single plasmid vector system pssXC was transfected into HeLa cell lines. 24-48 hours after the transfection, assays for ssDNA were performed by PCR and dot blot analysis. Also same as above
Reverse transcriptase activity was assayed using the RT-PCR assay developed by Silver et al. (Supra (1993)). Individual colony isolates of stable replacement HeLa cell lines (A12 and B12) were further assayed for RT activity. Ss-cDNA was isolated from cells transfected 48-72 hours earlier. Ss-cDNA that co-localizes with RNA is a Trizol reagent (Gibco Life Technologies,
Geisersburg, Maryland). Specific ss-cDNA
Group-wise assays were performed by both PCR-based assays for internal fragments and denaturing single-stranded gel electrophoresis followed by nylon blotting and probing with internal biotin-labeled probes.

This experiment demonstrates that human tissue culture cells (HeLa cell lines) transfected with a plasmid designed to synthesize processed ss-cDNA produce ss-cDNA of the expected size. showed that. The ssDN of interest produced in vivo from pssXC, as reported in the above-incorporated application Serial No. 09/397782.
The A sequence is from the position between the inverted repeats after stem digestion of the stem-loop intermediate or between the inverted repeats and the primer binding site due to immature termination of the reverse transcriptase cDNA transcript on the 3'side of the stem structure. Manufactured.

By using the total RNA fraction, expression of intracellular single-stranded c-raf DNA enzyme was measured by simple dot-blot analysis. The biotin-labeled c-raf specific oligonucleotide probe used was Integrated DN.
A technology (Coralville, Iowa) synthesized and used to detect signal in RNA samples isolated from A549 cells transfected with control pssXD-I or pssXD-II containing the c-raf DNA enzyme sequence. . Pretreatment of 2 μg of total RNA with ribonuclease A in the presence and absence of S1 nuclease for 30 minutes at 37 ° C. eliminated any possibility of non-specific hybridization to RNA. Subsequent to this, the sample was placed on a high bond-N + film (Amersham Pharmacia Biotech, Piscataway,
(New Jersey) and fixed by UV exposure for 3 minutes. Hybridization and signal detection was performed using the North 2 South chemiluminescent nucleic acid hybridization and detection kit (Pierce, Rockford, IL). FIG. 11 shows that only cells transfected with pssXD-II showed a positive signal, and in the presence of S1 nuclease no detectable signal was observed due to the specific degradation of the ssDNA enzyme by S1 nuclease. Shows.

Quantitative RT-PCR was performed to determine whether the single-stranded DNA enzyme expressed in A549 cells modifies c-raf mRNA levels. C-raf mRNA was quantified by RT-PCR as described by Li et al. (7 Gene Therapy 321-328 (2000)) with some modification. Briefly, 1 μg of total RNA was reverse transcribed using a reverse transcription system (Promega Corporation, Madison, Wisconsin). Generated cDN
Fraction A was used as a template for PCR amplification. PCR was performed for 40 cycles using specific primers (95 ° C, 30 seconds, 50 ° C, 30 seconds, and 72 ° C.
, 60 seconds). The specific primer sequences used were as follows: 1) c-ra
f primer: 5'-TCAGAGAAGCTCTGCTAAG-3 'and 5'
-CAATGCACTGGACACCTTA-3 ', 2) actin primer: 5
'-ACCTTCTACAATGAGCTGCG-3' and 5'-GCTTGC
TGATCCACATCTGC-3 '. Actin was used as a housekeeping gene control. Total RN isolated from cells transfected with control pssXD-I or pssXD-II containing the c-raf DNA enzyme sequence
A was reverse transcribed and PCR amplified using a pair of c-raf specific primers. The amount of loading between different samples was normalized by using PCR amplification of actin mRNA as a control. As shown in Figure 12, cells transfected with pssXD-II (lane 2) compared to the control (lane 1).
A significant reduction in c-raf mRNA was detected (about 70-80%).

A5 transfected with pssXD-I or pssXD-II
The level of c-raf protein in 49 cells was assessed by Western blot analysis. 30 μg of cell extract was subjected to electrophoresis (SDS-PAGE) on 12% sodium dodecyl sulfate-polyacrylamide gel. Follow manufacturer's instructions (BioRad Laboratories, Hercules, CA)
Proteins were electrotransferred to high bond ECL membranes (Amersham Pharmacia Biotech, Piscataway, NJ) using a mini trans-blot electrophoretic transfer cell. This is followed by 25 mM Tris-HCl, pH 7.5, 500 mM NaCl.
Membranes were blocked with a buffer containing 0.05% Tween-20 and 5% skim milk, and then incubated with primary and HRP-conjugated secondary antibodies for 45 minutes each. Polyclonal antibody to c-raf (anti-raf1) and monoclonal antibody to actin (Ab-1) were purchased from Calbiochem-Novabiochem Corporation (San Diego, Calif.). Poly-AD
Monoclonal antibody (IgG1, C to P ribose polymerase (PARP)
-2-10) was purchased from Clontech Laboratories, Inc. (Palo Alto, CA). SuperSignal West Pico Chemiluminescent Substrate Kit (Pierce, Rockford, Illinois)
Was used to visualize the proteins. Control pssXD as shown in FIG.
The level of c-raf protein in -I transfected cells (lane 2) was similar to that in untransfected cells (lane 3). However, in the case of cells transfected with pssXD-II expressing the c-raf DNA enzyme (lane 1), the protein level of c-raf was lower than that of the control (about 20-30%).

To determine whether expression of the c-raf DNA enzyme can induce A549 cell apoptosis, two standard apoptosis assays, genomic DNA cleavage and PA.
RP cleavage was performed. Genomic DNA cleavage can be performed using LM- according to the manufacturer's instructions.
It was measured using the PCR Ladder Assay Kit (Clontech Laboratories, Inc., Palo Alto, Calif.). Briefly, 0.5 μg of genomic DNA was ligated with T4 DNA ligase at 15 ° C. overnight to an adapter supplied by Clontech Laboratories. Adapter connection D
The NA fraction was used as a template in LM-PCR. 25 cycles of P
CR (95 ° C, 1 minute and 72 ° C, 3 minutes) was performed at 72 ° C with an extension of 15 minutes. Genomic DNA isolated from cells transiently transfected with pssXD-I (control) or pssXD-II (DNA enzyme) was ligated to a specific adapter. Following that, LM-PCR was performed using the c-raf primer and the specific primer. The control plasmid, as shown in FIG.
A significant increase in fragmented genomic DNA was observed in cells transfected with pssXD-II (lane 1) as compared to cells transfected with pssXD-I (lane 2) or untransfected cells (lane 3). Was given. These results indicate that the increase in fragmented genomic DNA was associated with c-rafD.
It is suggested that it is the result of DNA cleavage induced by suppression of c-raf gene expression modified by the presence of NA enzyme.

Another apoptosis assay, PARP cleavage assay, was performed using Western blot analysis. Compared with the control (lanes 2-3), the amount of full-length PARP was reduced in the cells transfected with pssXD-II (lane 1) (Fig. 15), and thus the c-raf gene expression was also observed. It was shown that the suppression of cell death induces cell apoptosis. Similar amounts of protein were loaded per lane as measured by the presence of actin (lanes 1-3).

The above experiments are based on a multi-step reaction in which eukaryotic RT reactions and various cDNA priming reactions were used to effectively reduce in vivo expression of c-raf kinase.
Demonstrates methods for producing ssDNA in vitro and in vivo. Those skilled in the art will appreciate that the present invention is not limited to this embodiment. For example, it should be appreciated that many nucleic acid sequences can be used differently depending on the specific target and / or mode of action of inhibition of SOI. Similarly, the SOI may be located at two locations, such as between the IR and / or between the PBS and the 3'side of the IR, or both. Similarly, SOI is S
DNA depending on the specific target and / or mode of action of the OI and the DNA enzyme sequence
It may or may not include an enzyme sequence. Those skilled in the art who have the opportunity to appreciate the benefit of this disclosure will find any desired therapeutic effect by this method by transfecting the appropriate SOI into eukaryotic cells using the vector system of the present invention. But it should be admitted that it is produced. By way of non-limiting example, the following inhibitory nucleic acid sequences are known in the art and may be used as SOI according to the invention to alter gene expression:

Sequences that act as antisense oligonucleotides to one or more RNA molecules that encode one of several dopamine receptors for the treatment of Parkinson's disease. The antisense oligonucleotide specifically controls the expression of one or more dopamine receptor subtypes by specifically binding to the expression control sequence of the RNA molecule, and suppresses the pathology associated with those expression. Reduce,

Sequences that inhibit the expression of KSHV virion protein 26, including sequences that act as antisense and / or triplex oligonucleotides for use in the treatment of Karposi syndrome as described in US Pat. No. 5,856,903, US Pat. No. 5856903, an oligonucleotide for controlling the expression of IL-8 and / or IL-8 receptor for controlling tumor growth, metastasis and / or angiogenesis,

An oligonucleotide having a sequence of nucleotide bases capable of specifically hybridizing with a selected sequence of cytomegalovirus DNA or RNA, specifically cytomegalovirus DNA encoding IE1, IE2 or a DNA polymerase protein. Or a sequence that targets RNA. According to U.S. Pat. No. 5,442,049, the above oligonucleotide has about 5
It is preferred to have between about 50 and about 50 nucleobase units.

Herpes simplex virus type I open reading frames UL5, UL8, U containing nucleotide units with sufficient identity and number for the performance of specific hybridization.
L9, UL20, UL27, UL29, UL30, UL42, UL52 and I
An oligonucleotide capable of specifically hybridizing with RNA or DNA derived from the gene corresponding to one of E175. The oligonucleotide preferably hybridizes specifically with the translation initiation site, the coding region or the 5'untranslated region. Oligonucleotides include herpes simplex virus type 1 (HSV-1), herpes simplex virus type 2 (HSV-2), cytomegalovirus, human herpesvirus 6, Epstein-Barr virus (EBV) or chickenpox virus (VZV). Is designed to hybridize specifically with DNA or preferably RNA from one of the The oligonucleotides are conveniently and desirably provided as a pharmaceutical composition in a pharmaceutically acceptable carrier as described in US Pat. No. 5,514,577. One of skill in the art will recognize that the particular open reading frame reported for herpes simplex virus type I also applies to the other viruses listed herein. Thus, herpes simplex virus type 2, cytomegalovirus, human herpesvirus type 6, Epstein-Barr virus and varicella virus are each believed to have many similar open reading frames that encode proteins with similar functions. Accordingly, the present invention provides antisense oligonucleotides directed to similar viruses, wherein the oligonucleotide has one or more of the above similar reading frames, which may become known to any of the aforementioned viruses, or even later. It's about therapy. For convenience of the present invention, all of the above viruses are referred to as herpesviruses.

Antisense oligonucleotides for the proto-oncogene and especially the c-myb gene for use as anti-neoplastic and immunosuppressive agents as described in US Pat. No. 5,098,890.

A variety of inflammatory diseases or conditions involving inflammatory components, such as asthma, rheumatoid arthritis,
ICA in interleukin-1 beta-stimulated cells used as an anti-inflammatory agent with activity towards allograft rejection, inflammatory bowel disease, various skin conditions and psoriasis
Antisense oligonucleotides for M-1 gene expression. Furthermore, ICAM
-1, VCAM-1 and ELAM- inhibitors are effective in treating colds, AIDS, Kaposi's sarcoma and certain cancers and their metastases due to rhinovirus infection as described in US Pat. No. 5,843,738. obtain. Similarly, International Application No. PCT / US90 / 02357 describes ELAM-1 and VCAM-1 and V
Disclosed are DNA sequences encoding an endothelial adhesion molecule (ELAM), including CAM-1b. The oligonucleotides designated ISIS 1570 and ISIS 2302 are believed to be used as sequences of interest in the methods of the invention which specifically reduce the metastatic potential of target cells.

Protein binding oligonucleotides (aptamers) that specifically bind target molecules such as proteins and especially thrombin in host cells as described in US Pat. No. 5,840,867. These non-oligonucleotide target molecules bind to nucleic acids (Blackwell, TK et al., 250 Sciece 1104-1110 (1990), Blackw
ell, TK et al., 250 Science 1149-1152 (1990), Turek, C. and
L. Gold, 249 Science 505-510 (1990), Joyce, GF, 82 Gene8.
3-87 (1989)), specifically controlling the biological activity of proteins.

Although described with reference to the figures and examples presented herein, one of ordinary skill in the art would be able to practice without altering the manner in which the elements each function to achieve their intended result. It should be appreciated that certain changes can be made to the specific elements described in. For example, the cassettes described herein are described as containing three genetic elements, a sequence of interest, a primer binding site and an inverted tandem repeat, reverse transcriptase under the control of a suitable promoter. Upon transfection of the target cell with the gene, the inhibitory nucleic acids described herein are produced. However, one of ordinary skill in the art can, for example, replace the murine Moloney leukemia virus reverse transcriptase gene described for use of the cassette as a reverse transcriptase gene with other reverse transcriptase genes ( It should be appreciated that the reverse transcriptase gene from the human immunodeficiency virus was one of those genes), and that promoters other than the CMV promoter described herein could also be used to advantage. As mentioned above, the stem-loop intermediate formed may or may not contain restriction endonuclease sites, and its susceptibility to denaturation is of interest to those made from that intermediate. It is manipulated to be advantageous for a particular sequence. All such changes, as well as other modifications where modifications made without departing from the spirit of the invention are obvious to those skilled in the art by this description, are also claimed. It shall be included in the range.

[0109]

[Table 1]

[Table 2]

[Table 3]

[Table 4]

[Brief description of drawings]

FIG. 1 is a diagram outlining the production of ss-cDNA in a host cell according to the present invention.

2 is a schematic illustration of a stem-loop intermediate formed by the method outlined in FIG.

FIG. 3 is a schematic diagram of a pssXA plasmid containing the first component of the first aspect of the expression system of the present invention. Reverse transcriptase (RT) and MboII to produce pssXA
The gene was subcloned into the mammalian expression vector pBK-RSV (Stratagene) and expressed as a single polypeptide. The RT and MboII domains are separated by a histidine-rich linker.

FIG. 4A is a schematic drawing of the present invention comprising a sequence of interest, (1) MoMuLV reverse transcriptase promoter region, (2) NotI site, PacI and BamHI, and (3) tandem repeats IR-L and IR-R. FIG. 3 is a schematic diagram of a pssXB plasmid containing the second component of the first aspect of the expression system.

FIG. 4B is an invention comprising a sequence of interest, (1) MoMuLV reverse transcriptase promoter region, (2) NotI site, PacI and BamHI, and (3) tandem repeats IR-L and IR-R. It is the sequence of the insertion region of the pssXB plasmid containing the second component of the first aspect of the expression system.

FIG. 5A is a schematic diagram of the pssXC plasmid containing the second embodiment of the expression system of the present invention.

FIG. 5B is a schematic representation of the 10-23 DNA enzyme sequence.

FIG. 6A shows a schematic diagram of the pssXD plasmid containing the third embodiment of the expression system of the present invention.

FIG. 6B depicts a schematic representation of the expanded portion of the pssXD plasmid.

FIG. 7 shows the results of a PCR assay for RT activity in pssXA-transfected cell lysates. Lanes 1 and 2: A549 cells transiently transfected with pBK-RSV vector, lanes 3 and 4: ps.
A549 cells transiently transfected with sXA, lanes 5 and 5: A549 cells stably transfected with pssXA (E
10). Prior to PCR amplification, reverse transcription reactions were performed at 37 ° C for 10 (lanes 1, 3 and 5) or 30 minutes (lanes 2, 4 and 6), respectively.

FIG. 8 shows the results of an assay method for detecting ssDNA by PCR analysis. All RN
A was isolated from either E10 cells transiently transfected with pssXB vector, pssXB-I or pssXB-II. PCR
Prior to amplification, total RNA was pretreated with S1 nuclease (lanes 1 and 3) or ribonuclease (lanes 2, 4 and 5) for 30 minutes at 37 ° C. Lanes 1 and 2: pssXB-1, Lanes 3 and 4: pssXB-II, Lane 5: pssX.
B vector.

FIG. 9 shows the results of dot blot analysis for ssDNA detection. 1:
E10 cells transfected with pssXB-I, 2: pssXB
-II-transfected E10 cells, 3: E10 cells, 4: A5
49 cells.

FIG. 10 shows a bar graph quantifying Northern blots of ssDNA production vectors constructed according to the present invention producing antisense sequences for c-raf kinase. Lanes 1-3: cells harvested 24 hours after transfection, Lanes 4-6: cells harvested 48 hours after transfection. Lane 1: E10 cells transfected with pssXB vector, Lanes 2 and 5: E10 cells transfected with pssXB-I,
Lanes 3 and 6: E10 cells transfected with pssXB-II.

FIG. 11. Control pssXD-I or p containing c-raf DNA enzyme sequence.
5 shows the results of dot blot analysis for ssDNA detection in A549 cells transfected with ssXD-II. SsD by S1 nuclease
No detectable signal was generated in the presence of S1 nuclease due to the specific degradation of the NA enzyme.

FIG. 12 shows the results of quantitative RT-PCR to determine whether ssDNA expressed in A549 cells transfected with pssXD-II modified c-raf mRNA levels. Lane 1: Control pssXD-I
, Lane 2: pssXD-II.

FIG. 13 shows the results of Western blot regarding suppression of c-raf protein expression in A549 cells transfected with pssXD-I or pssXD-II. Lane 1: pssXD-II, Lane 2: control ps
sXD-I, lane 3: untransfected cells.

FIG. 14 shows the results of Western blotting regarding the cleavage of genomic DNA for the induction of cell apoptosis by suppressing the c-raf gene expression. Lane 1: p
ssXD-II, lane 2: control pssXD-I, lane 3: untransfected cells.

FIG. 15 shows the results of Western blotting regarding PARP cleavage for inducing cell apoptosis by suppressing c-raf gene expression. Lane 1: pss
XD-II, lane 2: control pssXD-I, lane 3: untransfected cells.

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) // A61K 31/7088 A61P 25/16 48/00 29/00 A61P 25/16 31/12 29/00 35 / 00 31/12 C12N 15/00 ZNAA 35/00 5/00 A (81) Designated countries EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT , LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM) , KE, LS, MW, MZ, SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AL, AM, AT, AU, AZ, B , BB, BG, BR, BY, CA, CH, CN, CR, CU, CZ, DE, DK, DM, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, NO, NZ , PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG, US, UZ, VN, YU, ZA, ZW (72) Inventor Inchen USA 77099 South Wilcrest 9881, Hughston, Texas, F-term in Sitegenics Incorporated (reference) 4B024 AA20 CA04 CA11 HA17 4B065 AA93X AB01 CA44 4C084 AA06 AA07 AA13 BA35 MA55 NA14 ZA031 ZB111 ZB261 ZB331 4C086 A A03 EA16 MA55 NA14 ZA02 ZB11 ZB26 ZB33 [Summary of Continuation] The double-stranded stem of the interstitium is cleaved by the desired corresponding restriction endonuclease (s), and then the loop portion, or the sequence of interest, is linear. Released as a single-stranded fragment of DNA. This released (or cleaved) piece of ssDNA contains minimal sequence information, whether upstream 5'or downstream 3'from the double-stranded stem. By binding to the endogenous target nucleic acid sequence, the generated ssDNA is inactivated by gene inactivation using nucleic acid duplex or triplex binding, site-directed mutagenesis, interruption of cell function by binding to a specific cellular protein, And alter the expression of that sequence for therapeutic purposes such as interference with RNA splicing function.

Claims (8)

[Claims] 1. A cassette comprising inverted tandem repeats and 3'primer binding sites (PBS) flanking the ends of the sequence of interest into the target cell, wherein the sequence of interest is It is composed of a nucleic acid sequence designed to produce a nucleic acid sequence that binds to an endogenous nucleic acid sequence during reverse transcription, and reverse transcription of an mRNA transcript of a cassette from PBS results in intracellular single-stranded cDNA transcription. A method of modifying expression of an endogenous nucleic acid target sequence in a target cell comprising releasing the product and modifying the expression of the target sequence by binding the cDNA transcript to the endogenous nucleic acid target sequence. 2. The method of claim 1, further comprising transfecting the reverse transcriptase / ribonuclease gene into the target cells. 3. The method of claim 1, further comprising linearizing the transcript of the sequence of interest. 4. Including a restriction endonuclease site in the inverted tandem repeat when the cDNA transcript of the sequence of interest forms a stem-loop intermediate by Watson-Crick base pairing of the inverted tandem repeat. 4. The method of claim 3, wherein the linearizes the transcript of the sequence of interest. 5. A method further comprising inducibly promoting transcription of a reverse transcriptase gene,
The method of claim 2. 6. The method of claim 5, wherein transcription of the reverse transcriptase gene is driven by a eukaryotic promoter. 7. A cDNA transcript produced by the method of claim 1. 8. A target cell in which the expression of a nucleic acid target sequence has been modified according to the method of claim 1.