CN1399679A

CN1399679A - Altering gene expression with ssDNA produced in vivo

Info

Publication number: CN1399679A
Application number: CN00815856A
Authority: CN
Inventors: 查尔斯·A·康拉德; 陈印
Original assignee: CytoGenix Inc
Current assignee: CytoGenix Inc
Priority date: 1999-10-04
Filing date: 2000-10-04
Publication date: 2003-02-26
Anticipated expiration: 2020-10-04
Also published as: KR20020059608A; IL148946A0; AU7855300A; EP1222259A1; JP2003511025A; BR0014814A; MXPA02003422A; WO2001025419A1; CA2386246A1; CR6613A; CN1276083C

Abstract

An expression vector for altering expression of a target nucleic acid sequence in a host cell by production of single-stranded cDNA (ss-cDNA) in the host cell in vivo. The expression vector is comprised of a cassette comprising a sequence of interest, an inverted tandem repeat, and a primer binding site 3' to the inverted tandem repeat, and a reverse transcriptase/RNAse H coding gene, and may be transfected into the host cell. Transcription of the cassette by the host cell produces an RNA template which is reverse transcribed with the product of the RT coding gene to produce ssDNA of a specified sequence. The ssDNA is modified to remove flanking vector sequences by taking advantage of the ''stem-loop'' structure of the ssDNA, which forms as a result of the inverted tandem repeat that allows the ssDNA to fold back on itself, forming a double stranded DNA stem. The double-stranded stem may contain one or more restriction endonuclease recognition sites and the loop, which remains as ssDNA, can be any desired nucleotide sequence. This design allows the double-stranded stem of the stem-loop intermediate to be cleaved by the desired corresponding restriction endonuclease(s) and the loop portion is then released as a linearized, single-stranded piece of DNA. The resulting ssDNA binds to an endogenous target nucleic acid sequence to alter the expression of that sequence for such therapeutic purposes as gene activation or inactivation using duplex or triplex binding of nucleic acids, site-directed mutagenesis, interruption of cellular function by binding to specific cellular proteins, or interfering with RNA splicing functions.

Description

Change genetic expression with the ssDNA that produces in the body

The present invention relates to change genetic expression with stable DNA construct, this construct is commonly referred to the sequence box, in this sequence box, insert nucleotide sequence and be used as the template that in protokaryon or eukaryotic host cell, produces this sequence subsequently, and relate to the system of in eukaryotic host cell, expressing this sequence that does not contain (or containing minimum) flanking sequence.This construct or sequence box comprise the differential concatenation tumor-necrosis factor glycoproteins that forms stem ring intermediate stem, its function in vivo is to cause the sequence that is called aim sequence as the expression of single stranded DNA (ssDNA) sequence, and this ssDNA combines with target gene or takes place and interacts to change this expression of gene.Expression system of the present invention forms through the stem ring and reverse transcription reaction is subsequently stopped by stem or remove great majority or whole adjacent plasmid (or other carrier) sequence through the cracking of stem ring intermediate from ssDNA.The ssDNA that produces with this method is designed to and can and/or combines with any endogenous nucleotide sequence target complementation, thus any goal gene of target.

Antisense gene therapy successfully is used for various application with the downward modulation gene function.Jain, K.K., gene therapy handbook, New York:Hofgrefe ﹠amp; Huber Publishing (1998).Yet, this therapy has many defectives and the limitation that seriously reduces this class therapy practicality to a certain extent so far, comprises antisense molecule half life weak point, nonspecific effect, the uncertainty of the antisense sequences mode of action and in animal experiment the potential toxic action.For example, antisense oligonucleotide (ODN) and analogue thereof must the intravenously medications, this with regard to produced cell and absorbed and the problem of distribution aspect (Cossum, P.A., etc., give the rat vein innerlich anwenden after ¹⁴The trend of the phosphorothioate oligonucleotide ISIS 2105 of C-mark, J.Pharmacol.Exp.Ther., 267,1181-1190 (1993), Sands, H., etc., inside ³The bio distribution of the oligonucleotide of H-mark and metabolism.II.3 ＇, the oligonucleotide of 5 ＇-sealings, molecular medicine is learned, 47,636-646 (1995)) and the toxicity problem (Henry, the S.P. that produce by high blood concentration, Deng, the toxicity assessment of a kind of phosphorothioate oligonucleotide ISIS 2302 in the CD-1 mouse in test 4-week, antisense nucleic acid medicament exploitation, 7,473-481 (1997), Henry, S.P., etc., phosphorothioate oligonucleotide ISIS 1082 and the ISIS 2105 toxicity situation after the subacute intracutaneous medication in the Sprague-Dawley rat compares, toxicology, 116,77-88 (1997)).

So far using maximum antisense ODN analogues in the antisense therapy is thiophosphatephosphorothioate or methylphosphonate.Yet thiophosphoric acid ODN tends to non-specific binding serum and intracellular protein (Crooke, S.T., Deng, the pharmacokinetic characteristic of some novel ligonucleotides analogues in mouse, J.Pharmacol.Exp.Ther., 227,923-937 (1996), Gao, W.Y., Deng, phosphorothioate oligonucleotide is the inhibitor of human DNA polymerase and RNase H: the implication of antisense technology, and molecular medicine is learned, and 41,223-229 (1992)), and the activity of inhibition RNase H when higher concentration (Crooke, S.T., etc., the dynamic characteristic of intestinal bacteria Rnase H: the cracking of various antisense oligonucleotides-RNA two strands, biochemical magazine, 312,599-608 (1995)).Thiophosphoric acid ODN to RNA than DNA have lower Tm (every couple base average 0.5 ℃) (Crooke, S.T. and B.LeBleu, antisense research and use BocaRaton:CRC Press (1993)).This lower Tm requires for effective combination, and thiophosphoric acid ODN is generally longer than phosphodiester DNA oligonucleotide.Yet the length increase of ODN can cause the specific forfeiture of hybridization (Toulme, J.J. is etc., antisense technology: Practical Research, see C.Lichtenstein and W.Nellen (editor), New York: IRL publication, 39-74 page or leaf (1997)).In addition, methylphosphonate ODN can not activate RNase H enzymic activity (Maher, L.J, etc., the triple helical that oligonucleotide instructs forms and suppresses dna binding protein dna, science, 245,725-730 (1989), Miller, P.S., oligodeoxynucleotide: the antisense inhibitor of genetic expression, see J.S.Cohen (editor), Boca Raton:CRC publishes, the 79th page (1989)) and removed rapidly (Chen, T.L., etc., the trend of oligodeoxynucleotide methylphosphonate and metabolism after the single intravenous injection in mouse, the drug metabolism trend, 18,815-818 (1990)).

Another program of gene therapy is to use the molecule that gene and/or gene transcription product are had catalytic activity.Ribozyme only comprises the RNA molecule, the cracking of the specific mRNA sequence of its energy catalysis, and owing to its catalytic capability it is believed that than antisense ODN more effective (Woolf, T.M., cracking or non-cracking: ribozyme and antisense, antisense progress, 5,227-232 (1995)).Ribozyme has been used as the inhibitor (Jain, ibid (1998)) of genetic expression and virus replication.Be different from antisense ODN, ribozyme can be an endogenous transmission, for example, and through the use virus vector, or exogenous transmission.Yet ribozyme has limited stability (Jain, ibid (1998)) owing to being degraded by RNases in vivo.

Use external selection, confirmed cracking (Breaker, the R.R. of the single stranded DNA s catalysis RNA that some are little recently, catalytic DNA: training and searching work, Nature Biotechnol, 17,422-423 (1999)), thus provide at the target of specific gene is active and guaranteed.Patent and scientific and technical literature described many demonstrated these short picodna sequences with catalytic activity (referring to, Breake, R.R. and G.F.Joyce, chemicobiology, 1,223-229 (1994); Cuenoud, B. and J.W.Szostak, nature, 375,611-613 (1995); Santoro, S.W. and G.F.Joyce, institute of American Academy of Sciences newspaper, 94,4262-4266 (1997); Faulhammer and M.Famulok, molecular biology magazine, 269,188-203 (1997); Carmi, N, etc., institute of American Academy of Sciences newspaper, 95, (1998); Li, Y. and R.R.Breaker, institute of American Academy of Sciences newspaper, 96,2746-2751 (1999) and U.S. Patent number 5,807,718 and 5,910,408), comprise being called " 10-23 DNA enzyme " and serving as, for example kinase whose other ssDNA sequence of copper dependent DNA ligase and Ca-dependent DNA.Confirmed the catalytic effect of this sequence, it in the presence of divalence magnesium with 10 ⁹m ^-1/ minute ^-1Cracking mRNA target, thus provide the directed chance of destroying substrate molecule (referring to, for example, R.R.Breaker, ibid (1999)).Although this enzymatic activity has been recognized and has been used for the treatment of the potentiality of purpose as far as is known, also do not have these target-specific enzymatic nucleotide sequences of existing generation so that produce the system of result of treatment in vivo in this area as if.

Therefore, the system that does not have the potential advantages change genetic expression of existing effective catalytic activity of utilizing these enzymatic nucleotide sequences.Therefore, an object of the present invention is to provide a kind of ssDNA of guidance synthetic DNA construct, described ssDNA contains the sequence of mRNA target in the specificity cracking body to change the expression of gene that produces this said target mrna.

Because secondary structure is folding may to be crucial to the catalysis of ssDNA enzymatic sequence; therefore another object of the present invention provides method and DNA construct; be used in eukaryotic cell, producing ssDNA; this ssDNA comprise this DNA enzyme sequence with any purpose nucleotide sequence and do not have unwanted interleave or the flanking nucleotide base so that protection ssDNA at the enzymatic functions of target nucleic acid, is used to change the expression of gene that comprises this target nucleic acid.

Another object of the present invention provides a kind of method and is used for the DNA construct of this method, is used for producing the ssDNA that contains the DNA enzyme sequence in eukaryotic cell, is used to overcome the obvious problem that runs into when use standard oligonucleotide transmission method is treated.

Another object of the present invention provides a kind of method and a kind of DNA construct, be used for producing in vivo ssDNA as any nucleotide sequence of (but being not limited to) inhibition nucleic acid, be used for for example combining to reduce interested gene product or virogene product in the antisense mode with mRNA, perhaps, for example, discern the protein bound of nucleotide sequence and suppress the specific cells function through combination.

Another object of the present invention provides a kind of method and a kind of DNA construct, is used for producing being designed to the preferential ssDNA that can disturb the triplex structure that normal gene transcribes and regulate with formation that combines with duplex (n DNA).

Another object of the present invention is to produce the purpose that ssDNA is used to destroy one or more cell functions in eukaryotic cell.

A further object of the invention provides a kind of method and a kind of DNA construct, be used to produce a kind of ssDNA, wherein secondary structure is designed to make this ssDNA oligonucleotide in conjunction with and/or suppress or activate to depend on proteinic katalysis or such as transcribing the interactional various cell functions of nucleic acid protein such as translation and dna replication dna.

Another object of the present invention provides a kind of method and a kind of DNA construct, is used for producing in vivo site-directed mutagenesis or the gene knockout that ssDNA is used for the treatment of application.

Another object of the present invention provides a kind of method and a kind of DNA construct, is used to produce the ssDNA that accurate qualification Nucleotide is formed, and the specificity to genomic locus that it helps to be used for the treatment of purpose is inserted.

A further object of the invention provides a kind of method and a kind of DNA construct, is used to produce the ssDNA that is complementary to any endogenous nucleic acid target and is used to change the expression of gene that comprises this nucleotide sequence target.

Another object of the present invention provides a kind of method and is used for the DNA expression of this method, be used for producing in vivo and comprise the ssDNA that shows at the sequence of the catalytic activity of mRNA target and advance eukaryotic cell with transfection, be used to overcome with the fat transfection, directly cell absorbs, and/or the conductive obstruction of ssDNA is directly used in microinjection.

Another object of the present invention is to provide to produce necessary all enzymatic functions of ssDNA in the body in single or binary plasmid expression system, and this ssDNA contains the sequence that enzymatic activity is arranged at selected said target mrna.

Another object of the present invention provides method and the pharmaceutically acceptable composition that is used for transmitting in the mode that produces result of treatment a kind of inhibition nucleotide sequence, and this inhibition nucleic acid comprises the sequence that target cell is had enzymatic activity.

Listed purpose of the present invention does not plan to list all purposes of the present invention.There are many other cell functions not mention here with practical purpose that for simplicity they are regulated through the ssDNA that produces in the body easily by the cellular genome mediation.For example, exonuclease digestion ssDNA is more much easier than double-stranded DNA (dsDNA).Therefore, another object of the present invention provides the method that produces this construct in a kind of ssDNA construct and the body, and this ssDNA construct is easily degraded by the natural acid excision enzyme in cell unlike dsDNA.From enumerating of the visible purposes more of the present invention that provide of this example be illustrative and the scope that is not intended to limit the present invention.

These purposes provide by the method that changes the expression of endogenous nucleic acid target sequence in the target cell, this method comprise with have by flank the aim sequence of differential concatenation tumor-necrosis factor glycoproteins and sequence box that 3 ＇ primer binding sites (PBS) are formed import target cell and from PBS begin to reverse this record sequence box the mRNA transcripton in case cell release strand cDNA transcripton.The nucleotide sequence that aim sequence contains produces the nucleotide sequence of expressing with the change target sequence in conjunction with the endogenous target nucleic acid sequence when reverse transcription.

Embodiments more of the present invention have been described in the accompanying drawing, and wherein Fig. 1 is the synoptic diagram that produces ss-cDNA according to the present invention in host cell.

Fig. 2 is the synoptic diagram of stem-ring intermediate of forming of method shown in Figure 1.

Fig. 3 is the synoptic diagram that contains the pssXA plasmid of first composition in first embodiment of expression system of the present invention.In order to prepare pssXA, reversed transcriptive enzyme (RT) and MboII gene subclone are advanced mammalian expression vector pBK-RSV (Stratagene company) and express as single polypeptide.RT and MboII structural domain are by the joint that is rich in Histidine separately.

Fig. 4 A and 4B are the synoptic diagram (Fig. 4 A) that contains the pssXB plasmid of second kind of composition in first embodiment of expression system of the present invention, it comprises aim sequence and contains (1) MoMuLV reversed transcriptive enzyme promoter region, (2) be used for two NotI sites of subclone target DNA sequence, PacI site and BamHI site and (3) series opposing tumor-necrosis factor glycoproteins IR-L and IR-R and pssXB plasmid insert the sequence (Fig. 4 B) in district.

Fig. 5 A is the synoptic diagram that contains second embodiment of expression system of the present invention and comprise the pssXC plasmid of 10-23DNA enzyme sequence shown in Fig. 5 B.

Fig. 6 A and 6B representative contains the synoptic diagram of the amplifier section (Fig. 6 B) of the pssXD plasmid (Fig. 6 A) of the 3rd embodiment of expression system of the present invention and pssXD plasmid.

Fig. 7 has shown that PCR measures the active result of RT in the pssXA cells transfected lysate.Swimming lane 1 and 2: with the A549 cell of pBK-RSV carrier transient transfection; Swimming lane 3 and 4: with the A549 cell of pssXA transient transfection; The A549 cell (E10) of swimming lane 5 and 6:pssXA stable transfection.Before the pcr amplification, under 37 ℃, carry out 10 minutes (

swimming lane

1,3 and 5) or 30 minutes (

swimming lane

2,4 and 6) reverse transcription reactions respectively.

Fig. 8 has shown that pcr analysis detects the measurement result of ssDNA.From using the pssXB carrier, the total RNA of E10 cellular segregation of pssXB-I or pssXB-II transient transfection.Before the pcr amplification, total RNA uses S1 nuclease (swimming lane 1 and 3) or RNase (

swimming lane

2,4 and 5) pre-treatment 30 minutes down at 37 ℃.Swimming lane 1 and 2:pssXB-I; Swimming lane 3 and 4:pssXB-II; Swimming lane 5:pssXB carrier.

Fig. 9 has shown the result that the Dot blot that is used to detect ssDNA is analyzed.1: with the E10 cell of pssXB-I transfection; 2. use the E10 cell of pssXB-II transfection; The 3:E10 cell; The 4:A549 cell.

Figure 10 has shown the column diagram of the Northern trace of the kinase whose antisense sequences ssDNA of the anti-c-raf generation type that can the produce carrier that quantitatively makes up according to the present invention.Swimming lane 1-3: the cell that transfection was gathered in the crops after 24 hours; Swimming lane 4-6: the cell that transfection was gathered in the crops after 48 hours.Swimming lane 1: with the E10 cell of pssXB carrier transfection; Swimming lane 2 and 5: with the E10 cell of pssXB-1 transfection; Swimming lane 3 and 6: with the E10 cell of pssXB-II transfection.

Figure 11 has shown with contrast pssXD-I or contain the result that the Dot blot that detects ssDNA in the A549 cell of pssXD-II transfection of c-raf DNA enzyme sequence is analyzed.In the presence of the S1 nuclease since the ssDNA enzyme by S1 nuclease specificity degraded and can not produce detectable signal.

Figure 12 has shown whether the ssDNA that expresses in the A549 cell that is determined at the pssXD-II transfection changes the result of the quantitative RT-PCR of c-rafmRNA level.Swimming lane 1: contrast pssXD-I; Swimming lane 2:pssXD-II.

Figure 13 has shown the Westem trace result who suppresses the c-raf protein expression in the A549 cell of pssXD-I or pssXD-II transfection.Swimming lane I:pssXD-II; Swimming lane 2: contrast pssXD-I; Swimming lane 3: the cell of untransfected.

Figure 14 has shown the genomic dna cracking active Westem trace result of cell death inducing through suppressing c-raf genetic expression.Swimming lane 1:pssXD-II; Swimming lane 2: contrast pssXD-I; Swimming lane 3: the cell of untransfected.

Figure 15 has shown the PARP cracking active Western trace result of cell death inducing through suppressing c-raf genetic expression.Swimming lane 1:pssXD-II; Swimming lane 2: contrast pssXD-I; Swimming lane 3: the cell of untransfected.

In specification of the present invention, described at yeast, prokaryotic, and/or produce in eukaryotic almost that predetermined or required nucleotide base arbitrarily forms in body, contain or do not contain the method for single stranded deoxyribonucleic acid (ss-cDNA) oligonucleotides of flanking nucleotide sequence and nucleic acid and build body and be used for changing the expression of target gene. Described use biology synthetic rather than external, perhaps manually synthesized the method for the ss-cDNA with required nucleotide base composition and build body. Owing to having used the biology reaction in these methods, i.e. enzymatic reaction, therefore, they can be applicable to system in any body.

In one embodiment; expression system of the present invention contains a kind of carrier; it is designed to produce any interested sequence in mammalian cell; it is the ss-cDNA molecule, does not preferably contain the ss-cDNA molecule (term used herein " carrier " refers to build body for transmitting and operate plasmid synthetic and/or naturally occurring nucleotide sequence or the virus of having modified or non-viral restructuring biology) of most of adjacent carrier sequences. This carrier system contain be useful in host cell all that produce ss-cDNA must the enzymatic function and signal instruct. The host cell that has shifted carrier of the present invention produces rna transcription (Fig. 1) by the eukaryotic promoter starting, and it is used as the template that instructs any required single stranded DNA sequence (" purpose sequence ") synthetic.

More particularly, this paper describes a kind of the first expression system, carrier wherein contains two plasmids, and they are advanced by cotransfection can be in yeast or any protokaryon or eukaryotic suitable host cell in order to produce interested ssDNA sequence for changing gene expression in this cell. Also described a kind of the second expression system, it contains the single plasmid that carries the purpose sequence, and this plasmid is transfected to be advanced suitable host cell and be used for changing gene expression in order to produce interested ssDNA sequence in this cell.

Using the ssDNA that produces in expression system body as herein described can be inhibition nucleic acid. Inhibition nucleic acid can be that it can be specifically in conjunction with the complementary nucleic acid sequence from mRNA template synthetic ssDNA or mRNA template itself. , through with suitable target nucleic acid sequence, being combined, form RNA--RNA, DNA--DNA, or RNA--DNA duplex or triplex. More commonly, these nucleic acid are commonly referred to " antisense ", because they are complementary to sense strand or the coding strand of gene usually, but also use " justice is arranged " sequence to be used for the treatment of purpose in cell. Therefore, term used herein " inhibition nucleic acid " refers to " justice is arranged " and " antisense " nucleic acid.

Inhibition nucleic acid is combined the function of rear change target nucleic acid with target nucleic acid. This change (normally a kind of inhibition effect) is by for example, and blocking dna is transcribed, processing or add poly (A) on mRNA, and DNA copies, and translation perhaps starts the inhibition mechanism (for example starting the RNA degraded) of cell and produces. Therefore, inhibition nucleic acid method comprises many different schemes and changes gene expression. These dissimilar inhibition nucleic acid technology are at Helene, C. and J.Toulme, biochemistry and Acta Biophysica Sinica, describe in 1049, the 99-125 pages, (1990), hereinafter referred to as " Helene and Toulme ", and with this concrete document, quote in this article as a whole.

Briefly, inhibition exonuclease treatment scheme can be divided into the scheme of (1) target DNA sequence dna, (2) scheme of targeted rna sequence (comprising precursor-mRNA and mRNA), (3) scheme of target protein (sense strand scheme), (4) cause the enzyme such as ssDNA, comprise herein the cracking of the target nucleic acid that is called " 10-23 enzyme " or the scheme of chemical modification. The first scheme comprises several types. Nucleic acid is designed to be combined with the major groove of double-stranded DNA form triple helical or " triplex " structure. Perhaps, inhibition nucleic acid be designed to copy or transcribe during double-stranded DNA open the single stranded DNA zone combination of generation. More commonly, inhibition nucleic acid is designed to be combined with mRNA or mRNA precursor. Also can use inhibition nucleic acid to prevent the maturation of precursor-mRNA. Inhibition nucleic acid can be designed to disturb RNA processing, montage or translation. In first scheme, inhibition nucleic acid target mRNA. In this scheme, inhibition nucleic acid is designed to specificity and suppresses the translation of coding albumen. Use first scheme, inhibition nucleic acid is used for selectively suppressing some cell function through the mRNA translation that suppresses the crucial protein of coding. The example of this inhibition nucleic acid is the sequence that is complementary to c-myc mRNA zone, it suppress in the human promyelocytic leukemia clone HL60 of overexpression c-myc proto-oncogene c-myc protein express (Wickstrom E.L., etc., institute of NAS newspaper, 85, the 1028-1032 pages, (1988) and Harel-Bellan, A., Deng, experimental medicine, 168, the 2309-2318 page, (1988)). As described in Helene and Toulme, the inhibition nucleic acid of target mRNA has demonstrated by the encode several different mechanism of albumen translation of inhibition and has worked.

Inhibition nucleic acid also can use the third scheme, its design " justice is arranged " chain of gene or mRNA with catch or compete enzyme or translate in conjunction with mRNA as Helene and Toulme described in the protein that relates to. Finally, inhibition nucleic acid can be used for inducing chemical deactivation or the cracking of target gene or mRNA. For example, through crosslinked between inhibition nucleic acid in inducing cell and target nucleic acid and by the contained method (that is, by inserting the sequence cracking target nucleic acid with enzymatic activity in sequence box of the present invention) of this paper, chemical deactivation occurs.

Briefly, aspect first, the present invention comprises to be applicable to transmit into cell in order to produce ssDNA in external or body and is used for changing one group of heredity element of gene expression, contains the expression system of the hereditary element of this group, and contains the cell of one or more stable transfections of the hereditary element of this group. The hereditary element of this group is inserted in a kind of expression system and is used for transmitting into cell and it comprising

(A) a kind of RNA dependent form archaeal dna polymerase (reverse transcriptase) gene, and

(B) a kind of sequence box, comprise (1) differential concatenation repetitive sequence (IR), (2) be positioned between (a) inverted repeats (IR), (b) the 3 ＇ ends of IR, or (c) between IR and 3 ＇ of IR one or more purpose sequences and (3) reverse transcriptase primer binding sites (PBS) that are positioned at IR3 ＇ end shown in Figure 2 of holding both all to have.

Although optional, this expression system preferably also comprises for the function of transcribing these compositions in body and signal guidance and the function and the signal guidance that are used for translating reverse transcriptase (RT) gene. The optional one or more RNAse genes that other element can comprise usually and the RT gene links that are included in the hereditary element of this group of the present invention, a restriction endonuclease (RE) gene (being used for purpose hereinafter described), one is used at eukaryotic expression so that the mRNA that the purpose sequence is produced contains the downstream polyadenylation signal sequence (seeing Fig. 1) of poly (A) tail, and a DNA sequence dna that has enzymatic activity when linearizing ssDNA is folded into corresponding secondary configuration. In an embodiment of the hereditary element of this group, DNA enzymatic sequence is positioned at the purpose sequence, no matter this purpose sequence is positioned between inverted repeats (IR) or be not always the case between the 3 ＇ ends of IR and PBS, but the present invention is not limited thereto.

In first embodiment of expression system as herein described, the carrier system that provides contains two kinds of plasmids, be applicable to transmit into cell so as to produce in vivo ssDNA above-mentioned one group heredity element comprise RNA-dependent form archaeal dna polymerase (reverse transcriptase) gene, also contain in addition the RNAse H gene that useful histidine-proline joint is connected with restriction endonuclease gene. Build these genes and insert to contain and transcribe and translate required control element and polyadenylic acid adds in the plasmid vector of tailer sequence. This plasmid is referred to herein as " A " plasmid, pssXA, as shown in Figure 3. Built the second plasmid, i.e. " B " plasmid, in embodiment as herein described, it contains above-mentioned three kinds of elements of sequence box,, is combined sequence (PBS) with the primer of reverse transcriptase (RT) coupling that is, purpose sequence (SOI), and inverted repeats (IR). In the second plasmid, take plasmid pssXB shown in Figure 4 as example, SOI is between the differential concatenation repetitive sequence, and perhaps in the 5 ' position of PBS (with respect to the mRNA transcripton), PBS is positioned at the 3 ' end of mRNA transcripton. In other words, SOI is positioned between (1) IR, (2) between IR and PBS, and/or both have between (3) IR and between IR and PBS, as described below, this paper describes two kinds of B plasmids, a kind of (pssXB-I) between IR (for example, the NotI site) and contain SOI, another kind of (pssXB-II) is between IR and PBS and contain SOI (for example, be cloned in the PacI/BamHI site in this). A is the same with plasmid, and plasmid B also comprises one group of transcriptional control element. Yet in another preferred embodiment of this paper, the B plasmid does not comprise (or not needing) translation control element, because from this structure body, do not produce protein.

In another embodiment as herein described, expression system of the present invention contains the single plasmid vector shown in Fig. 5 and 6, and difference called after plasmid pssXC and pssXD, has wherein inserted one group of above-mentioned heredity element. The composition of above-mentioned B plasmid, PBS for example, SOI, and IR, be positioned at 3 ＇ untranslated parts of RT polyprotein in the C plasmid. In other words, when the RT-RNAse of C plasmid H composition is transcribed under suitable promoter is controlled (in embodiment as herein described, use the RSV promoter), the mRNA transcripton of gained contains the code area of RT-RNAse H polyprotein, and while at the termination signal place, finishing translation, other mRNA transcripton contains (at 3 ' end of this translation albumen) element from the B plasmid, and the polyadenylation signal of 3 ＇ downstream signal events, it has kept the integrality with respect to RT-RNAse H composition.

Concrete single plasmid expression system as herein described does not contain restriction endonuclease (RE) gene, therefore can not digest the stem of the stem ring intermediate that is formed by inverted repeats. Therefore, SOI (comprising the DNA enzyme) is only in C or D plasmid are inserted in the 3 ＇ positions of IR,, because transcripton runs into the metastable stem of stem ring intermediate and can not continue to transcribe ss-cDNA from the mRNA transcripton, block and remove unwanted carrier sequence before making the maturation of ss-cDNA product. More particularly, as apparent in specification below, each SOI only inserts in the PacI/BamHI restriction site of pssXC and pssXD plasmid.

To B, the description of C and D plasmid it is evident that from following, and plasmid comprises for the cloning site that inserts SOI. NotI site (between IR) and PacI/BamHI (the 3 ＇ ends of IR, for example, between IR and PBS) site is provided in the preferred embodiment of B plasmid as herein described. C as herein described and D plasmid only comprise the site for this purpose PacI/BamHI. Yet, from benefited person of skill in the art will appreciate that of this specification, can select these concrete cloning sites useful equally for this purpose for concrete system as herein described and other cloning site. Two plasmid vector systems of the A of containing plasmid as herein described do not plan to comprise SOI, but also recognizing, those skilled in the art uses two plasmid vector systems, the element of this group of the present invention in hereditary element, and SOI particularly, can insert in arbitrary plasmid easily.

The nucleotide sequence that this paper is called the sequence box provides the template of synthesizing ss-cDNA in target cell.It is to comprise SOI, the element of IR and PBS.For other element in this group genetic elements of the present invention also is like this, this genetic elements preferably is subjected to being positioned at the suitable wide spectrum or the tissue-specific promoter/enhanser of genetic elements upstream, the adjusting of the combination of for example CMV promotor, or promotor/enhanser.Situation for other genetic elements also is that so promotor/enhanser can be composing type or inducible promoter.Can use many other eukaryotic promoters to help control to comprise SV-40, the expression of the SOI of RSV (acellular type specific) or tissue specificity glial fibrillary acidic protein (GFAP) from person of skill in the art will appreciate that of being benefited of this specification sheets.

Be used to start cDNA synthetic primer binding site (PBS) between 3 ＇ IR and polyadenylation signal.PBS is the sequence that is complementary to transfer RNA (tRNA) (tRNA) in the eucaryon target cell.In mouse Mo Luonishi reversed transcriptive enzyme described herein (MoMULV RT) and situation that the present invention is used in combination, PBS utilizes proline(Pro) tRNA.The PBS that is used in combination with the present embodiment preferred of the present invention as herein described takes from 18 nucleotide sequence districts of reality of mouse Mo Luonishi virus.Shinnick, T.M., etc., the nucleotide sequence of moloneys mouse quasi-leukemia virus, nature, 293,543-548 (1981).For by the following RT gene from the human immunodeficiency virus that has also carried out test, used PBS takes from the nucleotide sequence of HIV.Y.Li, etc., Journal of Virology, 66,6587-6600 (1992).Briefly, use any PBS that mates with concrete RT to be used for this purpose.PBS is discerned by target cell endogenous primer tRNA specificity.Each tRNA has particular sequence (that is) the ability, codon, and have the ability covalently bound with specific amino acids (that is, tRNA becomes " loading " when combining with specific amino acids) of coded amino acid on the identification mRNA transcripton.Yet, when combining with mRNA transcripton PBS and during not with amino acid covalently bound (that is, " unloaded "), it is synthetic that primer tRNA can be used for starting ssDNA by RT.For example, the MoMULV RT that uses in embodiment as herein described identification is also used the Methionin tRNA of unloaded, and the latter discerns and in conjunction with its peculiar sequence in PBS.Therefore, each PBS that inserts in the expression system of the present invention must contain the peculiar sequence of being discerned by primer tRNA, and primer tRNA must be by the primer tRNA of used specific RT identification.

Can use other retrovirus RT/RNAse H gene according to the present invention, preferred RT/RNase H gene is the RT/RNase H gene such as suitable upstream eukaryotic promoters such as CMV or RSV promotor/enhanser adjusting that is expressed in people's cell.Be applicable to that RNA-dependent form archaeal dna polymerase of the present invention/RT gene comprises from retrovirus, hepatitis B, hepatitis C virus strain, bacterium retroposon element and from those genes of each primary yeast and the isolating retroposon of bacterial species.As what find at nature, these RNA-dependent form archaeal dna polymerases have relevant RNase H composition usually in the same-code transcripton.Yet the present invention does not need to be used for the naturally occurring RNase H gene of specific RT.In other words, but those skilled in the art will recognize that from this specification sheets the various combination montages of RT and RNase H gene are used for the present invention to realize that this function and improvement and/or the mixed form of bringing into play these two kinds of enzyme systems of function in required mode to those skilled in the art are available and/or known together.Those skilled in the art will recognize that also target cell itself has enough endogenous RNase H to realize this function.Equally, person of skill in the art will appreciate that target cell itself for example can have, the enough endogenous RT activity that derive from former retroviral infection are to realize this function.

RT/RNase H gene also preferably includes downstream polyadenylation signal sequence so that the mRNA that produces from RT/RNase H gene comprises 3 ＇ poly (A) tails that can make mRNA stable.As known to those skilled in the art, can obtain a plurality of poly (A) tail and be used to produce the eukaryotic gene of being expressed routinely.

Those skilled in the art also will recognize also can use and not be top listed many tissue specificities or wide spectrum promotor/enhanser, or the combination of promotor/enhanser is to help regulation and control RT/RNAse H gene, RE gene (if you are using), and aim sequence.Come illustration the present invention although needn't list all available promotor/enhansers, as mentioned above, promotor/enhanser can be composing type or induction type and can comprise CMV or RSV (acellular type specific) or GFAP (tissue specificity) promotor/enhanser and a lot of other virus or the mammalian promoter of listing here.Representative promotor/the enhanser that is applicable to sequence box of the present invention can include, but not limited to HSVtk (S.L.McKnight, Deng, science, 217, the 316th page (1982)), people's betaglobulin promotor (R.Breathnach, etc., the biological chemistry yearbook, 50, the 349 pages (1981)), (Actin muscle (T.Kawamoto, etc., molecular cytobiology, 8, the 267 pages (1988)), rat growth hormone (P.R.Larsen, Deng, NAS's journal, 83, the 8283rd page (1986)), MMTV (A.L.Huang, etc., cell, 27, the 245 pages (1981)), adenovirus 5 E2 (M.J.Imperiale, etc., molecular cytobiology, 4, the 875 pages, (1984)), SV40 (P.Angel, etc., cell, 49, the 729th page (1987)), (the 2-macroglobulin (D.Kunz, etc., nucleic acids research, 17, the 1121 pages (1989)), MHC I type gene H-2kb (M.A.Blanar etc., EMBOJ., 8, the 1139 pages (1989)), and thyrotropin (V.K.Chatterjee, Deng, institute of NAS newspaper, 86, the 9114 pages (1989)).

The RT that produces in the cell uses the genetic elements that contains SOI hereinafter described to make the synthetic complementary DNA (cDNA) of template.The mRNA template composition of the RNase H active degradation RNA/cDNA crossbred of RT is so that produce ss-cDNA in vivo.

The gene (be used for two plasmid expression systems and be not necessary the composition of this system) of coding RE can be any of several genes of coding REs, and preferably is subjected to those genes of controlling such as one or more composing types listed above or induction type wide spectrum and/or tissue-specific promoter/enhanser.The concrete REs that is tested is MboII and FokI, but can comprise any RE (I, II, IIS, or III type) site from benefited person of skill in the art will appreciate that of this specification sheets among IR.These enzymes " are cut " or the stem that digests following stem ring intermediate becomes single stranded DNA with linearizing SOI.

Although by be arranged in the restriction endonuclease gene upstream such as suitable groups moulding or the adjustable RE expression of gene of inducible promoter/enhanser such as CMV that is used for expressing or RSV promotors at people's cell, but in plasmid pssXA, RE gene (MboII) is connected with RT-RNAse H polypeptide.The RE gene preferably also comprises downstream polyadenylation signal sequence, so that have 3 ＇ poly (A) tails from the mRNA transcripton of RE gene.

Sequence box of the present invention also comprises differential concatenation tumor-necrosis factor glycoproteins (IR).With the mRNA of RNAse H digestion mRNA-cDNA heteroduplex and after discharging ss-cDNA, IR is with U.S. Patent number 6,054,299 described modes cause that ss-cDNA self is folded to form the stem of loop-stem structure, this stem structure is made up of the antiparallel DNA of two strands, the sequence box after the mRNA transcripton of RT/RNase H from cell that transit cell record back and genetic transcription produce produces purpose ss-cDNA sequence as shown in Figure 2.One or more RE site (comprising the situation of the plasmid of RE gene for those) that the RE enzyme that is produced by the RE gene is cut can be designed to double-stranded part, i.e. IR, and its forms the stem of stem ring intermediate.Transcribe the ring that the ss-cDNA that is produced has 5 ＇ and the 3 ＇ coding regions (being made up of IR) of stem flank and contains SOI.Stem is cut (being also referred to as digestion or cracking) by any one enzyme in many RE enzymes then, the restriction enzyme site that this RE enzyme identification design is advanced in the stem (is noted, even in carrier system of the present invention, do not comprise the RE gene, also endonuclease recognition site can be designed in stem) to discharge ss-cDNA ring (see figure 1).The ss-cDNA loop section that does not form any apparent duplex DNA is not subjected to that RE is active to be influenced, because REs only discerns double-stranded DNA as the target substrate.

As mentioned above, person of skill in the art will appreciate that if desired from the SOI between PBS and IR to produce ssDNA that because transcribing at the stem place that IR forms of sequence box stop, so the RE site needn't be designed among the IR of formation stem ring intermediate stem into.Another selection is that IR is designed to contain eucaryon, protokaryon, or the DNA binding site of virus protein, and it is used for competitive titration and goes out selected cell protein.In IR, can comprise restriction site or other sequence-specific combination of elements so that produce the stem ring intermediate forms of the ssDNA that linearizing or accurate enzyme cuts according to the based composition of the IR that selects.The synthetic sequence-specific element that makes up of general preferred use in IR is because naturally occurring inverted repeats can not have the restriction site of proper alignment.

As mentioned above, the sequence box that contains one of the element of this group genetic elements of the present invention also comprises the dna sequence dna with catalytic activity.Owing to comprise so-called " DNA enzyme " (and in embodiment as herein described, the DNA enzyme is positioned at aim sequence) in the sequence box, the present invention is used for having advantage especially when aim sequence is used as inhibition nucleic acid (antisense sequences) synthetic template.Therefore, the embodiment that this paper lists has described the production of the antisense SOI shown in Fig. 5 B, this SOI comprises the sequence that mRNA is had enzymatic activity, this sequence comprise be designed to specificity in conjunction with by the c-raf lyase of the 3 ＇ non-translational regions of the c-raf mRNA of antisense ISIS 5132 targets (Monia, B.P., etc., nature medical science, 2,668-675 (1996) should concrete document introduces in this specification sheets with it in full at this).The flank of these two kinds of 9bp target-specific brachium conjunctivums is catalytic domain (Santoro, S.W. and G.F.Joyce, mechanism and practicality of the DNA enzyme of cleaving rna of 15bp, biological chemistry, 37,13330-13342 (1998) also should concrete document introduces in this specification sheets in full with it).Add suitable restriction site in DNA enzyme oligonucleotide, so that they can insert NotI site or PacI and BamHI site, the plasmid of gained is called after pssXB-I and pss-XB-II respectively.

Person of skill in the art will appreciate that the present invention is not limited to antisense sequences, this antisense sequences needn't contain the nucleotide sequence with catalytic activity, and the inhibition nucleotide sequence also can be the inhibition nucleotide sequence of above-mentioned any other form.Select above-mentioned SOI to be used to the present invention that demonstrates, because the c-raf kinases in the A549 lung carcinoma cell system is fully identified (Monia, etc., ibid (1996)).Raf albumen is serine/threonine protein kitase, shown that it serves as that the proteic direct downstream effect device of ras is used for the activation of downstream MEK1/MEK2 and the (Daum of activation subsequently of ERK1 and ERK2 in the map kinase signal pathway, G., Deng, rat is inside and outside kinase whose, the biology science is dynamic, and 19,474-480 (1994)).Confirmed that many solid tumors and leukemia contain sudden change in ras or the map kinase signal pathway raises.Be the attractive target of oncology treatment and confirmed that above-mentioned thiophosphoric acid ODN ISIS 5132 is effective antisense inhibitor (Monia, etc., ibid (1996)) such as signal transduction pathways such as craf related neoplasms.In addition, demonstrated ISIS 5132 cell death inducings (etc., oncogene, 16,1899-1902 (1998) also will this concrete document introduces in this specification sheets in full with it for Lau, Q.C.) and as if representative at potential effective treatment of this tumour.This antisense ODN has entered I clinical trial phase (O ＇ Dwyer recently, P.J., Deng, eliminating and tumor response with C-raf-1 among the patient of c-raf-1 antisense oligonucleotide ISIS 5132 (CGP 69846A) treatment, Clinical Cancer Research, 5,3977-3982 (1999)), and proof can be used for treating the c-raf-related neoplasms.Cloned other SOIs that plasmid into is used to use expression system of the present invention to express and comprised inserting to have 10-23 DNA enzyme sequence (Santoro and a Joyce between 5 ＇ and the 3 ＇ complementary sequences, ibid (1997)) the partial sequence of the 23rd codon of h-ras antisense binding sequence, insert the partial sequence of the multi-effect nutrient factor (pleiotropin) the antisense binding sequence between 5 ＇ and the 3 ＇ complementary sequences, and insert the partial sequence of the SIV sequence tat antisense land between 5 ＇ and the 3 ＇ complementary sequences with 10-23 DNA enzyme sequence with 10-23 DNA enzyme sequence.Although each in these sequences includes the DNA enzyme sequence, those skilled in the art will recognize that from this specification sheets the DNA enzyme sequence needn't comprise these, perhaps any other SOIs.

The nucleotide sequence with enzymatic activity that uses in the method for change genetic expression as herein described is 10-23 DNA enzyme (Santoro and Joyce, ibid (1997)).Enzyme sequence is in one of two positions or two middle insertion sequence boxes, for example, and (a) (in the NotI site) or (b) be positioned at 3 ＇ of IR and the 2nd SOI inside (in the PacI/BamHI site) of the 5 ＇ end of PBS between IR and the inner SOI.In each mode, the aptamer of gained has specificity and therefore is used for other dna sequence dna of target the SOI target, mRNA sequence and any other suitable substrate perhaps even in the specificity mode directly change cellular genome to suppress or to change the mechanism of DNA or mRNA montage.

Those skilled in the art will recognize that from this specification sheets any dna sequence dna with enzymatic activity will bring into play function and be used for required purpose when inserting sequence box of the present invention.Reported many nucleotide sequences in the literature, having comprised with enzymic activity:

Has the active sequence of RNAse, for example, so-called " 10-23 " and " 8-17 enzyme " (Santoro, S.W. and G.F.Joyce, ibid (1997)) and other metal dependent form RNAses (Breaker, R.R. and G.F.Joyce, biology chemistry, 1,223-229 (1994) and Breaker, R.R. and G.F.Joyce, biology chemistry, 2,655-660 (1995)) and Histidine dependent form RNAse (Roth, A. and R.R.Breaker, institute of NAS newspaper, 95,6027-6031 (1998));

Have the active sequence of DNAse, for example copper dependent form DNAse (Carmi, N., etc., chemicobiology, 3,1039-1046 (1996), Carmi, etc., ibid (1997); Sen, D. and C.R.Geyer, the chemicobiology prevailing view, 2,680-687 (1998)) with at Faulhammer, D. report needs divalent-metal ion as cofactor or do not rely on the DNAses of divalent-metal ion hydrolysis substrate and among the M.Famulok (molecular biology magazine, 269,18-203 (1997));

Has the active sequence of dna ligase, for example copper dependent form DNAse (Breaker, R.R., chemical review, 97,371-390 (1997)) and zinc dependent form E47 ligase enzyme (Cuenoud.B. and J.W.Szostak, nature, 375,611-613 (1995));

Sequence with DNA kinase activity, for example calcium dependent form DNA kinases (Li, Y. and R.R.Breaker, institute of NAS newspaper, 96,2746-2751 (1999)); With

Sequence with RNA kinase activity, for example calcium dependent form DNA kinases (ibid for LI, Y (1999)).

In general, it is that in the sequence box of the present invention those of being preferred for from physiological conditions have the dna sequence dna of enzymatic activity.

Be used for when target cell is expressed when the element that contains this group genetic elements of the present invention inserts in the carrier, preferably this carrier contains other special-purpose genetic elements and contains the expression level that this organizes the sequence box of genetic elements to help to identify the cell and/or the increase of carrying carrier and sequence box.Special-purpose genetic elements comprises selectable marker gene, so that carrier can transform in prokaryotic system and increase.For example, the most frequently used selective marker is to give bacterium (for example, intestinal bacteria) to such as penbritin, paraxin, kantlex (Xin Meisu), or the gene of the antibiotics resistance of tsiklomitsin.Also preferred vector contains special-purpose genetic elements and is used for subsequently transfection, identifies and the expression in eukaryotic system.In order in eukaryotic cell, to express, can use and give the resistance of cell to microbiotic or other medicines or the phenotype of change cell, morphological change for example, multiple choices scheme (for example, the Chinese hamster ovary: CHO) that the forfeiture of contact inhibition or growth velocity increase.The selective marker of using in eukaryotic system includes, but not limited to the resistance marker to Zeocin, to the resistance of G418, and to the resistance of aminoglycoside antibiotics, or Phenotypic Selection mark, for example β-gal or green fluorescent protein.

These compositions are inserted produced in the plasmid that contains expression system of the present invention two kinds easily method be used for after producing ssDNA, removing predetermined carrier sequence.In first method, from PBS reverse transcription sequence box, and the SOI between the IR contains the loop section of ssDNA stem ring intermediate, when the oligonucleotide ligand that contains IR produces this ssDNA stem ring intermediate when forming the stem of stem ring carrier, stem contains a RE site, and with after the suitable R E digestion, ring discharges as the linearizing strand cDNA that does not contain (and/or contain minimum) flanking sequence.In the second approach, similarly transcribe, but the stem place of the loop-stem structure that forms is stopped reverse transcription at the oligonucleotide ligand of IR from PBS reverse transcription sequence box and the SOI that is included in the 3 ' end of sequence box IR.In each method, produce the ssDNA that does not contain (and/or containing minimum) flanking sequence.Utilize second method to produce ssDNA if desired, with the IR implementation sequence box that forms stem, needed stem more stable (for example, IR can be designed to not contain the RE site) when this stem beguine produces ssDNA according to a first aspect of the present invention digestion stem.Have the formation sequence box of the IR of the stem of easy sex change according to a first aspect of the invention through design, carrying out reverse transcription to the SOI IR from the 2nd SOI (if it is designed into sequence box).Therefore reversed transcriptive enzyme cDNA transcripton provides the ss-cDNA that produces in the restriction body to contain the second method that interleaves the carrier sequence 3 ' end of stem structure this " stopping before ripe ".Stem as intermediate allows to produce first and second SOI on stability.

Those skilled in the art it is evident that from this specification sheets complete stem ring ss-cDNA structure is similar to linearizing ss-cDNA form function in many application.Therefore, use the sequence box do not contain restriction endonuclease gene and relevant controlling element and/or to have the aim sequence that lacks corresponding restriction endonuclease site also to have advantage.

Those skilled in the art it is evident that from the explanation of the preferred embodiments of the invention and can prepare the sequence box that coding has the ss-cDNA of " pruning " loop-stem structure.Design is encoded the RE site so that cut the stem that contains dsDNA with enzyme with corresponding RE digestion stem portion (duplex forms the back) in the IR of SOI flank, enzyme butt formula is to remove part stem and the flanking sequence that links to each other, and stays the enough duplex DNA that make transcripton keep above-mentioned loop-stem structure.This ss-cDNA structure has more resistance by nuclease in ssDNA " end " pair cell that keeps double chain form.

Those skilled in the art is conspicuous from the explanation of the preferred embodiment of the invention to also have stem (double-stranded DNA) can be designed to contain a predetermined sequence (or a plurality of sequence), that is, aptamers, it is by conjugated protein identification of specific DNA and combination.In other purposes, this stem structure is used as competitor goes out the specific gene function with titration selected albumen in cell.For example, the ss-cDNA stem ring that produces in cell according to the present invention contains the binding site such as the selected positive transcription factor of adenovirus Ela.Adenovirus Ela the same with other oncogene by influencing cell coding some adenovirus of activity regulation of transcription factor and the expression of cytogene, cause normal cell is changed over transformant.Jones, etc., gene exploitation, 2,267-281 (1988).Therefore, the double-stranded stem of the stem ring intermediate that produces according to the present invention is designed to have the function of " in conjunction with last " this transcription factor, prevents this protein bound promotor, and thereby suppresses specific detrimental expression.To those skilled in the art, it is evident that double-stranded stem structure can be chosen wantonly contains a plurality of binding sites, for example, is effectively regulated and control the site of the various transcription factors identifications that specific gene expresses.For example, found that adenovirus Ela suppresses transcribing of collagenase gene by Buddhist ripple ester response element, this element is a kind of promoter element, be responsible for 12-O-mnyristoyl phorbol 13-acetic ester (TPA), with many other mitogens, with with ras, mos, src and trk oncogene inducible transcription.This mechanism relates to the function that suppresses transcription factor family AP-1.Offringa, etc., cell, 62,527-538 (1990).Can with in required nucleotide sequence insertion genetic elements of " ring " part of coding stem ring intermediate to realize required inhibit feature, for example, antisense combination, the downward modulation of gene and function as herein described or the like.

Those skilled in the art can recognize on the other hand in, the present invention is used to make up complicated secondary ssDNA structure, this structure provides biologically to the cDNA transcripton on the basis of secondary structure folded conformation.This secondary structure can be transformed into and be used for any several function.For example, aim sequence can include, but is not limited to insert the loop section of strand cDNA transcripton to form such as the what is called " trifolium leaf " of those structures of finding in or the retrotransposon terminal repetition in adeno associated virus length or the sequence of " crucible " shape structure.Under suitable situation, this structure is integrated in the host genome in the locus specificity mode.

Be used for Mammals and human therapeutic purpose in the multiple commercially available transmission carrier because sequence box of the present invention is applicable to insert, therefore can use multiple pipeline according to the carrier that concrete target cell is selected.For example, virus vector is usually used in transforming patient's cell and with DNA quiding gene group.In an indirect method, the virus vector that carries new genetic information is used to infect the target cell of taking out from health and and then this cells infected implanted (that is ex vivo).Reported and can be used for preparing DNA that is wrapped in liposome and the DNA that is embedded in the proteoliposome that contains the peplos receptor protein in new life (postnatal) animal body being transferred in the direct body of gene.Nicolau, etc., institute of NAS newspaper, 80,1068-1072 (1983); Kaneda, etc., science, 243,375-378 (1989); Mannino, etc., biotechnology, 6,682-690 (1988).Positive findings with the DNA acquisition of coprecipitation of calcium phosphate has also been described.Benvenisty and Reshef, institute of NAS newspaper, 83,9551-9555 (1986).Be used to promote to contain this other system that organizes the expression system administration of genetic elements of the present invention and comprise intravenously, intramuscular and subcutaneous injection, and the interior and intracavitary administration of direct tumour.When inserting selected expression system, the sequence box also helps by the part, through mucous membrane, and rectum, oral, or the administration of induction type transmission method.

Use sequence box of the present invention to help transmitting antisense, triplex, or any other inhibition nucleic acid or purpose strand nucleotide sequence, can use known digestion and interconnection technique that sequence box (between the differential concatenation tumor-necrosis factor glycoproteins or between PBS and differential concatenation tumor-necrosis factor glycoproteins) is advanced in the montage of specific purpose sequence.Can modify according to the specific purposes sequence with manner known in the art from the above-mentioned signal that is used in eukaryotic cell, expressing that person of skill in the art will appreciate that this specification sheets is benefited.For example, a kind of possible modification is to change promotor so that favourable expression characterization is provided for the sequence box in the system that needs the expression aim sequence.Too many possible promotor and other signal are arranged, and they also depend on the concrete target cell of having selected aim sequence, therefore can not list for preferred all the potential enhansers of concrete target cell and aim sequence, induction type and constitutive promoter system, and/or poly (A) adds tail system.

In an especially preferred embodiment, the present invention has adopted the form of test kit, this test kit is made up of plasmid, and this plasmid has the multiple clone site (MCS) that the user who clones above-mentioned RNA-dependent form archaeal dna polymerase and RE gene wherein and can be convenient to test kit inserts specific SOI.The cloning site that inserts SOI is between above-mentioned IR.The plasmid of purifying gained from cell culture then, plasmid can be kept in this culture, and freeze-drying or preservation are used for packing and the user is given in shipment.This test kit preferably also comprises and is used to clone the RE that SOI advances MCS, ligase enzyme and other enzyme, and be used for SOI is connected the into suitable damping fluid and the plasmid map of plasmid.

In specific embodiments as herein described, by with called after A and B, design and be built into two plasmid co-transfection cells that comprise above-mentioned composition respectively, perhaps SOI is transmitted into host cell by single C or D plasmid.In two kinds of plasmid systems, the plasmid-encoded sequence box that comprises SOI of B, SOI are nested in the flanking sequence that comprises IR or between IR and PBS, and this PBS provides mediation to transcribe the post-treatment signal by what mRNA was transformed into ssDNA.First gene product of B plasmid is processed into ssDNA and removes carrier sequence and processing signal, particularly RT/RNAse H and RE (if use), required activity is from the A plasmid expression.The single stranded DNA sequence that interact to discharge by transcription product in the body of these compositions with antisense and triplex scheme freedom in conjunction with target in the cell, for example mRNA kind and DNA promotor.

As mentioned above, B plasmid as herein described comprises cloning site (the NotI site is used for B plasmid as herein described), put into any DNA SOI between this site (as mentioned above, in embodiment as herein described, SOI is the kinase whose antisense sequences of c-raf that comprises the 10-23 enzyme sequence, but as mentioned above, use other sequence that produces in the expression system body as herein described to comprise " padding sequence ", or detection sequence, telomere repeat sequence, h-ras, the coding region (from SIV) of the coding region of the angiogenesis growth factor multi-effect nutrient factor (pleiotrophin) and tat).The flank of cloning site is to instruct from promotor (using the CMV promotor B plasmid as herein described) the one-level mRNA transcripton that produces to be processed into the signal of required strand inhibition nucleic acid.After required SOI cloned into the B plasmid, A and B plasmid co-transfection are advanced selected clone be used for constitutive expression ssDNA.Equally, in simple substance grain expression system as herein described, clone into SOI in this plasmid and transfection is advanced clone and is used for further processing.No matter how the element in above-mentioned this group genetic elements distributes between two (or more a plurality of) plasmids, perhaps whether this element is included in the single plasmid, all processes by three steps after (that is, SOI, IR, and PBS) transcribes in the single stranded DNA district:

(1) with RT reverse transcription plastid rna transcripton, RT is by A in embodiment as herein described, C, or the RT of D plasmid expression is (in embodiment as herein described, RT is MoMuLV RT), begin reverse transcription from the primer binding site that is positioned at SOI (the optional sequence with enzymatic activity that comprises of SOI) 3 ' end, IR and PBS are as shown in Figure 1;

(2) with the RNAse H activity of RT polyprotein or with endogenous RNAse H activity the gained heteroduplex is carried out RNAse H digestion so that the single stranded DNA precursor discharges from its RNA complementary strand; With

(3) through the stem that forms by the Watson-Crick base pairing by the base that contains IR in the digestion stem ring intermediate or forms stem ring secondary structure by self complementary IR and make the termination before maturation of cDNA transcripton remove flanking sequence.

Those skilled in the art will recognize the concrete cloning site of SOI flank from this specification sheets, concrete RT, RE (if you are using), promotor, all other elements in PBS and this group genetic elements of the present invention can be selected according to concrete SOI and/or the system of expressing ssDNA.

Embodiment

Except as otherwise noted, use among the listed below embodiment and press Seabrook, wait (1989) (J.Seabrook, Deng, molecular cloning: laboratory manual (the 2nd edition), (1989), hereinafter referred to as " Maniatis; wait (1989) " are published in the cold spring port) and Ausubel, Deng, (1987) (F.M.Ausubel, etc., the molecular biology popular approach, New York: John Wiley ﹠amp; Sons (1987)) described standard technique, these two pieces of documents are quoted at this with the integral body of this concrete reference.Should understand also can use in the method for the invention to produce other method of ssDNA with natural method with the manual method of different enzyme products or system design, and embodiment provided herein be provide for the purpose of illustration and be not used in this specification sheets or the scope of the present invention described herein of limiting.

Plasmid pcDNA3.1Zeo+ from Invitrogen company (Carlsbad, CA) buy and plasmid pBK-RSV from Statagene (La Jolla, CA).The reagent company that oligodeoxynucleotide (ODN) is examined and determine by Midland (Midland, TX) synthetic.(Indianapolis, IN) the Taq archaeal dna polymerase of Gou Maiing (carries out among the Stratagene (La Jolla, CA)) at Robo-gradient thermal cycler from Boehringer Mannheim company in polymerase chain reaction (PCR) use.(Indianapolis IN) obtains from Boehringer Mannheim company for restriction endonuclease and T4 dna ligase.The ODN that uses lists in appended sequence table.

All ODN in 70 ℃ of following incubations among 1 μ l (5 μ g/ μ l are soluble in water), hybridize and at room temperature hybridized 15 minutes in 5 minutes the separately test tube.The enzyme and the suitable reaction buffer that are used in 10 units in the 15 μ l total reaction volume carry out criteria limit endonuclease enzymic digestion (EcoRI is as negative control).Dna segment is offered an explanation on sepharose and from wherein separating.Press Maniatis, etc., (1989) described conversion is entered competence XL1-Blue MRF cell (Stratagene) back and carry out the selection of positive colony on the penbritin flat board.After selecting positive colony, use above-mentioned Quiagen plasmid separating kit isolated plasmid dna.

The structure of plasmid.The structure of 4 kinds of expression plasmids has been described.First kind of plasmid pssXB (Fig. 3) is from pcDNA3.1Zeo (+) (Invitrogen company) and contain the genetic elements of the purpose ss-cDNA sequence used herein of encoding.911 and the 978 digestion pcDNA3.1Zeo (+) in the position respectively with restriction endonuclease HindIII and NotI.Make synthetic strand oligodeoxynucleotide ODN-5 ＇-N/M (joint) 2-H/N and ODN-3 ＇-N/M (joint) 2-H/N annealing form double-stranded connector area with compatible HindIII and NotI end, it is connected the pcDNA3.1Zeo (+) that advances the HindIII/NotI double digested under standard conditions, this plasmid has transformed into SureII cell (Stratagene company).ODN in 70 ℃ of following incubations in 5 minutes the Ependorf pipe in 1 μ l (5 μ g/ μ l are soluble in water) hybridization and at room temperature hybridized 15 minutes.The selection and the suitable clone that checks order are to be sure of the correct insertion of connector area.The plasmid of gained is called pssXB.PssXB shows in Fig. 4 A and it is the plasmid that the clone advances aim sequence (Fig. 4 B).For aim sequence being cloned between the differential concatenation tumor-necrosis factor glycoproteins, use respectively in two NotI sites of 935 and 978 positions (seeing Fig. 4 A).These two sites are included in the differential concatenation tumor-necrosis factor glycoproteins.In order between differential concatenation tumor-necrosis factor glycoproteins and primer binding site, to insert aim sequence, use 1004 and 1021 PacI and BamHI site in the position respectively.

Second kind of plasmid also is a kind of composition of two plasmid vector systems as herein described, i.e. pssXA (Fig. 3).This " A " plasmid contain Mo-MuLV-RT (Shinnick, T.M., etc., nature, 293,543-548 (1981)) and restriction endonuclease gene and from pBK-RSV (Stratagene), also use XL-1 Blue MRF ＇ as host cell.The mouse cell lines of expressing Moloney (Moloney) murine leukemia virus obtains (#CRL-1858) from American type culture collection.Viral RNA is according to Chomczymski, P. and N.Sacchi (biological chemistry annual report, 162,156-159 (1987)) described method is used Trizol reagent (GibcoBRL) to separate from cell and is used primer 3 ＇-RT-HindlII (5 ＇-CTTGTGCACAAGCTTTGCAGGTCT-3 ＇) reverse transcription.Transcripton uses the long polysaccharase of TaqPlus system (Stratagene) through 35 circulations of pcr amplification then: 94 ℃ 1 minute, 67 ℃ of 1 minute and 72 ℃ 2.5 minutes.The primer that is used for the PCR reaction is 5 ＇-RT-SacI (5 ＇-GGGATCAGGAGCTCAGATCATGGGAC-CAATGG-3 ＇) and the identical 3 ＇s-RT-HindIII used with reverse transcription.These primers comprise suitable SacI and HindIII site respectively.The 2.4kb product of gained comprises the Mo-MuLV sequence between position 2546 and 4908.Sophisticated viral RT peptide is by the sequence encoding between position 2337 and 4349 (Petropoulos, C.J., retroviral classification, protein structure, sequence and genetic map are seen J.M.Coffin, Deng (editor), retrovirus, New York: cold spring harbor laboratory publishes, 757-805 page or leaf (1997)), but N-terminal truncation type peptide has kept whole activity (Tanese, N. and S.P.Golf, institute of American Academy of Sciences newspaper, 85,1777-1781 (1988)).Peptide by this construct coding comprises the part integrase gene, after its RT in the MoMuLV polyprotein (Petropoulos, ibid (1997)).

Coding restriction endonuclease MboII (Bocklage, H., etc., nucleic acids research, 19,1007-1013 (1991)) bacterium hemophilus bovis (Moraxella bovis) obtain from American type culture collection (ATCC#10900).Use Stratagene DNA extraction test kit to press shop instruction from the hemophilus bovis isolation of genomic DNA and as the template DNA the PCR.Use two primers, 5 ＇-MboII-HindIII (5 ＇-CAATTAAGGAAAGCTTTGAAAAATTATGTC-3 ＇) and 3 ＇-MboII-XmaI (5 ＇-TAATGGCCCGGGCATAGTCGGGTAGGG-3 ＇), from genomic dna through 30 circulations of pcr amplification MboII gene: 94 ℃, 30 seconds, 58 ℃, 1 minute, 72 ℃, 1 minute.These design of primers become to comprise respectively HindIII and XmaI site.The 1.2kb product that M.bovis genome between the copy position 888 and 2206 obtains contains the coding region of MboII enzyme.

With XmaI and NheI digestion pBK-RSV carrier.Use is transformed into the SacI end by the joint that two annealed oligonucleotide 5 ＇-Nhe-Sac-joints (5 ＇-CTAGCGGCAAGCGTAGCT-3 ＇) and 3 ＇-Nhe-Sac-joint (5 ＇ ACGCTTGCCG-3 ＇) form with the NheI end.RT and MboII amplicon connect by the HindIII site and this construct is connected between the Sacl of pBK-RSV and the Xmal site subsequently to produce pBK-RSV-RT/MboII.

In order to insert resilient connector between the RT of polyprotein and MboII structural domain; the segment of the pBK-RSV-RT/MboII plasmid between AseI and BglII site of excision coding MboII gene 5 'end and part integrase gene also replaces with the insertion sequence of the 5 '-MboII dna segment that contains the 6-His-joint and lack through double digested. through from the 3' end with a 17 nucleotide sequence complementary to two templates , Rep (+) (5'- ATACTATTAATTTTGGCAAATCATAGCGGTTATGCTGACTCAGGTGAATGCCGCGATAATTTTCAGATTGCAATCTTTCATCAATGAATTTCAGTGATGAATTGCCAAGATTGATGTTGC-3 ') and Rep (-) (5'GACGAGATCTCCTCCAGGAATTCTCGAGAATTCGGATCCCCCGCTCCCCACCACCACCACCACCACCCTGCCCCGCGGATGAAAAATTATGTGAGCAACATCAATCTTGGC-3') with each other to obtain induced DNA synthesis in the insertion sequence . Anneal these two oligonucleotide also with T7 archaeal dna polymerase (USB) prolongation of modifying, and double chain oligonucleotide digests with AseI and BglII then and inserts the pBK-RSV carrier to produce pssXA (Fig. 3).

In first embodiment of the single plasmid expression vector system that makes up according to the present invention, pc3.1DNAZeo (+)-deutero-" B " plasmid and pBK-RSV-deutero-" A " plasmid are merged so that plasmid-encoded of the present invention this of gained organized all elements of genetic elements, the aim sequence that comprises the ss-cDNA that encodes, the series opposing tumor-necrosis factor glycoproteins, Mo-MuLV-RT gene, and restriction endonuclease (MboII) gene.In order to produce the C plasmid, with SacI XmaI digested plasmid pssDNA-Express-A to remove the MboII gene.Make the connector area that contains oligonucleotide 5 ＇-(joint) 2-Hind/Xba (5 ＇-CCGGATCTAGACCGCAAG-CTTCACCGC-3 ＇) and 3 ＇-(joint) 2-Hind/Xba (5 ＇-GGTGAAGCTTGCGGTCTAGAT-3 ＇) at 70 ℃ of annealing 15 minutes and slow cool to room temperature, the digestion back connects to advance plasmid under standard conditions.Results positive colony and order-checking digest this plasmid with Xba and HindIII then to confirm the position of joint.Described differential concatenation tumor-necrosis factor glycoproteins with HindIII and Xba digested plasmid pssDNA-Express-B and before will containing, the dna segment of corresponding 300 base pairs of multiple clone site and PBS are cloned the plasmid that into digested to produce pssXC (Fig. 5 A).Carry out the standard ligation and transform SureII cell (Stratagene company).Gather in the crops the positive bacterium colony of conversion and identify positive colony with restriction analysis.

Use BamHI and PacI site in the multiple clone site that aim sequence is cloned the into multiple clone site of pssXC (Fig. 5 B).Synthetic 4 different aim sequences are used for above-mentioned these constructs, use in similar 4 aim sequences of program insertion each.By making the paired oligonucleotide at 70 ℃ of annealing 15 minutes and cool to room temperature, then connection is advanced plasmid and is prepared every kind of construct under standard conditions.After transforming the SureII cell, select suitable bacterium colony through each insertion sequence of order-checking.

Make up the second plasmid pssXD that is used for simple substance grain expression system by make up two plasmid pssXA and pssXB by following mode.Digest the pssXA that contains Mo-MuLV reversed transcriptive enzyme (RT) with XmaI and BglII, the XmaI-BglII segment of gained is with passing through the double-stranded DNA adapter replacement that annealing two oligonucleotide XmaI-BglII-terminators 1 (5 '-CCGGATCTAGACCGCAAGCTTCATTTAAA-3 ＇) and XmaI-BgllI-terminator 2 (GATCTTTAAATGAAGCTTGCGGTCTCGAT-3 ＇) form.This adapter contains protein translation terminator codon and subclone site XbaI and HindIII.The plasmid called after pssXD (Fig. 6 A) of gained.From pssXB and pssXB-II cracking XbaI-HindIII segment, the clone advances between the XbaI and HindIII of pssXD then.These dna segments contain: 1) RT primer binding site (PBS); 2) loop-stem structure; With 3) any control sequence (pssXB) or c-raf DNA enzyme sequence (pssXB-II).The plasmid of gained is called after pssXD-I and pssXDII respectively.Genetic expression and all elements that RSV promoter regulation single stranded DNA is expressed all required elements are transcribed into strand mRNA molecule.Endogenous tRNA ^ProIn conjunction with the PBS of transcripton 3 ＇ ends, and as single stranded DNA synthetic primer (Marquet, etc., biological chemistry, 77,113-124 (1995)).Behind RT reverse transcription single stranded DNA, when template mRNA discharges ssDNA (Tanase and Goff, institute of NAS newspaper, 85,1777-1781 (1988)) during by the RNase H active degradation of endogenous RNase H or RT.

The tissue culture test.(Boehringer Mannhiem Corp., Indianapolis IN) stablize and transient transfection by the appended specification sheets of manufacturer to use the DOTAP lipofectamine.All plasmid construction body transfections advance replenishing DulbeccoShi modified form Eagles substratum (the DMEM) (GibcoBRL of 10% foetal calf serum (FCS), Gaithersburg is in the A549 lung cancer cell line of keeping in MD) (ATCCCCL-185) and HeLa clone.Carry out the mensuration of ssDNA after transfection 24-48 hour by PCR and Dot blot analysis.Cells transfected was separated ssDNA before from 48-72 hour.Use Trizol reagent (Gibco Life Technologies, Inc., Gaithersburg, MD) common (Mitrochnitchenko that concentrates of realization sscDNA and total RNA, O., Deng, use the bacterium retroposon in mammalian cell, to produce single stranded DNA, journal of biological chemistry, 269,2380-2383 (1994)).Measure specificity ss-cDNA kind by the pulsating PCR in inside being measured and surveying by the gel electrophoresis of sex change strand and nylon trace subsequently with biotin labeled internal probe.

In particular, use Silver, J., the RT-PCR assay method warp that waits (RT-PCR that can detect single virus particulate reverse transcriptase activity measures nucleic acids research, 21,3593-3594 (1993)) to set up is measured reverse transcriptase activity by following improvement.With lysis buffer (1%Triton ^TM, 1mM MgCl ₂, 100mM NaCl, 10mM TRIS-HCl, pH8.0 and 2nM DTT) and cracking pssXA cells transfected.With 18,000g collects supernatant and freezing standby at-80 ℃ after centrifugal 30 minutes.Through with contain the active split product of RT 37 ℃ of following incubations 10 or 30 minutes and reverse transcription is used as brome mosaic virus (BMV) RNA of template.Use then primer 5 ＇-CGTGGTTGACACGCAGACCTCTTAC-3 ＇ and 5 ＇-TCAACACTGTA-CGGCACCCGCATTC-3 ＇ with the reverse transcription product through 40 circulations of pcr amplification: 94 ℃, 20 seconds, 56 ℃, 20 seconds and 72 ℃, 20 seconds.Agarose gel analysis RT-PCR product with 1.5%, as shown in Figure 6.

This RT-PCR measures RT activity in the cell lysate that depends on transfectional cell to produce the cDNA transcripton of BMVRNA substrate.Therefore this viral replicative cycle does not relate to the DNA intermediate, has got rid of the possibility that produces amplified production without formerly reverse transcription.In the relative E10 clone (swimming lane 5 and 6) of lysate (swimming lane 3 and 4) of the A549 cell of using the pssXA plasmid transfection, measure the RT activity than high expression level with demonstration.Also from the A549 raji cell assay Raji of contrast pBK-RSV plasmid (swimming lane 1 and 2) transient transfection the RT activity.For transient transfection, prepare split product after 48 hours in transfection.The result shows that all supporting to produce the expection size from the cell lysate of (E10) cell of instantaneous and stable transfection is the band of 150bp (swimming lane 3-6), and the contrast split product shows not have (swimming lane 1 and 2).

In order to detect the ssDNA that when advancing A549 cell (E10), in mammalian cell, expresses by pssXB-I and pssXB-II plasmid, use T7 primer and c-raf DNA enzyme spcificity primer 5 ＇-CTAGCTACAACGAGACATGC-3 ＇ to carry out the PCR reaction with the pssXA cotransfection.Total RNA composition as template and with S1 nuclease or RNAse A 37 ℃ of following pre-treatment 30 minutes or do not handle.30 circulations of the pretreated RNA sample of pcr amplification then: 94 ℃, 45 seconds, 55 ℃, 45 seconds and 72 ℃, 30 seconds.Acrylamide gel with 8% is analyzed PCR product, (

swimming lane

1 and 3, S1 nuclease as shown in Figure 7;

Swimming lane

2,4 and 5, RNAse.All produce the band of expection size in the total RNA goods (swimming lane 2 and 4) handled and the untreated goods (data not shown).Use the Sl nuclease, the contrast goods that a kind of ssDNA endonuclease of high degree of specificity is handled do not have amplified production to produce (swimming lane 1 and 3).

Use North2South chemoluminescence nucleic acid hybridization and detection kit (Pierce) to detect the existence that ssDNA further confirms c-raf DNA enzyme by Dot blot by manufacturers instruction.Use is from pssXA/pssXB-I or pssXA/pssXB-II, or the total RNA of 2 μ g of the cellular segregation of pssXA cells transfected or untransfected.The specific biotin labeled probe sequence of c-raf is 5 ＇-GGCCGCACTAATGCATGTCTCGTTGTAGCTA-GCCCAGGCGGGAAGTGC-3 ＇.As shown in Figure 8, biotin labeled c-raf specificity oligomerization probe only detects signal but does not have in the E10 of untransfected cell or A549 cell in the RNA goods of the E10 cellular segregation of pssXB-I orpssXB-II transfection.

In mammalian cell, whether change c-raf mRNA expression in order to measure the strand c-rafDNA enzyme of expressing, carried out the northern engram analysis with pssXA/pssXB carrier system of the present invention.With pssXB-I or pssXB-II transient transfection E10 clone.At 24 and 48 hours, harvested cell was used to prepare total RNA.On the sex change sepharose, separate the total RNA of 15 μ g and be used for the Northern engram analysis.After transfer was spent the night, fixedly film was also used ³²The c-raf dna segment of P mark and a kind of house-keeping gene, glyceraldehyde-3-phosphate dehydrogenase (G3PDH) is surveyed.Use is from the labelling kit of initiation at random of Boehringer Mannheim, from comprising the IMAGE of position, c-raf kinase gene coding region 571 to 2028 ^TMCDNA clone (ID 645539, Research Genetics) preparation c-raf probe.G3PDH also is ³²The P-mark and stdn that be used for the RNA trace.Film 2xSSC, 0.1%SDS washing 15 minutes and with O.1xSSC washing 5 minutes.Then with trace to x-ray film exposure or with molecular dynamics phosphorus imager ^TMQuantitatively.The phosphorus imaging quantitative result of representative experiment in Fig. 9 with graphic presentation.Compare with the contrast of the pssXB transfection that contains irrelevant sequence, pssXB-II with the c-rafmRNA level be reduced at 24 hours 81% and at 48 hours to 66%.PssXB-I has similar effect, makes c-raf mRNA level reduce by 35% after cultivating 48 hours.Also observing has obviously more necrocytosis (about many 1/3rd) compared with the control in the pssXA/pssXB carrier cells transfected of expressing c-raf DNA enzyme.Only results keep adherent cell rather than those to begin the cell of " floating ", and the degree that reduces of mRNA is bigger than measured 34-36% minimizing like this.

HeLa clone is advanced in the single plasmid vector pssXC of system transfection.After transfection, carried out the mensuration of ssDNA as mentioned above in 24-48 hour by PCR and Dot blot analysis.Also use Silver as mentioned above, the RT-PCR assay method that waits (ibid (1993)) to set up is measured reverse transcriptase activity.Measure the RT activity of single bacterium colony isolate (A12 and B12) of the stable HeLa clone that replaces in addition.Cells transfected was separated ss-cDNA before from 48-72 hour.(Gibco Life Technologies, Inc., Gaithersburg MD) carry out the common of ss-cDNA and RNA and concentrate to use Trizol reagent.Measure specificity sscDNA kind by also surveying with biotin labeled internal probe to the mensuration of the pulsating PCR-based in inside with by gel electrophoresis of sex change strand and nylon trace subsequently.

This experiment has shown that people's tissue culture (HeLa clone) has been designed to the ss-cDNA of synthetic processing, produces the plasmid transfection of the ss-cDNA of expection size.As the application serial no of above quoting 09/397, described in 782, the ssDNA aim sequence that produces in the pssXC body is producing behind the stem of digestion stem ring intermediate or is producing from the position between inverted repeats and the primer binding site by termination reversed transcriptive enzyme cDNA transcripton before stem structure 3 ' end is ripe from the position between the inverted repeats.

Use total RNA composition, by the expression of strand c-rafDNA enzyme in the simple Dot blot assay determination cell.Used biotin labeled c-raf specific oligonucleotide probe is by (the Coralville of dna integration technology company, IA) synthetic, and be used for contrasting pssXD-I or containing the RNA sample detection signal of A549 cellular segregation of the pssXD-II transfection of c-raf DNA enzyme sequence.With the total RNA of RNase A pre-treatment 2 μ g getting rid of any possible non-specific hybridization with RNA, and the S1 nuclease exist and non-existent condition under 37 ℃ of processing 30 minutes.Subsequently, with sample on the sample to the Hybond-N+ film (Amersham Pharmacia Biotec, Piscataway, NJ) on, and fixing through uv irradiating 3 minutes.(Pierce, Rockford IL) are hybridized and signal detection to use North2South chemoluminescence nucleic acid hybridization and detection kit.Figure 11 show have only with pssXD-II cells transfected positive signals and in the presence of the S1 nuclease because the ssDNA enzyme is degraded by S1 nuclease specificity, do not observe detectable signal.

Whether change the c-rafmRNA level in order to measure the single stranded DNA enzyme of expressing in the A549 cell, carry out quantitative RT-PCR.By having the Li of some modifications, wait (gene therapy, 7,321-328 (2000)) quantitative c-raf mRNA of described RT-PCR.Briefly, use reverse transcription system (Promega company, Madison, WI) the total RNA of reverse transcription 1 μ g.The cDNA composition of gained is as the template of pcr amplification.Use Auele Specific Primer to carry out 40 PCR circulations (95 ℃, 30 seconds, 50 ℃, 30 seconds and 72 ℃, 60 seconds).The specific primer sequence that uses is as follows: 1) c-raf primer: 5 ＇-TCAGAGAAGCTCTGCTAAG-3 ＇ and 5 ＇-CAATGCACTGGACACCTTA-3 ＇; 2) Actin muscle primer: 5 ＇-ACCTTCTACAATGAGCTGCG-3 ＇ and 5 ＇-GCTTGCTGATCCACATCTGC-3 ＇.Actin muscle is as the house-keeping gene contrast.Be reversed record and use a pair of c-raf Auele Specific Primer to carry out pcr amplification from contrast pssXD-I or the isolating total RNA of pssXD-II cells transfected that contains the c-rafDNA enzyme sequence.The pcr amplification of the Actin muscle mRNA applied sample amount that compares with the different sample rooms of stdn.As shown in figure 12, compare the remarkable minimizing (approximately 70-80%) that in pssXD-II cells transfected (swimming lane 2), detects c-raf mRNA with contrast (swimming lane 1).

Measure with the c-raf protein level in the A549 cell of pssXD-I or pssXD-II transfection by the Westem engram analysis.30 μ g cell extracts carry out electrophoresis on sodium lauryl sulphate-polyacrylamide gel (SDS-PAGE) of 12%.Use miniature stride trace electrophoretic transfer pond according to manufacturers instruction (the BioRad laboratory, Hercules, CA) with the protein electrotransfer to Hybond ECL film (AmershamPharmacia Biotec, Piscataway, NJ) on.Subsequently film is being contained 25mM Tris-HCl, pH7.5,500mM NaCl seals in the damping fluid of 0.05%Tween-20 and 5% skimming milk, then with first and HRP-link coupled second antibody respectively cultivated 45 minutes.The polyclonal antibody of anti-c-raf (anti--rafl) and the monoclonal antibody (Ab-1) of anti-Actin muscle (San Diego CA) buys from Calbiochem-NovaBiochem company.(IgGl, C-2-10) from ClontechLaboratories, (Palo Alto CA) buys Inc. the monoclonal antibody of anti-poly-ADP ribose polymerase (PARP).Use SuperSignal West Pico chemical luminous substrate test kit (Pierce, Rockford, IL) observing protein.As shown in figure 13, in the control cells of pssXD-I transfection the proteinic level of c-raf (swimming lane 2) similar in appearance to the cell (swimming lane 3) of untransfected.Yet, have lower c-raf protein level (approximately 20-30%) compared with the control with the pssXD-II cells transfected (swimming lane 1) of expressing c-raf DNA enzyme.

Whether induce the A549 apoptosis for the expression of measuring c-raf DNA enzyme, carried out two standard apoptosis tests, i.e. genomic dna cracking and PARP cracking.(Palo Alto CA) presses manufacturers instruction and measures the genomic dna cracking for Clontech Laboratories, Inc. to use LM-PCR ladder test kit.Briefly, with 0.5 μ g genomic dna and ClontechLaboratories, the adapter that Inc. provides spends the night 15 ℃ of connections with the T4 dna ligase.The DNA fraction that adapter connects is as the template of LM-PCR.Carry out 25 round-robin PCR (95 ℃, 1 minute and 72 ℃, 3 minutes) and extended 15 minutes at 72 ℃.To be connected on the specificity adapter from the genomic dna of the cellular segregation of pssXD-I (contrast) or pssXD-II (DNA enzyme) transient transfection.Subsequently, use c-raf primer and Auele Specific Primer to carry out LM-PCR.As shown in figure 14, and with control plasmid pssXD-I cells transfected (swimming lane 2), or the cell of untransfected (swimming lane 3) compares, and the genomic dna of segmentization significantly increases in pssXD-II cells transfected (swimming lane 1).These results show that the increase of segment genomic dna is the result of the dna cleavage that the restraining effect of reformed c-raf genetic expression causes under being existed by the c-rafDNA enzyme.

Use the Westem engram analysis to carry out another apoptosis test, i.e. PARP breaking test.Compare with contrast (swimming lane 2-3), use the amount of pssXD-II cells transfected (swimming lane 1) total length PARP to reduce (Figure 15), but show the inhibition cell death inducing of c-raf genetic expression once more.The protein (swimming lane 1-3) of sample analog quantity on each swimming lane when in the presence of Actin muscle, measuring.

*****

Above-mentioned experiment confirm uses the polystep reaction of eucaryon RT reaction and various cDNA initiation reactions method external and the interior ssDNA of generation of body successfully to reduce the kinase whose expression of c-raf in the body.Person of skill in the art will appreciate that the present invention is not limited to this specific embodiments.For example can recognize according to the mode of concrete target and/or the effect of SOI inhibition and can use many nucleotide sequences.Equally, SOI can be positioned at one of two positions or two positions all have, for example between the IR and/or between the 3 ' end of PBS and IR.Similarly, according to the mode and/or the DNA enzyme sequence of concrete target and/or SOI effect, SOI can comprise or not comprise the DNA enzyme sequence.From the benefited carrier system that person of skill in the art will appreciate that the application of the invention of this specification sheets eukaryotic method is advanced in suitable SOI transfection and can be produced required result of treatment arbitrarily.In the mode of giving an example rather than limiting, following inhibition nucleotide sequence is well known in the art and can be used as SOI to change genetic expression according to the present invention:

The sequence of antisense oligonucleotide of serving as one or more RNA molecules of one of some Dopamine Receptorss of coding of being used for the sick treatment of Parkinson (Parkinson ' s).This antisense oligonucleotide specificity is in conjunction with the expression regulation sequence of this class RNA molecule, thus the expression of one or more Dopamine Receptors subclass of selective regulation, and alleviate the pathology symptom relevant with its expression;

Suppress the sequence that KSHV virion protein 26 is expressed, comprise and serving as, the 903 described sequences that are used for the treatment of syndromic antisense of Karposi ＇ s and/or triplex oligonucleotide as U.S. Patent number 5,856.

As U.S. Patent number 5,856,903 describedly are used to control IL-8 and/or IL-8 expression of receptor so that the control tumor growth, shift and/or oligonucleotide that the tumour medium vessels generates;

Have can with the oligonucleotide of the nucleotide base sequence of the selected sequence-specific hybridization of cytomegalovirus dna or RNA, specifically, target coding IE1, IE2, or the sequence of proteic cytomegalovirus dna of archaeal dna polymerase or RNA.Preferably have as U.S. Patent number 5,442 049 described about 5 oligonucleotide to about 50 nucleic acid base units.

Can with from read frame UL5, UL8, UL9 corresponding to herpes simplex virus type 1, UL20, UL27, UL29, UL30, UL42, the RNA of the gene of one of UL52 and IE175 or DNA specific hybrid and contain at homogeny and quantitatively be enough to influence the oligonucleotide of the nucleotide unit of this specific hybrid.Preferably can with translation initiation site, the oligonucleotide of coding region or 5 ＇ non-translational region specific hybrids.Oligonucleotide be designed to from herpes simplex virus type 1 (HSV-1), herpes simplex virus type 2 (HSV-2), cytomegalovirus, human herpes virus-6, the DNA of one of Epstein Barr virus (EBV) or varicella zoster virus (VZV), or preferred RNA specific hybrid.This class oligonucleotide is convenient and wish that conduct medicinal compositions in the acceptable carrier on medicinal provides, and as U.S. Patent number 5,514,577 is described.Person of skill in the art will appreciate that for the described specific reading frame of herpes simplex virus type 1 and can in specified other virus, find homologue.Therefore it is believed that herpes simplex virus type 2 (HSV-2), cytomegalovirus, the human herpes virus-6, each in Epstein Barr virus and the varicella zoster virus all has the proteic many similar reading frames of coding identity function.Therefore, the present invention relates to antisense oligonucleotide treatment, wherein said oligonucleotide is at any above-mentioned virus, or in fact at known any similar virus with the similar reading frame of one or more these classes later on.The present invention for convenience, all these viroids all are called simplexvirus.

Proto-oncogene, and the antisense oligonucleotide of c-myb gene particularly, as antineoplastic agent and immunosuppressor, as U.S. Patent number 5,098,890 is described.

(antisense oligonucleotide of anti-ICAM-1 genetic expression is as anti-inflammatory agent in the stimulated cells at il-1, to various diseases associated with inflammation or have the disease of struvite composition, asthma for example, rheumatoid arthritis, allograft rejection, inflammatory bowel disease, various dermatology symptoms and psoriasis have activity.In addition, ICAM-1, the inhibitor of VCAM-1 and ELAM-1 be in the flu that is caused by rhinovirus infection, AIDS, and effectively, as U.S. Patent number 5,843,738 is described in the treatment of Ka Boxishi (Kaposi ' s) sarcoma and certain cancers and transfer thereof.Equally, international application no PCT/US90/02357 discloses the dna sequence dna that coding comprises the endothelial cell adhesion molecule (ELAM) of ELAM-1 and VCAM-1 and VCAM-lb.The special expectation of the oligonucleotide of called after ISIS 1570 and ISIS 2302 is used to reduce the metastatic potential of target cell as the aim sequence in the method for the present invention.

As U.S. Patent number 5,840,867 described specificitys are in conjunction with the target molecule in the host cell, protein for example, and the protein binding type oligonucleotide (aptamers) of zymoplasm particularly.But these non-oligonucleotide target molecule bind nucleic acids (Blackwell, T.K., etc., science, 250,1104-1110 (1990); Blackwell, T.K., etc., science, 250,1149-1152 (1990); Turek, C. and L. Gold, science, 249,505-510 (1990); Joyce, G.F., gene, 82,83-87 (1989)), control this proteinic biologic activity specifically.

Although be described, person of skill in the art will appreciate that and to make some change and not change these element performance functions concrete element provided herein to reach its predetermined result's separately mode with reference to the drawings and specific embodiments provided herein.For example, sequence box as herein described is described as containing three genetic elements, i.e. aim sequence, primer binding site and series opposing tumor-necrosis factor glycoproteins, when transfection is advanced to have in the target cell of the pol gene under the control of suitable promotor, produce inhibition nucleotide sequence as herein described.Yet, person of skill in the art will appreciate that, for example, described mouse moloney leukemia virus pol gene as sequence box pol gene can with other pol gene replacement (pol gene from the human immunodeficiency virus is an above-mentioned this gene) and to use the promotor outside the CMV promotor as herein described also be useful.As mentioned above, the stem ring intermediate of formation can comprise or not comprise the restriction endonuclease site and handle its susceptibility to sex change according to the specific purposes sequence that expectation produces from intermediate to be useful.Other change that all these change and the modification of conspicuous to those skilled in the art this specification sheets by not departing from spirit of the present invention can be made will drop in the scope of following claims.

Table #1

oligodeoxynucleotide, (ODN ' s), title: 5 '-N/M, (joint) 2-H/N, 5 ' AGCTTGGTCGGCGGCCTTGAAGAGCGGCCGCACTCACGATAGAGTGGGAGATGGGC GCGAGAAAGTGCGGCC, GCTCTTCAAGGCCGCCGACCTTAATTAAGTCAGCGGGGGATCCTTTTTGGGGGCTC GTCCGGGATCGGGAGACC, CCT-3 ', title: 3 '-N/M, (joint) 2-H/N, 5 ' GGCCAGGGGTCTCCCGATCCCGGACGAGCCCCCAAAAAGGATCCCCCGCTGACTTA ATTAAGGTCGGCGGCCT, TGAAGAGCGGCCGCACTTTCTCGCGCCCATCTCCCACTCTATCGTGAGTGCGGCCG CTCTTCAAGGCCGCCGACC, A-3 ', title: 5 '-polyNM-gag joint-(Pleio)-DNAse-1023-B/P, 5 '-GAT, GTA, AG, TCG, TTG, TAG, CTA, GCC, TCC, CCT, G-3 ', title: 3 '-polyNM-gag joint-(Pleio)-DNAse-1023-B/P, 5 '-GAT, CCA, GGG, GA, GGC, TAG, CTA, CAA, CGA, CTT, ACA, TCA, T-3 ', title: 5 '-polyNM-gag joint-(hras)-DNAse-1023-B/P, 5 '-GGTGGG, CGCCTCGTTGTAGCTAGCCTCGGTGTGGG-3 ', title: 3 '-polyNM-gag joint-(hras)-DNAse-1023-B/P, 5 '-GATCCCCACACCGAGGCTAGCTACAACGAGGCGCCCACCAT-3 ', title: 5 '-polyNM-gag joint-(rafK)-DNAse-1023-B/P, 5 '-AATGCATGTCTCGTTGTAGCTAGCCCAGGCGGGA-3, title: 3 '-poJyNM-gag joint-(rafK)-DNAse-1023-B/P, 5 '-GATCTCCCGCCTGGGCTAGCTACAACGAGACATGCATTAT-3 ', title:, 5 '-polyN/M-gag joint-(tat-SIV)-DNAse-1023-B/P, 5 '-AGATGGAGACTCGTTGTAGCTAGCCCCCTTGAGGGCAGATTGGCGCCCGAACAGGG ACTTGAAGGA-3 ', title: 3 '-polyN/M-gag joint-(tat-SIV)-DNAse-1023-B/P, 5 '-GATCTCCTTCAAGTCCCTGTTCGGGCGCCAATCTGCCCTCAAGGGGGCTAGCTACA ACGAGTCTCCATCTAT-, 3 ', title: 5 '-(joint) 2-Hind/Xba, 5 '-CCG, GAT, CTA, GAC, CGC, AAG, CTT, CAC, CGC-3 ', title: 3 '-(joint) 2-Hind/Xba, 5 '-GGT, GAA, GCT, TGC, GGT, CTA, GAT-3 '

129 bases of ODN-PMMV (+) (#23)	?5′-CTAGGTCGGCGGCCGCGAAGATTGGTGCGCACACACACAACGCGCA ?CCAATCTTCGCGGCCGCCGACCCGTCAGCGGGGGTCTTTCATTTGGGGG ?CTCGTCCGGGATCGGGAGACCCCTGCCCAGGGCC-3′
129 bases of ODN-PMMV (+) (#23)		121 bases of ODN-PMMV (-) (#24)	?5′-CTGGGCAGGGGTCTCCCGATCCCGGACGAGCCCCCAAATGAAAGAC ?CCCCGCTGACGGGTCGGCGGCCGCGAAGATTGGTGCGCGTTGTGTGTGT ?GCGCACCAATCTTCGCGGCCGCCGAC-3′
57 bases of ODN-Test (+) (#38)	?5′-GGCCGGAAGATTGGGGCGCCAAAGAGTAACTCTCAAAGGCACGCGC ?CCCAATCTTCC-3′	121 bases of ODN-PMMV (-) (#24)
57 bases of ODN-Test (+) (#38)		57 bases of ODN-Test (-) (#39)	?5′-GGCCGGAAGATTGGGGCGCGTGCCTTTGAGAGTTACTCTTTGGCGC ?CCCAATCTTCC-3′
92 bases of ODN-Telo (+) (#40)	?5′-GGCCGGAAGATTGGGGCGTTAGGGTTAGGGTTAGGGTTAGGGTTAG ?GGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGCGCCCCAATCTTCC-3′	57 bases of ODN-Test (-) (#39)
92 bases of ODN-Telo (+) (#40)		92 bases of ODN-Telo (-) (#41)	?5′-GGCCGGAAGATTGGGGCGCCCTAACCCTAACCCTAACCCTAACCCT ?AACCCTAACCCTAACCCTAACCCTAACCCTAACGCCCCAATCTTCC-3′
51 bases of ODN-XB (+)	?5′-GGCCTTGAAGAGCGGCCGCACTAACACCACCACAGTGCGGCCGCTC ?TTCAA-3′	92 bases of ODN-Telo (-) (#41)
51 bases of ODN-XB (+)		51 bases of ODN-XB (-)	?5′-GGCCTTGAAGAGCGGCCGCACTGTGGTGGTGTTAGTGCGGCCGCTC ?TTCAA-3′
32 bases of ODN-RT (+) (#13)	?5′-GGGATCAGGAGCTCAGATCATGGGACCAATGG-3′	51 bases of ODN-XB (-)
32 bases of ODN-RT (+) (#13)	?5′-GGGATCAGGAGCTCAGATCATGGGACCAATGG-3′	24 bases of ODN-RT (-) (#12)	?5′-CTTGTGCACAAGCTTTGCAGGTCT-3′
18 bases of ODN-N＞S (+) (#25)	?5′-CTAGCGGCAAGCGTAGCT-3′	24 bases of ODN-RT (-) (#12)	?5′-CTTGTGCACAAGCTTTGCAGGTCT-3′
18 bases of ODN-N＞S (+) (#25)	?5′-CTAGCGGCAAGCGTAGCT-3′	10 bases of ODN-N＞S (-) (#26)	?5′-ACGCTTGCCG-3′
30 bases of ODN-Mbo (+) (#16)	?5′-CAATTAAGGAAAGCTTTGAAAAATTATGTC-3′	10 bases of ODN-N＞S (-) (#26)	?5′-ACGCTTGCCG-3′
30 bases of ODN-Mbo (+) (#16)	?5′-CAATTAAGGAAAGCTTTGAAAAATTATGTC-3′	27 bases of ODN-Mbo (-) (#33)	?5′-TAATGGCCCGGGCATAGTCGGGTAGGG-3′
43 bases of ODN-HisPro (+) (#36)	?5′-AGCTGGATCCCCCGCTCCCCACCACCACCACCACCCTGCCCCT-3′	27 bases of ODN-Mbo (-) (#33)	?5′-TAATGGCCCGGGCATAGTCGGGTAGGG-3′
43 bases of ODN-HisPro (+) (#36)	?5′-AGCTGGATCCCCCGCTCCCCACCACCACCACCACCCTGCCCCT-3′	42 base (#37 of ODN-HisPro (-)	?5′-AGCAGGGGCAGGGTGGTGGTGGTGGTGGGGAGCGGGGGATCC-3′
121 bases of ODN-Rep (+)	?5′-ATATCTATTAATTTTGGCAAATCATAGCGGTTATGCTGACTCAGGT ?GAATGCCGCGATAATTTTCAGATTGCAATCTTTCATCAATGAATTTCAG ?TGATGAATTGCCAAGATTGATGTTGC-3′	42 base (#37 of ODN-HisPro (-)	?5′-AGCAGGGGCAGGGTGGTGGTGGTGGTGGGGAGCGGGGGATCC-3′
121 bases of ODN-Rep (+)		111 bases of ODN-Rep (-)	?5′-GACGAGATCTCCTCCAGGAATTCTCGAGAATTCGGATCCCCCGCTC ?CCCACCACCACCACCACCACCCTGCCCCGCGGATGAAAAATTATGTGAG ?CAACATCAATCTTGGC-3′

1. title: 3 ＇-RT/Mol-HindIII (24-aggressiveness)

Sequence: 5 ＇-CTT GTG CAC AAG CTT TGC AGG TCT-3 ＇

2 titles: 5 ＇-RT/Mol-Sac I (32-aggressiveness)

Sequence: 5 ＇-GGG ATC AGG AGC TCA GAT CAT GGG ACC AAT GG-3 ＇

3. title: 5 ＇-Mbo II-Hind III (30-aggressiveness)

Sequence: 5 ＇-CAA TTA AGG AAA GCT TTG AAA AAT TAT GTC-3 ＇

4. title: 5 ＇-RT-Not-Mbo-joint (129-aggressiveness)

Sequence: 5 ＇-CTA GGT CGG CGG CCG CGA AGA TTG GTG CGC ACA CACACA ACG CGC ACC AAT CTT CGC GGC CGC CGA CCC GTC AGC GGGGGT CTT TCA TTT GGG GGC TCG TCC GGG ATC GGG AGA CCC CTGCCC AGG GCC

5. title: 3 ＇-RT-Not-Mbo-joint (121-aggressiveness)

Sequence: 5 ＇-CT GGG CAG GGG TCT CCC GAT CCC GGA CGA GCC CCCAAA TGA AAG ACC CCC GCT GAC GGG TCG GCG GCC GCG AAG ATTGGT GCG CGT TGT GTG TGT GCG CAC CAA TCT TCG CGG CCG CCGAC-3 ＇

6. title: 5 ＇-Nhe-Sac-joint (18-aggressiveness)

Sequence: 5 ＇-CTA GCG GCA AGC GTA GCT-3 ＇

7. title: 3 ＇-Nhe-Sac-joint (10-aggressiveness)

Sequence: 5 ＇-ACG CTT GCC G-3 ＇

8. title: 3 ＇-Mbo II-Xba I (27-aggressiveness)

Sequence: 5 ＇-TAA TGG CCC GGG CAT AGT CGG GTA GGG-3 ＇

9. title: 5 ＇-Hind-joint-Histag (43-aggressiveness)

Sequence: 5 ＇-A GCT GGA TCC CCC GCT CCC CAC CAC CAC CAC CACCCT GCC CCT-3 ＇

10. title: 3 ＇-Hind-joint-Histag (42-aggressiveness)

Sequence: 5 ＇-AGC AGG GGC AGG GTG GTG GTG GTG GTG GGG AGCGGG GGA TCC-3 '

11. title: 5 ＇-Not-joint-test 1 (57-aggressiveness)

Sequence: 5 ＇-G GCC GGA AGA TTG GGG CGC CAA AGA GTA ACT CTCAAA GGC ACG CGC CCC AAT CTT CC-3 ＇

12. title: 3 ＇-Not-joint-test 1 (57-aggressiveness)

Sequence: 5 ＇-GGC CGG AAG ATT GGG GCG CGT GCC TTT GAG AGT TACTCT TTG GCG CCC CAA TCT TCC-3 ＇

13. title: 5 ＇-Not-Mbo-joint-telo (92-aggressiveness)

Sequence: 5 ＇-GGC CGG AAG ATT GGG GCG TTA GGG TTA GGG TTA GGGTIA GGG TTA GGG TTA GGG TTA GGG TTA GGG TTA GGG TTA GGGCGC CCC AAT CTT CC-3 ＇

14. title: 3 ＇-Not-Mbo-joint-telo (92-aggressiveness)

Sequence: 5 ＇-GGC CGG AAG ATT GGG GCG CCC TAA CCC TAA CCC TAACCC TAA CCC TAA CCC TAA CCC TAA CCC TAA CCC TAA CCC TAACGC CCC AAT CTT CC-3 ＇

15.5 '-SL-joint-Fok1-RT (111-aggressiveness)

Sequence: 5 ＇-CTA GTC GGA TGC GGC CGC TGC ACA ACA ACA CAC AACACA GCG GCC GCA TCC GAT CAG CGG GGG TCT TTC ATT TGG GGGCTC GTC CGG ATC GGG AGA CCC CTG CCC AGC GCC-3 ＇

16.3 '-SL-joint-Fok1-RT (103-aggressiveness)

Sequence: 5 ＇-CTG GGC AGG GGT CIC CCG ATC CGG ACG AGC CCC CAAATG AAA GAC CCC CGC TGA TCG GAT GCG GCC GCT GTG TTG rrr GTTGTT GTG CAG CGG CCG CAT CCG A-3 ＇

17. title: XmaI-BglII-terminator 1

Sequence: 5 ＇-CCGGATCTAGACCGCAAGCTTCATTTAAA-3 ＇

18. title: XmaI-BrlII-terminator 2

Sequence: 5 ＇-GATCTTTAAATGAAGCTTGCGGTCTCGAT-3 ＇

Sequence table

Sequence Table <110> Esposito Genie Terex Corporation (INGENE, INC.) <120> with ssDNA produced by the body alters gene expression <130> INGA, 004/CIP/PCT <140> PCT/US00/27381 <141> 2000-10-04 <150> PCT/US99/23936 <151> 1999-10-12 <160> 34 <170> PatentIn Ver.2.1 <210> 1 <211> 149 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 1 agcttggtcg gcggccttga agagcggccg cactcacgat agagtgggag atgggcgcga 60 gaaagtgcgg ccgctcttca aggccgccga ccttaattaa gtcagcgggg gatccttttt 120 gggggctcgt ccgggatcgg gagacccct 149 <210> 2 <211> 149 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 2 ggccaggggt ctcccgatcc cggacgagcc cccaaaaagg atcccccgct gacttaatta 60 aggtcggcgg ccttgaagag cggccgcact ttctcgcgcc catctcccac tctatcgtga 120 gtgcggccgc tcttcaaggc cgccgacca 149 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 3 gatgtaagtc gttgtagcta gcctcccctg 30 <210> 4 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 4 gatccagggg aggctagcta caacgactta catcat 36 <210> 5 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 5 ggtgggcgcc tcgttgtagc tagcctcggt gtggg 35 <210> 6 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 6 gatccccaca ccgaggctag ctacaacgag gcgcccacca t 41 <210> 7 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 7 aatgcatgtc tcgttgtagc tagcccaggc ggga 34 <210> 8 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 8 gatctcccgc ctgggctagc tacaacgaga catgcattat 40 <210> 9 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 9 agatggagac tcgttgtagc tagccccctt gagggcagat tggcgcccga acagggactt 60 gaagga 66 <210> 10 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 10 gatctccttc aagtccctgt tcgggcgcca atctgccctc aagggggcta gctacaacga 60 gtctccatct at 72 <210> 11 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 11 ccggatctag accgcaagct tcaccgc 27 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 12 ggtgaagctt gcggtctaga t 21 <210> 13 <211> 129 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 13 ctaggtcggc ggccgcgaag attggtgcgc acacacacaa cgcgcaccaa tcttcgcggc 60 cgccgacccg tcagcggggg tctttcattt gggggctcgt ccgggatcgg gagacccctg 120 cccagggcc 129 <210> 14 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 14 ctgggcaggg gtctcccgat cccggacgag cccccaaatg aaagaccccc gctgacgggt 60 cggcggccgc gaagattggt gcgcgttgtg tgtgtgcgca ccaatcttcg cggccgccga 120 c 121 <210> 15 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 15 ggccggaaga ttggggcgcc aaagagtaac tctcaaaggc acgcgcccca atcttcc 57 <210> 16 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 16 ggccggaaga ttggggcgcg tgcctttgag agttactctt tggcgcccca atcttcc 57 <210> 17 <211> 92 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 17 ggccggaaga ttggggcgtt agggttaggg ttagggttag ggttagggtt agggttaggg 60 ttagggttag ggttagggcg ccccaatctt cc 92 <210> 18 <211> 92 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 18 ggccggaaga ttggggcgcc ctaaccctaa ccctaaccct aaccctaacc ctaaccctaa 60 ccctaaccct aaccctaacg ccccaatctt cc 92 <210> 19 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 19 ggccttgaag agcggccgca ctaacaccac cacagtgcgg ccgctcttca a 51 <210> 20 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 20 ggccttgaag agcggccgca ctgtggtggt gttagtgcgg ccgctcttca a 51 <210> 21 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 21 gggatcagga gctcagatca tgggaccaat gg 32 <210> 22 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 22 cttgtgcaca agctttgcag gtct 24 <210> 23 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 23 ctagcggcaa gcgtagct 18 <210> 24 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 24 acgcttgccg 10 <210> 25 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 25 caattaagga aagctttgaa aaattatgtc 30 <210> 26 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 26 taatggcccg ggcatagtcg ggtaggg 27 <210> 27 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 27 agctggatcc cccgctcccc accaccacca ccaccctgcc cct 43 <210> 28 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 28 agcaggggca gggtggtggt ggtggtgggg agcgggggat cc 42 <210> 29 <211> 121 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 29 atatctatta attttggcaa atcatagcgg ttatgctgac tcaggtgaat gccgcgataa 60 ttttcagatt gcaatctttc atcaatgaat ttcagtgatg aattgccaag attgatgttg 120 c 121 <210> 30 <211> 111 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic oligonucleotide <400> 30 gacgagatct cctccaggaa ttctcgagaa ttcggatccc ccgctcccca ccaccaccac 60 caccaccctg ccccgcggat gaaaaattat gtgagcaaca tcaatcttgg c 111 <210> 31 <211> 111 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Connector <400> 31 ctagtcggat caggccgctg cacaacaaca cacaacacag cggccgcatc cgatcagcgg 60 gggtctttca tttgggggct cgtccggatc gggagacccc tgcccagcgc c 111 <210> 32 <211> 103 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Connector <400> 32 ctgggcaggg gtctcccgat ccggacgagc ccccaaatga aagacccccg ctgatcggat 60 gcggccgctg tgttgtttgt tgttgtgcag cggccgcatc cga 103 <210> 33 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 33 ccggatctag accgcaagct tcatttaaa 29 <210> 34 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 34 gatctttaaa tgaagcttgc ggtctcgat 29 ...

Claims

1. change the method for the expression of endogenous nucleic acid target sequence in the target cell, comprise the steps:

To import target cell by the sequence box that the differential concatenation tumor-necrosis factor glycoproteins and the 3 ＇ primer binding sites (PBS) of aim sequence and flank thereof are formed, this aim sequence is made up of nucleotide sequence, and producing when this nucleotide sequence is designed to reverse transcription can be in conjunction with the nucleotide sequence of endogenous nucleotide sequence;

Begin the mRNA transcripton of the described sequence box of reverse transcription so that cell, discharge strand cDNA transcripton from PBS; With

This cDNA transcripton is attached on the endogenous nucleic acid target sequence to change the expression of this target sequence.

2. the method for claim 1 also comprises described target cell is advanced in reversed transcriptive enzyme/RNase gene transfection.

3. the method for claim 1 also comprises the transcripton linearizing that makes aim sequence.

4. the method for claim 3, wherein when the cDNA of aim sequence transcripton passed through the Watson-Crick base pairing formation stem ring intermediate of differential concatenation tumor-necrosis factor glycoproteins, the transcripton of aim sequence was linearized by the restriction endonuclease site that has imported in the differential concatenation tumor-necrosis factor glycoproteins.

5. the method for claim 2 comprises that also inducibility starts transcribing of pol gene.

6. the method for claim 5 wherein starts transcribing of pol gene with eukaryotic promoter.

7. the cDNA transcripton that produces by the method for claim 1.

8. a target cell has wherein changed the expression of nucleic acid target sequence according to the method for claim 1.