DD297838A5 - METHOD FOR INTRODUCING GENETIC UNITS IN THE CELL - Google Patents

Abstract

The invention relates to a genetic unit, which is optionally in multicopy form, for the inhibition of RNA. The unit contains the transcription units necessary for transcription by polymerase III, and a DNA which codes for inhibiting RNA and which is arranged within the unit in such a way that the transcribed RNA is part of the polymerase III transcript. These units can be used to achieve increased stability of the inhibiting RNA, which can be in the form of ribozymes or antisense RNAs, while there is no reduction in the activity. The invention furthermore relates to a process for introducing the genetic units into the cell, to the use of these units and to pharmaceutical formulations containing them.

Description

RNA enzymes can be constructed according to this model and have already been shown to be useful in vitro for the efficient and specific cleavage of RNA sequences (Haseloff et al., 1988).

More recently, other types of autocatalytic RNA cleavage activity that may be considered for targeted RNA inhibition have been discovered. One of these models is the so-called "hairpin" ribozyme, whose active site is derived from the minus strand of the tobacco-ringpotvirus satellite RNA (Hampel and Tritz, 1989). Further self-cleaving RNA activities are with the hepatitis delta virus Wu et al., 1989) and mRNA RNAseP (Altmann et al., 1988). The experiments preceding the work of the present invention served to compare the effect antisense RNA, antisense DNA, and ribozymes were performed using the snRNP U 7-dependent histone-premRNA processing reaction in an in vitro system that processes U7-dependent histone premRNA (Mowry et al. , 1987, Soldati et al., 1988). Antisense RNA was found to be the most potent inhibitor, with inhibition being reversible The inhibitory effects of antisense DNA and hammerhead-type ribozymes were both irreversible within the same size In each case, an approximate 10OOfacher excess compared to the substrate RNA was required for the complete inhibition.

While previous experiments on ribozymes with naked RNA were carried out in protein-free systems, preliminary experiments on the present invention were the first experiments which showed that synthetically produced ribozymes directed to a specific sequence also show a cleavage effect in a protein-containing environment. This fact provided a first indication of a potential in vivo application.

One of the limiting factors in the use of ribozymes to inhibit the expression of specific genes is believed to be in the build-up of a ribozyme concentration sufficient to effect the efficient elimination of a particular biological response; the causes for this are likely, similar to the use of antisense RNA, u. a. be located in the too low stability of the RNA.

Object of the invention

By the method according to the invention, genetic units are introduced into the cell, whereby an increased stability of the inhibiting RNA can be achieved without having to accept an impairment of their activity in terms of activity.

Explanation of the essence of the invention

The present invention has for its object to provide a system for the application of mRNA as an in vivo inhibitor of mRNA, which eliminates the existing limitations in the application of RNA by providing an effective concentration of inhibitory RNA in the cell, and a method of introducing genetic

To provide units to the cell.

This object has been achieved according to the invention by a method for introducing a genetic unit into the cell which contains the transcription units required for the transcription by polymerase III and a RNA coding for RNA function-encoding DNA which is so disordered within the genetic unit that the inhibiting RNA part of the

Polymerase III transcript.

In the solution of this problem was based on the consideration that by introducing a gene producing the inhibiting RNA to the import of the RNA as such, a considerable amplification of the RNA and thus a to

Inhibiting the biological response would ensure sufficient RNA supply.

The inhibiting RNA can be any ribozyme or other mRNA-inhibiting RNA, ζ. An antisense RNA.

In principle, it would be conceivable to efficiently transport RNA or the DNA sequence coding for it via viruses or

viral vectors, e.g. B. retroviruses perform.

However, this system has some major drawbacks, the mobilization of endogenous viruses, recombination with endogenous retroviruses, activation of endogenous genes by integration, restriction of host organism and

Tissue type.

In contrast, therefore, according to the invention carrier genes were provided which do not have these disadvantages.

The genes proposed as carrier genes for RNA genes in the context of the present invention have the following advantages: they have a compact structure, can be transported more easily into the cell because of their small size, have a high transcription rate and are not in their expression limited to certain tissues but become ubiquitous,

i.e. expressed in almost all cell types.

Another advantage of the polymerase III genes is the presence of a very strong transcription termination signal.

This will increase the likelihood that a nearby cellular gene will be undesirably activated.

significantly reduced.

The genes transcribed by the polymerase III have the following characteristics: these are genes whose promoter is not upstream of the gene but internal to the gene (Geiduschek et al., 1988). These internal control regions essential for the binding of polymerase III have a discontinuous structure; they consist of two so-called

"Boxes" (the Α-box and the B-box) that are essential for recognition by the transcription factors, as well as an intermediate gene segment that is critical in length (Hofstetter et al., 1981)

is 31-74 base pairs (Clarkson) in tRNA genes.

Representative of these genes transcribed by polymerase III are the tRNA genes, 5S RNA and a number of other small nuclear and cytoplasmic RNA genes: 7SK, 7SL, M, U6 and 4,5S RNA, as well as the adenovirus genes VA1 and VA2 (Geiduschek et al., 1988). Common to these genes is their smaller size, their compact structure, their high transcription rate and their

ubiquitous transcription.

It has surprisingly been found that with the aid of the genetic units according to the invention, an increased stability of the inhibiting RNA can be achieved without compromising their effectiveness with regard to activity

must be taken.

It has already been demonstrated by Jennings and Molloy, 1987, that a specific promoter recognized by polymerase III is suitable for directing the synthesis of antisense RNA. For this purpose, the XbaI / BamH 1 fragment of the VA1 gene, containing the promoter, was cloned in 5 'direction in front of the antisense DNA, which corresponds to the conventional principle when polymerase I1 promoters are used. The aim was to obtain a short transcript compared to polymerase II transcripts. The transcript has only a minor modification that allows base-pairing of the ends to the ends before digestion

by single-stranded exonucleases.

In contrast to this proposal, where only the promoter sequence of a specific polymerase HI gene is used (the range between F.os.-30 to 73, while the wild-type VA1 gene extends to the terminator sequence at pos. + 160- + 200 extends), according to the present invention, additionally those sequences of the polymerase III gene are used which are relevant for the secondary structure of the transcript in order to exploit them for the stabilization of the inhibitory RNA sequences. In contrast to the above-described proposal, the gene sequence coding for the inhibiting RNA is arranged within the gene transcribed by polymerase III such that according to the invention a "gene cassette"

is present. Moreover, unlike the viral VA1 gene, the carrier genes used in the present invention are non-toxic.

The transcribed from polymerase III Genn are flexible in the context of the invention. With regard to their function as carrier genes for RNA-inhibiting sequences, the following criteria must be taken into account in the selection or modification of natural or in the construction of artificial genes:

1) The A and B boxes are highly conserved.

2) A section of 5 to 7 T residues downstream of the B box is responsible for the termination of transcription.

3) The distance between A and B box can not be increased arbitrarily, the maximum is currently assumed to be about 90 bp.

4) In some systems, the 5 'flanking sequence has an influence on transcription.

5) There is evidence that an intact anticodon stem region is essential to the stability of the transcript.

Particularly suitable as carrier genes for the production of the genetic unit according to the invention are tRNA genes. The of

In addition, due to their trefoil structure, RNAs encoded by these genes are to be regarded as particularly suitable for providing stability to the inhibiting RNA. With their help, compact RNA-producing gene units can be prepared by introducing the sequence coding for the inhibiting RNA between the A and Γ blocks (FIG. 1 shows a schematic diagram of FIG

Representation of a tRNA ribozyme gene). Experiments in the context of the present invention were carried out with the starting methionine tRNA which has an Apa I Restriction site in the A- and B-block anticodon stem and loop region has (the Start methionine tRNAs of all higher eukaryotes have this restriction site in the anticodon loop). In addition to the A- and B-block region, other insertion sites are within the carrier DNA sequences

(tRNA genes or other polymerase HI genes) possible as long as it is ensured that transcriptional activity of the polymer III

and preserve the stability of the transcript.

However, the genetic units according to the invention can in principle be prepared with all tRNAs;

if necessary, a suitable restriction site can be constructed into which the inhibitory RNA coding sequence is then inserted. In the insertion, it only needs to be considered that no anticodon stem region exists

Base substitution is made of the transcription rate of the gene or the stability of the resulting tRNA

impaired (Folk et al., 1983). In addition, the fact must be taken into account that Inserts greater than 60 bp the

Transcription (Ciliberto et al., 1982). With regard to the choice of suitable carrier genes, it is in principle desirable to use species-specific tRNA genes or others of Polymerase III transcribed genes that are non-toxic to avoid. The experiments in the context of the present invention were carried out by ribozyme sequences in normal tRNA genes

were introduced. When the tRNA ribozyme transcribed from this gene is predominantly located in the cytoplasm, however, it is useful for certain applications, e.g. B. nucleus-specific RNAs, eg. For example, to inhibit those of snRNP particles, it is desirable to be able to localize the tRNA ribozyme or the tRNA ribozyme or the tRNA antisense RNA in the nucleus

Mutants are used, which are mainly located in the nucleus, z. For example, that of Zasloff et al., 1982. and Zasloff, 1983,

described met i tRNA gene having a single base exchange.

The genetic units of the invention may, for. B. be prepared as follows: A copy of the polymerase III transcribed gene, e.g. A tRNA-clone contained on a bacterial plasmid,

is incubated with a suitable restriction enzyme at the site intended for insertion, e.g. B. between the A and the

B block, cleaved and prepared by standard methods double-stranded DNA encoding the inhibitory RNA,

hineinllgiert. Thus, suitable host organisms are transformed, selected, propagated and recovered the amplified plasmid DNA. The plasmids are checked for the presence of the genetic unit according to the invention; this may be by restriction digestion, sequence analysis or by detection of a functional in vitro transcript of the plasmid DNA

respectively.

The genetic units thus obtained can be in the form of both the circular plasmid and in the form of the plasmid

excised gene unit containing all the information required for transcription by polymerase III,

to apply.

Which form is chosen depends in general on the field of application and after the introduction of the Gene unit in the cell selected transport system. The genetic units according to the invention can also be present as multiple copies (these are Tandem structures in which the genetic units are arranged several times in succession, with the inhibiting Inserts can be the same or different). Transcription of such a tandem results from the promoter contained in each individual unit Termination signals separate RNA units. Because of this property of the fragments, as each complete Transcription units, the orientation of the individual units is irrelevant to each other. In the preparation of

such tandems are based on plasmids encoding multimeric copies of those coding for the inhibitory units

Region included. Muitimere tRNA ribozyme genes containing vectors may, for. B. produced by starting from

the erbBschnitt series described in Example 1, the individual fragments are ligated to polymer using T4 DNA ligase and the polymeric genes are recloned into a corresponding restriction site of a suitable plasmid vector. The

Manufacture of such tandems is due to the small size of the units according to the invention, preferably 200 to 350 bp

is possible. With the help of such a "tandem inhibitor" can after preparation of a heteromeric complex of

Antisense RNAs or ribozymes can be tested in a single trial of the effectiveness of a set of inhibitors. To the For example, a mixture of 5 to 10 ribozymes can be introduced into a cell system in this way. After a

Since the inhibition has been made by the mixture, the individual ribozymes can be tested for their effectiveness. This is particularly advantageous due to the fact that the criteria for the selection of target RNA sequences to be inhibited

not all researched yet.

As good target sequences are ζ. For example, those regions that have no secondary structure, regions near gap signals, Regions after the initiation codon, regions without binding sites for specific proteins (such as Sm binding site in

snRNA molecules). With the aid of the present invention, in particular when used in tandem, is

allows to obtain information about such target sequences and to inhibit them efficiently in the sequence.

The application of tandem units is also beneficial when it comes to inactivating biological processes

is required, the RNA, ζ. As viral RNA, to split in several places. A multiple split can z. B. can be achieved by constructing a larger number of different ribozymes and introducing a vector containing the genetic units with the respective DNA sequences coding therefor into cells. Upon transcription of these sequences, the

Ribozyme units to the corresponding target sequences, whereby the mRNA is cleaved into fragments. Multimere copies can be used if for Wi. for certain applications, such as

the use of the transferrin-polycation transport system, larger amounts of a low molecular weight ribozyme are required. Plasmids carrying multimeric copies of the genetic unit encoding the DNA sequence encoding that ribozyme

contain, improve the production of the fragment by increasing the yield by a multiple.

Tandem units can also be used to advantage when simultaneously providing inhibiting RNAs

which are directed against different types of RNA.

When applying the invention to antisense RNA, it should be noted that the size of the insert is limited in tRNA genes. With regard to efficient transcription, the order of magnitude is about 60bp; Therefore, it will be larger at Verwondung Antisense FtNA constructs other genes transcribed from polymerase III that are transcriptional in longer sequences

have a larger capacity to be considered.

The carrier genes which can be used in the context of the invention can also be produced synthetically, provided they fulfill the condition of having the transcription units required for transcription by polymerase III. The use of such synthetic genes can have the following advantages:

a) Such genes are not recognized by aminoacylsynesms and ribosomes, thereby preventing interference with the translational machinery of the cell.

b) It is possible to produce inhibiting RNAs with greater stability and higher transcription rate than with a natural gene by creating synthetic constructs.

c) The cloning process can be made more flexible by creating synthetic sequences.

It has been found within the scope of the present invention that the stability of ribozyme tRNA molecules can be increased by extending the anticodon stem region of the carrier tDNA molecule. It has been shown that extension of the 5 base pairs anticodon stem region of the wild-type tRNA gene to 9 base pairs results in a 6-fold increased transcript over the truncated wild-type tRNA gene, indicating an increase in stability and the achievable processability can be traced back.

It has further been found that increasing the stability of the genetic units according to the invention in the form voi. tRNA ribozyme genes or tRNA antisense genes can also be achieved if the coding for the inhibitory RNA function DNA sequences as part of introns vorliegon (in the case of ribozymes referred to as "ribintrons") naturally occurring introns do not alter the secondary structure of tRNA precursor molecules and the tRNA introns show no sequence conservation, thereby minimizing and thus increasing the stability of the resulting tRNA precursor by cloning ribozyme or antisense sequences as part of introns On the basis of the tyrtRNA gene used in the context of the present invention, in which the splicing of the tRNA precursor molecules takes place only slowly, it has been shown that the use of tRNA molecules containing "ribintrone" sequences inhibits the activity of ribtRNA can be effectively increased. This makes it possible to attack RNAs that are increasingly localized in the cytoplasm. This system readily allows the incorporation of appropriate structural elements to increase the stability of the ribintrons to degradation by exonucleases, for example by additional base pairing or by larger hairpin regions contiguous to the ribozyme sequences note that the structures responsible for splicing the intron remain intact.

The natural inconsistencies can be modified, e.g. by inserting suitable restriction sites to allow cloning of oligonucleotides or, if not included in the naturally occurring gene, by insertion of nucleotides that allow base pairing with the anticodon triplet to have an additional stabilizing structural feature.

It could be shown in the context of the present invention that the expression of ribozymes as a component of introns brings substantially no impairment of the tRNA secondary structure, whereby the mtstehende transcript can be accumulated in high concentration and processed correctly. If the intron released during processing proves not to be sufficiently stable, suitable structural features can be provided to provide an increase in stability to exonuclease degradation.

To introduce the genetic units of the invention into the cell, several methods are applicable: The standard method of introducing DNA into tissue culture cells utilizes the formation of a co-precipitate between the DNA and calcium phosphate (Graham et al., 1973). The precipitate is added to cells that take up a certain proportion, possibly through a pynocytosis process. A similar method uses a positively charged material, DEAE-dextran, which facilitates the uptake of DNA by the cell. Methods have also been developed of bringing DNA into the cell by electroporation (thereby causing pores to temporarily pass through a pulsating electric field) (Langridge et al., 1987, Fromm et al., 1987). Microinjection techniques for introduction into large cells (Kressmann et al., 1980) and tissue culture cells (Pepperkok et al., 1988) are also applicable. However, these methods are only useful in the laboratory or for in vitro applications. Recently, a synthetic cationic peptide (DOTMA) has been developed that forms spontaneously with DNA liposomes

and facilitating transpiration into the cells (Felgner et al., 1987). Basically, as already mentioned, retroviral vectors are also suitable for the transfer of genetic material into the cell (Stewart et al., 1986, 1987); However, these systems have the disadvantages already mentioned.

Another transport mechanism is based on the use of "disarmed" toxins as transport vehicles The transport methods hitherto used all have the shortcoming of not being able to deliver enough inhibitory nukloic acid into the cell, by virtue of the present invention it is now due to the small size and the Due to the small size and compact structure of the genetic units of the invention, minor modification, eg, conjugation with cholesterol, lipophilic counterions, or nuclear localization peptides may also be induced on a transport system for the>> be waived.

Within the scope of the present invention, preference is given to using a soluble system for transport which proceeds via receptor-mediated endocytosis. In this case, a transferrin-polycation conjugate with the genetic unit according to the invention is particularly preferably complexed; the complex is taken up by the transferrin receptor, which is present on virtually all growing cells.

The fields of application for the present invention are numerous: z. For example, transgenic animals can be produced which, due to the presence of the genetic units of the invention in the genetic material, have intracellular immunity to viruses, e.g. Foot-and-mouth disease virus, Newcastle disease virus, bovine papillomavirus, pseudorabies or infectious gastroenteritis.

Accordingly, in transgenic plants intracellular immunity, eg. Against the potato virus PVX. Furthermore, the genetic units according to the invention can be introduced into somatic cells in order to use ribozymes or antisense RNAs directed against pathogenic viruses, such as HIV or related retroviruses, for controlling these viral pathogens.

Another area of application is in gene therapy by using RNA constructs that are complementary to oncogenes or other key genes that control cell growth and / or differentiation. In such applications, the effectively achievable by means of the present invention high specificity of RNA inhibition, by means of which z. B. a distinction between proto-oncogene and oncotranscripts is possible to bear. Further, the genetic units of the present invention can be used to prevent the expression of specific genes in plants or animals to produce desirable properties. The inhibitory effect of RNA can also be exploited in the control of diseases such that the production of undesirable gene products is suppressed, for. The production of major plaque protein or autoimmune disease-causing proteins in Alzheimer's Disease The present invention may also be used in those cases where a regulatory protein that interacts with RNA , should be turned off by addition of RNA.

Pharmaceutical preparations containing the genetic units according to the invention as an active component, for example in the form of lyophilisates, are likewise provided by the invention. Their application includes the indicated indications.

On the basis of the experiments carried out in the context of the present invention, it was possible to detect transcriptional activity of the tDNA ribozyme gene. For this purpose, a tDNA ribozyme gene construct was prepared by a coding for a 53 bp long, directed against the snRNA U 7 sequence ribozyme DNA sequence in the Apal restriction site between the A-box and the B-box of the starting methionine tDNA was inserted (the A and B boxes are the two polymerase recognition sequences; transcription begins 15 bp upstream of the Α box and ends at an oligo T sequence downstream of the B box). After microinjection of this gene, transcription was detected; the concentration of destRNA / ribozyme hybrid was 10-20% of the concentration of tRNA produced by a co-injected wild-type tRNA gene. RNA molecules synthesized in vitro by the tRNA ribozyme gene cleave the target RNA at the intended site. The addition of the tRNA structure to the ribozyme sequence does not block ribozyme activity. TRNA ribozyme molecules, synthesized from genes that have been injected into oocytes, also cleave the target RNA at the intended site and with the same efficiency as in vitro synthesized ribozymes without the additional tRNA structure. This proves that in vivo synthesis and processing of a tRNA ribozyme are not accompanied by modifications that hinder the action of the ribozyme. In the context of the present invention, the activity of a ribozyme was first detected in vivo. For this purpose, tDNA / ribozyme genes were injected together with radioactively labeled GTP into the nucleus of oocytes. After an eight hour incubation intended for ribozyme synthesis, radiolabelled substrate RNA (U 7 RNA) was injected into the cytoplasm of the oocytes. After another two hours, the nucleic acid was prepared from the oocytes: in the oocytes in which ribozyme synthesis had taken place, no remaining substrate RNA was detected. In contrast, the S'jbstrat RNA was stable in those oocytes that had not been injected with the tDNA / ribozyme gene or in which the gene had missed the nucleus.

In the context of the present invention, it has also been shown that the tDNA ribozymes according to the invention can inhibit the transforming action of an oncogene. On the basis of erythroid chicken cells transformed with the erbB oncogene, the activity of a tRNA ribozyme on the inhibition by c! - erbB expression has been demonstrated to induce differentiation of cells into erythrocytes.

The efficacy of the genetic units of the invention can also be assessed by monitoring the resistance of mouse cells to infections, for example, polyoma infections, after application of genetic units of the present invention directed against the virus (optionally against multiple regions), e.g. B. directed against the papilloma virus are checked.

embodiments

example 1

Construction of tRNA ribozyme genes

a) Construction of pSPT 18 met 1

The Xenopus methionine initiator 1-tRNA gene present on a 284 b ρ EcoRI fragment cloned into pBR322 (the Hinfl HG fragment (Hofstetter et al., 1981, Tellford et al., 1979 ), was isolated by EcoRI digestion of the pBR322 vector, purified by gel electrophoresis (2% agarose / TBE) and ligated into the EcoR 1 site of the bacterial plasmid pSPTI 8 (Boehringer Mannheim) such that upon transcription of the plasmid with SP 6 polymerase Sense-tRNA transcript was obtained using standard cloning methods described in (Maniatis) The main advantage of recloning the tRNA gene in pSPT 18 is the presence of opposing SP6 and T7 RNA polymerase promoters on the plasmid. Thus, by in vitro transcription, specific RNA transcripts containing either the tRNA hibozyme sequence or its complementary sequence can be obtained (Melton et al., 1984) .These transcripts are useful to assess the cleavage activity of the RN A molecule to test or by an "RNase Protection Mapping" the presence of tRNA ribozymes in cell extracts that express the tRNA ribozyme detect.

b) Construction of tRNA ribozyme genes

The tRNA gene ai pSPT 18met 1 was cleaved at the unique Apal site in the anticodon stem and loop region (see Figure 2). This figure shows plasmids containing the tRNA ribozyme coding sequences. pSPT 18 met 1 contains the 234 bp EcoR 1 fragment carrying the Xenopus laevis initiator tRNA gene. This is the G-H fragment (Hofstetter et al., 1981), cloned into the EcoR 1 site of the polylinker of pSPT18. The complementary oligonucleotides encoding ribosomes directed against U7snRNA (CD33 and the two sequences of erbB mRNA (ES 13, ES 53) are shown.) The cloning strategy used here resulted in the removal of the protruding ends of the Apal site in the tRNA The portion of the insert coding for the ribozyme and the regions complementary to the target RNA (anti-U7, anti-erbB) is characterized, as is the A and B box, the portion of the 5T residues (termination signal The plasmid contains the Co 1 El origin of replication, an ampicillin resistance marker and the promoters for T7 and SP6 RNA polymerase.

To prepare double-stranded synthetic DNA oligonucleotides encoding the viroid cleavage sequence (Haseloff et al., 1988) flanked by the sequences complementary to the target mRNA, single-stranded oligonucleotides were first prepared by standard methods (Applied Biosystems DNA synthesizer). complement; e oligonucleotides were phosphorylated, finnealt and ligated into the Apal digested pSPT18met 1 plasmid using standard methods (Maniatis). The ligation mixture was used to transform E. coli HP101, bacterial clones containing the new plasmid were isolated, and the presence of active ribozyme sequences on the bacterial plasmid was confirmed in two ways:

1) RNA molecules that stole from the in vitro SP6 transcription of cloned DNA plasmids were incubated with a radioactively labeled RNA containing the target sequence for the ribozyme and tested for specific cleavage of the target RNA (see FIG ).

2) The presence of correctly inserted DNA sequences was confirmed by dideoxy DNA sequencing via the insertion site.

Fig. 4 shows the in vitro ribozyme activity of tRNA ribozymes. Plasmid DNA molecules carrying the cut-tRNA ribozymes ES 13 and ES53 were digested with Pvull and transcribed with SP6 RNA polymerase. This transcription provided 230 nucleotide RNA molecules containing the tRNA ribozyme sequence and additionally the 5 'and 3' flanking sequences derived from the flanking Xenopus sequences and the flanking bacterial plasmid sequences (see Figure 2).

The ribozyme transcripts were incubated with 20000 cpm (2OfM) of an RNA molecule with the region of erbB mRNA comprising the initiation codon. The RNA molecule has the target sequences for both ES 13 and ES 53 (see Fig. 3). After 2 hours of incubation of the ribozyme plus target RNA at 37 ⁰ C in the presence of 1OmM MgCl _2, 2OmM Tris-HCl, pH 7.5 and 15OmM NaCl, the sample was fed EDTAzu a concentration of 15 mM, dried in 80% formamide / TBE solved, 30 sec. heated at 95 ⁰ C and separated on a 9.5% acrylamide / 8.3 M urea / TBE gel. After electrophoresis, the labeled were

RNA molecules detected by autoradiography.

Lane M: Molecular weight marker: pBR322 DNA cleaved with Hpall and radiolabeled using the Klunow fragment of DNA polymerase with alpha-32 P-CTP (Maniatis). The molecular weight markers were dissolved immediately before application to the gel in 80% formamide / TBE and heated at 95 ⁰ C for 3 min. The molecular weights, some of the fragments (in

Nucleotides) are shown on the left.

Lane 1: erbB target mRNA (20000 cpm, 2OfM) without incubation.

Lane 3: erbB target mRNA (20000 cpm, 2OfM) incubated with MgCl ₂ at 37 ° C without ribozymes.

Lane 4: erbB target mRNA (20000 cpm, 2OfM) incubated with ES 13 RNA (1 fM).

Lane 5: erbB target mRNA (20000 cpm, 2OfM) incubated with ES53 RNA.

To the right of the figure are the molecular weights (in nucleotides) of the erbB target mRNA and the 5 'and 3' cleavage products of both

Ribozyme cleavage reactions indicated, (see also Fig.3)

3 shows the complementarity between ribozymes and target RNAs: CD33 (A) against U7snRNA Cotten et al., 1988), ES 13 (C)

and ES53 (B) against sequences of erbBmRNA (Venustrom et al., 1980).

The tRNA portion of animal tRNA ribozymes is not shown for reasons of clarity. The cleavage sites for the ribozyme are

as well as the initiation codons of erbB mRNA.

Example 2

tRNA-ribozymii anscription in Xenopus oocytes.

Transcription of the tRN / ribozyme genes, microinjected into Xenopus oocytes, was performed according to the method described in (Kressmann et al., 1978, Hofstetter et al., 1981, Kressinann et al., 1980) for tDNA. The procedure was as follows: Stage Vl oocytes were obtained from HCG (human chorionic gonadotropin) -stimulated adult

Xenopus laevis female. The oocytes were briefly centrifuged to bring the nucleus to the edge of the oocyte. Each nucleus was injected with about 5% of a solution containing 0.3μg / μΙ of supercoiled plasmid DNA (containing the tRNA ribozyme gene of Example 1) and 2μϊϊ / μΐ of 32P-GTP. After 5 to 8 hours incubation at 20 ⁰ C the individual oocytes were injected in

1% SDS, 1 mg / ml proteinase K, 30OmM NaCl, 2OmM Tris, pH 8,2OmM EDTA (400μΙ / Οοζγΐβ) at 37 ⁰ C 45min. digested, extracted once with phenol and once with phenol / chloroform and precipitated with ethanol. The collected ethanol precipitates were dissolved formamide / TBE in 80%, briefly for the purpose of denaturation at 95 ⁰ C. and separated by electrophoresis on a 10% acrylamide / urea 8,3m / TBE gel and visualized by autoradiography. In all experiments with tRNA ribozyme genes, the injection solutions contained the wild-type metRNA gene at a concentration of ¹ A of the concentration of the tRNA ribozyme gene. TBE buffer (Tris, borate, EDTA) was prepared according to the procedure described in (Maniatis).

The result of these experiments is shown in FIG. 5:

Lane m: molecular weight marker: as in FIG. The molecular weights of some of the fragments (in nucleotides) are shown on the left in the figure. Lanes 1,2,3: The nucleic acid from single oocytes injected with the Met-tRNA gene and the MeMRNA ribozyme gene metribo 33. Right in the figure are the positions of the Met-tRNA (met, 77 nucleotides long) and the tRNA Ribozyms (met ribo), 128 nucleotides long).

Example 3

Determination of ribozyme activity of oocyte synthesized tRNA ribozyme in comparison with in vitro synthesized ribozyme which has no tRNA sequences.

An anti-U7 tRNA ribozyme synthesized in microinjected oocytes was obtained by resolution by electrophoresis, visualized by autoradiography, excised from the polyacrylamide gel, and incubated overnight in an Eppendorf Vibrator in HEP ("Heidelberg Extraction Buffer": 0.75 M ammonium acetate, 10 mM magnesium acetate, 1% IVol / v) phenol, 0.1% [w / v] SDS, O ₁ ImM EDTA.) The eluted RNA was washed once with phenol / chloroform and once with Chloroform was extracted and precipitated with ethanol in the presence of 10 μg E. coli tRNA as carrier The precipitate was picked and quantified by Cerenkov counting of 32 P mat. Using specific activity values (Kressmann et al., 1982) determined. Ooben of the tRNA-ribozyme were labeled with 32 P-labeled RNA containing the U7 sequence (lOOOOcpm / sample 1OfM plus the indicated amounts of unlabeled RNA U7) for 2 h at 37 ⁰ C in the presence of 15OmM NaCI, 1OmM MgCl ₂ and 20 mM Tris-HCl, pH 7.5. The reactions were stopped by addition of EDTA to 15 mM, the samples were dried, dissolved formamide / TBE in 80%, 95 sec at ⁰ C thirtieth heated and separated on a preheated 9.5% acrylamide / 8.3M urea / TBE gel. The radioactively labeled RNA species were visualized by autoradiography at -8O ⁰ C with a Dr. Goos .special "intensifying screen made visible.

The ribozyme CD32 was obtained by T7 polymerase transcription of a plasmid containing the insert of CD33 (see Figure 2) and cloned into the Hind III / Sal I sites of pSPT19 (Boehringer Mannheim). This transcript contains only the ribozyme sequence plus the U7 complementary sequences flanked by short segments of the vector sequence. The cleavage activity of this ribozyme was used as a comparison with the cleavage activity of the oocyte-synthesized tRNA ribozyme CD33 in order to assess the influence of the secondary structure of the tRNA and the in vivo synthesis and modification on the ribozyme activity. It was found that both ribozymes (CD32 and CD33) cleave the U7 sequence containing RNA (94 nucleotides long) into a 5 'cleavage product of 25 nucleotides and a 3' cleavage product of 69 nucleotides.

The result of these experiments is shown in FIG. 6: Tracks m; Molecular weight marker analogous to FIG Lane 1: U7 RNA (10000 cpm, 10mM) incubated without ribozyme. Lane 2: U7 RNA (10000 cpm, 10OfM) incubated with 10mM of the oocyte-synthesized tRNA ribozyme CD33 Lane 3: U7 RNA (10000 cpm, 1 pM) incubated with 10mM oocyte-synthesized tRNA ribozyme CD33. Lane 4: U7 RNA (10000 cpm, 10OfM) incubated with 10mM of in vitro T7 polymerase-synthesized ribozyme CD32. Lane 5: μ7 RNA (10000 cpm, 10OfM) incubated with 1 fM of in vitro T7 polymerase-synthesized ribozyme CD32. Example 4 Determination of cleavage of ribozyme substrate in oocytes A mixture of 32 P-GTP, anti U 7 tRNA ribozyme gene and the Met-tRNA gene were injected into oocyte nuclei. The injected Oocytes were incubated at 2O ⁰ C for 8 h as described in Example 2 to allow transcription to take place. Thereupon became

radio-labeled U7 RNA (50 nl, 10OOOcpm / μΙ, 100 μM / μΙ) was injected into the cytoplasm of the oocytes. The oocytes were then

Incubated for 2 h. The preparation of the nucleic acids from individual oocytes and their separation by gel electrophoresis were carried out as described above.

The result of these experiments is shown in FIG. Lanes m: molecular weight markers as in FIG. 5 Lane 1: Nucleic acids from an oocyte injected with the Met and Metribo genes Lanes 2 and 3: oocytes injected with Met and Metribo followed by U7 RNA injection. Lanes 4 and 5: oocytes injected with U 7 RNA only. Lane 6: An aliquot of U 7 RNA used for injection. Lane 7: U-7 RNA (1OfM), incubated with the ribozyme CD32 (1OfM) for 2 h at 37 ⁰ C in the presence of 15OmM NaCI, 1OmM MgCf ₂ and 2OmM Tris-HCl, pH 7.5. Because of the gel conditions, only the 3 'cleavage product (69 nucleotides) is shown. Example 5: Transcriptional activity of tRNA ribozymes in chicken cells Piasmide DNA molecules containing the tRNA ribozyme genes were introduced into chicken cells to monitor transcriptional activity

to determine the genes. It has been shown that the tRNA ribozyme gene (derived from a Xenopus tRNA gene) in

Chicken cells are efficiently transcribed. The procedure was as follows: 10 ^s primary chicken embryo fibroblast cells

(Zenke et al., 1988) were seeded per 10 cm dish by standard method and grown overnight. In the morning

Each dish was transfected with 10 μg of plasmid DNA (containing either erbBschnitt 13 or section 53) using the calcium phosphate co-precipitation method (Graham et al., 1973). The cells were exposed to the precipitate overnight, washed twice with fresh medium the following morning, and incubated an additional 48 hours in fresh medium. The medium was then removed, the cells were taken up in PK / SDS buffer (see above) and the nucleic acid was recovered. The nucleic acid was then subjected to "RNAse Protection Mapping" using 32 P-labeled antisense erbBschnitt 13 or erbBschnitt 53 RNA probes to detect the presence of tRNA-ribozyme transcripts Labeled RNA (10000 cpm / 10 fm antisense RNA per sample) was added to the dried ethanol precipitate, the sample was again dried and dissolved in 10 μl 80% deionized formamide, 40 mM NaCl, 20 mM PIPES, pH 6.5, 10 mM EDTA The samples were overlaid with sterile paraffin oil, heated at 95 ° C. for 3 min and In the morning, 0.3 ml of ice-cold NaCl (30 oMM), 30 mM Tris, pH 7.5.1 mM EDTA, 0.05 mg / ml RNase A and 80 units were rapidly transferred to a 45 ° C waterbath incubated overnight The samples were incubated at room temperature for 45 min, Proteinase K and SDS were added to 1 mg / ml and 0.5%, incubation at room temperature and then at 56 ° C for 20 min continued. The sample was precipitated with ethanol after addition of 10 μρ tRNA. The collected precipitate was taken up in 80% formamide / TBE and separated on a prewarmed 9.5% acrylamide / 8.3M urea / TBE gel.

The result of this experiment is shown in FIG. Traces m: molecular weight markers as in the previous examples Lane 1: antisense ES 13 probe hybridized to E. coli tRNA (10μς) Lane 2: antisense ES53 probe hybridized to E. coli tRNA Lanes 3 and 4: Mapping of the nucleic acids of 10,000 and 100,000 cells not containing plasmid DNA hybridized with the ES 13 Probe, transfected Lanes 5 and 6: Mapping of the nucleic acids of 10,000 and 100,000 cells transfected with ES 13 hybridized with the ES 13 probe. Lanes 7 and 8: Mapping of the nucleic acid from 10,000 and 100,000 cells transfected with ES53 with the ES53 probe

had been hybridized.

Example β

Weakening of the effect of the v-erb B oncogene by tDNA ribozyme genes using polylysine-transferrin conjugates

erythroblasts transformed into v-erb B were introduced.

By means of this example, it has been shown that tDNA ribozymes directed against the erb B oncogene can be expressed with the aid of Polylysine-transferrin conjugates have been introduced into erb B-transformed chicken erythroblasts and the transforming Weaken the effect of the oncogene. Preliminary test 1 Preparation of transferrin · polylysine conjugates The coupling was carried out analogously to methods known from the literature (compare G. Jung, W. Koehnlein and G. Luders, Biochem., Biophys. Res. Commun. 101 [1981], 599) by introduction of disulfide bridges after modification with succinimidylpyridyldithiopropionate. Pyridyldithiopropionate - modified transferrin 1:

6ml of Sephadex G-25 gel-filtered solution of 120mg (1.5pmol) transferrin (from egg white, Sigma, Conalbumin Type I, iron free) in 0.1M sodium phosphate buffer (pH 7.8) was added with good shaking with 200μl one 15mM ethanolic solution of succinimidylpyridyldithiopropionate (SPDP, Pharmacia) and allowed to react for 1 h at room temperature and occasionally shaking. Using a gel column (Sephadex G-25.14 mm χ 180 mm, 0.1 M sodium phosphate buffer pH 7.8), low molecular weight reaction products and reagent residues were separated to give 7 ml of the product fraction; the salary of Transfei. in bound Pyridyldithiopropionatresten was determined on the basis of an aliquot after reduction with dithiothreitol by photometric determination of the amount of released pyridine-2-thione and was about 2.6pmol.

Mercaptopropionate - modified polylysine 2:

A solution of 18mg (approximately Ι, ΟμΜοΙ) poly (L) lysine hydrobromide (Sigma, fluorescein isothiocyanate (= FITC) - labeled, molecular weight about 18,000 / corresponds to an average degree of polymerization about 90) in 3 ml of 0.1 M sodium phosphate (pH 7.8) was filtered through Sephadex G-25. The polylysine solution was diluted to 7 ml with water, added with good shaking with 270 μM of a 15 mM ethanolic solution of SPDP, and allowed to react in the dark at room temperature for 1 h with occasional shaking. After addition of 0.5 ml of sodium acetate buffer (pH 5.0), filtration was carried out on Sephadex G-25 to separate low molecular weight substances (eluent: 20 mM sodium acetate buffer pH 5.0). The product fraction (ninhydrin staining, fluorescence) was i. Vak. concentrated, brought to pH about 7 with buffer, a solution of 23mg (150μιτιοΙ) dithiothreitol in 200μΙ water was added and 1 h at room temp. allowed to stand in the dark under argon. Further gel filtration (Sephadex G-25, 14 mrr χ 130 mm column, 10 mM sodium acetate buffer pH 5.0) was separated from excess reducing agent to give 3.5 ml of product solution of fluorescence-labeled polylysine with a content of 3.8 Mol mercapto groups (photometric determination using Ellman's reagent, 5,5'-dithiobis (2-nitrobenzoic acid)).

Transferrin-polylysine Konjugate3:

The solution of modified transferrin 1 obtained as described above (7 ml in 0.1 M sodium phosphate buffer pH 7.8, about 1.5 μl of transferrin with about 2.6 μl of pyridyldithiopropionate residues) was flushed with argon; 2.0 ml of the above-described solution of mercapto-modified polylysine 2 (in 10 mM sodium acetate buffer pH 5.0, which corresponds to about Ο, βμπιοΙ poly Lysin with about 2.2 pmol mercapto groups) was added, rinsed with argon, shaken and 18h at room temperature in the dark and allowed to react under argon. The reaction mixture was diluted to 14 ml with water and separated by ion exchange chromatography (Pharmacia Mono S column HR10 / 10, ciradient elution, buffer A: 50 mM HEPES pH 7.9, buffer B: A + 3 M sodium chloride, 0.5 ml / min). , Unconjugated transferrin was initially eluted, product fractions

at about 0.66-1.5M Nntriumchlorid. Dio conjugated products (ninhydrin staining, in UV at 280nm protein absorbance, and fluorescence) were collected in 6 fractions containing approximately 10 mg transferrin each. The political groups were initially against? 10 μM iron (III) citrate solution (brought to pH 7.8 with sodium bicarbonate) and then twice more against 1 mM HEPES buffer (pH 7.5).

Sodium dodecyl sulfate gel electrophoresis (10% SDS, 8% polyacrylamide) showed approximately the same level of transferrin in all 6 fractions when pretreated with 2-mercaptoethanol, while in unreduced samples no bandon was visible for free transferrin but only less migratory conjugates.

Preliminary test 2 Transport of transferrin-polylysine conjugates into living cells To demonstrate that the transferrin-polylysine conjugates described in Preliminary Study 1 efficiently into living erythroblasts

These conjugates were labeled with FITC. It is known (Schmidt et al., 1986) that FITC-labeled

Transferrin was in vesicles after several hours of incubation with erythroblasts previously deprived of transferrin

was detectable within the cell (examination in a fluorescence microscope).

In the present example, erythroblasts (transformed by an EGF receptor retrovirus, Kahazaie et al., 1988) were used.

Incubated for 18 hours in transferrin-free differentiation medium (composition in Zenke et al., 1988) at 37 ° C (cell concentration 1.5 x 10Vml) After addition of the various transferrin-polylysine conjugates (or, as a control, the equivalent amount of sterile aq bidest) the cells at 37 ⁰ C in the presence of 10 ng / ml EGF (to the transformed

Maintain state) incubated. After 24 and 48 hours, approximately 5 × 10 ⁶ cells were removed, 1 μm in

phosphate-buffered physiological saline (PBS; pH 7.2), with the 50-fold volume of a mixture of 3.7% formaldehyde and 0.02% glutaraldehyde in PBS is fixed (10 min, 4O ⁰ C), 1 time in PBS, eingebettetund in Elvanol in Fluorescence microscope (Zeiss Axiophot, narrow-band FITC and TRITC excitation) examined. At the same time, in other aliquots of the different approaches, the growth rate of the cells was determined. For this purpose, ΊΟΟμΙ cell suspensions were taken and the incorporation of ³ H-thymidine (8pCi / ml, 2 hours) determined as described in Leutz et al., 1984. From Fig. 10, it is apparent that the erythroblasts incubated with transferrin-polylysine have 2 to 10 strongly fluorescent vesicles after 24 hours, which are undetectable in the controls. Table A shows that with the exception of fraction 6, all conjugates of

virtually all cells have been recorded.

The fact that cells grow equally fast in all samples (as by incorporation of tritiated thymidine ( ³ H TdR)

measured; Table A), proves that the cells are not damaged by the polylysine constructs and thus a

Non-specific uptake (eg via permeable cell membranes) can be ruled out.

Preliminary test 3

Polylysine transferrin constructs can functionally replace the native transferrin-iron complex in the in vitro induced maturation of chicken erythroblasts into erythrocytes.

The aim of this experiment was to show that the transferrin-polylysine conjugates used here are used by the cell as native trensferrin, ie, undergo the normal transfer cycle with similar efficiency. As a test system for this purpose, erythroblasts which can be induced to "break down" the transforming oncogene to mature into normal erythrocytes are particularly suitable (Beug et al., 1982) It is known from the literature that such cells for normal maturation have high levels of transferrin Iron complex (100-200pg / ml, 3 times lower concentrations prevent the maturation of cells and lead to death of the cells after several days [Kowenz et al., 1986]) and it has also been shown (Schmidt et al., 1986 ) that "recycling", ie reuse of transferrin receptors and thus an optimal speed transferrin cycle is essential for normal in vitro differentiation. Erythroblasts (transformed by the EGF receptor retrovirus) were induced to differentiate by withdrawal of EGF and addition of an optimal amount of partially purified chicken erythropoietin (Kowenz et al., 1986, free from transferrin). The incubation was carried out at a cell concentration of 1 x 10Vml in transferrin-free differentiation medium at 42 ⁰ C and 5% CO _2. At the start of incubation, either native transferrin-iron complex (Sigma, 100 μ / ml) or the iron-saturated transferrin-polylysine conjugates (concentration also 100 μg / ml) were added. Growth and maturation of the cells were analyzed in the following manner after 24 and 48 h:

1. Determination of the cell number (in the Coulter Counter, model ZM, Beug et al., 1984)

2. Recording cell size distributions (in Coulter-Channelyzer Mod. 256) and

3. Photometric measurement of the hemoglobin content of the cells (Kowenz et al., 1986)

In addition, aliquots of the batches were centrifuged on slides after 72 hours in a cytocentrifuge (Shandon) and subjected to histochemical detection of hemoglobin (neutral benzidine staining plus Diff-Quik rapid staining for blood cells, Beug et al., 1982).

The results in Table B clearly show that cells induced for differentiation in the presence of polylysine-transferrin conjugate fraction 1-5 mature as efficiently and at the same rate as those incubated with native transferrin-iron. The cells in the transferrin-free controls, on the other hand, showed greatly slowed cell growth and accumulated only small amounts of hemoglobin. Examination of the cell phenotype on stained cytospin preparations revealed that the cells incubated with polylysine-transferrin conjugates had matured as late as reticulocytes (late reticulocytes, Beug et al., 1982) as those treated with native transferrin, while those incubated without transferrin Cells were a mixture of disintegrated and immature, erythroblast-like, cells (Schmidt et al., 1986). Only cells treated with transferrin-polylysine fraction 6 had lower hemoglobin content and a greater percentage of immature cells (Table B). This indicates that the fraction of polylysine conjugated 6 works less well in the transferrin cycle. At the same time this result indicates the sensitivity of the test method.

Preliminary test 4

Polylysine-transferrin conjugates allow uptake of DNA into chicken erythroblasts.

In the present experiment, it should be examined whether DNA of a size corresponding to that of tDNA ribozymes (see Example 1) can be efficiently transported by transferrin-polylysine conjugateU> n into the cell interior. In the present example

was tDNA with an insert of the sequence

CGTTAACAAGCTAACGTTGAGGGGCATGATATCGGGCCCCGGGCAATTGTTCGAfTGCAACTCCCCGTACTATAGC,

Molecular weight approx. 300,000, with gamma ³² PATP endma.klert (Maniatis). Approximately 0.3 μg of this DNA, dissolved in 20 μM TE buffer, was mixed with either 10 μg native transform, with 10 μg transferrin-poly lysine conjugate fraction-3, each dissolved in 50 mM aq bidest plus 400 μg / ml bovine serum albumin (ref et al., 1982) or mixed with 50μΙ of this solvent without transferrin. The DNA-protein mixtures were added to 2 ml each of transferrin-free differentiation medium, 4 x 10 ^{e of} chicken villoutroblasts (transformed with an EGF receptor retrovirus and pre-incubated for 18 h in transferrin-free medium in the presence of EGF (Kahazaie et al , 1988) and the batches were incubated for 8 hours at 37 ^° C. and 5% CO _2, after which the cells were centrifuged off, the supernatant was removed and the cells were washed 3 times in transferrin-free medium Cell sediment and culture medium were washed in 1% SDS, 1 mg / ml proteinase K, 30OmM NaCl, 2OmM Tris pH 8,0,1OmM EDTA (PK / SDS buffer) was added, incubated at 37 ⁰ C for 30 min, phenol / chloroform extracted and the DNA isolated by ethanol precipitation. the isolated DNA with a total of 2000 cpm of radioactivity was resolved on a non-denaturing 3.5% acrylamide gel (TBE, Maniatis) and the DNA detected by autoradiography The figure shows fluorescence images of chicken erythroblasts which are 24h oh ne (A) or with / ITC-labeled transferrin-polylysine conjugates (B, C) were incubated. When excited with blue light (B, for the detection of FITC) clearly several fluorescent vesicles can be seen in each cell. The specificity of this fluorescence is evidenced by the fact that vesicle fluorescence does not occur upon excitation with green light (in which a similar nonspecific fluorescence of the cells is seen as in A) (C). This figure shows that in the transferrin-polylysine treated cell sample about 5-10 times more DMA was taken up by the cells than in the control samples with native transferrin or without transferrin. Two tRNA ribozyme genes directed against the translation initiation region of erbB were constructed (see Figures 2 and 3, Example 1). Approximately 100 μg of each plasmid containing the gene was digested with EcoRI to release the tRNA ribozyme gene on a 225bp fragment. The digestion products were end-labeled using Klenow fragments and purified by gel electrophoresis through a 2% agarose / TBE gel. The vector fragment and the tRNARibozymgen fragments were localized by ethidium bromide staining, excised and recovered by electroelution, phenol / chloroform and chloroform extraction, and ethanol precipitation. The purified, radiolabeled DNA fragments were then used to determine the uptake and inhibition of erbB RNA using the transferrin-polylysine transport system. As control DNA, the vector pSPT 18 was used.

As a test cell system, a chicken erythroblast cell line was selected which was transformed by a tempera-sensitive mutant (ts 34, Graf et al., 1978) of avian erythroblastosis virus AEV (Beug et al., 1982 b). (The above-expressed erb A oncogene in these cells can be inhibited by a specific protein kinase inhibitor | H7] It has been found that the v-erbA oncogene exists in vivo and in vitro (ie as a bacterially expressed protein) in two places, namely Ser28 and Ser29, is phosphorylated by protein kinase C or by cAMP-dependent protein kinase Mutations of these serines to alanines prevent phosphorylation and destroy v-erbA oncogene activity H7 is a specific inhibitor of these two kinases and is capable of v-erbA-v-erbB containing erythroblasts selectively abolish the changes caused by v-erbA [eg block differentiation]).

It is known that erythroblasts whose erbB oncogene is inactivated - e.g. By increasing the temperature in the case of a temperature-sensitive erb B mutant - induced to mature to erythrocytes. One of the first signs of this process is an induction of hemogiobin synthesis, which can be detected by sensitive detection (acid benzidine staining, Orkin et al., 1975, Graf et al., 19/8) at the single cell level. As a phenotypic effect of a directed against erb B ribozyme in this test system, a specific increase in the number of benzidine-positive cells would be expected.

The experimental series on which this example was based was carried out as follows: The various DNA preparations (see above and Table C), dissolved in 30 mM TE buffer, were each treated with 10 μg of native transferrin-iron complex or transferrin-polylysine conjugate (dissolved in 50 μl of a bidist .) And incubated at 37 ⁰ C for 30 min. In the case of vector DNA (10 μg), correspondingly more (100 μg) of transferrin preparations were used. The DNA-transferrin-DNA mixtures were added to 1 ml each of transferrin-free differentiation medium (Zenke et al., 1988). The test cells (per batch 3 χ 10 ^s) were incubated for 60min prior to experiment in transferrin-free differentiation medium at 42 ⁰ C, (this is the transferrin receiving amplified) and added to the DNA-transferrin-containing approaches. After 6h, 18h and 68h (treatment of cells see below) samples were taken as described, separated into supernatant and cell pellet, taken up in PK / SDS buffer and the DNA analyzed. (Figure 9) After the end of incubation (6h) the cells were spun down and incubated in transferrin-containing differentiation medium with erythropoietin and insulin (Kowenz et al., 1986, Zenke et al., 1988), 2 ml per batch and at 37 ^° C in the presence of an active v-erb B protein) was incubated for a further 72 h.

The following results were obtained:

1. Similar to pre-experiment 4, increased uptake of DNA in the size of the DNA of the DNA in the transferrin-polylysine-treated cell samples (about 5-fold) could be observed.

2. Transfection of chicken fibroblasts with DNA was shown to express the hereditary ribozyme tDNA in chicken cells (see Example 5).

3. Table Czuigt that in all cases in which erbschnitt-Ftibozym-tDNA was introduced by means of polylysine-transferrin construction in erb B transformed erythroblasts, the percentage of benzidine-positive cells significantly (to approx

Doubling) (the samples supplied with vector DNA and in which the use of polylysine-transferrin conjugates was not expected to increase the number of benzidine-positive cells served as delivery).

Example 7 Prolongation of the anticodon stem region increases the yield of ribtRNA.

The human met tRNA gene (cloned as a BamHI / Rsal fragment, supplemented by EcoRI linker, into the EcoRI site of the Bluescript vector) was cleaved at its unique Apal site in the anticodon stem region. The single-stranded overhangs were removed by T4 DNA polymerase treatment and oligonucleotides containing the ribozyme sequences inserted. The ribozyme insertion used in the previous examples resulted in a ribtRNA molecule containing a 3 base strain (Figure 11 shows the wildtype tRNAmet and the tRNArib with the truncated anticodon strain). In the second construction, an oligonucleotide differing from the first by the GGTTAT sequence complementary to the wild-type sequence at the 5'-end was used. The wild-type strain was restored and extended by 4 additional base pairs (Figure 12 shows the construction of the tRNArib with the amplified anticodon strain.) The sequence of the ribozymes is shown in Figure 13, with the differences in the left end (5 ') Nucleotide sequence between the region coding for the truncated strain and the amplified strain., Figure 13 also shows the sequence of the met tRNA gene). The two ligation products were transformed into E. coli HB101 according to the standard method described in Maniatis, suitable clones were selected, the plasmid DNA was isolated and sequenced to determine the correct structure. The two resulting ribtRNA genes were examined by microinjection of the cloned DNA into Xenopus oocytes, performed as described in Examples 2 and 3 respectively, in the presence of ³² P-GTP for transcriptional activity and accumulation of the ribtRNA molecules. The wild-type tRNA gene was coinjected at 10-fold lower concentration. The injected oocytes were incubated for 7 h at 20 ° C, the resulting RNA was harvested (see Example 2) and electrophoretically separated (10% acrylamide / 8.3 M urea / TBE gel) and the RNA molecules by autoradiography ( Exposed for 2 days at -70 ° C) (Fig. 14). The truncated rRNA gene yields about Vio of the amount of RNA transcribed from the wild-type gene, compared to the gene encoding the ribtRNA molecule with the extended strain that yields 6-fold the amount of RNA.

Example 8 Expression of ribozyme genes from introns The starting gene chosen was a Xenopus laevis tRNAtyrC gene (oocyte type), which comprises a 13-nucleotide Contains intron. The natural intron sequence was modified as follows: First, a suitable restriction site

inserted (Apal; GGGCCC) to allow subsequent cloning of oligonucleotides, secondly complementary

Nucleotides to the anticodon triplet, by extension of the intron sequence via an additional stabilizing Structural feature. The size of the intron in the modified gene is increased from 13 nucleotides to 15 nucleotides (Figure 15). The modification of the intron sequence was carried out with the aid of the polymerase chain reaction (PCR, Ho et.

at., 1989). For this, four primers were synthesized, two of which contained the altered intron sequence (to each other complementary) and two directed against the 5 'and the 3' end of the gene, respectively, to an EcoRI and Sail, respectively

Introduce restriction site. The wild-type gene was present as a Hhal fragment (258 bp), mated in pBR 327 (Stutz et al., 1989). The resulting PCR product was purified on an agarose gel, cut with the said restriction enzymes and

with the vector pAALM (= pSP64 + T7 promoter, Vieira and Messing, 1982). The construct was transformed into E. coli HB101

and clones containing the desired insert identified by sequence analysis.

The activity of the modified gene ((RNA ¹ VM) was compared to that of the wild-type gene by microinjection into Xenopus oocytes

using as internal standard a 5S RNA gene (50 fold lower concentration) co-injected on the plasmid pUC-10S template (Carroll and Brown, 1976) in the presence of ³² P-GTP. The injected oocytes were incubated at 20 ° C for 20 hours, the RNA separated on an 8% acrylamide / 8.3 M urea / TBE gel and autoradiographed (Figure 16). In addition to the 5S RNA at 120 n, the primary tRNAV transcript at 100 (102) nt, the 5 'and 3' processed precursor form at 90 (92) nt, and the fully processed tyrosine tRNA at 76nt are visible. The splicing of the 90nt precursor form appears as the limiting factor, so that most of the transcript formed (about 80%) is in this form. As expected, the

biological activity is not diminished by the modification of the wild-type gene.

In another experiment, the performance of the system was tested. There were two ribozyme sequences

containing Oligoceoxyribonukleotide synthesized that already contain Apal ends and thus could be cloned directly into the intron sequence of the modified tRNA'Y 'gene. For an oligonucleotide, 12 nt were inserted at both ends to give in

Ribintrons stable "hairpins" to form and thus counteract Exonukleasegbau.The total size of the resulting

resulting intron was 89 nt (ribozyme HP) compared to 65nt in the case of the unprotected ribozyme sequence (ribozyme C). The

Sequences of the ribozymes and the cloning scheme are shown in FIG. For the analogous to the above-described microinjections in Xenopus oocytes was described in addition to the two Constructs used a third, which contains the ribozyme HP in dimeric form, thus increasing the intron size to 163 nt

(Ribozyme D). The concentration of coinjected 5S standard was 1:20 for constructs HP and D, 1: 1 for construct C (Figure 18). The experiment shows that the constructs HP and C are transcribed very actively despite significantly increased introns and are processed with the same efficiency · We the wild-type tRNA'V gene. In the case of the construct D is only a minimal amount

Transcript detectable because apparently necessary for the formation of a Pol III transcription complex Secondary structure was destroyed by the long intron sequence. It could be shown that the expression of ribozymes as introns of tRNAs does not lead to any significant impairment

leads to the tRNA secondary structure, whereby the resulting transcript accumulates in high concentration and correct

can be processed.

Literature:

Altmann et al. (1988), Structure and Fuction of Major and Minor Small Nuclear Ribonucleoprotein Particles, publisher Birnstiel, Springer Verlag,

Berlin, 183-195

Beug et al. (1982a), J. Cell Physol. Suppl. 1,195-207 Beug et al. (1982b) Cell 28, 907-919 Beug et al. (1984), Cell 36,963-972 Caroll and Brown, (1976), Cell 7,477-486 Clliberto et al. (1982), Proc. Natl. Acad. ScI. 79.1921-1925 Clarkson, Eukaryotic Genes, Their Structure, Activity and Regulation, Editors: McLean et al., Butterworih (1983), 239-261 Colten et al. (1988), EMBO J., 7, 801-808 Felgner et al. (1987), Proc. Natl. Acad. Be. 84.7413-7417 Folk et al. (1983) Cell 33, 585-593 Fromm et al. (1987), Meth. IDs in Enzymol. 153.351-368 Geiduschek et al. (1988), Ai n. Rev. Biochem. 57.873-914 Graf et al. (1978) Nature 275,496-501 Graham et al. (1973) Virology 52,456-467 Hampel u. TriU (1989), Biochemistry 28, 49929-4933 Haseloff et al. (1988), Nature 334, 585-591 Ho et al. (1989), Gene 77: 51-59 Hofstetter et al. (1981) Cell 24,573-585 Jennings et al. (1987), EMBO J. Vol.6, 10-3043-3047 Jung et al. (1981), Biochem. Res. Commun. 101.599 Kahazaie et al. (1988), EMBO J. 10, 3061-3071 Kowenz et al. (1986), Mod. Trends In Human Leukemia VII, Springer Verlag, 199-209 Kressmann et al. (1978), Proc. Natl. Acad. Be. 75.1176-1180 Kressmann et al. (1980), Series 31,383-407 Kuo et al. (1988) J. Viral. 62.4439-4444 Langrldge et al. (1987), Methods Enzymol. 153.336-351 Leutz et al. 0984), EMBO J. 3,3191-3197 Maniatis et al. (1982), Molecular Cloning, Cold Spring Harbor Melton et al. (1984), Nucleic Acids Res. 12,7035-7056 Mowry et al. (1987), Science 238, C82-1687 Orkin et al. (1975), Proc. Natl. Acad. Be. 72.98-102 Pepperkok et al. (1988), Proc. Natl. Acad. Be. 85.6748-6752 Schmidt et al. (1986), Cell 46, 41-51 Sharmeen et al. (1988) J. Virol. 62.2674-2679 Soldati et al. (1988), MoI. Cell. Biol. 8,1518-1524 Stewart et al. (1987), EMBO J. 6,383-388 Sfitz et al. (1989), Genes & Development Vol. 3,8,1190-1198 Tellivvd et al. (1979), Proc. Acad. ScI. 76.2590-2594 Uhlenbei * et al. (1987), Nature 328, 566-600 Vennstrom ei al. (1980) J. Virol. 36.575-685 Viera and Messing, (1982), Gene 19, 259-268 Wu et al. (1989), Proc. Natl. Acad. ScI. 86.1831-1835 Zasloff et al. (1982), Nature 300, 81-84 Zaslof'et al. (1983) Proc. Acad. Be. 80.6426-6440 Zenke et al. (1988) Cell 52, 107-119

Table A Transport of poly Lysine transferrin in erythroblasts

approach medium Transferrin polyLysine FrI Vesicle fluorescence 24 h 48 h <1% Viability (3H Td R installation) 48 h 1 2 ml without addition Fr2 <1% <1% 140,000 cpm 2 2 ml 145 μΐ Η20 r3 <1% > 90% ++ 126,000 cpm 3 2 ml 145 μΐ TfpL Fr4 > 90% ⁺⁺ > 90% ++ - 137,000 cpm 4 2 ml 145 μΐ TfpL Fr5 > 90% +++ > 90% ++ ^ ^ 161,000 cpm 5 2 ml 145 μΐ TfpL Fr6, > 90% +++ > 90% ++ ^ ► 153,000 cpm 6 2 ml 145 μΐ TfpL about 80% +++ > 90% ++ h * 151,000 cpm 7 2 ml 145 μΐ TfpL about 60% +++ > 90% ++ - > 153,000 cpm 8th 2 ml 145 μΐ TfpL about 40% +++ * 165,000 cpm

++ and +++ denote the relative strength of vesicle fluorescence

Table B

PolyLysine transferrin may functionally replace normal transferrin in stimulating in vitro induced maturation of erythroblasts

No. medium additional ^ Cell number (x 106 / ml) 24 h 48 h 4.38 Hemoglobin E 492 24 h 48 h 2.74 Degree of maturation% reticulocytes 72 h 1 2 ml Fe-transferrin 3.28 2.56 1.38 0.23 > 80% 2 2 ml - 2.62 2.42 0.35 0 .. 13 <1% 3 2 ml H20 2.60 4.44 0.30 2.69 <1% 4 2 ml TfpL FrI 3.70 4.24 1.36 2.51 > 80% 5 2 ml TfpL Fr2 3.56 4.54 1.16 2.54 n.b.a 6 2 ml TfpL Fr3 3.72 4.56 1.58 2.55 > 80% 7 2 ml TfpL Fr4 3.48 4.26 1.57 2.47 n.d. 8th 2 ml TfpL Fr5 3.36 4.4 1.41 1.93 n.d. 9 2 ml TfpL Fr6 3.58 1.14 '60-65%

: not determined

Fe transferrin, 200 pg in 13 μΐ; TfpL fractions, 200 pg in 130 μΐ; Η20, 130 μΐ

Table C

Maturation (hemoglobin content) of v-erbB-transformed erythroblasts, the v-erbB ribozyme DNA

have recorded

No. kind DNA amount transferrin kind Fr5 amount Hemoglobin content (% positive after acid benzidine staining) hereditary 13 MW 1 pg tf 10 pg 14 h 62 h 1 hereditary 13 2x105 TfpL Fr5 10 pg <1 15 + -3a (3) b 2 section 53 ι pg tf 10 pg <1 37 + -4 (2) 3 section 53 2x105 TfpL Fr5 10 pg <1 25 + -2 (2) 4 vector without ribozyme 10 pg tf 100 pg <1 42 + -1 (2) 5 vector without ribozyme 2x106 10 pg TfpL Fr5 100 pg <1 23 + -3 (2) 6 hereditary 13 0.5 + 0.5 pg tf 10 pg <1 22 + -2 (2) 7 hereditary 13 + 53 s.o. 0.5 + 0.5 pg TfpL 10 pg <1 21 + -2 (2) 8th + 53 <1 38 + -2 (2)

a: For each determination> 200 cells were counted, values + - standard deviation b: number of independent determinations

Claims (22)

A method of introducing genetic units into the cell, characterized in that the genetic units are modified such that their uptake into the cell is by receptor-mediated endocytosis. 2. The method according to claim 1, characterized in that the genetic units complexed with a transferrin-polycation conjugate and the cells are brought into contact with this complex, 3. The method according to claim 1, characterized in that a genetic unit is introduced, which contains the transcription units required for the transcription by polymerase III and a DNA coding for RNA-inhibiting RNA, which is arranged within the genetic unit such that the inhibiting RNA part of the polymerase III transcript. 4. The method according to claim 3, characterized in that a genetic unit is introduced, wherein the inhibiting RNA is a ribozyme. 5. The method according to claim 4, characterized in that a genetic unit is introduced, wherein the ribozyme is of the "hammerhead" type. 6. The method according to claim 3, characterized in that a genetic unit is introduced, wherein the inhibiting RNA is an antisense RNA. 7. The method according to any one of claims 3 to 6, characterized in that a genetic unit is introduced which contains the transcription units of a tDNA gene. 8. The method according to claim 7, characterized in that a genetic unit is introduced, which contains the transcription units of an initiation Met tDNA. 9. The method according to claim 7, characterized in that a genetic unit is introduced which contains the transcription units of a tyrtDNA. 10. The method according to any one of claims 3 to 9, characterized in that a genetic unit is introduced which contains the DNA coding for the inhibiting RNA as an insert between the A block and the B block of the polymerase III transcribed gene. 11. The method according to claim 10, characterized in that a genetic unit is introduced, wherein the inhibiting RNA is a ribozyme. 12. The method according to claim 11, characterized in that a genetic unit is introduced, wherein the ribozyme is a ribozyme of the "hammerhead" type. 13. The method according to any one of claims 8, 10, 11 and 12, characterized in that a genetic unit is introduced which contains DNA coding for inhibiting RNA as an indicator in the natural Apal restriction cleavage site between A and B block. 14. The method according to claim 9, characterized in that a genetic unit is introduced which contains the coding for the inhibiting RNA oligonucleotide sequence as part of the intron. 15. The method according to any one of claims 7 to 14, characterized in that a genetic unit is introduced which contains an oligonucleotide sequence such that the anticodon stem region of the tRNA transcript is extended compared to the wild-type tRNA transcript. 16. The method according to claim 15, characterized in that a genetic unit is introduced which contains a coding for a ribozyme DNA. 17. The method according to claim 16, characterized in that a genetic unit is introduced, wherein the ribozyme is a "hammerhead" -type ribozyme. 18. The method according to any one of claims 14 to 17, characterized in that a genetic unit is introduced which contains the DNA coding for the inhibiting RNA as an ad in an artificially introduced restriction Schnittstelie. 19. The method according to any one of claims 12 to 18, characterized in that a genetic unit is introduced, wherein the intron is modified so that the secondary structure of the precursor tRNA is stabilized, whereby the relevant structures for splicing are retained. 20. The method according to any one of claims 3 to 19, characterized in that a genetich9 unit is introduced, wherein the inhibiting RNA is directed against viral RNA. 21. The method according to any one of claims 3 to 19, characterized in that a genetic unit is introduced, wherein the inhibiting RNA againstOncogene or other key genes that control the growth and / or differentiation of cells, is directed. 22. The method according to any one of claims 3 to 21, characterized in that a genetic unit is introduced, which is present as a multiple copy, wherein the same or different DNA coding for inhibiting RNA contained subunits present as complete transcription units. For this 3 pages tables, 18 pages drawings Field of application of the invention The present invention relates to specific inhibition of RNA by interaction with RNA. Characteristic of the known state of the art The specific inhibition of genes by oligonucleotides, e.g. B. in terms of a therapeutically effecting blocking of deregulated oncogenes or viral genes, based on the ability of such complementary RNA or DNA sequences, so-called "antisense oligonucleotides" to hybridize with mRNAs, processing signals or pre-mRNAs and on this way to interrupt the transfer of information from genes to proteins. The use of antisense DNA causes a degradation of complementary target RNA by RNAse Η cleavage of the resulting hybrid, the result is the irreversible destruction of the respective complementary RNA. In the case of the use of antisense RNA, there is a so-called "hybrid arrest" of translation or processing, with the RNA / RNA hybrids being the structural obstacle, it is believed that such hybrids accumulate in the cell, but their fate has not yet According to the current state of knowledge, this mechanism should essentially be a reversible event.The use of antisense RNA molecules has the advantage that these molecules can either be synthesized in vitro and incorporated into the cells, or that they can encoding genes can be introduced into the cells so that the inhibiting RNA can be produced within the cell, but so far it has not been possible to bring such genes into a form that allows the production of an effective amount of antisense RNA in the cell. Recently, a third principle of RNA inhibition has been discovered and made available for in vitro use. This principle is based on the ability of RNA molecules, the so-called "rebozymes," to recognize, bind, and cleave certain RNA sequences and was derived from in vivo observed autocatalytic cleavage reactions of RNA molecules in plant viroids and satellite RNA. Based on certain structural requirements for the ribozyme-catalyzed RNA cleavage, de novo ribozymes can now be constructed which have an In endonuclease activity directed to a specific target sequence. Since such ribozymes, which have hitherto been most thoroughly researched because of their structure called "hammerhead" ribozymes, can act on numerous different sequences, the corresponding ribozyme can be "tailor-made" for virtually any RNA substrate. This makes ribozymes interesting, highly flexible tools for the inhibition of specific genes and a promising alternative to antisense constructs which have already demonstrated potential therapeutic utility. One of the currently known, so far most thoroughly researched ribocyrin models comprises three structural domains; Based on this model, ribozymes have already been successfully constructed against the CAT mRNA (Haseloff et al., 1988, Uhlenbeck et al., 1987): The three domains include: a) a highly conserved region of nucleotides flanking the cleavage site in the S 'direction. This is usually the sequence GUC, v. Similarly, a modification in GUA or GUU showed a substantially unimpaired cleavage activity. Cleavage was also shown after the sequences CUC, to a lesser extent also for AUC and UUC (the requirements for efficient cleavage have not yet been fully elucidated). b) the highly conserved sequences contained in naturally occurring split domains of ribozymes which form a kind of base-paired stem; c) the regions flanking the cleavage site on both sides, which ensure the exact attachment of the ribozyme in relation to the cleavage site and cohesion of substrate and enzyme (in the experiments carried out so far, 8 bases were chosen on both sides).