FI105046B - Process for the preparation of a therapeutically active polypeptide, recombinant vector and host cell - Google Patents

Description

105046

METHOD FOR PREPARING A THERAPEUTIC ACTIVE POLYPEPTIDE, RECOMBINANT TACTOR AND HOST CELL

The invention relates to materials for determining the spread of hepatitis virus infection other than type A or Bs (NANBV). More particularly, it relates to a method for producing polypeptides derived from the genome of the etiological agent of NANBV, hepatitis C virus (HCV). These reagents are useful as screening agents for HCV and its infection and as protective agents against the disease.

10 The specification refers to the following publications by Ban · et al. (1986), Biotechniques 4: 428.

Botstein (1979), Gene 8:17.

Brinton, M.A. (1986), in THE VIRUSES: THE TOGAVIRIDAE AND FLAVIDRIDAE (edited by Fraenkel-Conrat and Wagner, edited by Schlesinger n and Schlesinger, Plenum Press), p. 327-374.

Broach (1981) in Molecular Biology of the Yeast Saccharomyces, Vol. 1, p.

Cold Spring Harbor Press.

Broach et al. (1983) Meth. Enz. 101: 307.

Chang et al. (1977), Nature 198: 1056.

., 20 Chirgwin et al. (1979), Biochemistry 18: 5294.

Chomczynski and Sacchi (1987), Analytical Biochemistry 162: 156.

««, ...: Clewell et al. (1969) Proc. Natl. Acad. Sci. USA 62: 1159.

• *

Clewell (1972) J. Bacteriol. 110: 667.

• ·

Cohen (1972) Proc. Natl. Acad. Sci. USA £ 9: 2110.

«25 Cousens et al. (1987), Gene 61: 265.

: De Boer et al. (1983) Proc Natl. Acad. Sci. USA 292: 128.

* φ ·; * § · Dreesman et al. (1985), J. Infect. Disease 151: 761.

*. f ·.: Feinstone, S.M. and Hoofhagle, J.H. (1984), New Engl. J. Med. 3JJ: 185.

• :: Fields & Knipe (1986), FUNDAMENTAL VIROLOGY (Raven Press, N.Y.) 30 Fiers et al. (1978), Nature 273: 113.

:. * · Gerety, R.J. et al. in VIRAL HEPATITIS AND LIVER DISEASE (Vyas, B.N.

Dienstag, J.L., and Hoofhagle, J.H., eds., Grune and Stratton, Inc., 1984). 23-47.

2 105046

Goeddel et al. (1980), Nucleic Acids Res. 8: 4057.

Graham and Van der Eb (1978), Virology 52: 546.

Grunstein and Hogness (1975), Proc. Natl. Acad. Sci. USA 73: 3961.

Grych et al. (1985), Nature 316: 74. s Gubler and Hoffman (1983), Gene 25: 263.

Hammerling et al. (1981), MONOCLONAL ANTIBODIES AND T-CELL HYBRIDO-MAS.

Han (1987), Biochemistry 26: 1617.

Helfman (1983) Proc. Natl. Acad. Sci. USA 80:31. Hess et al. (1968), J. Adv. Enzyme Reg. 7: 149.

Hinnen et al. (1978) Proc. Natl. Acad. Sci. 75: 1929.

Hitzeman et al. (1980) J. Biol. Chem. 255: 2073.

Holland et al. (1978), Biochemistry 17: 4900.

Holland (1981) J. Biol. Chem. 256: 1385. π Houghton et al. (1981), Nucleic Acids Res. Of £ 247.

Hunyh, T.V. et al. (1985), DNA CLONING TECHNIQUES; A PRACTICAL APPROACH (D. Glover, ed., IRL Press, Oxford, U.K.), p. 49-78.

Immun. Rev. (1982) 62: 185.

·. : Iwarson (1987), British Medical J. 295: 946.

=: V: 20 Kenneth et al. (1980), MONOCLONAL ANTIBODIES.

Kyte Kyte and Doolittle (1982), J. Mol. Biol. 157: 105-132.

'' Laemmli (1970), Nature 227,680.

• · * ·] · * Lee et al. (1988). Science 239: 1288.

m · ·

Maniatis, T. et al. (1982), MOLECULAR CLONING; A LABORATORY MANUAL

^ ...% 25 (Cold Spring Harbor Press, Cold Spring Harbor, N. Y.).

• · ·

Mayer and Walker, ed. (1987), IMMUNOCHEMICAL METHODS IN CELL AND

• · «MOLECULAR BIOLOGY (Academic Press, London).

• · · • · · 'Maxam et al. (1980), Methods in Enzymology 65: 499.

MacNamaraetal. (1984), Science226: 1325.

I I

'' *. 30 Messing et al. (1981), Nucleic Acids Res. 9: 309.

Messing (1983), Methods in Enzymology 101: 20-37.

METHODS IN ENZYMOLOGY (Academic Press).

3, 105046

Michelle et al., Int. Symposium on Viral Hepatitis.

Monath (1986) in THE VIRUSES: THE TOGAVIRIDAE AND FLAVTRIDAE (Saga edited by Fraenkel-Conrat and Wagner, edited by Schlesinger and Schlesinger, Plenum Press), p. 375-440.

s Nagahuma et al. (1984) Anal. Biochem. 141: 74.

Neurath et al. (1984), Science 224: 392.

Nisonoff et al. (1981) Clin. Immunol. Immunopathol. 21: 397-406.

Overby, L.R. (1985) Curr. Hepatol. 5:49.

Overby, L.R. (1986) Curr. Hepatol. 6:65. ιο Overby, L.R. (1987) Curr. Hepatol. 7:35.

Peleg (1969), Nature 221: 193.

Pferrerkom and Shapiro (1974), COMPREHENSIVE VIROLOGY, Vol.2 (Fraenkel-Conrat & Wagner, ed., Plenum, N.Y.) ss. 171-230.

Prince, A.M. (1983), Annu. Rev. Microbiol. 37: 217. is Rice et al. (1985), Science 229: 726.

Rice et al. (1986) in THE VIRUSES: THE TOGAVIRIDAE AND FLAVIRIDAE (edited by Fraenkel-Conrat and Wagner, edited by Schlesinger and Schlesinger, Plenum Press), p. 279-328.

'· · Roehrig (1986) in THE VIRUSES: THE TOGAVIRIDAE AND FLAVIRIDAE

20 (edited by Fraenkel-Conrat and Wagner, edited by Schlesinger and I · · · 'Schlesinger, Plenum Press).

Sadler et al. (1980), Gene 8,279.

• · ·

Saiki et al. (1986), Nature 324: 163.

Saiki et al. (1988), Science 239: 487.

25 Sanger et al. (1977) Proc. Natl. Acad. Sci. USA 74: 5463.

• · <v Schlesinger et al. (1986) J. Virol. 60: 1153.

/. Schreier, M., et al. (1980), HYBRIDOMA TECHNIQUES.

• ·

Scopes (1984), PROTEIN PURIFICATION, PRINCIPLES AND PRACTICE, SECOND

.;. EDITION (Springer-Verlag, N.Y.).

! '/. io Shimatake et al. (1981), Nature 292: 128.

«« ·

Steimer et al. (1986) J. Virol. 58: 9.

4, 105046

Stollar (1980), in THE TOGA VIRUSES (R.W. Schlesinger, ed., Academic Press, N.Y.), p. 584-622.

Sumiyoshi et al. (1987), Virology 161: 497.

Taylor et al. (1976) Biochem. Biophys. Acta 442: 324.

5 Towbin et al. (1979) Proc Natl. Acad. Sci. USA 76: 4350.

Tsu and Herzenberg (1980), in SELECTED METHODS IN CELLULAR IMMUNOLOGY (W.H. Freeman and Co.) ss. 373-391.

Vytdehaag et al. (1985), J. Immunol. 134: 1225.

Valenzuela, P., et al. (1982), Nature 298: 344.

to Valenzuela, P., et al. (1984), in HEPATITIS B (Millman, I., et al., Eds., Plenum Press) p. 225-236.

Warner (1984), DNA 3: 401.

Wu and Grossman (1987), Methods in Enzymology, Vol. 154, RECOMBINANT DNA,

Part E, too. Wu (1987), Methods in Enzymology, Vol. 155, RECOMBINANT DNA, Vol. F.

Zoller (1982), Nucleic Acids Res. 10: 6487.

Also referenced are the following patents: '' "EP Publication No. 318,216; PCT Publication No. WO 89/04669; U.S. Pat. Nos. 4,341,761;: X: 4,399,121; 4,427,783; 4,444,887; 4,466,917; 4,472,600;

• · I

Hepatitis other than type A and B (NANBH) is an infectious disease or family of diseases believed to be caused by a virus in the home and which is distinguishable from other viruses caused by the virus * »* • · · forms of liver disease, including those caused by known hepatitis ». ···. 25 viruses, m.p. hepatitis A virus (HAV), hepatitis B virus (HBV), and deltahepatitis virus (HDV), as well as cytomegalovirus (CMV) and Epstein-Barr virus (EBV). these hepatitis. NANBH was first identified in blood transfusion patients. Infection from humans • · «,,.,: Chimpanzees and mass infestation among chimpanzees provided evidence that the cause of NANBH • ·. . is infectious to the infectious agent (s).

«·« · X 'n • · · • ·

Epidemiological evidence suggests that there may be three types of NANBH: an epidemic type in water; blood or needle type; and 5 105046 randomly acquired (community acquired) type. However, the number of substances that can cause NANBH is unknown.

The clinical diagnosis and identification of NANBH is primarily made by excluding other viral markers. Among the methods used to detect putative ς NANBV antigens and antibodies are agar gel diffusion, counterimmunoelectrophoresis, immunofluorescence microscopy, immunoelectron microscopy, radioimmunoassay, and enzyme-linked immunosorbent assay. However, none of these assays have proven to be sufficiently sensitive, specific, and reproducible to be used as a diagnostic test for ßο NANBH.

Previously, there was no clarity or agreement on the identity or specificity of the antigen-antibody systems associated with NANBH agents. This is due, at least in part, to the presence of HBV-15 infection in humans pre- or concurrently with NANBV, and the known complexity of soluble and particulate HBV-related antigens, as well as the integration of HBV DNA into the liver cell genome. In addition, there is the possibility that NANBH is caused by more than one infectious agent, and it is possible that NANBH is misdiagnosed. It remains unclear what '' · serological assays detect in the serum of NANBH patients. It has been postulated that agargeem »20 Liquid diffusion and anti-immunoelectrophoresis assays detect autoimmune responses or« · · ·· «t ... ···. * ·· · '* non-specific protein-protein interactions between serum samples and i | And that they do not represent specific NANBV antigen-antibody reactions. Immunofluorescence and enzyme-linked immunosorbent and radioimmunoassays appear to detect low levels of rheumatoid factor-like material that is commonly present in such

S

25 patients with NANBH, as well as patients with other hepatic or non-hepatic disorders. Some observed reaction. may represent an antibody to host-defined cytoplasmic antigens.

• n

• V

f • «

There are numerous NANBV candidates. See, for example, the articles by Prince (1983), 30 Feinstone and Hoofnagle (1984) and Overby (1985, 1986, 1987) and Iwarson (1987). However, there is no evidence that any of these candidates represents the etiological agent of NANBV.

6 105046

The requirement for sensitive, specific methods for screening or identifying NANBV carriers and NANBV contaminated blood or blood products is significant. Post-transfusion hepatitis (PTH) occurs in approximately 10% of patients receiving transfusion, and up to 90% of these cases are caused by NANBH. The main problem with this disease is its normal progression to chronic liver injury (25-55%).

Patient care and prevention of NANBH infection through blood or blood products or close personal contact require reliable diagnostic and predictive tools for the detection of NANBV-related nucleic acids, antigens, and antibodies. In addition, there is a need for effective vaccines and immunotherapeutic therapeutic agents to prevent and / or treat the disease.

The Applicant has invented a novel virus, hepatitis C virus (HCV), which has been shown to be the major etiologic agent of blood-borne NANBV (BB-NANBH). The applicant's original work, including a partial genomic sequence of the prototype HCV isolate, CDC / HCV1 (also referred to as HCV1), is described in EP Publication No. 318,216 (issued May 31, 1989) and in PCT Publication No. WO 89/04669 (published 01.06.1989). For example; The contents of patent applications, as well as any similar national application, • · 20 are incorporated herein by reference. These applications teach e.g. recombinant DNA methods: · '' for cloning and expression of HCV sequences, HCV polypeptides, HCV immunodiagnostic techniques, HCV probe diagnostic techniques, anti-HCV For isolation of HCV sequences, including sequences of new HCV (II • · «isolates).

... 25 I * · »» ». ·; ·. This invention is based, in part, on novel HCV sequences and polypeptides which are not present. disclosed in EP Publication No. 318,216 or PCT Publication No. WO 89/04669. The invention allows the use of these novel sequences and polypeptides, e.g. immunodiagnostics, • «probe diagnostics, anti-HCV antibody production, PCR technology * · 30 and recombinant DNA technology. The invention also provides novel immunological methods based on the immunogenicity of the HCV polypeptides disclosed herein. The new subject matter claimed herein, although developed using techniques described in 7,105,646, e.g. 318,216, is the priority date that precedes the publication of that or any of its equivalents. Thus, the invention provides novel compositions and methods useful in screening for samples of HCV antigens and antibodies and useful in treating HCV infections. An object of the invention is a method of producing a purified polypeptide comprising an epitope encoded in the HCV cDNA wherein the HCV cDNA is the sequence designated by nucleotide numbers -319-1348 or 8659-8,866 in Figure 17.

Another object of the invention is a method of producing a peptide comprising an HCV epitope having the formula AAx-AAy.

wherein x and y represent the amino acid numbers shown in Figure 17 and wherein the peptide is selected from the group consisting of is AA1-AA50; AA1-AA84; AA9-AA177; AA50-AA100; AA40-AA90; AA65-AA75; AA99-AA120; AA95-AA110; AA100-AA150; AA150-AA200; AA200-AA250; AA220-AA240; AA245-AA265; AA250-AA300; AA290-AA330; AA290-AA305; AA300-AA350; AA310-AA330; AA350-AA400; AA405-AA495; AA400-AA450; '· AA437-AA582; AA450-AA500; AA475-AA495; AA500-AA550; AA511-AA690; 20 AA515-AA550; AA550-AA600; AA550-AA625; AA575-AA605; AA600-AA650; · *; AA600-AA625; AA635-AA665; AA650-AA700; AA645-AA680; AA700-AA750; 1. * AA700-AA725; AA725-AA775; AA770-AA790; AA750-AA800; AA800-AA815; • · * AA850-AA875; AA800-AA850; AA920-AA990; AA850-AA900; AA920-AA945; i i «AA940-AA965; AA950-AA1000; AA1000, AA1060; AA1000, AA1050; AA1025-2s AA1040; AA1075, AA1175; AA1050, AA1200; AA 1070-AA 1100; AA1100- • · # 9;. ·; ·· AA1140; ΑΛΙ 192-AA1457; AA1195-AA 1250; AA1200, AA1225; AA1225- AA1250; AA1250, AA1300; AA1260, AA1310; AA1260, AA1280; AA1266- • · f 'AA1428; AA1300, AA1350; AA1310, AA1340; AA1345, AA1405; AA1350-AA 1400; AA1365, AA1380; AA1380, AA1405; AA1400, AA1450; AA1450-

I I

30 AA1500; AA1475, AA1515; AA1475, AA1500; AA1500, AA1550; AA1515- * AA1550; AA1550, AA1600; AA1570, AA1590; AA1595, AA1610; AA1590- AA1650; AA1610, AA1645; AA1650, AA1690; AA1685, AA1770; AA1690- 8 105046 AA1720; AA1720, AA1745; AA1745, AA1770; AA1750, AA1800; AA1775- AA1810; AA1795, AA1850; AA1850, AA1900; AA1900, AA1950; AA1900- AA1920; AA1916, AA2021; AA1920, AA1940; AA1949, AA2124; AA1950- AA2000; AA1950, AA1985; AA2000, AA2050; AA2020, AA2045; AA2045- j AA2100; AA2045, AA2070; AA2054, AA2223; AA2070, AA2100; AA2100- AA2150; AA2150, AA2200; AA2200, AA2325; AA2250, AA2330; AA2265- AA2280; AA2280, AA2290; AA2287, AA2385; AA2300, AA2350; AA2350- AA2400; AA2345, AA2415; AA2345, AA2375; AA2348, AA2464; AA2370- AA2410; AA2400, AA2450; AA2400, AA2425; AA2415, AA2450; AA2445- io AA2500; AA2371, AA2502; AA2500, AA2550; AA2505, AA2540; AA2550- AA2600; AA2560, AA2580; AA2600, AA2650; AA2620, AA2650; AA2650- AA2700; AA2655, AA2670; AA2670, AA2700; AA2700, AA2750; AA2750- AA2800; AA2755, AA2780; AA2780, AA2830; AA2785, AA2810; AA2796- AA2886; AA2810, AA2825; AA2800, AA2850; AA2850, AA2900; AA2900-15 AA2950; AA2910, AA2930; AA2925, AA2950; and the AA2945 end (C'-end).

Figure 1 shows the sequence of HCV cDNA in clone 12f and the amino acids encoded therein.

Figure 2 shows the sequence of the HCV cDNA in clone k9-1 and the amino acid ·: acids encoded therein.

Figure 3 shows the sequence of the HCV cDNA in clone 15e and the amino acid encoded therein.

«« · -B

9 * · 25 son.

··· / this ' • · · "

Figure 4 shows the nucleotide sequence of HCV cDNA in clone 13i and its encoded amino acids and sequences which overlap with clone 12f.

Figure 5 shows the nucleotide sequence of HCV cDNA in clone 26j and the encoded amino acids and sequences overlapping with clone 13i.

• «·« · 9 105046

Figure 6 shows the nucleotide sequence of the HCV cDNA in clone CA59a and the amino acids and sequences assembled therein that overlap with clones 26j and K9-1.

. Figure 7 shows the nucleotide sequence of the HCV cDNA in clone CA84a and the amino acids and sequences encoded therein that overlap with clone CA59a.

Figure 8 shows the nucleotide sequence of the HCV cDNA in clone CAI 56e and the amino acids and sequences encoded therein that overlap with clone CA84a.

Figure 9 shows the nucleotide sequence of the HCV cDNA in clone CAI67b and the amino acids and sequences encoded therein that overlap with clone CAI 56e.

Figure 10 shows the nucleotide sequence of the HCV cDNA in clone CA216a and the amino acids and sequences encoded therein that overlap with clone CAI 67b.

Figure 11 shows the nucleotide sequence of HCV cDNA in clone CA290a and the amino acids encoded therein and overlap with clone CA216a.

Figure 12 shows the nucleotide sequence of HCV cDNA in clone ag30a and overlap with clone CA290a.

Figure 13 shows the nucleotide sequence of the HCV cDNA in clone CA205a and the overlap with the HCV cDNA sequence in clone CA290a.

Figure 14 shows the nucleotide sequence of HCV cDNA in clone 18g and overlapping

Sr · * * * * '25 with the HCV cDNA sequence in clone ag30a.

- · ·· v »·» • · t, ···. Figure 15 shows the nucleotide sequence of the HCV cDNA in clone 16jh, the amino acids encoded therein, and the nucleotide overlap of the HCV cDNA sequence in clone ^ e-1 «JO * * * · t • * • · * • ♦ · • · 10 105046

Fig. 16 shows the ORF of the HCV cDNA derived from the clones silica 4a, CA167b, CA156e, CA84a, CA59a, K9-1, 12f, 14i, 11b, 7f, 7e, 8h, 33c, 40b, 37b, 35, 36, 81, 32, 33b, 25c, 14c, 8f, 33f, 33g, 39c, 35f, 19g, 26g and 15e.

Figure 17 shows the sense strand of the assembled HCV cDNA sequence derived from the above clones and the assembled HCV cDNA sequence disclosed in EP Publication No. 318.216. The clones from which the sequence is derived are bl14a, 18g, ag30a, CA205a, CA290a, CA216a, pil4a, CA167b, CA156e, CA84a, CA59a, K9-1 (also called k9-1), 26j, 13i, 12f, 14i. , 11b, 7f, 7e, 8h, 33c, 40b, 37b, 35, 36, 81, 32, 33b, 25c, / o 14c, 8f, 33f, 33g, 39c, 35f, 19g, 26g, 15e, b5a and 16jh . In the figure, the three lines above the sequence indicate the position of the putative initiator methionine codon. The figure also shows the amino acid sequence of the putative polyprotein encoded in the recombinant HCV cDNA.

Figure 18 is a diagram of an immunological colony screening method used in anti-15 gene mapping studies.

Figure 19 shows the hydrophobicity profiles of the polyproteins encoded in HCV and West Nile virus.

Figure 20 is a follow-up of the hydrophilicity / hydrophobicity profile and of the putative HCV polyprotein ::: antigen index.

• ·

Figure 21 shows the surviving co-linear peptides in HCV and Flaviviruses.

• · t t i <• «» * · • *

I I I

25 I. Definitions

The term "hepatitis C virus" is reserved for a hitherto unknown etiologist of NANBV, its causative agent. Thus, as used herein, "hepatitis C virus" (HCV) refers to the causative agent of NANBV, previously referred to as NANBV and / or BB-30 NANBV. The terms HCV, NANBV and BB-NANBV are used interchangeably herein. A continuation of this terminology is called HCV-induced disease, which was previously known as NANB hepatitis (NANBH), hepatitis C. The terms NANBH and hepatitis C are used interchangeably herein.

The term "HCV", as used herein, refers to viral species which are caused by pathogenic strains. Attenuated strains or defective interfering particles derived from NANBH.

As shown below, the HCV genome consists of RNA. It is known that RNA-containing viruses have relatively high rates of spontaneous mutations, i. velocities in the order of 10 * 3 to 10 ^ nucleotides have been reported (Fields & Knipe (1986)). Therefore, among the HCV species described below, there are many strains that may be virulent or avirulent. The compositions and methods described herein allow for the proliferation, determination, detection and isolation of various HCV-10a strains or isolates. Further, the disclosure herein permits the preparation of diagnostic tools and vaccines for different strains, and also allows compositions and methods for use in screening methods for antiviral agents for pharmacological use in that they inhibit HCV replication. is.

The information provided herein, although derived from a single HCV strain or isolate, hereafter referred to as CDC / HCV1 (also referred to as HCV1), is sufficient for viral taxonomists to permit identification of other strains within the species. The information given here gives me the belief that HCV is a Flavi-like virus. The morphology and composition of Flavivirus ·: 20 particles are known and are discussed in Brinton v. (1986). In general morphology, Flaviviruses contain a central core: capsid surrounded by a bilayer lipid. Virions are spherical and have a diameter of about 40-50 nm. Their cores are about 25-30 nm in diameter. There are protrusions along the outer surface of the virion fabric that are about 5 to 10 nm long and the knobs at their ends are about 2 nm in diameter.

HCV strains and isolates are expected to contain variations in amino acids and nucleic acids. in tartaric acids compared to the prototype isolate, HCV1. Many isolates are expected to exhibit high (i.e., greater than 40%) homology in the total amino acid sequence as compared to HCV1. However, other HCV isolates with less homology can also be detected. These could be determined as HCV strains according to various criteria, such as an ORF of about 9000 nucleotides to about 12000 nucleotides encoding a poly-12105046 protein similar in size to HCV1, encoded in a polyprotein having the same hydrophobic and antigenic character as HCV1, and in the presence of co-linear peptide sequences that remain with HCV1. In addition, the genome would be positive-stranded RNA.

HCV encodes at least one epitope that is immunologically identifiable with the epitope in the HCV genome from which the cDNAs described herein are derived; preferably the epitope is included in the amino acid sequence described herein. The epitope is unique to HCV when compared to other known Flaviviruses. The uniqueness of the epitope can be determined by its immunological reactivity with antibodies against HCV and the absence of immunological reactivity with antibodies against other species of Flavi virus. Methods for determining immunological reactivity are known in the art, for example, radioimmunoassay, ELISA, hemoagglutination, and numerous examples of suitable techniques for assays are given herein. li

In addition to the foregoing, the following nucleic acid homology and amino acid homology parameters, either alone or in combination, may be used to identify the strain or isolate as HCV. Because HCV strains and isolates are related in their development, it is expected that the total homology of the genomes at the nucleotide level is likely to be about 40% or: 2 ° more, probably about 60% or more, and more likely about 80% or more; and in addition to having corresponding contiguous at least about 13 nucleotides sec; sequences. The correspondence between the putative HCV strain genome sequence and the CDC / CH1 cDNA sequence can be determined by techniques known in the art. For example, they can be determined by directly comparing the sequence information of the putative HCV polynucleotide with the HCV cDNA sequences described herein. For example, they can also be determined by hybridizing the polynucleotides under conditions that form stable duplexes between the homologous regions · · · m (e.g., the regions that would be used prior to S1 cleavage) followed by »* ♦. cleavage with single-stranded specific nucleases followed by determination of the size of the cleaved fragments.

«I

io 1 ". Due to the relationship with the development of HCV strains, putative HCV strains or isolates can be identified by their homology at the polypeptide level. In general, HCV strains 13105046 or isolates are more than about 40% homologous, probably more than about 70% homologous, and more likely more than about SO% homologous, and some may be more than about 90% homologous at the polypeptide level. Techniques. amino acid sequences for homology determination are known in the art. For example, the s amino acid sequence can be directly determined and compared to the sequences provided herein. Alternatively, the nucleotide sequence of the putative HCV genomic material can be determined (usually via a cDNA intermediate), the encoded amino acid sequence can be determined, and the corresponding regions can be compared.

As used herein, a polynucleotide "derived from" a given sequence refers to a polynucleotide sequence comprising at least about 6 nucleotides, preferably at least about 8 nucleotides, more preferably at least about 10-12 nucleotides, and more preferably at least about 15-20 nucleotides. , which corresponds to the region of the labeled nucleotide sequence. "Responsive" means homologous or complementary to a given sequence. Preferably, the sequence from which the polynucleotide is derived is homologous or complementary to a sequence unique to the HCV genome. Whether the sequence is unique to the HCV genome or not, it can be determined by techniques known to those skilled in the art. For example, the sequence may be compared to sequences in a data bank, such as Genebank, to determine whether it is present in an uninfected host or other organism. The sequence may also be compared to known sequences of other viral agents, including those known to cause hepatitis, such as HAV, HBV and HDV, and other members of the Flaviviridae family]. Match or mismatch between the deduced sequence and other sequences

• · J

can also be determined by hydration under suitable stringent conditions. Hybridization techniques for determining the complementarity of nucleic acid sequences are known in the art and are discussed below. See also, for example, Maniatis et al. (1982). In addition, duplex polynucleotides formed by hybridization are inappropriate. . Otherness can be determined by known techniques, including, for example, cleavage with a nuclease, such as S1, which specifically breaks single-stranded regions in duplex polynucleotides. The regions from which typical DNA sequences can be "deduced" include, but are not limited to, regions encoding specific epitopes and, in addition, non-transcribed and / or untranslated regions.

14 105046

The derived polynucleotide is not necessarily physically derived from the nucleotide sequence shown, but may be generated in any manner, including, for example, chemical synthesis or DNA replication or reverse transcription or transcription. In addition, combinations of regions corresponding to regions of a given sequence may be modified in ways known in the art to correspond to the intended use.

Similarly, a polypeptide or amino acid sequence "derived" from a given nucleic acid sequence refers to a polypeptide having an amino acid sequence identical to that of the β polypeptide encoded into the sequence or portion thereof, wherein the portion comprises at least 3-5 amino acids and preferably at least 8-10 amino acids and more preferably at least 11-15 amino acids or which is immunologically identifiable by the polypeptide encoded in the sequence.

The recombinant or derived polypeptide is not necessarily translated from a given nucleic acid sequence, for example the HCV cDNA sequence described herein; it may be created in any way, including, for example, chemical synthesis or expression or isolation of a recombinant expression system from mutated HCV. The recombinant or derived polypeptide may contain one or more analogs of amino acids or non-natural amino acids in its sequence. Methods for introducing amino acid analogs into a sequence:.:. · Are known in the art. It may also include one or more stamps known to the person skilled in the art.

• · • * • · · · *

The term "recombinant polynucleotide" as used herein denotes a polynucleotide derived from the genome, cDNA, of semi-synthetic or synthetic origin, which by virtue of its origin or manipulation: (1) is not related to all to the polynucleotides or portions thereof to which it is linked. in the wild; (2) is linked to a polynucleotide other than that to which it is linked • «· ....; or (3) it does not occur in nature.

.1. 30

The term "polynucleotide," as used herein, refers to the polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. This term refers to is 105046 only the primary structure of the molecule. Thus, this term includes double-stranded and single-stranded DNA as well as double-stranded and single-stranded RNA. It also includes known modified types, for example, labels known in the art, methylation, "tailing", substitution of one or more naturally occurring nucleotides with an analog, inter-nucleotide conversions such as those with uncharged linkages (e.g., methylphosphonates, phosphotriesters, phosphoamidates, carbamates, etc.) and charge-linked (e.g., phosphorothioates, phosphorodithioates, etc.) those containing dependent moieties, such as proteins (including, for example, nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.). , those having intermediate layers (e.g., acridine, psoralen, etc.), those containing chelators (e.g. metals, radioactive metals, boron, oxidizing metals, etc.), those containing alkylating agents, those having modified bonds (e.g. alpha-anomeric nucleic acids, etc.) and also unmodified forms of polynucleotides.

The term "purified viral polynucleotide" refers to the HCV genome or fragment thereof, which is substantially free, i. it contains less than about 50%, preferably less than about 70%, and more preferably less than about 90% of the polypeptides naturally associated with the viral polynucleotide. Techniques for purifying viral polynucleotides from viral particles are known in the art and include, for example, particle cleavage with a cathropic agent, differential extraction and separation of polynucleotides and polypeptides; ·: 20 ion exchange chromatography, affinity chromatography, and sedimentation according to V. 'density.

«<I

The term "purified viral polypeptide" refers to an HCV polypeptide or fragment thereof that is substantially free, i. it contains less than about 50%, preferably less than about 70%, and more preferably less than about 90% of the cellular components to which the viral polypeptide naturally attaches. Techniques for purifying viral polypeptides are known in the art and examples of these techniques are discussed below. The term "purified viral polynucleotide" refers to the HCV genome or a fragment thereof which is substantially free, containing less than about 20%, preferably less than about 50%, and more • · 30 preferably less than about 70% of the polypeptides to which the viral polynucleotide is linked in nature Viral polynucleotide purification techniques from viral particles are known in the art and include, e.g. by density by sedimentation.

"Recombinant host cells", "host cells", "cells", "cell lines", "cell cultures" and other terms designating microorganisms or higher eukaryotic cell lines cultured as single cell entities refer to cells that can be used or used in combination. It will be appreciated that a single parent cell genome may not be completely identical in morphology or genome, or may not be a complete complement of the original parent, natural, accidental, or intended mutation. as a result.

A "replicon" (Replicon) is any genetic element, for example a plasmid, chromosome, virus, cosmid, etc., that behaves autonomously as a unit of polynucleotide replication within a cell; i.e. it is capable of replication under its own control.

A "vector" is a replicon to which a second polynucleotide segment is attached to introduce replication and / or expression of the attached segment.

20 "Regulation sequence" refers to the polynucleotide sequences necessary for their v. ' providing expression of the coding sequences to which they are bound. The nature of such control sequences differs according to the host organism; in prokaryotes, such control sequences generally include a promoter, a ribosome binding site, and terminators; In eukaryotes, such control sequences generally include promoters, terminators, and, in some cases, enhancers. The term "control sequences" is intended to encompass all components whose presence is necessary for expression and may also include additional components whose presence is preferred, e.g. leader sequence.

· 30 "Functionally connected" refers to a parallel arrangement with so-called components * · /. '*: Are in a ratio that allows them to function as intended. The control sequence, which is "operably linked" to the coding sequence, is engineered such that expression of the coding sequence is achieved under conditions compatible with the control sequences.

* An "open reading frame ORF" is a region of a polynucleotide sequence that encodes a polypeptide; this region may represent part or all of the coding sequence.

An "encoding sequence" is a polynucleotide sequence that is transcribed into mRNA and / or translated into a polypeptide after being placed under control of appropriate regulatory sequences. The boundaries of the coding sequence are defined by the translation start codon at the 5 'end and the translation stop codon at the 3' end. The coding sequence may include, but is not limited to, mRNA, cDNA, and recombinant polynucleotide sequences.

"Immunologically identifiable by something / something" refers to the presence of epitopes and poly-15 peptides that are also present and unique to the given polypeptides, usually HCV proteins. Immunological identity may be determined by antibody binding and / or competition in binding; these techniques are known to one of ordinary skill in the art and are also described below.

As used herein, "epitope" refers to an antigenic determinant of a polypeptide; an epitope * · 20 could comprise three amino acids for an epitope in a unique space conformation, * f · * 'generally comprises at least five such amino acids and more commonly comprises I ·

I I

; \ at least 8-10 such amino acids. Determination of space conformation of amino acids,. methods are known in the art and include, for example, x-ray crystallography and two-dimensional nuclear magnetic resonance.

S i »25

A polypeptide is "immunologically reactive" with an antibody when it binds to an antibody by recognizing an antibody of an epitope contained in a particular polypeptide.

«: Immunological reactivity can be determined by antibody binding, more particularly by the kinetics of antibody binding and / or competition for binding using known polypeptides containing the epitope against which the antibody is directed.

• I

I I I

. ·. : Techniques for determining whether or not a polypeptide is immunologically reactive with the antibody are known in the art.

105046 As used herein, the term "immunogenic polypeptide" is a polypeptide that gives a cellular and / or fluid response, either alone or in association with a carrier in the presence or absence of an excipient.

The term "polypeptide" refers to a polymer of amino acids and does not refer to the specific length of the product; thus, peptides, oligopeptides, and proteins are included within the definition of polypeptide.

This term also does not refer to or exclude post-expression variants of polypeptides, for example, glycosylations, acetylations, phosphorylations and the like. The definition includes, for example, polypeptides containing one or more analogs of amino acids (including, for example, non-natural amino acids, etc.), polypeptides having substituted linkages and also other variants known in the art, both naturally occurring and non-naturally occurring.

"Transformation" as used herein refers to the insertion of an extrinsic polynucleotide into a host cell 15, regardless of the method used for insertion, for example, direct uptake, transduction, F-fusion or electroporation. The external polynucleotide may be considered as an non-integrated vector, for example a plasmid, or alternatively it may be integrated into the host genome.

% '- "' 20" Treatment "as used herein refers to prevention and / or therapy.

«· * ·» • · ·; "Individual" as used herein refers to vertebrates, especially members of the mammalian species, and includes, but is not limited to, domestic animals, sports animals, and primates, including humans.

• · «• · • * * · * * • · ·

I I I

As used herein, the "sense strand" of a nucleic acid contains a sequence having the sequence homo · · · · logic with the sequence of the mRNA. The "antisense strand" contains a sequence complementary to the "sense" strand.

As used herein, the "positive strand genome" of a virus is one in which the genome, either · 30 RNA or DNA, is single-stranded and encodes viral polypeptides. Examples of positive * RNA viruses include the Togaviridae, the Coronaviridae, the Retroviridae, the Picorotes, and the Caliciviridae. Also included are Flaviviridae, previously classified as Togaviridae. See Fields & Knipe (1986).

As used herein, "antibody-containing muscle portion" refers to the portion of an individual's body that is the source of the antibodies in question. Antibody-containing body parts are known in the art and include, but are not limited to, plasma, serum, cerebrospinal fluid, lymphatic, respiratory, gastrointestinal, and genitourinary external components, tears, saliva, milk, white blood cells, and myelomas.

As used herein, "purified HCV" refers to an HCV preparation isolated from the cellular parts normally associated with the virus and other types of virus that may be present in the infected tissue. Techniques for isolating viruses are known to those skilled in the art and include, for example, centrifugation and affinity chromatography; the method for preparing purified HCV is discussed below.

li

The term "HCV particles" as used herein includes the entire virion and also particles that are intermediates in virion formation. HCV particles generally contain one or more HCV proteins associated with HCV nucleic acid.

As used herein, "probe" refers to a polynucleotide that forms a hybrid structure with the target region due to the complementarity of at least one sequence in the probe with the target region sequence. However, the probe does not contain the sequence, which is complementary to the sequences used to initiate the polymerase chain reaction.

• * · • · • i

• «I

»♦ ·» · * 25 As used herein, the term "target region" refers to a region of a nucleic acid to be amplified and / or detected.

(: As used herein, the term "viral RNA" containing HCV RNA refers to RNA from the viral «i * t * genome, its fragments, its transcripts and derived mutant sequences.

.1. already from vens.

As used herein, "biological sample" refers to a tissue or fluid sample isolated from an individual, including plasma, serum, spinal fluid, lymph, skin, respiratory tract, gastrointestinal tract, and exogenous parts of the genitourinary tract, tears, saliva, milk, blood cells, tumors, organs and also specimens of in vitro cell culture media (including but not limited to reconstituted culture medium resulting from cell growth in cell culture medium, , recombinant cells and cellular components).

II. DESCRIPTION OF THE INVENTION The practice of this invention employs, unless otherwise stated, conventional techniques in molecular biology, microbiology, recombinant DNA technology and immunology, which are well known in the art. Such techniques are fully explored in the scam. See, for example, Maniatis, Fitsch & Sambrook, MOLECULAR CLONING; A LABORATORY MANUAL (1982); DNA CLONING, VOLUMES I AND ((D.N. Glover ed. 1985); OLIGONUCLEOTIDE SYNTHESIS (M. J. Gait ed. 1984); NUCLEIC ACID HYBRIDIZATION (B.D. Hames & S.J. Higgins Ed. 1984); ANIMAL CELL CULTURE (R.I. Freshney ed. 1986); IMMOBOLIZED CELLS AND ENZYMES (IRL Press, 1986); B.Perbal, A PRACTICAL GUIDE TO MOLECULAR CLONING ·. : (1984); Saija, METHODS IN ENZYMOLOGY (Academic Press, Inc.); GENE TRANS-FER VECTORS FOR MAMMALIAN CELLS (J.H. Miller and M.P.Calos ed. 1987, Cold i. Spring Spring Laboratory), Methods in Enzymology Vol. 154 and Vol. 155 (Wu and

Grossman, and Wu, eds.), Mayer and Walker, eds. (1987), IM-MUNOCHEMICAL METHODS IN CELL AND MOLECULAR BIOLOGY (Academis • · ·

Press, London), Scopes, (1987), PROTEIN PURIFICATION: PRINCIPLES AND PRAC-25 TICE, Second Edition (Springer-Verlag, N.Y.), and HANDBOOK OF EXPERIMENTAL

IMMUNOLOGY, VOLUMES I-IV (D.M.Weir and C.C. Blackwell eds. 1986). All patents, exams, patent applications, and publications cited herein, both above and below, are incorporated by reference herein.

(I

«• · · • ·. Useful materials and methods of the present invention allow closely related homologous nucleotide sequences isolated from cDNA libraries containing HCV cDNA sequences. These cDNA libraries were derived from the nucleic acid sequences of the infected chimpanzee 21105046. The structure of one of these libraries, the "c" library (ATCC No. 40394), was reported in EP Publication No. 318.216. Numerous clones containing the HCV cDNA reported herein were obtained from the "c" library. While others here. reported clones were obtained from other HCV cDNA libraries, the presence of clones containing j sequences in the "c" library was confirmed. As discussed in EP Publication No. 318,216, the family of HCV cDNA sequences isolated from the "c" libraries is not of human or chimpanzee origin and does not show any significant homology with the sequences contained in the HBV genome.

The availability of the HCV cDNAs described herein permits the construction of polynucleotide probes that are reagents useful for detecting viral polynucleotides, including donated blood. For example, it is possible to synthesize DNA oligomers of about 8-10 nucleotides or larger from the sequences, which are useful as hybridization probes for detecting HCV RNA, for example in donated blood, in sera of subjects suspected of carrying the virus or cell culture systems in which the virus replicated. In addition, cDNA sequences also allow the design and production of HCV-specific polypeptides useful as diagnostic reagents for the presence of antibodies generated during HCV infection. Antibodies to purified polypeptides derived from cDNA can also be used to: .v 20 detect viral antigens in biological samples, including, for example: donated blood samples, serum from patients with NANBH, and tissue culture systems. 'Systems used to replicate HCV. In addition, the immunogenic «· ·, 1,1 polypeptides disclosed herein encoded in the ORF portions of the HCV cDNA shown in Figure 17 are also useful for screening, diagnosing and treating HCV and for the detection of such antibodies. which are useful for these purposes.

• · · »

• M

• · *. In addition, the novel cDNA sequences described herein allow for additional mapping of the HCV genome. Polynucleotide probes and primers derived from these sequences can be used to amplify sequences present in cDNA libraries and / or screen 30 cDNA libraries for additional cDNA sequences. which, in turn, can be used to obtain an overlap of overlapping sequences. As mentioned below and in EP-A-318,216, the HCV 22 105046 genome appears to be RNA, which consists primarily of a large open reading frame (ORF) encoding a large polyprotein.

HCV cDNA sequences provided herein, polypeptides derived from these 's sequences, and immunogenic polypeptides described herein, as well as antibodies directed against these polypeptides, are also useful in the production of NABV (BB-NANBV) ) in isolation and identification. For example, antibodies directed against HCV epitopes contained in polypeptides derived from cDNA can be used in methods based on affinity romatography to isolate the virus. Alternatively, the antibodies may be used to identify virus particles isolated by other techniques. The viral antigens and genomic material in the isolated virus particles can then be further characterized.

In addition to the above, the information given below permits the identification of additional HCV strains or isolates. Isolation and determination of additional HCV strains or isolates can be accomplished by isolating nucleic acids from parts of the body containing viral particles and / or viral RNA, creating cDNA libraries using polynucleotide probes based on the HCV cDNA probes described below, by screening for them. just in case, '. · Containing the HCV cDNA sequences described below and comparing the HCV • · ::: 20 cDNAs from the new isolates with the cDNAs described below. The polypeptides encoded therein or in the viral genome can be monitored for immunological cross-reactivity using the polypeptides and antibodies described above. Strains or isolates that fit the HCV parameters as described in the assay section above are readily identifiable. Other methods for identifying HCV strains will be apparent to those skilled in the art based upon the information provided herein.

• «· • · ·

Ml • · · * «·. Isolation of HCV cDNA Sequences «« · t («· I« «

The novel HCV cDNA sequences, described below, expand the HCV-1 · 30 genome of the cDNA sequence reported in EP no. 318.216. Sequences present in cloning · · · neissabll4a, 18g, ag30a, CA205a, CA290a, CA216a, pil4a, CA167b, CA156e, CA84, and CA59a, when assembled, give the recombinant HCV nucleotide 23105046 cDNA 319-1348. (The negative number of the nucleotide denotes its distance upstream of the nucleotide, which initiates the putative initiator-MET codon.) The sequences present in clones b5a and 16jh are downstream of the reported sequence. and give the recombinant sequence nucleotides 8659-8866. The recombinant HCV cDNA sequence containing the sequences in the above clones is shown in Figure 17.

The novel HCV cDNAs described herein were isolated from numerous HCV cDNA libraries, including the "c" library contained in lambda gtll (ATCC No. 40394). HCV cDNA libraries were constructed using stored serum from a chimpanzee with chronic HCV infection and containing a high viral titer, m.p. at least 106 chimpanzee infections / ml (CID / ml). Stored serum was used to isolate virus particles; nucleic acids isolated from these particles were used as a template for constructing the cDNA library on the viral genome. Methods for isolating putative HCV particles and constructing the HCV cDNA repository "c" are described in EP Publication No. 318.216. Other methods for constructing is HCV cDNA libraries are known in the art and some of these methods are described below in the Examples. Sequence isolation was performed by screening libraries using synthetic polynucleotide probes whose sequences were derived from the 5 'and 3' regions of the known HCV cDNA sequence. Description of the Method cDNA-; ; obtaining sequences is mostly historically interesting. The resulting v .: 20 sequences (and their complement) are given herein and the sequences or any part thereof could be prepared using synthetic methods or a combination of synthetic methods, obtaining partial sequences using methods similar to? which are described herein.

Preparation of Viral Polypeptide ia Fragments • »i • • · · • * *. The availability of cDNA sequences or nucleotide sequences derived therefrom (including sequence · · ·, · segments and variants) permits the construction of expression vectors,.;. which encode a polypeptide encoded on either strand antigenically ac- <! '. 30 dense areas. These antigenically active regions may be derived from envelope or envelope antigens or core antigens or nonstructural antigens including, for example, polynucleotide binding proteins, polynucleotide polymerases, and other viral particles and replicas / viral particles required for viral particle or replication. Fragments encoding the desired polypeptides are derived from cDNA clones by conventional restriction digestion or by synthetic methods and inserted into vectors which may, for example, contain portions of the filament sequences such as betagalactosidase or s superoxide dismutase (SOD), preferably S. Methods and vectors useful for producing polypeptides containing SOD fusion sequences are described in EP 0196056, published October 1, 1986. Vectors for expressing SOD fusion polypeptides and HCV polypeptides which are encoded in numerous HCV clones are described below in the Examples. ίο Any portion of the HCV cDNA containing an open reading frame in either of the sense strands can be obtained as a recombinant polypeptide, such as a mature or fusion protein; alternatively, the polypeptide encoded by the cDNA may be obtained by chemical synthesis.

The DNA encoding the desired polypeptide, either in fused or mature form and containing the signal sequence to allow secretion or absence, may be inserted into Express express vectors suitable for any suitable host. Both eukaryotic and prokaryotic host systems are currently used to construct recombinant polypeptides, and a summary of some of the more commonly used control systems and host cell lines • · f .::: 20 is given below. The polypeptide is then isolated from lysed cells or culture medium and:. cleaned to the extent necessary for its intended use. Purification can be accomplished by techniques known in the art, for example, differential extraction, salt fractionation, ion exchange resin chromatography, affinity chromatography, centrifugation, and the like. See, for example, Methods in Enzymology for numerous methods of purifying proteins. Such polypeptides can be used as diagnostic tools or those that generate neutralizing antibodies can be formulated as vaccines.

• · ·. Antibodies raised against these polypeptides can also be used in diagnostics I · · • * ·, and in passive immunotherapy. In addition, as discussed below, antibodies to these polypeptides are useful for the isolation and identification of HCV particles.

i I.

\: 30 4 · 25 105046

Preparation and Conjugation of Antigenic Polypeptides with a Carrier

The antigenic region of a polypeptide is generally relatively small - typically 8- to 10 amino acids in length or less. Fragments of as few as 5 amino acids can characterize the antigenic region. These segments may correspond to regions of the HCV antigen. Thus, using HCV cDNAs as a template, DNAs encoding short segments of HCV polypeptides can be expressed in combination either as fusion proteins or as isolated polypeptides. In addition, short amino acid sequences may be conveniently obtained by chemical synthesis. For example, where the synthesized polypeptide is properly formulated to provide the correct epitope but is too small to be immunogenic, the polypeptide may be attached to a suitable carrier.

Numerous techniques for obtaining such a linkage are known in the art, including the formation of disulfide bonds using N-succinimidyl-3- (2-pyridylthio) propionate (SPDP) and succinimidyl 4- (N-maleic imidomethyl) cyclohexane-1-carboxylate (SMCC). available from the Pierce Company, Rockford, Illinois (if the peptide does not have a sulfhydryl group, it may be provided by the addition of a cysteine residue). These reagents create a disulfide bond between themselves and the cysteine residue of the peptide in one protein and an amide linkage via the lysine epsilonamino or other free amino group in the other group. Numerous such disulfide / amide forming agents are known.

l .:: 20 See, for example, Immun. Rev. (1982) £ 2: 185. Other double-acting coupling agents form: thioether rather than disulfide bonds. Many of these thioethers are | of the delivery agents are commercially available and include 6-maleimidocaproic acid, 2-bromoacetic acid, 2-iodoacetic acid, 4- (N-maleic imidomethyl) cyclohexane-1-carboxylic acid and the like. reactive esters of such. The carboxyl groups can be activated by combining them with succinimide or the sodium salt of 1-hydroxyl-2-nitro-4-sulfonic acid. Additional methods for linking antigens utilize a rotavirus / "binding peptide" system. system described in EP Publication No. 259,149, the contents of which are hereby incorporated by reference. The above list is not intended to be exhaustive and the names of the

• I

.;. can be clearly used.

«·. 30 · a • · · * *,

Any carrier which does not itself produce antibodies harmful to the host can be used. Suitable carriers are typically large, slowly metabolized liver. 105046 romolecules such as proteins; polysaccharides such as latex-functionalized Sepharose, agarose, cellulose, cellulose spheres and the like; polymeric amino acids such as polyglutamic acid, polylysine and the like; amino acid copolymers; and inactive virus particles. Particularly useful protein carriers are serum-5 tubers, keyhole Iimpef hemocyanin, immunoglobulin molecules, thyroglobulin, ovalbumin, tetanus toxoid, and other proteins well known to those skilled in the art.

In addition to full-length viral proteins, polypeptides comprising truncated HCV-10a amino acid sequences encoding at least one viral epitope are useful as immunological reagents. For example, polypeptides comprising such truncated sequences may be used as reagents for immunoassay. These polypeptides are also candidate subunit antigens in compositions for producing antiserum or for vaccines. While these truncated sequences may be produced by various known treatments of the native nature viral protein, it is generally preferred to make synthetic or recombinant polypeptides comprising the HCV sequence. Polypeptides comprising these truncated HCV sequences can be made entirely of HCV sequences (one or more epitopes, either contiguous or non-contiguous) or HCV sequences and immediate; ; rological sequences in the fusion protein. Useful heterologous sequences include 20 sequences that confer secretion from the recombinant host, confirming the immunoprecipitation of HCV epitopes.

i I.

: · 'Ammunological reactivity or facilitate coupling of a polypeptide to an immunoassay or vaccine carrier. See. for example, EP Publication No. 116.201; US- • · Patent No. 4,722,840; EP Publication No. 259.149; U.S. Pat. 4,629,783 with Contents • · ·

«# I

is incorporated herein by reference.

F

• · ·

The size of the polypeptides comprising truncated HCV sequences can vary widely, from mini * /. is a sequence of sufficient size to yield the HCV epitope, while the maximal size test is not critical. For convenience, the maximum size is usually not substantially larger than that required to provide the desired HCV epitopes and heterologous sec. ; 30 license functions, if any. Typically, the truncated HCV amino acid sequence is from about 5 to about 100 amino acids in length. More typically, however, the HCV sequence is up to about 50 amino acids in length, preferably up to about 30 amino acids in length. It is usually desirable to select HCV sequences having at least about 10.12 or 15 amino acids, up to about 20 or 25 amino acids at most.

. Truncated HCV amino acid sequences comprising epitopes can be identified in a number of ways. For example, the entire viral protein sequence can be screened by preparing a series of short peptides that together cover the entire protein sequence. An example of antigen screening of HCV polyprotein regions is given below. In addition, starting with, for example, 100-mer polypeptides, it would be routine to test each polypeptide for the presence of epitopes that exhibit the desired reactivity, and then to test progressively smaller and overlapping fragments of the identified 100-mer to identify the epitope of interest. Screening such peptides by immunoassay is well within the skill in the art. It is also known to perform computer-based analysis of protein sequences to identify potential epitopes and then prepare oligopeptides comprising the identified regions for screening. Such a computer analysis of the HCV amino-15 acid sequence is shown in Figure 20 where the hydrophilic / hydrophobic nature is shown above the antigen index. Amino acids are numbered starting with the starting MET (position 1) as shown in Figure 17. Those skilled in the art will appreciate that such computer analysis of antigenicity does not always identify the epi- •; a top that actually exists and may also misidentify an epitope containing a region of protein 20.

«I

Examples of HCV amino acid sequences that may be useful are expressed from expression vectors comprising clones 5-1-1, 81, CA74a, 35f, 279a, C36, C33b, CA290a, C8f, C12f, 14c, 15e, C25c, C33c, C33f, 33g, C39c, C40b, Cal67b, are depicted below. Other examples of HCV amino acid sequences that may be useful, / · *; as described herein, is given below. It is to be understood that these peptides may not necessarily; closely map one epitope and may also contain a non-m · · ♦ », ...: immunogenic HCV sequence. These non-immunogenic portions of the sequence can be determined as described above using conventional techniques and have been removed from the sequences described.

«·. ·. : 30 Further add truncated HCV amino acid sequences comprising the epitope or

• t I

immunogenic, can be identified as described above. The following amino acid sequences are given in amino acid numbers (i.e. "AAn"), where n is the amino acid number as shown in Figure 17: AA1-AA50; AA1-AA84; AA9-AA177; AA50-AA100; AA40-AA90; AA65-AA75; / AA99-AA120; AA95-AA110; AA100-AA150; AA150-AA200; AA200-AA250; AA220-AA240; AA245-AA265; AA250-AA300; AA290-AA330; AA290-AA305; AA300-AA350; AA310-AA330; AA350-AA400; AA405-AA495; AA400-AA450; AA437-AA582; AA450-AA500; AA475-AA495; AA500-AA550; AA511-AA690; AA515-AA550; AA550-AA600; AA550-AA625; AA575-AA605; AA600-AA650; AA AA-AA625; AA635-AA665; AA650-AA700; AA645-AA680; AA700-AA750; AA700-AA725; AA725-AA775; AA770-AA790; AA750-AA800; AA800-AA815; AA850-AA875; AA800-AA850; AA920-AA990; AA850-AA900; AA920-AA945; AA940-AA965; AA950-AA1000; AA1000, AA1060; AA1000, AA1050; AA1025, AA1040; AA1075, AA1175; AA1050, AA1200; AA1070, AA1100; AA1100- i5 AA1140; AA1192, AA1457; AA1195, AA1250; AA1200, AA1225; AA1225- AA1250; AA1250, AA1300; AA1260, AA1310; AA1260, AA1280; AA1266- AA1428; AA1300, AA1350; AA1310, AA1340; AA1345, AA1405; AA1350- AA1400; AA1365, AA1380; AA1380, AA1405; AA1400, AA1450; AA1450- •: AA1500; AA1475, AA1515; AA1475, AA1500; AA1500, AA1550; AA1515- '•' .0 20 AA1550; AA1550, AA1600; AA1570, AA1590; AA1595, AA1610; AA1590-: V AA1650; AA1610, AA1645; AA1650, AA1690; AA1685, AA1770; AA1690- AA1720; AA1720, AA1745; AA1745, AA1770; AA1750, AA1800; AA1775- • · I · · AA1810; AA1795, AA1850; AA1850, AA1900; AA1900, AA1950; AA1900- • · · AA1920; AA1916, AA2021; AA1920, AA1940; AA1949, AA2124; AA1950- AA2000; AA1950, AA1985; AA2000, AA2050; AA2020, AA2045; AA2045- • «/: ·. AA2100; AA2045, AA2070; AA2054, AA2223; AA2070, AA2100; AA2100- m · · /. AA2150; AA2150, AA2200; AA2200, AA2325; AA2250, AA2330; AA2265- • · · J r • · # AA2280; AA2280, AA2290; AA2287, AA2385; AA2300, AA2350; AA2350- AA2400; AA2345, AA2415; AA2345, AA2375; AA2348, AA2464; AA2370- to AA2410; AA2400, AA2450; AA2400, AA2425; AA2415, AA2450; AA2445- AA2500; AA2371, AA2502; AA2500, AA2550; AA2505, AA2540; AA2550- AA2600; AA2560, AA2580; AA2600, AA2650; AA2620, AA2650; AA2650- 29 105046 AA2700; AA2655, AA2670; AA2670, AA2700; AA2700, AA2750; AA2750- AA2800; AA2755, AA2780; AA2780, AA2830; AA2785, AA2810; AA2796- AA2886; AA2810, AA2825; AA2800, AA2850; AA2850, AA2900; AA2900- AA2950; AA2910, AA2930; AA2925, AA2950; and the AA2945 end (C-terminus).

'5' The above HCV amino acid sequences may be prepared as separate peptides or attached to a larger polypeptide fragment and may have use as described herein. Additional poly peptides comprising truncated HCV sequences are described in the Examples.

ίο The observed relationship of putative HCV polyproteins with Flaviviruses allows the prediction of putative regions of HCV "nonstructural" (NS) proteins. The locations of the individual NS proteins in the putative Flavivirus precursor polyprotein are quite well known. Furthermore, these also agree with the observed overall variations in the hydrophobicity profile of the polyprotein. It has been shown that Flaviviruses NS5 encodes virion polymerase 15 and that NS1 corresponds to the complement attachment antigen, which has been shown to be an effective vaccine in animals. Recently, it has been shown that flavivirus protease function is in NS3. Due to the observed similarities between HCV and Flaviviruses, which are described below, conclusions are possible regarding the approximate locations of the respective protein regions and '; ; HCV polyprotein functions. Expression of polypeptides containing these regions in a plurality of :20 elmä systemic host cells, including, for example, bacteria, yeast, insect and vertebrate cells, should increase the detection of important immunological reagents that can be used for diagnosis. vaccines.

) · · »· # • · t · a · •« ·

Although there is some similarity between the HCV isolate described herein and the putative nonprotein regions of polyproteins in Flaviviruses, there is less similarity · · · /: ·. between the supposed structural regions towards the N-terminus. In this area «t · *. has greater sequence mismatch and, in addition, the hydrophobicity profile of the two regions • · · shows less similarity. This "aberration" starts at the N-terminus of the putative NS1-1f region of HCV and extends to the putative N-terminus. In any case, there may still be · · hydrophobic) approximate sites on the HCV polyprotein. In the examples, the predictions are based on the changes observed in the hydrophobic profile of the HCV polyprotein and Flaviv: It is already possible to predict the putative core capsule (N-terminal basic region) and the E region (generally

• I I

• · 30 105046 for information on the nature and location of brown proteins. From these predictions, it may be possible to identify approximate regions of the HCV polyprotein that could correspond to useful immunological reagents. For example, the E and NS 1 proteins of Flaviviruses are known to be effective as protective vaccines. These regions, as well as some that have been shown to be antigenic in the HCV isolate described herein, for example those in putative NS3, C, and NS5 proteins, would provide diagnostic reagents. In addition, the position and expression of virus-encoded enzymes may also allow the evaluation of antiviral enzyme inhibitors, i. for example, inhibitors that inhibit enzyme activity as a result of their interaction with these enzymes themselves or agents that can inhibit enzyme expression (e.g., antisense RNA or other drugs that interfere with expression).

Preparation of HCV Epitope-containing Hybrid Particle Immunogens The immunogenicity of HCV epitopes can also be confirmed by preparing them in a mammalian or yeast system fused or installed to contain particle-forming proteins such as those associated with hepatitis B: n surface antigen. Structures in which the NANBV epitope is directly linked to sequences encoding a particle form hybrids that are immunogenic with respect to the? 20 HCV epitope. In addition, all vectors made contain HBV specific epitopes. having varying levels of immunogenicity, such as the pre-S peptide (pre surface protein). Thus, the * * · '\' l particles that make up the particle-forming proteins that contain the HCV sequences are immunogenic for HCV and t ♦ * For HBV.

... 25 • · · • · ·. ···. Hepatitis surface antigens (HBSAg) have been shown to be formed and associated with S. cerevi * * · ·. *. siae (Valenzuela et al. (1982)) and also, for example, in mammalian cells (ij (Valenzuela P., et al. (1984))). The formation of such particles has been shown to enhance the immunogenicity of the monomeric subunit. The structures may also contain hepatitis.

| · An immunodominant epitope of a tick surface antigen, comprising a region of 55 amino acids upstream of (pre-S)? Neurath et al. (1984). Pre-S-HBSag particle structures that are expressed in yeast are disclosed in EP 174,444, published March 31, 1986; hybrids containing heterologous vims for yeast expression are disclosed in EP 175,261, issued March 26, 1986. These constructs can be expressed in mammalian cells such as Chinese Hamster Ovary (CHO) cells using the SV40 dihydrofolate reductase vector (Michelle et al. (1984)).

In addition, parts of the particle-forming protein coding sequence may be exchanged for codons encoding the HCV epitope. In this exchange, regions not required to mediate assembly of units to form immunogenic particles in yeast or mammals can be eliminated thereby avoiding competition for additional HBV anti-gene sites with the HCV epitope.

Preparation of Vaccines n Vaccines may be prepared from one or more immunogenic polypeptides derived from HCV cDNA including the cDNA sequences described in the Examples. The homology observed between HCV and Flaviviruses provides information on the polypeptides that may be most effective as vaccines and also on the genomic regions into which they have been encoded. The general structure of the 20 genomes of flaviviruses is discussed in Rice et al. (1986). The flaviviral genome RNA is believed to be the only virus-specific mRNA species and is cataloged into three viral structural proteins, i. C, M, and E, and also two non-structural structural proteins, NS4 and NS5, and complex Saija, smaller non-structural I · <f · * * liproteins. It is known that the major neutralizing epitopes for Flaviruses are in the E- f ... e 25 protein (shell = Envelope) (Roehrig (1986)). Thus, vaccines may be composed of recombinant polypeptides containing the HCV E epitopes. These polypeptides can be. expressed in bacterial, yeast or mammalian cells or alternatively can be isolated from viral preparations. It is also predicted that other structural proteins may also contain

I

epitopes that give rise to protective antibodies against HCV. Thus, polypeptides containing epitopes of E, C, and M may also be used, either alone or in combination, in HCV vaccines.

105046 32

In addition, it has been shown that immunization with NS1 (non-structural protein 1), results in protection against yellow fever (Schlesinger et al. (1986)). This is true, although immunization does not produce neutralizing antibodies. Thus, especially since this protein appears to be highly conserved among Flaviviruses, it is likely that HCV NS1 would also protect against HCV infection. In addition, it also demonstrates that nonstructural proteins can provide protection against viral pathogenicity, although they do not induce the production of neutralizing antibodies.

The information provided in the examples regarding the immunogenicity of polypeptides expressed from cloned HCV cDNAs covering different regions of the HCV ORF also allows predictions regarding their use in vaccines.

In view of the above, polyvalent vaccines against HCV may consist of one or more epitopes of one or more structural proteins and / or one or more epitopes of one or more nonstructural proteins. These vaccines may consist, for example, of recombinant HCV polypeptides and / or polypeptides isolated from virions. In particular, vaccines are designed to comprise one or more of the following HCV proteins or derived subunit antigens: E, NS1, C, NS2, NS3, NS4 and NS5. Vaccines comprising E and / or NS1 or their subunits are particularly preferred.

• ·

The preparation of vaccines containing immunogenic polypeptides as active ingredients is known to those skilled in the art. Typically, such vaccines are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, a liquid prior to injection may also be prepared. The formulation may also be made into an emulsion or the protein may be encapsulated in liposomes. Ak-; . *. dense immunogenic ingredients are often mixed with excipients which are pharmaceutical

• M

,., cytologically acceptable and compatible with the active ingredients. Suitable excipients include, for example, water, saline, dextrose, glycerol, ethanol, and the like, and the like. 30 combinations. Additionally, the vaccine may, if desired, contain minor amounts of adjuvants, such as wetting or emulsifying agents, pH buffering agents and / or adjuvants that enhance the efficacy of the vaccine. Examples of excipients that may be effective include but are not limited to 105046 33

are not limited thereto: aluminum hydroxide, N-acetylmuramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetylnormuramyl-L-alanyl-D-isoglutamine (CGP 11637, referred to as nor-MDP), N- acetylmuramyl-L-alanyl-D-isoglutaminyl, L-alanine-2- (1,2-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy) -ethylamine (CGP

19835A (referred to as MTP-PE) and RIBI containing three components extracted from bacteria, monophosphoryl lipid A, trehalose dicholate and cell wall backbone (MPL + TDM + CWS) in 2% squalene / Tween 80 emulsion. The activity of an excipient can be determined by measuring the amount of antibodies directed against an immunogenic polypeptide containing the antigenic sequence of HCV resulting from the administration of this polypeptide in vaccines consisting of various excipients.

The vaccines are traditionally administered parenterally, for example by injection either subcutaneously or intramuscularly. Additional formulations suitable for other modes of administration include suppositories and, in some cases, oral compositions. For suppository suppositories, conventional binders and carriers may contain, for example, polyalkylene glycols or triglycerides; such suppositories may be formed from mixtures containing 0.5-10%, preferably 1-2%, of the active ingredient. Oral preparations include such commonly used excipients as, for example, pharmaceutical grade mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate and the like. These compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders and contain 10-95% active ingredient, preferably 25-70%.

• · • · · * · 9 9 9 9 9

The proteins may be formulated as a vaccine in neutral or salt form. Pharmaceutically, ···. Acceptable salts include acid addition salts (formed with the amino groups of the free peptide peptides) and formed with inorganic acids such as. hydrochloric or phosphoric acid or organic acids such as acetic acid, oxalic acid, tartaric acid, maleic acid and the like. Salts formed with free carboxyl groups may also be derived from inorganic bases such as sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium hydroxide or iron hydroxides, and organic bases such as isopropylamine, trimethylamine, trimethylamine, like that.

"105046 34

Dose and administration of vaccines

The vaccines are administered in a manner that is compatible with the dosage formulation and to an extent that is efficacious in the prophylactic and / or therapeutic sense. The amount to be administered, generally 5 pg to 250 pg antigen per dose, will depend upon the subject being treated, the capacity of the subject's immune system to synthesize antibodies, and the degree of protection desired. The exact amount of active ingredient required to be administered may be at the discretion of the physician and may be specific to each subject.

10

The vaccine may be administered in a single dose, or preferably in multiple doses. The multi-dose protocol is one in which an initial vaccination schedule can be performed in 1 to 10 separate doses, followed by other doses at subsequent intervals required to maintain or reaffirm the immune response, for example 1-4 months for the second dose and, if necessary, the following the dose is given after several months. Dosage instructions, at least in part, will be determined by the individual and will be at the discretion of the physician.

In addition, a vaccine containing immunogenic HCV antigens may be administered in conjunction with other immune system regulating agents, for example immunoglobulins.

• I

• · • · ·

Preparation of Antibodies Against HCV Epitopes i i i • · · 25 Immunogenic polypeptides prepared as described above are used to produce | »· T antibodies, both polyclonal and monoclonal. If polyclonal antibodies are desired. substances, the selected mammal (e.g., mouse, rabbit, goat, horse, etc.) is immunized with • · · »9 immunogenic polypeptide carrying HCV epitopes. Serum immunized <9. the animal is collected and treated in accordance with known procedures. If serum containing? 9? Polyclonal antibodies to the HCV epitope contains antibodies to other antigens,? Polyclonal antibodies can be purified by immunoaffinity chromatography.

35 105046

Techniques for producing and processing polyclonal antiserum are known in the art, see, for example, Mayer and Walker (1987).

Alternatively, polyclonal antibodies may be isolated from a mammal previously infected with HCV. An example of a method for purifying antibodies to HCV epitopes from the serum of an infected individual based on affinity chromatography using the SOD fusion polypeptide and polypeptide encoded in the cDNA of clone 5-1-1 is disclosed in EP Publication No. 318.216.

Monoclonal antibodies directed against HCV epitopes can also be readily produced by one of ordinary skill in the art. General methods for making monoclonal antibodies via hybridomas are well known. Immortalized antibody-producing cell lines can be created by cell fusion as well as other techniques, such as direct transformation of B lymphocytes by oncogenic DNA or transfection with Epstein-Barr virus. See, for example, M. Schreier et al. (1980); Hammerling et al. is (1981); Kennett et al. (1980); see also U.S. Patent Nos. 4,341,761; 4,399,121; 4,427,783; 4,444,887; 4,466,917; 4,472,500; 4,491,632 and 4,493,890. Kits of monoclonal antibodies raised against HCV epitopes can be screened for different properties; i.e. isotype, epitope affinity, etc.

«• ·

• I

Antibodies, both monoclonal and polyclonal, directed against HCV-epitopes are particularly useful in diagnosis and those that are neutralizing are useful in passive immunotherapy. Monoclonal antibodies can be used to specifically generate anti-idiotype antibodies.

* · · · T m 25 Anti-idiotype antibodies are immunoglobulins having an "internal image" of infecting j / j *; antigen of the substance to be protected. See, for example, NisonofT, A., et t · ',; Oh. (1981) and Dreesman et al. (1985).

I, λ Techniques for generating anti-idiotype antibodies are known in the art. See, for example, Grzych (1985), MacNamara et al. (1984), and Uytdehaag et al. (1985). These anti-idiotype antibodies may also be useful in the treatment and / or diagnosis of NANBH and also in clarifying the immunogenic regions of HCV antigens.

36 10EC46

One of ordinary skill in the art would recognize that numerous types of antibodies directed against HCV epitopes can be produced. As used herein, "antibody" refers to a polypeptide or group of polypeptides formed by at least one antibody binding site. An "antibody binding site" or "binding region" is formed by the folding of variable regions of antibody molecules to form three-dimensional binding states with internal surface shape and charge distribution complementary to antigen epitope features. The antibody junction site can consist of a heavy and / or light chain region (VH and VL, respectively) which form highly variable loops that support antigen binding. The term "antibody" includes, for example, vertebrate antibodies, hybrid antibodies, imaginary antibodies, altered antibodies, monovalent antibodies, Fab proteins, and single region antibodies.

A "single region antibody" (dAb) is an antibody consisting of a VH region that is reactive with an immunologically targeted antigen. The dAb does not contain a VL region, but may contain other antigen binding sites known to be present in antibodies, such as kappa and lambda. Methods for preparing dAbs are known in the art.

See, e.g., Ward et al. (1989).

• · A: 20 Antibodies can also consist of VH and VL regions, as well as other known anti-

I »I

i \: binding regions of the gene. Examples of these antibody types and methods for their% .....

'' are known in the art (see, e.g., U.S. Patent No. 4,816,467, which is incorporated herein by reference) and include the following. For example, "vertebrate antibodies" refer to * * · • · · * antibodies that are tetramers or their associations, comprising light and ras-25 chains that are usually linked in a "Y" configuration and may have • · · Or not to be covalent bonds between the chains. In vertebrate antibodies, the amino acid sequences of all _ * ·, *, specific antibody chains are homologous to those chains found in a single antibody produced by a lymphocyte of the type I,; situ or in vitro (e.g., hydridom). Antibodies to vertebrates typically contain natural antibodies, for example, purified polyclonal antibodies and monoclonal antibodies. Examples of methods for preparing these antibodies are described below.

105046 "Hybrid antibodies" are antibodies in which one heavy and light chain pair is homologous with the chains in the first antibody, while the other heavy and light chain pair is homologous with the chains in the second antibody. Typically, each of these two pairs binds different epitopes, particularly to different antigens. This is the "result of the" divalence "property, i.e. ability to bind two antigens simultaneously.

Such hybrids may also be formed using imaginary chains as shown below.

ίο "Chimeric antibodies" are antibodies in which the heavy and / or light chain are fusion proteins. Typically, the constant region of the chains is of one particular species and / or class and the variable regions are of a different species and / or class. This also includes any antibody in which either the heavy or light chain, or both, is composed of combinations of sequences that mimic the sequences in antibodies from different sources, be they of different classes or species of origin and be a fusion site at the variable / constant boundary. . Thus, it is possible to produce antibodies in which neither the constant nor the variable region mimics known antibody sequences. It will then become possible, for example, to construct antibodies having a variable region with a higher specific affinity for a particular antigen, or a constant region of which may provide enhanced complement attachment or other enhancements in specific region-specific properties.

• · • ·

I I I

• I I

Another example is the "altered antibody", which refers to antibodies in which the naturally occurring * * amino acid sequence in the vertebrate antibody is varied. Using recombinant DNA techniques, antibodies can be reformulated to obtain the desired properties. The possible variations are many and range from alteration of one or more amino acids to complete remodeling of a region, such as a constant region. Changes in the alert area generally provide the desired cell-method properties. *. such as changes in complement attachment, intermembrane mutual · · · · · · ·, ·, ·, and other effector functions. Changes in the variable range can be made.

30 antigen binding properties. The antibody may also be constructed to assist specific delivery of the molecule or agent to a specific cell or tissue site.

• * · • · 38 105046

The desired alterations can be made by known techniques in molecular biology, for example by recombinant techniques, site-directed mutagenesis, etc.

Yet another example are "monovalent antibodies", which are aggregates formed by a heavy chain / light chain dimer bound to another heavy chain Fc region (i.e., the state region). Antigen modulation cannot be performed on this type of antibody. See. e.g., Glennie et al. (1982).

Also included within the definition of antibodies are "Fab" fragments of antibodies. The "Fab" region refers to those portions of the heavy and light chains which are roughly equivalent or analogous to sequences comprising the heavy and light chain branching and which have been shown to exhibit immunological binding to a specific antigen but lacking the Fc portion of the effector. "Fab" includes one heavy and one light chain aggregate (commonly known as Fab '), as well as tetramers containing 2H and 2L chains (referred to as F (ab) 2) that are capable of reacting selectively with a given antigen or antigen family. "Fab" antibodies can be divided into subgroups analogous to those described above, i. "vertebrate Fab", "hybrid Fab", "chimeric Fab" and "modified Fab". Methods for producing "Fab" fragments of antibodies are known in the art and include, for example, combined techniques of proteolysis and synthesis.

·: ··: 20 ««

Diagnostic Oligonucleotide Probes and Instrumentation Using the isolated portions of the HCV cDNAs as the template, oligomers of about 8 nucleotides or more can be prepared by either cleavage or synthetically, which * (i '25 oligomers hybridize to the HCV genome and are useful in viral identification, further characterization of viral genomes, and also in the detection of viruses in diseased • 1 · * · «, ··· individuals. For HCV polynucleotides. the lengths of the probes (either natural or derived • · ·. ·.) are such that they allow the detection of unique viral sequences.

«I I

'through hybridization. While 6-8 nucleotides may be an effective length, 10-12 nucleotides are already preferred sequences and about 20 nucleotides appear to be optimal. I prefer • · '· .1 ·. these sequences are derived from regions without heterogeneity. These probes can be prepared using routine methods including automated oligonucleotide synthesis methods. Useful probes include, for example, those derived from the recently isolated clones provided herein, as well as various oligomers useful for the study of cDNA repositories, as described below. Any HCV. the complement of the unique portion of the genome is also satisfactory. For use as probes, complete complementarity is desirable, although it may be unnecessary as the fragment length increases.

For use in such diagnostic probes, a biological assay sample, such as blood or serum, may be treated, if desired, to extract the nucleic acids it contains. The resulting nucleic acids can be subjected to gel electrophoresis or other size-discriminating technique; alternatively, the nucleic acid sample can be dot-blotted without size discrimination. The probes are then labeled. Suitable labels and probe labeling methods are known in the art and include, for example, radioactive labels attached by nickel translation or kinase, biotin, fluorescent probes, and chemiluminescent probes. Mucleic acids extracted from the sample are then treated with a labeled probe under suitably stringent hybridization conditions, and polynucleotide duplexes containing the probe are detected.

The probes can be made fully complementary to the HCV genome. Therefore, very stringent conditions are desirable to prevent false positives. However, very stringent conditions should only be used if the probes are complementary to a region of the viral genome lacking heterogeneity. The stringency of hybridization is and factors during the washing process, including temperature, ionic strength, length of time, and formamide content, such as those outlined in * Maniatis, T. (1982).

r ··· • · · · · ·

It is generally expected that the HCV genome will be present in the serum of infected individuals • ·

• 2 I

. at relatively low levels, i. at levels of about 10-10 infectious doses of chimpanzees I «

• I I

(CID) per ml. This level may require the use of amplif1, · in hybridization analysis. 30 pouring techniques. Such techniques are known in the art. For example, Enzo Biochemical. Corporation's "Bio-Bridge" system uses terminal deoxynucleotide transferase # · · to insert unmodified 3'-poly-dT tails into the DNA probe. The poly dT tailed 40105046 probe is hybridized to the target nucleotide sequence and then to biotin-modified poly-A. PCT Application 84/03250 and EP 124221 disclose a DNA hybridization assay wherein: (1) the analyte is heat treated to a single-stranded DNA probe complementary to an enzyme-labeled olinucleotide; and (2) hybridizing the resulting tail s duplex to an enzyme-labeled oligonucleotide. EP Publication 204510 describes a DNA hybridization assay in which the analyte DNA is contacted with a probe having a tail such as a poly-dT tail, an amplification strand having a sequence hybridizing to a probe tail such as a poly-A sequence, and which can bind multiple stamped threads. A particularly desirable technique may first include amplification of the target HCV-lo sequences in the serum to about 10,000 fold, i. about 106 sequences / ml. This can be done, for example, by the polymerase chain reaction (PCR) technique disclosed by Saiki et al. (1986), Mullis in U.S. Patent 4,683,195 and Mullis et al. U.S. Patent 4,683,202. The amplified sequences can then be detected using the hybridization assay described in EP 317,077, published May 24, 1989. These hybridization assays, which should detect sequences at 106 / ml, use nucleic acid primers that bind to single-stranded analyte nucleic acid and also bind to many single-stranded labeled oligonucleotides. A suitable solution sandwich assay that can be used with labeled polynucleotide probes and methods for preparing the probes is described in EP publication 225,807, published June 1, 20, 20:87.

• 'Probes can be packaged as diagnostic tools. Diagnostic kits include probe DNA, which may be labeled; alternatively, the probe DNA may be unlabeled and the labeling means may be contained in separate containers. Tooling can also

Φ I I I I I

• 25 contains other suitably packaged reagents and materials required for a particular hybridization mode, such as standards and also instructions for conducting the assay.

• · ·

I I

Immunological analysis and diagnostic tools • · 50 * ·

As well as polypeptides that immunologically react with serum containing HCV antibodies, for example those detected by the antigen screening method described in the Examples below, as well as those derived from, or encoded by, the isolated clones described in the Examples. composites and antibodies raised against specific HCV epitopes on these polypeptides are useful in immunoassays for the presence of HCV antibodies or for detection of viral s and / or viral antigens in biological samples. The design of immunoassays is subject to considerable variation and is well known in the art. For example, an immunoassay may use a single viral epitope; alternatively, a combination of viral epitopes derived from these sources may be used for immunoassay; these epitopes may be derived from the same or different viral polypeptides, and may be contained in separate recombinant or natural polypeptides, or together in the same recombinant polypeptides. For example, it may use a monoclonal antibody directed against viral epitopes, a combination of monoclonal antibodies directed against epitopes of a single viral antigen, monoclonal antibodies directed against epitopes of various viral antigens, polyclonal antibodies directed against directed against the same viral antigen or polyclonal antibodies directed against different viral antigens. Policies may be based, for example, on competition, direct reaction or sandwich analysis. The procedures may also use, for example, solid supports or may be accomplished by immunoprecipitation. Most assays involve the use of a labeled antibody or polypeptide; the labels may be exemplified by fluorescent, chemiluminescent, radioactive or colored molecules. Analyzes that amplify probe signals are also known; of which example; These are assays that use biotin and avidin and enzyme-labeled and enzyme-mediated immunoassays, such as ELISA.

Some antigenic regions of the putative polyprotein have been mapped and identified by screening for bacterial expression products of HCV cDNAs encoding a portion of the polyprotein. · Antigenicity. See examples. Other HCV antigenic sites may be indicated by ex- • · ·. ' . compressing regions of HCV cDNAs in other expression systems, including yeast sequences. Systems and cellular systems derived from insects and vertebrates. In addition, f 30 studies providing antigenicity index and hydrophobicity / hydrophilicity profile,

I

! '. provide information regarding the probability of the region's antigenic cause.

• Il «· 42. 105046

Studies of antigenicity mapping by expression of HCV cDNAs showed that a number of clones containing these cDNAs expressed polypeptides that were immunologically reactive with serum from individuals with NANBH. No single polypeptide was immunologically reactive with all sera. Five of these polypeptides were highly immunogenic in that antibodies to HCV epitopes in these polypeptides were detected in many different patient sera, although the overlap was not complete. Thus, the immunogenicity results of the polypeptides encoded in the various clones suggest that efficient targeting systems may include the use of epitope panels. Panel epitopes may be constructed on one or more polypeptides.

Devices suitable for immunological diagnoses and containing appropriately labeled reagents are constructed by packaging appropriate materials, including polypeptides of the invention, containing antibodies against HCV epitopes or HCV epitopes in appropriate containers, together with their other reagents and materials. which are required to perform the analysis and also suitable analysis instructions.

HCV eenomin. further characterization of virions and viral antigens using probes. which are derived from the viral genome cDNA • HCV cDNA sequence information in newly isolated clones described in the examples can be used to obtain more information on HCV. genome sequence and to identify and * · «*; / isolate the HCV agent and thus assist in its characterization, including the nature of the genome, the structure of the I t · t« r 25 viral particle and the antigens that it is composed of. This information may in turn lead to additional polynucleotide probes , polypeptides derived from the HCV genome and antibodies against HCV epitopes that could be useful in the diagnosis and / or treatment of HCV-induced NANBH.

Already, the cDNA sequence information of the above clones is useful in designing probes to separate additional cDNA sequences derived from unidentified regions of the HCV genomes from which the cDNAs described in this and EP 318,216 are described. clones are derived from. For example, labeled probes containing about 8 or more nucleotide sequences, and preferably 20 or more nucleotide sequences, are derived from regions close to the 5 or 3 'end of the recombinant HCV cDNA sequence shown in Figure 17. , can be used to isolate overlapping cDNA sequences from HCV cDNA libraries. Alternatively, characterization of genomic segments could be done from viral genomes isolated from purified HCV particles. Methods for purifying and detecting HCV particles during the purification procedure are described below. Procedures for isolating polynucleotide digenomes from a viral particle are known in the art and a useful method is described in EP 218,316. The isolated genomic segments could then be cloned and sequenced. An example of this technique which uses amplification of the sequences to be cloned is given below and resulted in clone 16jh.

Methods for generating cDNA libraries are known in the art and are discussed above and below; a method for generating an HCV cDNA library in a lambda-gtll vector is discussed in EP 318,216. However, cDNA libraries useful for screening with nucleic acid probes can also be constructed with other vectors known in the art, for example lambda-gt10 (Huynh et al. (1985)).

':: Screening of 20 antiviral agents against HCV * ·

• I I

• * «

The availability of cell culture and animal model systems for HCV also makes it possible to screen for antiviral agents that inhibit HCV replication, and especially those that primarily allow cell growth and replication but prevent *! i * 25 viral replication. These screening methods are known to those skilled in the art. General,. ·: ·. that is, antiviral agents are tested at numerous concentrations for their efficacy in preventing viral replication in cell culture systems that support viral replication and then; for inhibition of infectivity of the viral pathogen (and for low-level toxicity) * · in the animal model system.

. · '··. These methods and compositions provided herein for the detection of HCV antigens and HCV * t polynucleotides are useful in screening for antiviral agents 44 105046, providing an alternative and perhaps more sensitive means of detecting the efficacy of the agent in viral replication than cell plaque analysis. or ID50 analysis. For example, the HCV polynucleotide probes described herein can be used to determine the amount of viral nucleic acid produced in cell culture. This could be done, for example, by hybridization of infected so-5 lunucleic acids or by competitive hybridization with a labeled HCV polynucleotide probe. For example, anti-HCV antibodies may also be used to identify and quantify HCV antigens in cell culture using the immunological assays described herein. In addition, since it may be desirable to determine the amount of HCV antigens in an infected cell culture by competition analysis, the polypeptides encoded by the HCV cDNAs described herein are useful in these competition assays. Generally, a recombinant HCV polypeptide derived from HCV cDNA could be labeled and the inhibition of binding of this labeled polypeptide to the HCV polypeptide due to the antigen produced in the cell culture system would be monitored. In addition, these techniques are particularly useful in cases where HCV can replicate in a cell line without causing cell death.

Antiviral agents that can be tested for potency by these methods are known in the art and include, for example, those that interact with virion and / or cellular components essential for virus binding and / or replication. Typical antiviral agents may include pre- ::; for example, inhibitors of the virion polymerase and / or protease necessary for the cleavage of precursor polypeptides:. Other antiviral agents may include those that affect nucleic acids to prevent viral replication, for example antisense polynucleotides, etc.

• · «• t ·

2S

The antisense polynucleotide molecules are composed of a complementary nucleotide sequence that allows them to hybridize specifically to the given genomes of RNAs. areas. For example, antisense polynucleotides may contain molecules that inhibit protein translation by binding to mRNA or may be molecules that inhibit viral RNA replication by transcriptase. They may also contain molecules that carry substances (non-covalently attached or covalently bound) that cause viral RNA to be inactive, for example by causing cuts in the viral skin. They may also bind to cell polynucleotides that enhance and / or are required for viral infectivity, replication, or chronicity. Antisense molecules that are to hybridize to HCV-derived RNAs can be designed based on the sequence information of HCV cDNAs provided herein. Antiviral agents based on HCV antisense polynucleotides can be designed to bind with high specificity, be soluble, have high stability, and have low toxicity. Thus, they can be delivered in specialized residues such as liposomes or gene therapy. In addition, they may contain analogues, attached proteins, a substituted or modified bond between bases, etc.

10

Other types of drugs may be based on polynucleotides that "mimic" important regulatory regions of the HCV genome and which may be curative due to their interaction with key components of the system responsible for viral infectivity or replication. is

General methods

General techniques used to extract the genome from a virus, construct and test a cDNA library, sequencing clones, constructing expression vectors, transforming cells, performing immunoassays such as radioimmunoassays and ELISAs, and growing cells in culture. to all of them are known in the art and laboratory artisans describing these techniques are available. However, as a general guide, the following will outline a few sources that are »» v 1 /, currently available for procedures and materials that are useful for f * · * »» 2S.

• ·· <* ♦ · • · ·

Both prokaryotic and eukaryotic host cells can be used for the desired coding sequence. for expression of expression using appropriate control sequences that are compatible with the intended host. Among prokaryotic hosts, E. coli is most often used. Expression control sequences for prokaryotic cells include promoters, possibly containing operator moieties, and ribosome binding sites. Transfer vectors, · · compatible with prokaryotic hosts, are generally derived, for example, from 46 to 105046 pBR322, a plasmid containing operons conferring ampicillin and tetracycline resistance and various pUC vectors also containing sequences which confer antibiotic resistance . These markers can be used to obtain successful transformants through selection. Commonly used prokaryotic control sequences include s beta-lactamase (penicillinase) and lactose promoter systems (Chang et al. (1977)), tryptophan promoter system (trp) (Goeddel et al. (1980)), and the lambda-derived PL Nα promoter (PL). . (1981)) and a hybrid tac promoter (De Boer et al. (1983)) derived from the sequences of the trp and Lac UV5 promoters. The above systems are particularly compatible with E. Coli; other prokaryotic hosts such as Bacillus or Pseudomonas strains may be used with the corresponding control sequences.

Eukaryotic hosts include yeast and mammalian cells in culture systems. Saccharomvces cerevisiae and Saccharomvces carlsbereensis are the most commonly used yeast hosts and they are nice fungal hosts. Yeast-compatible vectors contain markers that allow the selection of successful transformants by conferring prototrophy on auxotrophic mutants or resistance to heavy metals in wild-type strains. Yeast-compatible vectors may use a 2 pm replication primer (Broach et al. (1983)), a combination of CEN3 and ARS1, or other means to ensure replication such as sequences that provide for the fusion of a suitable fragment into the host cell genome. The control sequences for yeast vectors are known in the art and include glycolytic promoters; . for the synthesis of enzymes (Hess et al. (1968); Holland et al. (1978)), including a pro- motor for 3-phosphoglycerate kinase (Hitzeman (1980)). Terminators may also be included, such as those derived from the enolase gene (Holland (1981)). Particularly useful regulating systems thereof include those comprising the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or alcohol dehydrogenase (ADH) adjustable promoter, terminators also derived from GAPDH and if you desire • · ·, *. secretion, a leader sequence for the yeast alpha factor. In addition, the transcription regulatory region and the transcription initiation region which are operably linked to one another may be such. 30 because they are not naturally associated with wild-type organisms. These systems are described in detail in EP-A-120,551, issued October 3, 1984; No. 116,201, published Aug. 47, 105046, Aug. 22, 1984, and Dec. 164, 556, issued December 18, 1985, all of which are incorporated by reference in this application.

Mammalian cell lines available for expression are known in the art and include many surviving cell lines available from the American Type Culture Culture Collection (ATCC), including HeLa cells, Chinese hamster ovary (CHO) cells, Hamster chick kidney cells (BHK). ) and numerous other cell lines. Suitable promoters for mammalian cells are also known in the art and include viral promoters such as those derived from Human Monkey 40 (SV40) (Fiers (1978)), Rous'n to Sarcoma Virus (RSV), Adenovirus (ADV) and Bovine Papilloma Virus (BPV). . Mammalian cells may also require terminator sequences and poly A addition sequences; amplification sequences that increase expression may also be included, and sequences that cause gene amplification may also be desirable. These sequences are known in the art. Suitable vectors for replication in mammalian cells may include viral replicons or sequences that ensure integration of appropriate sequences encoding NANBV epitopes into the host genome.

Transformation can be accomplished by any known method for introducing polynucleotides into a host cell, including, for example, packaging the polynucleotide with a virus and *: ':: transforming the host cell with a virus or direct polynucleotide uptake. The transfor- mation procedure used depends on the host to be transformed. For example, the transformation of E. coli host cells I ':' with the lambda-gt11 vector containing BB-NANBV sequences is discussed in the example section below. Bacterial transformation by direct uptake usually involves treatment with calcium chloride or rubidium chloride (Cohen (1972); Maniatis (1982)). Yeast transformation by direct uptake can be performed using Hinnen et al. (1978). The direct mammalian transformation can be performed using the calcium phosphate precipitation method of Graham and Van der Eb (1978) or various known variants thereof. doses.

The construction of the vector uses techniques known in the art. Place-specific • t • · i ''. DNA cleavage is accomplished by treatment with appropriate restriction enzymes under conditions generally defined by the manufacturer of these commercially available enzymes. In general, about 48 to 105046 1 pg of plasmid or DNA sequence are cleaved with 1 unit of enzyme in about 20 μ1: η buffer solution by incubation for 1-2 hours at 37 ° C. After incubation with the restriction enzyme, the protein is removed by phenol / chloroform extraction and the DNA is recovered by ethanol precipitation. The cleaved fragments can be separated using polyacrylamide or s agarose gel electrophoresis techniques according to the general procedures found in Methods in Enzymology (1980) 65: 499-560.

Adhesive cleavage fragments can be truncated at their ends using E. coli DNA polymerase I (Klenow) in the presence of suitable deoxynucleotide triphosphates (dNTP) in the mixture. Treatment with S1 nuclease can also be used, resulting in hydrolysis of any single stranded DNA moieties.

The couplings are performed using standard buffer and temperature conditions using T4 DNA ligase and ATP; adhesive-end linkages require less ATP and less is ligase than blunt-ended linkages. When vector fragments are used as part of the coupling mixture, the vector fragment is often treated with bacterial alkaline phosphatase (BAP) or calf intestinal alkaline phosphatase to remove the 5'-phosphate and thus prevent the re-joining of the vector; alternatively, restriction enzyme cleavage of unwanted fragments may be performed to prevent fusion.

':': 20 ^ I

Joining mixtures are transformed into suitable cloning hosts, such as E. Coli's and I • I ·

I I I

For example, transformants are selected for antibiotic resistance and screened for the correct structure.

Synthetic oligonucleotides can be prepared using automated oligonucleotide synthesizers as described by Warner (1984). If desired, the synthetic filaments may be labeled with? 32 P by treatment with polynucleotide kinase in the presence of 32 P-ATP using standards. The reaction conditions.

• «· • * • ·. DNA sequences, including those isolated from cDNA libraries, can be modified by known techniques, including, for example, site-directed mutagenesis as described by Zoller (1982). The shortly engineered DNA is packaged into a phage as a single-stranded sequence and transformed into double-stranded DNA by DNA polymerase using as a primer a synthetic oligonucleotide complementary to the modifiable portion of the DNA and having the desired modification contained within its own sequence. The resulting double-stranded DNA is transformed into a phage carrying the host bacterium. Cultures of the transformed bacterium containing replication products of each strand of the phage are plated on agar to obtain plaques. Theoretically, 50% of the new plaques contain a phage with the mutation sequence and the remaining 50% have the original sequence. Plaque replicates are hybridized to labeled synthetic probes at temperatures and conditions that allow hybridization with the correct strand but not with the unmodified sequence ίο. The sequences identified by hybridization are recovered and cloned.

DNA libraries can be screened with probes using the method of Grunstein and Hogness (1975). Briefly, the DNA to be assayed in this procedure is immobilized on nitrocellulose filters, denatured and pre-hybridized with a buffer containing 0-50% for-15 mamide, 0.75 M NaCl, 75 mM Na citrate, 0.02% (w / v). bovine serum albumin, polyvinylpyrrolidone and Fricoll each, 50 mM Na phosphate (pH 6.5), 0.1% SDS and 100 μg / ml carrier denatured DNA. The percentage of formamide in the buffer and also the time and temperature conditions of the pre-hybridization and subsequent hybridization steps depend on the severity required. Oligomeric probes that require lower duck. ,,: 20 rat conditions, generally used for low formamide, lower temperatures: '; and longer hybridization times. Probes containing more than 30 or more

I I

; ' · 40 nucleotides, such as those derived from cDNA or genomic sequences, generally use higher temperatures, e.g., about 40-42 ° C and high formamide content, V.1, e.g., 50%. Following prehybridization, the 5'-32P-labeled oligonucleotide probe is added to the buffer * * 1 <· · · '' 'and filters are incubated in this mixture under hybridization conditions. After washing, the treated filters are autoradiographed to locate the hybridized probe; At DNA-matching sites, the original agar plates are used as the source of the desired DNA.

• · • · · 9 t · • · ·. For routine vector constructs, the junction mixtures are transformed into E. coli strain HB 101 or · «· '··' with another suitable host and successful transformants are selected by antibiotic resistance or other markers f '· ·. Plasmids are then prepared from the transformants of Clevwell et al. 105046 al. (1969), usually following the phenolic amplification of chlorian (Clewell (1972)). DNA is usually isolated and analyzed by restriction enzyme analysis and / or sequencing. Sequencing can be done by the dideok method of Sanger et al. (1977) and further described by Mes-, s sing et al. (1981) or by the method described by Maxam et al. (1980). Problems associated with band compression, sometimes observed in GC-rich regions, were overcome using T-deacoguanosine by Barr et al. (1986).

Enzyme-linked immunosorbent assay (ELISA) can be used to measure either antigen or antibody levels. This method depends on the binding of the enzyme to either the antigen or the antibody and uses the activity of the bound enzyme as a quantitative label. To measure the antibody, the known antigen is fixed in a solid phase (e.g., microplate or plastic cup), incubated with dilutions of test serum, washed, incubated with enzyme-labeled anti-immunoglobulin, and washed again. Suitable enzymes for labeling are known in the art and include, for example, pepper-root peroxidase. Solid phase bound enzyme activity is measured by adding a specific substrate and determining the formation or use of the substrate colorimetrically. Bound enzyme activity is a direct function of the amount of antibody bound.

,.,.: 20 To measure the antigen, a known specific antibody is attached to the solid phase, further. ';'; After incubation of the test material containing the antigen, the solid phase is washed and another enzyme-labeled antibody is added. After washing, the substrate is added and the enzyme activity is evaluated colorimetrically and proportional to the antigen content.

• · • · f • · · · ·

Ml *. · '25 Examples • · · • · ·

The examples of the present invention which are given for illustration purposes only are described below. nor to limit the scope of the present invention. In light of this disclosure, numerous embodiments within the scope of the claims will be apparent to those of ordinary skill in the art.

«« 30 • »· 1 ·» Il «· ·

• I

si 105046 13i of overlapping HCV cPNA clones. 26i. CA59a. CA84a. Isolation and sequence of CA156e and CAI67b

Clones 13i, 26j, CA59a, CA84a, CA156e and CA167b were isolated from the lambda-gtll library containing the HCV cDNA (ATCC No. 40394), the preparation of which is described in EP-T Publication 318,216 (published May 31, 1989). and WO 89/04669 (published June 1, 1989). The kiosk screening was performed with the probes described below using the method described by Huynh (1985). The frequency at which positive clones appeared with the respective probes is about 1: 50,000.

10

Isolation of clone 13i was performed using a synthetic probe derived from the sequence of clone 12f. The probe sequence was: 5 'GAA CGT TGC GAT CTG GAA GAC AGG GAC AGG 3'.

Isolation of clone 26j was performed using a probe derived from the 5 'region of clone K9-1. The probe sequence was: 5 'TAT CAG TTA TGC CAA CGG AAG CGG CCC CGA 3'.

Isolation procedures for clone 12f and clone k9-1 (also called K9-1) are described. 20 EP 318,216 and their sequences are shown in Figures 1 and 2, respectively. The HCV cDNA sequences of clones 13i and 26j are shown in Figures 4 and 5, respectively. They also show the amino acids encoded therein. and also the overlap of clone 13i with clone 12f and the overlap of clone 26j with clone 13i. The sequences of these clones var-: Y: recognized the sequence of clone K9-1. Clone K9-1 was isolated from a different HCV cDNA library in VV (See EP 218,316).

Clone CA59a was isolated using a probe based on the 5 'region of clone 26j. The sequence of this ··· * · * * · 'probe was:' / • j -5 'CTG GTT AGC AGG GCT TTT CTA TCA CCA CAA 3'.

»30

The probe from the sequence of clone CA59a was used to isolate clone CA84a.

* »•. '· The probe used for this isolation was: 52 105046 5' AAG GTC CTG GTA GTG CTG CTG CTA TTT GCC 3 '.

Clone CA156e was isolated using a probe derived from the sequence of clone CA84a. The probe sequence was: s 5 'ACT GGA CGA CGC AAG GTT GCA ATT GCT CTA 3'.

Clone CAI 67b was isolated using a probe derived from the sequence of clone CA156e. The probe sequence was: 5 'TTC GAC GTC ACA TCG ATC TGC TTG TCG GGA 3'.

The nucleotide sequences of HCV cDNAs in clones CA59a, CA84a, CA156e and CA167b are shown in Figures 6, 7, 8 and 9, respectively. The amino acids encoded therein as well as the overlap with the relevant clones are also shown in the Figures.

is HCV cDNA library "pj" creation The HCV cDNA library, "pi" library, was constructed from the same batch of infected chimpanzee plasma used to construct the HCV cDNA lambda-gt11 library (ATCC No. 40394) described in EP Publication No. 318,216 and employing substantially the same techniques. 2o berth. However, the construction of the pi-lobe used a primer extension method with inverse I · f. The t-transcriptase primer was based on the sequence of clone CA59A. The primer sequence was:; V. 5 'GGT GAC GTG GGT TTC 3'.

• · • t • ff

Isolation and sequence of the clone silicon 4a • · i ·· i i * 25

% · · * J

Screening of the "pi" of the HCV cDNA library, described above, with a probe used for isolation of the ··· '·,! To give clone CAI67b (See above) resulted in clone silicon. The clone contains about 800 bp VD cDNA overlapping with clones CA167b, CA156e, CA84a and CA59a isolated from the HCV lambda-gt11 cDNA library (ATCC No. 40394).

In addition, silicon also contains about 250 base pairs of DNA upstream of the HCV cDNA in clone CAI67b.

<i «« I · '<I · I «53 105046

CA216a of clones. Isolation and sequence of CA290a and ae30a

Based on the sequence of clone CA167b, a synthetic probe having the following sequence was made: 5 'GGC TTT ACC ACG TCA CCA ATG ATT GCC CTA 3'.

T

The probe above was used to screen the libraries resulting in clone CA216a, whose HCV sequences are shown in Figure 10.

another probe was made using the sequence of clone CA216a having the following sequence: 5 'TTT GGG TAA GGT CAT CGA TAC CCT TAC GTG 3'.

Screening of the Lambda-gt11 libraries (ATCC No. 40394) with this probe yielded the clone is CA290a, with the HCV sequences contained therein shown in Figure 11.

In a parallel approach, a primer extension cDNA library was made using nucleic acid extracted from the same infectious plasma used in the original lambda-gt11 cDNA library described above. The primer used was based on the sequence of clones CA216a 20 and CA290a: • · · 1: *: '5' GAA GCC GCA CGT AAG 3 '.

The cDNA library was constructed using methods similar to those previously described for the library for the isolation of pil4a and k9-l clones. The probe used for following this library was based on the sequence of clone CA290a:? 5? CCG GCG TAG GTC GCG CAA TTT GGG TAA 3 '.

• · • i i «Il

I I

Clone ag30a was isolated from the new library by the above probe and contained approximately 670 .mu.l of the HCV sequence base pair. See Figure 12. Some of this sequence overlaps · ·

• · I

. ·. : HCV sequence of CA216a and CA290a clones. However, about 300 base pairs of the clone ag30a sequence are upstream of the clone CA290a sequence. The sequence, 54 105046, which does not overlap, contains a start codon (1) and end codons that may indicate the start of the HCV ORF. Figure 12 also indicates putative small coded peptides (#) that may play a role in translation regulation, as well as the putative first putative polypeptide amino acid (/) and downstream amino acids encoded therein.

5

Isolation and sequence of CA205a clone

Clone CA205a was isolated from the original lambda gt11 libraries (ATCC No. 40394) using a synthetic probe derived from the HCV sequence in clone CA290a / o (Figure 11). The probe sequence was: 5 'TCA GAT CGT TGG TGG AGT TTA CTT GTT GCC 3'.

The HCV cDNA sequence in CA205a, shown in Figure 13, overlaps with the cDNA sequences of the gentle clones ag30a and CA290a. The sequence overlap with the CA290a sequence is shown by a dotted line over the sequence (the figure also shows putative amino acids encoded in this fragment).

. As observed from the HCV cDNA sequences in clones CA205a and ag30a, HCV is assumed. . The polyprotein appears to start from the ATG start codon; The HCV sequences in both clones contain an in-frame adjacent double termination codon (TGATAG) 42 µg upstream of this ATG. The HCV ORF appears to start after these stop codons and extend at least 8907 nucleotides (see the cDNA for the combined HCV shown in Figure 17).

", 25 I" · V · Isolation and Sequence of Clone 18g Based on the Clone Ag30a Sequence (See Figure 12) from the Original Lambda gtl 1 Library ":" (ATCC No. 40394), a synthetic probe having the following sequence was made: '1.j 5' CCA TAG TGG TCT GCG GAA CCG GTG AGT ACA 3 '.

55 105046

Screening of the original lambda gtll-HCV cDNA library by probe gave clone 18g having the HCV cDNA sequence shown in Figure 14. The figure shows the overlap with clone ag30a and putative polypeptides encoded in HCV cDNA.

s The cDNA sequence in clone 18g (Cl8g or 18g) overlaps with the sequences of clones ag30a and * CA205a described above. The C18g sequence contains the stop codon region found in clone ag30a. The region of the polynucleotide upstream of these stop codons is believed to represent part of the 5 'region of the HCV genome, which may contain short ORFs and can be confirmed by direct sequencing of the purified HCV genome. These putative small coded peptides may play a regulatory role in translation. The region upstream of the C18g region represented by the HCV genome can be isolated for sequence analysis using essentially the technique described in EP 318,216 for isolating cDNA sequences upstream of the HCV cDNA sequence in clone 12f. Essentially, small reverse transcriptase oligonucleo-15 tide primers are synthesized based on the C18g sequence and used to bind to the corresponding sequence in HCV genomic RNA. The primer sequences are close to the known 5 'end of C18g, but sufficient downstream to allow the design of probe sequences upstream of the primer sequences. Known standard methods for priming and. used for cloning. The resulting cDNA libraries are screened for sequences up to • 20 upstream of the primer sites (deduced from the sequenced Cl8g). HCV genomic

'*; RNA is obtained from either plasma or liver samples from individuals with NANBH. Because HCV

* «·; ··· seems to be a Flavian virus, the 5'-end of the genome can be modified by a" cap "structure.

• * _: .ϊρ! It is known that the genomes of Flaviviruses contain 5 'end "cap" structures.

ML (Yellow Fever Virus, Rice et al. (1988); Dengue Virus, Hahn et al. (1988); Japanese Encephalitis Virus (1987)).

• · · • · · · · * * -

»M

Isolation and Sequence of Clones from Beta HCV cDNA Stringes

Clones containing the cDNA representing the 3 'end region of the HCV genome were isolated

• * I

already from the cDNA library constructed from the original infectious chimpanzee plasmid library used to generate the HCV cDNA lambda-gtll library (ATCC No.

40394) described in EP Publication No. 318.216. Plasma RNA was "tailed" with poly-rA using poly (rA) polymerase to generate a DNA library, and cDNA was synthesized using oligo (dT) 12-18 as a primer for reverse transcriptase. The resulting RNArcDNA hybrid was digested with RNAase H and converted to double stranded HCV cDNA. The resulting HCV cDNA was cloned into lambda-gt10 using essentially the technique described by Huynh (1985) to give a beta (or b-) HCV cDNA kiqast. The procedures followed were as follows.

A plasma sample (12 ml) was treated with proteinase K and extracted with an equal volume of phenol saturated with 0.05M Tris-HCl, pH 7.5, 0.05% (v / v) betamercaptoethanol, 18% (w / v) hydroxyquinoline, 1 mM EDTA. The resulting aqueous phase was reextracted with a phenol mixture followed by 3 extractions with a 1: 1 mixture of phenol and chloroform risoamyl alcohol (24: 1), followed by 2 extractions with a mixture of chloroform and isoamyl alcohol (1: 1). After adjusting the aqueous phase to 200 mM NaCl, the aqueous phase nucleic acids were precipitated overnight at -20 ° C with 2.5 volumes of cold absolute n ethanol. The precipitates were collected by centrifugation at 10,000 rpm for 40 minutes, washed with 70% ethanol containing 20 mM NaCl and 100% cold ethanol, dried for 5 minutes in a desiccator and dissolved in water.

____; Isolated nucleic acids from an infectious chimpanzee plasma repository were provided with a poly-2? RA tail using poly-A polymerase in the presence of human placental ribonuclease inhibitor (HPRI) (purchased from Amersham Corp.) using MS2 RNA as carrier.

• «·; ·; Isolated nucleic acids equal to 2 ml of plasma were incubated in solution of V containing TMN (50 mM Tris-HCl, pH 7.9, 10 mM MgCl2, 250 mM NaCl, 2.5 · MM MnCl2, 2 mM dithiothreitol (DTT)), 40 micromolar alpha- [32 P] ATP, 20 units HPRI (Amersham Corp.) and approximately 9-10 units RNase-free poly-A- · · · Polymerase (BRL). Incubate for 10 minutes at 37 ° C and quench the reactions with EDTA (~ 250 mM final concentration). The solution was extracted with an equal volume of phenol • V '* chloroform and the same volume of chloroform and nucleic acids were precipitated overnight -

I «I M

At 20 ° C with 2.5 volumes of ethanol in the presence of 200 mM NaCl.

so * · • «· • · · 57 105046

Isolation of clone b5a

The beta HCV cDNA library was screened by hybridization using a synthetic probe having a sequence based on the HCV cDNA sequence in clone 15e. The isolation of clone 15e is described in EP 318,216 and its sequence is shown in Figure 3. The sequence of the synthetic probe was: 5 'ATT GCG AGA TCT ACG GGG CCT GCT ACT CCA 3'.

Screening of the library gave a clone beta-5a (b5a) containing the HCV cDNA region, which is approximately 1000 base pairs. The 5 'region of this cDNA overlaps with clones 35f, 19g, 26g and 15e (clones described above). The region between the 3 'end of the poly A sequence and its 3' sequence which overlaps with clone 15e contains approximately 200 base pairs. This clone allows the sequence region of the 3 'end of the HCV genome to be identified.

The sequence of is b5a is contained in the HCV cDNA sequence in clone 16jh (described below). In addition, the sequence is also present in CC34a, which is isolated from the original lambda-gt11 libraries (ATCC No. 40394). (The original lambda-gt11 libraries are referred to herein as the "C" libraries).

Sequence Isolation of Clones Created by PCR amplification of the 3 'Region of the HCV Eenome • ·: A: Many cDNA clones containing nucleotide sequences derived from the 3' region of the HCV genome have been generated. area. This was done by amplifying the genomic target region using the polymer-25 backbone chain reaction technique described by Saiki et al. (1986) and Saiki et al. (1988), which was modified as described below. The HCV RNA, which was amplified, was obtained from the original? · I 'infectious chimpanzee plasma pool used in the HCV cDNA lambda-gtl 1- • *. * ': for creating a library (ATCC No. 40394) described in EP 318,216. Isolation of HCV RNA was performed as described above. The isolated RNA was tailed 3'- * 30 by ATP with E. coli poly-A polymerase as described by Sippel (1973), except that the nucleic acid substrate was replaced by the nucleic acids isolated from the serum of the pancreas. The tailed RNA was then reverse transcribed into cDNA using reverse transcriptase 58 105046 was a go dT primer adapter substantially as described by Han (1987) except that the primer adapter sequence components were:

Stuffer Notl SP6 Promoter Aluke AATTC GCGGCCGC CATACGATTTAGGTGACACTATAGAA Ti5 5

The resulting cDNA was amplified by PCR using two primers:

Primer Sequence

JH32 (30-mer) ATAGCGGCCGCCCTCGATTGCGAGATCTAC

JH11 (20-mer) AATTCGGGCGGCCGCCATACGA

The 10 JH32 primer contained 20 nucleotide sequences capable of hybridizing to the 5 'end of the cDNA target site with an estimated Tm of 66 ° C. JH11 was derived from the oligo dT primer adapter portion; thus, it was specific for the 3 'end of the cDNA with a Tm of 64 ° C. Both primers were designed to have a recognition site at the 5 'end of the restriction enzyme, NotI, for use in subsequent cloning of the amplified HCV cDNA.

The PCR reaction was performed by suspending cDNA and primers in 100 µl of reaction mixture which. contained four deoxynucleoside triphosphates, buffer salts and metal ions and heat stable 20 l DNA polymerase isolated from Thermus aauaticus (Taq polymerase) I · contained in Perkin Elmer Cetus PCR Kit (N801-0043 or N801). -0055). The PCR reaction was carried out for 35 cycles on a Perkin Elmer Cetus DNA thermal cycler. Each cycle consisted of a 1.5 minute denaturation step at 94 ° C, · ·: T: a heat treatment step at 60 ° C for 2 minutes and a primer extension step at 72 ° C for 3 25 minutes. The PCR products were subjected to Southem blot analysis using a 30 nucleotide probe, JH34, whose sequence was based on the 3 'end sequence of clone 15e. Sequence of JH34 on: '5' CTT GAT CTA CCT CCA ATC ATT CAA AGA CTC 3 '.

The size of the PCR products detected by the HCV cDNA probe ranged from about 50 to about 400 base pairs.

50 59. 105046

To clone the amplified HCV cDNA, the PCR products were cleaved with NotI and selected by size by polyacrylamide gel electrophoresis. DNAs larger than 300 bp were cloned into the Not1 site of pUC18S. The vector pUC18S is constructed by the insertion of a Not1 polylinker cloned between the EcoRI and SalI sites of pUC18. Clones * were screened for HCV cDNA using the JH34 probe. A number of positive clones were obtained and sequenced. The nucleotide sequence of the HCV cDNA insert of one of these clones, 16 µh, and the amino acids encoded therein are shown in Figure 15. The nucleotide heterogeneity observed in the HCV cDNA sequence in clone 16 µh compared to another clone in this region is indicated in the figure. .

Collected HCV cPNA Sequences The HCV cDNA sequence is assembled from a series of overlapping clones derived from the various HCV cDNA libraries described above. The HCV cDNA sequence assembled in this sequence, obtained from the clones bll4a, 18g, ag30a, CA205a, CA290a, CA216a, pil4a, CA167b, CA156e, CA84a and CA59a, is upstream of the HCV cDNA sequence published in EP, No. 318,216, and is shown in Fig. 16. The assembled HCV cDNA sequence obtained from clones b5a and 16jh is downstream of the codon: V: 20 of the HCV cDNA sequence disclosed in EP Publ. 318.216.

• I I

«I

* * Figure 17 shows the assembled HCV cDNA sequence derived from the above-described clones and the assembled HCV cDNA sequence disclosed in EP Publ. 318.216.

The clones from which the sequence was derived are b1a, 18g, ag30a, CA205a, CA290a, CA216a, ... 25 pil4a, CA167b, CA156e, CA84a, CA59a, K9-1 (also called k9 -l: ksi), 26j, 13i, • · · „y.'m 12f, 14i, 1 Ib, 7f, 7e, 8h, 33c, 40b, 37b, 35, 36, 81,32, 33b, 25c, 14c, 8f, 33f, 33g, 39c, 35f, • · ·. ·. 19g, 26g, 15e, b5a and 16jh. In the figure, three spots on the sequence denote the position of the putative initiator methionine codon.

Clone b1a was obtained using the cloning procedure described above for clone b5a, except that the probe was a synthetic probe used to detect clone 18g above. Clone b1a 14a overlaps with clones 18g, ag30a and CA205a, except that clone 60105046 b1a contains an additional two nucleotides upstream of clone 18g (i.e., 5'-CA). These two additional nucleotides are included in the HCV genome sequence shown in Figure 17.

It should be noted that although many of the clones described above were obtained from libraries other than the original lambda-gtl lC library of HCV cDNA (ATCC No. 40394), these clones contain HCV cDNA sequences which overlap with the HCV cDNA sequences of the original library. Thus, substantially all HCV sequences can be derived from the original lambda-gt11 1-C library (ATCC No. 40394) used to isolate the first HCV cDNA clone (5-1-1). Isolation of clone 5-1-1 is described in EP Publication No. 318.216.

Purification of Fusion Polypentide C100-3 CV Alternative Methods 15

The fusion polypeptide C100-3 (also called HCV cl00-3 and alternatively cl00-3) consists of the superoxide dismutase (SOD) at the N-terminus and the Cl00 HCV poppeptide at the C-terminus. A method for preparing a polypeptide by expressing in yeast and differentially extracting the insoluble fraction of the extracted host yeast cells is described in EP Publ. 318.216. An alternative method for making this fusion polypeptide is described below. In this method, antigen is precipitated from crude cell lysate with acetone; the acetone-precipitated antigen is then subjected to ion-exchange chromatography and further purified by gel filtration.

• · · »· · · ·

... 25 The fusion polypeptide C100-3 (HCV cl00-3) is expressed in the yeast strain JSC 308 (ATCC

• · n

Well. 20879) transformed with pAB24C 100-3 (ATCC No. 67976); transformed yeast cells are grown under conditions that allow expression (i.e., by growth in YEP, containing 1% glucose). (See EP Publication No. 318,216). Cell lysate was prepared by suspending cells in buffer A (20 mM Tris-HCl, pH 8.0, 1 mM EDTA, 1 mM PMSF).

Already Cells were disrupted by grinding with glass beads in a Dynomill type homogenizer or «· · • · ·. The degree of cell disruption was monitored by counting the cells under a microscope Ä1105046

Oh, phase optics. Damaged cells look dark, while viable cells are light in color. The percentage of disrupted cells was determined.

The percentage of Kim broken cells was about 90% or more, the waste of broken cells was separated from the glass beads by centrifugation, and the glass beads were washed with buffer A. - After combining the washes and the homogenate, the insoluble material of the lysate was obtained by centrifugation. The pellet material was washed to remove soluble proteins by suspension in buffer B (50 mM glycine, pH 12.0, 1 mM DTT, 500 mM NaCl). The insoluble material was recovered by centrifugation and made soluble by suspending in buffer containing SDS. The extraction solution can be heated in the presence of betamercaptoethanol and concentrated by ultrafiltration. HCV cl00-3 extract was precipitated with cold acetone. If desired, the precipitate may be stored at temperatures below -15 ° C.

Prior to ion exchange chromatography, the acetone precipitated material was recovered by centrifugation and could be dried under a nitrogen atmosphere. The precipitate was suspended in buffer D (50 mM glycine, pH 10.0, 1 mM DTT, 7 M urea) and centrifuged into a pellet of insoluble material. The spinning fluid material was used on an anion exchange column previously equilibrated: · · · · · · · · · · · · · · · · · · · · · Weighted with buffer D. Fractions were collected and analyzed by ultraviolet absorbance or gel electrophoresis on SDS-polyacrylic gels. The fractions containing HCV cl00-1.3 were stored.

To purify the HC00 cl00-3 polypeptide by gel filtration, the ion exchange stored storage gel fractions were heated in the presence of betamercaptoethanol and SDS and the eluate was concentrated by ultrafiltration. The concentrate was applied to a gel filtration column previously equilibrated with buffer E (20 mM Tris-HCl, pH 7.0, 1 mM DTT, 0.1% SDS).

The presence of HCV cl00-3 in the eluted fractions and also the presence of impurities was determined by gel electrophoresis on polyacrylamide gels in the presence of SDS and by po-. hypeptides visible. The fractions containing purified HCV cl00-3 were stored.

The fractions already rich in H CV: 100-3 can be further purified by repeating the gel filtration procedure. If particle-shaped material is removed, material containing HCV cl00-3 can be filtered through a 0.22 µm filter. through.

62 105046 Expression and Antigenic Polypeptides Encoded in HCV cDNA. Polypeptides encoded in numerous HCV cDNAs spanning the HCV genomic ORF were expressed in E. coli and tested for antigenicity using serum obtained from numerous individuals with NANBH. Expression vectors containing the cloned HCV cDNAs were constructed from pSODcfl (Steimer et al. (1986)). To make sure that the correct reading frame was obtained, three separate expression vectors, pcfl AB, pcflCD and pcflEF, were created by attaching one of the three linkers AB, CD and EF to the BamHI-EcoRI fragment resulting from complete restriction of the pSODcfl vector with EcoRI and BamHE. followed by treatment with alkaline phosphatase. Link kerfs were generated from six oligomers, A, B, C, D, E and F. Each oligomer was phosphorylated by treatment with kinase in the presence of ATP prior to heat treatment to a complementary oligomer-15. The sequences of the synthetic linkers were as follows.

Name_DNA sequence (5 '-> 3')

A GATC CTG AAT TCC TGA TAA

....: B GAC TTA AGG ACT ATT TTA A

• ·. *. ·. 20

C GATC CGA ATT CTG TGA TAA

D GCT TAA GAC ACT ATT TTA A

i «• · • · · • f ·

E GATC CTG GAA TTC TGA TAA

• · *

25 F GAC CTT AAG ACT ATT TTA A

• M

• # · • · ·

Each of the three linkers destroys the original EcoRI site and creates a new EcoRI site '. *. linker, but in a different reading frame. As a result, the EcoRI fragments of the HCV cDNA, which were isolated from the clones upon insertion into the expression vector, were present in three different readouts.

• · • • «· • i · • ·

HCV cDNA fragments in the given lambda-gt11 clones were cut by Eco RI cut; each fragment was inserted into pcflAB, pcflCD and pcflEF. These 63105046 expression constructs were then transformed into D1210 E. coli cells, the transformants were cloned and the recombinant bacteria of each clone were expressed to express fusion polypeptides by growing bacteria in the presence of IPTG.

Expression products of the given HCV cDNAs were tested for antigenicity by direct immunological screening of the colonies using a modification of the method described by Helfman et al. (1983). Briefly, as shown in Figure 18, the bacteria were applied to nitrocellulose filters on ampicillin plates to give approximately 1000 colonies per filter. The colonies were re-applied to a nitrocellulose filter and grown overnight in the presence of 2 mM IPTG and ampicillin. The bacterial colonies were lysed by suspending the nitrocellulose filters for about 15-20 minutes in an atmosphere saturated with CHCl3 vapor. Each filter was then placed in a single 100 mm Petri dish containing 10 mL of 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 5 mM MgCl 2, 3% (w / v) BSA, 40 pg / mL lysozyme and 0.1 pg / ml of DNase. The plates were gently shaken for at least 8 hours at room temperature. The filters were rinsed in TBST (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.005% Tween 20). After incubation, cell debris was rinsed and incubated in TBS (TBST without Tween) containing 10% sheep serum; incubation was carried out for 1 hour. Filters •: · I was then incubated with pretreated serum in TBS from individuals with NANBH, such as: ', ·'; 20 ka included: 3 chimpanzees; 8 patients with chronic HANBH whose sera were • · · • V positive for antibodies against HCV C100-3 (described in; EP Publication No. 318,216 and above) (also referred to as C100) ); 8 patients with NANBH chronically negative sera for anti-Cl00 antibodies; ··· • # · * · 'recovered patient with serum negative for anti-Cl00 antibodies; and ... 25 6 patients with community-acquired NANBH, including one with serum strength • «· • ·«. I, 'cos positive for anti-C100 antibodies and one with serum borderline positive for anti-C100 antibodies. Serum diluted with TBS was pretreated by pre-absorbing with hSOD. The filters were incubated with serum for at least two hours. After incubation, the filters were washed two times for 30 minutes with TBST. Labeling of the expressed proteins to which serum antibodies were attached was carried out by incubation for 2 hours with I-Labeled 64105046 sheep anti-human antibody. After washing, the filters were washed twice for 30 minutes with TBST, dried and autoradiographed.

A number of clones (see below) express polypeptides containing HCV epitopes, which were immunologically reactive with serum from individuals with NANBH. Five of these polypeptides were highly immunogenic in that antibodies to the HCV epitopes in these polypeptides were detected in many different patient sera. The clones encoding these polypeptides and the position of the polypeptides in the putative HCV polyprotein (where the amino acid numbers start from the putative initiator codon) are as follows: clone ηο 5-1-1, amino acids 1694-1735; clone C100, amino acids 1569-1931; clone 33c, amino acids 1192-1457; clone CA279a, amino acids 1-84; and clone CA290a, amino acids 9-177. The position of the immunogenic polypeptides in the putative HCV polyprotein is immediately shown below.

is Clones encoding polypeptides. with proven reactivity with NANBH notepad serum

Clone Role in HCV Generation Protein (Amino Acid Number Starting with Yeast-; ·: 20 Initiator Methion) 9 9 9 9 9 • 99 • · • · * CA279a 1-84! . * CA74a 437-582 • ♦ · 25 13i 511-690 • · · • · · CA290a 9-177 33c 1192-1457 • · * 9 40b 1266-1428 /. : 5-1-1 1694-1735 f ** 30 81 1689-1805 «<33b 1916-2021 25c 1949-2124 14c 2054-2223 65 105046 8f 2200-3325 33f 2287-2385 33g 2348-2464 39c 2371-2502 s. 15e 2796-2886 C100 1569-1931

Results on the immunogenicity of the polypeptides encoded in the various clones examined suggest efficient detection and immunization sequences may include panels of HCV polypeptides / epitopes.

Expression of HCV epitopes in yeast

Three different yeast expression vectors that allow insertion of HCV cDNA into three different reading frames were constructed. The construction of one vector, pAB24C 100-3, is described in EP Publication No. 318.216. In the studies below, the products expressed by the HCV cDNA from the clones listed above in the antigenic mapping assay using E. coli replaced the C100-HCV cDNA. The structure of the other vectors replaces the E. coli · above. ; adapter used in studies with one of the following adapters: • ·::: 20 • «• V Adapter 1

ATT TTG AAT TCC TAA TGA G

V .: AC TTA AGG ATT ACT CAG CT

1 * 1 • · · · · m 25 Adapter 2 • · ·

: · *: AAT TTG GAA TTC TAA TGA G

: · 5 * AC CTT AAG ATT ACT CAG CT

The inserted HCV cDNA is expressed in yeast transformed with vectors using the expression conditions described above for fusion polypeptide Cl00-3. The resulting * · polypeptides are screened using serum from individuals is NANBH described above for screening immunogenic polypeptides encoded in HCV cDNAs expressed in E. coli.

Comparison of the Hydrophobic Profile of HCV Polv Proteins with West Nile Virus Polyvinyl Protein 5 and Deneue Virus NS1 The hydrophobic profile of the HCV polyprotein segment was compared to that of a typical Flavivirus, West Nile virus. The West Nile virus polypeptide polypeptide sequence was derived from a known polynucleotide sequence that encodes non-structural proteins of that virus. The polyprotein sequence of HCV was derived from the sequence of overlapping cDNA clones. The profiles were defined by an antigen program that uses a 7 amino acid wide window (said amino acid and three residues on each side) to give an average hydrophobicity for a given amino acid residue. The parameters that give reactive hydrophobicity to each amino acid residue are from Kyte and a Doolittle (1982). Figure 19 shows the hydrophobicity profiles of two polyproteins; the regions corresponding to the West Nile virus nonstructural proteins, NS1-NS5, are indicated in the figure. As can be seen from the figure, there is a common similarity between the profiles of HCV polyprotein and West Nile virus polyprotein.

The amino acid sequence encoded by the 5'-: Y: 20 region of the HCV cDNA shown in Figure 16 is compared to the corresponding region of one strain of Dengue virus described above. profile of hydrophobicity and hydrophilicity regions (data not shown). This comparison revealed that the HCV and Dengue virus polypeptides encoding this region, which corresponds to the region encoding NS1 (or a portion thereof), were similar ··· • ♦ · * · * hydrophobicity / hydrophilicity profiles.

L. Similarity in Hydrophobicity Profiles with previously Identified Homologs in HCV and Dengue Flavivirus Amino Acids

• * ·· '; 318,216, suggests that HCV is related to these members of the Flavivirus family.

Characterization of putative HCV-encoded polypeptides already in the HCV ORF 67 105046

The sense strand of the HCV cDNA shown in Figure 17 was deduced from the overlapping HCV cDNAs in the various clones described in EP Publication No. 318,216 and those described above. From the sequence it can be deduced that the HCV genome contains predominantly one long continuous ORF encoding a polyprotein. In the sequence, the nucleotide number 1 corresponds to the first nucleotide of the initiator MET codon; minus numbers' indicate that the nucleotides are at that distance in the 5 'direction (upstream), while positive numbers indicate that the nucleotides are at that distance in the 3' direction (downstream). The recombinant sequence represents the "sense" strand of the HCV cDNA.

The amino acid sequence of the putative HCV polyprotein derived from the HCV cDNA sense strand sequence is also shown in Figure 17, where position 1 begins with the putative initiator methionine.

The possible protein regions and also the approximate boundaries of the encoded HCV polyprotein are is. the following (identified polypeptides in parentheses are those encoded in the Flavivirus region):

Expected Range Boundary (amino acid numbers) 20 • · “C” (nuclear capsule protein) 1-120 • · “E” (virion coat proteins and · ·; ··· possible matrix proteins (M)) 120-400 “NS 1” (complement fixation antigen?) 400 -660V · 25 "NS2" (unknown function) 660-1050 "NS3" (protease?) 1050-1640 * · 1 "NS4" (unknown function) 1640-2000 • · · ', "NS5" (polymerase?) 2000? end • · • 1 1 30 However, it should be noted that the hydrophobicity profiles (described below) imply that • · · HCV differs from the Flavivirus model, particularly the upstream region of NS2.

• · ψ · 1 68 105046

In addition, the marked borders are not intended to indicate strong boundaries between putative polypeptides.

Further, it can be inferred from the sequence shown in Figure 17 that it has four small ORFs containing ATG upstream of the putative large polyprotein initiator MET. The ATGs of these ORFs are at nucleotide numbers -310, -257, -246, and -127.

Hydrophilic profile and antigenic profile of the polypeptide The hydrophilicity / hydrophobicity profiles and antigenic index of the putative polyprotein encoded in the HCV cDNA sequence shown in Figure 16 were determined by computer analysis. The hydrophilicity / hydrophobicity program was described above. An antigenic index is the result of a computer program based on the following criteria: 1) surface probability; 2) predicting alpha helix by two different methods; 3) predicting beta-15 lamellae by two different methods; 4) predicting U-turns by two different methods; 5) hydrophilicity / hydrophobicity; and flexibility. Profile traces of computer analyzes are shown in Figure 20. In the hydrophilicity profile, deviation above the abscissa means hydrophilicity and below the abscissa means hydrophobicity. The probability that the polypeptide region is antigenic is generally considered to increase with an upward deviation from the abscissa in the hydrophilicity and / or antigenicity profile. However, it should be noted that these profiles do not necessarily represent the im- • · ·: · of the polypeptide. the potency of munogenicity.

• · «·

Identification of co-linear peptides in HCV and Flaviviruses The amino acid sequence of the putative polyprotein encoded into the sense strand of HCV cDNA was compared to known amino acid sequences of several members of the Flaviviruses. Comparison shows that homology is low but, due to the regions where it was found, it is potentially significant. The conserved co-linear regions are shown in Figure 21. In the amino acid numbers already listed below, the sequences represent the number in the putative HCV · · · · · .. polyprotein (See Figure 17).

These persistent topics are similar between Flaviviruses and HCV and imply that there is some similarity between HCV and these flaviviruses.

The following materials listed are deposited with the Budapest Treatyr under the conditions of the American Type Culture Collection (ATCC), 12301 Parklawn Dr., Rockville, Maryland 20852, USA and are assigned the following deposit numbers.

lambda-gtl 1 ATCC No. Date of Deposit HCV cDNA Queue 40394 12/01/1987 to Clone 81 40388 Nov 17, 1987 Clone 91 40389 Nov 17, 1987 Clone 1-2 40390 Nov 17, 1987 Clone 5-1-1 40391 Nov 18, 1987 Clone 12f 40514 Nov 10, 1988 Is Clone 35f 40511 10.11.1988 clone 15e 40513 10.11.1988 clone K9-1 40512 10.11.1988 JSC 308 20879 05.05.1988 pS356 67683 29.04.1988 ____; 20 m «

In addition, the following deposits were made on 11 May 1989.

•: *: • Stock Linkers ATCC No.

D1210 (Cfl / 5-1-1) EF 67967 O'1 D1210 (Cfl / 81) EF 67968 D1210 (Cfl / CA74a) EF 67969 • · · D1210 (Cfl / 35f) AB 67970 »· · 'D1210 (Cn / 279a) EF .67971 D1210 (Cfl / C36) CD 67972 :, 'so D1210 (Cfl / 13i) AB 67973 D1210 (Cfl / C33b) EF 67974 I ·: ·' ·· D1210 (Cfl / 290a) AB 67975 70 105046 HB 101 (AB24 / C100 # 3R) 67976

The following derivatives of strain D1210 were deposited on 5 May 1989.

j Stock Derivative ATCC No.

pCFlCS / C8f 67956 pCFlAB / C12f 67952 pCFlEF / 14c 67949 / o pCFl AB / C25c 67958 pCFlEF / C33c 67953 pCFlEF / C33f 67950 pCFlCD / 33g 67951

The following positions were deposited on 12.05.1989.

• 20 Strain ATCC No.

Lambda gtl 1 (C35) 40603: v. Lambda gt 10 (beta-5a) 40602 • · D1210 (C40b) 67980: Y: D1210 (M16) 67981

• M

• · * ... 25

Once a corresponding US patent has been granted, all restrictions on the availability of these deposits will be irrevocably removed; and, subject to the provisions of 37 CFR 1.14 and 30 35 USC 1.22, in the course of processing a U.S. application corresponding to this application, it is possible to obtain a designated deposit. In addition, subscribed deposits are maintained for thirty (30) years from the date of deposit or for five (5) years from the date of the last request for a deposit; m · 9 •. ', Or the corresponding US patent, whichever is longer. The storage materials mentioned herein are for convenience only and are not required for the practice of this invention in the light of the description provided herein, and in addition these materials are incorporated herein by reference.

j Industrial Utility

V

The invention, in its numerous embodiments disclosed herein, has many industrial uses, some of which are as follows. HCV cDNAs can be used to design probes to detect HCV nucleic acids in samples. Probes derived from cDNAs can be used to detect HCV nucleic acids, for example, in chemical synthetic reactions. They can also be used in screening programs for antiviral agents, to determine the efficacy of agents to prevent viral replication in cell culture ice and animal model systems. HCV polynucleotide probes are also useful in detecting viral nucleic acids in humans and thus may serve as a basis for the diagnosis of HCV infection in humans.

In addition to the above, the cDNAs provided herein provide information and means for synthesizing polypeptides containing HCV epitopes. These polypeptides are useful in the detection of antibodies to HCV antigens. Described herein are Saija immunoassays for HCV>; 20 infection based on recombinant polypeptides containing HCV epitopes and commercially available for the diagnosis of HCV-induced NANBH, screening blood bank donors for HCV-induced infectious hepatitis, and • · ·: contaminated blood coming from infectious blood donors. Viral antigens also have utility in monitoring the efficacy of antiviral agents in animal model systems. In addition, the polypeptides derived from HCV cDNAs described herein have utility as vaccines in the treatment of HCV infections.

Polypeptides derived from HCV cDNAs are useful as described above. : in addition to uses to generate antibodies against HCV. Thus, they can be used as vaccines against HCV. However, antibodies raised by immunization with HCV polypeptides are also useful in detecting the presence of viral antigens in a sample. Thus, they can be used for HCV

Claims (21)

72 105046 for analyzing the production of polypeptides in chemical ice systems. Anti-HCV antibodies may also be used to monitor the efficacy of antiviral agents in screening programs where these agents are tested in tissue culture systems. They can also be used for passive immunotherapy and for the diagnosis of HCV-induced NANBH in sal-mucus detection of viral antigens in both blood donors and recipients. Another important use for anti-HCV antibodies is in affinity chromatography to purify the virus and viral polypeptides. Purified virus and virus polypeptide preparations may be used in vaccines. However, purified virus can also be useful in developing cell culture systems in which HCV replicates. A method for preparing a therapeutically active polypeptide comprising a continuous sequence of at least 8 amino acids from the HCV polyprotein and an HCV antigenic determinant, wherein the continuous sequence is derived from amino acids 1-450 or 2887-2955 of the HCV polyprotein of Figure 17, characterized in that: the method comprising; A) introducing a recombinant host cell transformed with an expression sequence encoding a polypeptide and expression control units including a promoter compatible with the host cell; and • · b) incubating the host cell to express the polypeptide, followed by isolating and purifying the peptide V * 25. The method according to claim 1, characterized in that the continuous amino acid. the sequence is at least 10 amino acids long. The method of claim 1, wherein the continuous amino acid sequence is at least 15 amino acids long. • · • ♦ · • · 73 105046 2. Förfarande enligt patentkrav 1, kännetecknat därav att längden on this obrutna amino acid sequence of 10 aminosyror. 3. Förfarande enligt patentkrav 1, käonetecknat därav att längden on this obrutna s amino acid sequence of 15 aminosyror. 4. Förfarande enligt patentkrav 1, kännetecknat därav att längden on this obrutna amino acid sequence of 20 aminosyror. 5. The amino acid sequence of the patent for use in patent applications for the use of amino acids 1 and 84: (a) HCV-aminosyror 1-84; (b) HCV-aminosyror 9-177; (c) HCV-aminosyror 1-120; is (d) HCV-aminosyror 2900-2950; eller (e) that the immunologically reactive fragment is ur a-d. A method according to claim 1, characterized in that the continuous amino acid sequence is at least 20 amino acids long. 5 AA1-AA50; AA1-AA84; AA9-AA177; AA50-AA100; AA40-AA90; AA65-AA75; AA99-AA120; AA95-AA110; AA100-AA150; AA150-AA200; AA200-AA250; AA220-AA240; AA245-AA265; AA250-AA300; AA290-AA330; AA290-AA305; AA300-AA350; AA310-AA330; AA350-AA400; AA400-AA450; AA2900, AA2950; AA2910, AA2930; AA2925, AA2950; and AA2945-lo slut (C-band). 5 AA625; AA575-AA605; AA600-AA650; AA600-AA625; AA635-AA665; AA650-AA700; AA645-AA680; AA700-AA750; AA700-AA725; AA725- AA775; AA770-AA790; AA750-AA800; AA800-AA815; AA850-AA875; AA800-AA850; AA920-AA990; AA850-AA900; AA920-AA945; AA940-AA965; AA950-AA1000; AA1000, AA1060; AA1000, AA1050; AA1025- ιο AA1040; ΑΑ1075-ΑΑΠ75; AA1050, AA1200; AA1070, AA1100; AA1100- AA1140; AA1192, AA1457; AA1195, AA1250; AA1200, AA1225; AA1225- AA1250; AA1250, AA1300; AA1260, AA1310; AA1260, AA1280; AA1266- AA1428; AA1300, AA1350; AA1310, AA1340; AA1345, AA1405; AA1350- AA1400; AA1365, AA1380; AA1380, AA1405; AA1400, AA1450; AA1450- 5 AA1-AA50; AA1-AA84; AA9-AA177; AA50-AA100; AA40-AA90; AA65-AA75; AA99-AA120; AA95-AA110; AA100-AA150; AA150-AA200; AA200-AA250; AA220-AA240; AA245-AA265; AA250-AA300; AA290-AA330; AA290-AA305; AA300-AA350; AA310-AA330; AA350-AA400; AA400-AA450; AA2900, AA2950; AA2910, AA2930; AA2925, AA2950; and the AA2945-lo end (C'-end). The method of claim 1, wherein the continuous amino acid sequence is selected from: (a) HCV amino acids 1-84; (b) HCV amino acids 9-177; (c) HCV amino acids 1-120; (d) HCV amino acids 2900-2950; or ίο (e) an immunologically reactive fragment of any one of (a) to (d). 6. Förfarande enligt face av patent krav 1-5, immunoreactive fragment according to the sequence of the obrutna such as ur HCV-aminosyror 1-50, 35-45, 50-20 100,40-90,65-75,80- 90.99-120.95-110, 100-150, 2910-2930 eller 2925-2950. I f I » The method according to any one of claims 1 to 5, characterized in that the continuous sequence is an immunologically reactive fragment selected from HCV amino acids 1-50, 35-45, 50-100, 40-90.65-75, 80-90.99-120 , 95-110,100-150,2910-2930 or 2925-2950. is 7. Förfarande för framställning av en therapeutiskt Active polypeptides, flasks förfarande »· omfattar feljande steg: a) en recombinant dye cell Bruk, transferees and transformers med ett expressionionsystem · 9 '25 som codar en polypeptides, and control element för expression fuzzy innefattar en promotor som är kompatibel med Värdcellen; b) · 9 * * · 'b) expression cell polypeptides, varefter peptides, · 1' isoleras and renas; «> '. nucleotide sequences of omnidirectional polypeptide omfattar en obruten sequences genome for hepatitis C virus (HCV) eller dess complement, «4 · varvid den obrutna nucleotide sequences codar en obruten sequence urinos · A HCV-antigen determinant, the amino acid sequence of which is selected from the group of 105046, the color of which is formed by the form Aa * - Aay of the amino acid sequence of the HCV-polyproteinet is shown in Figure 17: AA1-AA50; AA1-AA84; AA9-AA177; AA50-AA100; AA40-AA90; AA65-AA75; AA99-AA120; AA95-AA110; AA100-AA150; AA150-AA200; AA200-AA250; AA220-AA240; AA245-AA265; AA250-AA300; AA290-AA330; AA290-AA305; AA300-AA350; AA310-AA330; AA350-AA400; AA405-AA495; AA400-AA450; AA437-AA582; AA450-AA500; AA475-AA495; AA500-AA550; AA511-AA690; AA515-AA550; AA550-AA600; AA550-AA625; AA575-AA605; AA600-AA650; AA600-AA625; AA635-AA665; AA650-AA700; AA645-AA680; AA700-AA750; ßο AA700-AA725; AA725-AA775; AA770-AA790; AA750-AA800; AA800-AA815; AA850-AA875; AA800-AA850; AA920-AA990; AA850-AA900; AA920-AA945; AA940-AA965; AA950-AA1000; AA1000, AA1060; AA1000, AA1050; AA1025, AA1040; AA1075, AA1175; AA1050, AA1200; AA1070-AA 1100; AA1100- AA1140; AA1192, AA1457; AA1195-AA 1250; AA1200, AA1225; AA1225- A method for producing a therapeutically active polypeptide, comprising the steps of: a) providing a recombinant host cell transformed with an expression system encoding the polypeptide and expression control units including # 1; 20 host cell compatible promoter; and * ·, ·. ·. b) incubating the host cell to express the polypeptide, followed by the peptide. isolated and purified; Characterized in that the polypeptide comprises a continuous nucleotide sequence capable of selectively hybridizing to the hepatitis C virus genome or its complement, wherein the continuous nucleotide sequence encodes the continuous amino acid sequence shown in Figure 17 and the HCV antigenic determinant, wherein: the continuous sequence is selected from the group set forth below in the brochure * M · «· · '·' 'where the continuous sequence is denoted AAx-AAy and x and y represent amino- *'; acid numbers in the HCV polyprotein shown in Figure 17: • · V ". AA1-AA50; AA1-AA84; AA9-AA177; AA50-AA100; AA40-AA90; AA65-AA75; fso AA99-AA120; AA95-AA110; AA100- AA150; AA150-AA200; AA200-AA250; O AA220-AA240; AA245-AA265; AA250-AA300; AA290-AA330; AA290-AA305; • ·: AA300-AA350; AA310-AA330; AA350-AA400; AA405-AA495; AA400-AA450; M 105046 AA437-AA582; AA450-AA500; AA475-AA495; AA500-AA550; AA511-AA690; AA515-AA550; AA550-AA600; AA550-AA625; AA575-AA605; AA600-AA650; AA600-AA625; AA635-AA665; AA650-AA700; AA645-AA680; AA700-AA750; AA700-AA725; AA725-AA775; AA770-AA790; AA750-AA800; AA800-AA815; s AA850-AA875; AA800-AA850; AA920-AA990; AA850 -AA900; AA920-AA945; AA940-AA965; AA950-AA1000; AA1000-AA1060; AA1000-AA1050; AA1025-AA1040; AA 1075-AA 1175; AA1050-AA1200; AA1070-AA1100; AA1100-AA1140; AA1192-AA1457; AA1195 -AA1250; AA1200-AA1225; AA1225-AA1250; AA1250-AA1300; AA1260-AA1310; AA1260-AA1280; AA1266-lo AA1428; AA1300-AA1350; AA1310-AA1340; AA1345-AA14 05; AA1350-AA1400; AA1365, AA1380; AA1380, AA1405; AA1400, AA1450; AA1450- AA1500; AA1475, AA1515; AA1475, AA1500; AA1500, AA1550; AA1515- AA1550; AA1550, AA1600; AA1570, AA1590; AA1595, AA1610; AA1590- AA1650; AA1610, AA1645; AA1650, AA1690; AA1685, AA1770; AA1690- The method of claim 7, wherein said continuous sequence is selected from the group below wherein the continuous sequence is designated AAx-AAy> and x and y represent the amino acid numbers in the HCV polyprotein shown in Figure 17: AA1-AA50; AA1-AA84; AA9-AA177; AA50-AA100; AA40-AA90; AA65-AA75; AA99-AA120; AA95-AA110; AA100-AA150; AA150-AA200; AA200-AA250; AA220-AA240; AA245-AA265; AA250-AA300; AA290-AA330; AA290-AA305; AA300-AA350; AA310-AA330; AA350-AA400; AA400-AA450; AA2900, AA2950; AA2910, AA2930; AA2925, AA2950; and the AA2945 end (C-terminus). The method of claim 7, wherein said continuous sequence comprises an entire continuous sequence selected from the group below, wherein the entire continuous sequence is designated AAx-AAy and x and y represent amino acid numbers in the HCV polyprotein shown in Figure 17: AA405-AA495; AA437-AA582; AA450-AA500; and AA2850-AA2900. of 9. Förfarande enligt patent krav 7, kännetecknat därav att sagda obrutna amino acid sequence is bestär av en hei obruten sequence vald ur feljande group color of this obrutna sequence har formeln Aa, - Aay där x och y betecknar aminosyranumine 17 HCV-polyprur 17 AA495; AA437-AA582; AA450-AA500; och AA2850-AA2900. 20 10. Förfarande enligt nägot av patentkrav 1-9, kännetecknat därav att nämnda obrutna • ·. '. '. SEQ ID NO: 2 and SEQ ID NO: med en icke-HCV-amino acid sequence. II «%% m · • · ·: ··: 11. Förfarande enligt patentkrav 10, kännetecknat därav att nämnda icke-HCV- • · aminosyrase sequences ur Gruppen bestäende av superoxiddismut sequences, -« Il *. * * 25 betagalactoside a sequence, a signal sequence for utsöndring, a particle formande sequence, a hepatitis B pre-y sequence and a hepatit B beta antigen sequence. • * • · · · · · · · · · Method according to one of claims 1 to 9, characterized in that the continuous sequence is fused to a non-HCV amino acid sequence. Antisense polynucleotides may be used as inhibitors of viral replication. For convenience, anti-HCV antibodies and HCV polypeptides, either natural or combination, may be packaged in kit packs. 15 The method according to claim 10, characterized in that the non-HCV (itf: 20 amino acid sequence) is selected from the group consisting of superoxide dismutase sequence, beta beta-galactose oxidase, secretory signaling sequence, particle I: 1-forming sequence, hepatitis B precursor sequence and hepatitis B peptide. 12. A recombinant vector, characterized in that it is capable of expressing a therapeutically active polypeptide comprising a sequence of at least 8 amino acids in Figure 17 v 1 ·· Amino acids 1-450 or 2887-2955 of the HCV polyprotein according to »II * · 1 ', wherein said vector comprises a continuous nucleotide sequence encoding an amino acid sequence as well as an antigenic determinant wherein the sequence is operably linked to a control sequence 30 which may provide a code sequence i expression in the host cell. 1 · 7S 105046/0 12. Recombinant vector, antigenic pathway for therapeutic use Activated <I · '': polypeptides innehällande en obruten sequence med minst 8 aminosyror 1 - 30 450 eller aminosyroma 2887-2955 i polyproteinet enligt fig 17 The nucleotide sequence of the present invention encodes a codon amino acid sequence and is a determinant of the HCV antigen, a coding sequence and a copy sequence of the expression sequence of the codon sequence. 13. The recombinant vector enligt patent number 12, the coding sequence of which is located 5 obrutna amino acid sequences of 10 aminosyror. Recombinant vector according to claim 12, characterized in that said continuous amino acid sequence is at least 10 amino acids long. 14. The recombinant vector enligt patent number 12, the coding sequence for the amino acid sequence of obrutna ammin 15. 15. The recombinant vector enligt patent krav 12, the coding sequence därav att längden on this obrutna amino acid sequence of 20 aminosyror. Recombinant vector according to claim 12, characterized in that said 5 continuous amino acid sequences are at least 15 amino acids long. 15 AA1500; AA1475, AA1515; AA1475, AA1500; AA1500, AA1550; AA1515- AA1550; AA1550, AA1600; AA1570, AA1590; AA1595, AA1610; AA1590- AA1650; AA1610, AA1645; AA1650, AA1690; AA1685, AA1770; AA1690- AA1720; AA1720, AA1745; AA1745, AA1770; AA1750, AA1800; AA1775- AA1810; AA1795, AA1850; AA1850, AA1900; AA1900, AA1950; AA1900- ... 20 AA 1920; AA1916, AA2021; AA1920, AA1940; AA1949, AA2124; AA1950- AA2000; AA1950, AA1985; AA2000, AA2050; AA2020, AA2045; AA2045- AA2100; AA2045, AA2070; AA2054, AA2223; AA2070, AA2100; AA2100 * • · ·: ·· AA2150; AA2150, AA2200; AA2200, AA2325; AA2250, AA2330; AA2265-: V: AA2280; AA2280, AA2290; AA2287, AA2385; AA2300, AA2350; AA2350- Vi ': 25 AA2400; AA2345, AA2415; AA2345, AA2375; AA2348, AA2464; AA2370- AA2410; AA2400, AA2450; AA2400, AA2425; AA2415, AA2450; AA2445- * * ·: AA2500; AA2371, AA2502; AA2500, AA2550; AA2505, AA2540; AA2550- * · «: ·; 1 AA2600; AA2560, AA2580; AA2600, AA2650; AA2620, AA2650; AA2650- AA2700; AA2655, AA2670; AA2670, AA2700; AA2700, AA2750; AA2750-30 AA2800; AA2755, AA2780; AA2780, AA2830; AA2785, AA2810; AA2796- AA2886; AA2810, AA2825; AA2800, AA2850; AA2850, AA2900; AA2900 - * '· **: AA2950; AA2910, AA2930; AA2925, AA2950; and AA2945-slut (C-band). 84 105046 15 AA1250; AA1250, AA1300; AA1260, AA1310; AA1260, AA1280; AA1266- AA1428; AA1300, AA1350; AA1310, AA1340; AA1345, AA1405; AA1350- AA1400; AA1365, AA1380; AA1380, AA1405; AA1400, AA1450; AA1450- AA1500; AA1475, AA1515; AA1475, AA1500; AA1500, AA1550; AA1515- AA1550; AA1550, AA1600; AA1570, AA1590; AA1595, AA1610; AA1590- The recombinant vector of claim 12, wherein said continuous amino acid sequence is at least 20 amino acids long. 16. The recombinant vector of claim 12, wherein said continuous amino acid sequence is selected from the group consisting of: (a) HCV amino acids 1-84; (b) HCV amino acids 9-177; (c) HCV amino acids 1-120; is (d) HCV amino acids 2900-2950; or (e) an immunologically reactive fragment of any of a) to d). 15 AA1720; AA1720, AA1745; AA1745, AA1770; AA1750, AA1800; AA1775- AA1810; AA1795, AA1850; AA1850, AA1900; AA1900, AA1950; AA1900- AA1920; AA1916, AA2021; AA1920, AA1940; AA1949, AA2124; AA1950- AA2000; AA1950, AA1985; AA2000, AA2050; AA2020, AA2045; AA2045- AA2100; AA2045, AA2070; AA2054, AA2223; AA2070, AA2100; AA2100- 16. The recombinant vector enligt patent number 12, the amino acid sequence of such an obrutna amino acid sequence in a group: (a) HCV-aminosyror 1-84; (b) HCV-aminosyror 9-177; (c) HCV-aminosyror 1-120; (d) HCV-aminosyror 2900-2950; eller (e) that immunologically reactive fragment ur a), (b), (c) eller (d). ____: 20. ·. ·. 17. The recombinant vector enligt face av patent number 12-16, the lumbar spine därav att like this; obrutna sequence and immunologically reactive fragment based on ur HCV-aminosyror 1-50, 35- • · ·: ··: 45, 50-100, 40-90.65-75, 80-90.99-120, 95-110 , 100-150, 2910-2930 eller 2925-2950. • 18. The recombinant vector, the coding sequence for the nucleotide sequences of the omnidirectional nucleotide sequence selective hybridizer account genome for hepatitis C virus (HCV) eller. 'dess complement, varvid den obrutna nucleotide sequences kodar en obruten sequence • · · * \ aminosyror ur figur 17 och en HCV-antigen determinant, och sagda obrutna • *. "the amino acid sequence of the superfamily is the color of the obrutna sequence har formeln Aa, t · · · jo - Aay där x och y betecknar aminosyranummer i HCV-polyproteinet enligt figure 17: AA1-AA50; AA1-AA84; AA9-AA177; AA50 -AA100; AA40-AA90; AA65-AA75; AA99-AA120; AA95-AA110; AA100-AA150; AA150-AA200; AA200-105046 AA250; AA220-AA240; AA245-AA265; AA250-AA300; AA290-AA330; AA290- AA305; AA300-AA350; AA310-AA330; AA350-AA400; AA405-AA495; AA400-AA450; AA437-AA582; AA450-AA500; AA475-AA495; AA500-AA550; AA511-AA690; AA515-AA550; AA550-AA600; AA550- A recombinant vector according to any one of claims 12 to 16, characterized in that the continuous amino acid sequence is an immunologically reactive fragment selected. 20 groups consisting of HCV amino acids 1-50, 35-45, 50-100, 40-90, 65-75, 80-90, 99- 120.95-100, 100-150, 2910-2930 or 2925 -2950. A recombinant vector, characterized in that it comprises a continuous nucleotide sequence capable of selectively hybridizing to the hepatitis C virus (HCV) genome or its complement, wherein the continuous nucleotide sequence is encodes the continuous amino acid sequence and the HCV antigenic determinant shown in Figure 17, and the continuous amino acid sequence is selected from the following group, where the continuous sequence is designated AAX-AAV * ·· ** • · · * · '* And x and y represent the amino acid numbers in the HCV (polyprotein shown in Figure 17: " 30 AAI-AA50; AA1-AA84; AA9-AA177; AA50-AA100; AA40-AA90; AA65-C: AA75; AA99- AA120; AA95-AA110; AA100-AA150; AA150-AA200; AA200- • AA250; AA220-AA240; AA245-AA265; AA250-AA300; AA290-AA330; 77 105046 AA290-AA305; AA300-AA350; AA310-AA330; AA350-AA400; AA405-AA495; AA400-AA450; AA437-AA582; AA450-AA500; AA475-AA495; AA500-AA 550; AA511-AA690; AA515-AA550; AA550-AA600; AA550-AA625; AA575-AA605; AA600-AA650; AA600-AA625; AA635-AA665; s ΑΑ650-ΑΑ700; ΑΑ645-ΑΑ680; ΑΑ700-ΑΑ750; ΑΑ700-ΑΑ725; ΑΑ725- ΑΑ775; ΑΑ770-ΑΑ790; ΑΑ750-ΑΑ800; ΑΑ800-ΑΑ815; ΑΑ850-ΑΑ875; ΑΑ800-ΑΑ850; ΑΑ920-ΑΑ990; ΑΑ850-ΑΑ900; ΑΑ920-ΑΑ945; ΑΑ940- ΑΑ965; ΑΑ950-ΑΑ1000; ΑΑ1000-ΑΑ1060; ΑΑ1000-ΑΑ1050; ΑΑ1025-ΑΑ1040; AA 1075-AA 1175; AA1050, AA1200; AA 1070-AA 1100; AA1100-lo AA1140; AA1192, AA1457; AA1195, AA1250; AA1200, AA1225; AA1225- AA1250; AA1250, AA1300; AA1260, AA1310; AA1260, AA1280; AA1266, AA1428; AA1300, AA1350; AA1310, AA1340; AA1345, AA1405; AA1350, AA1400; AA1365, AA1380; AA1380, AA1405; AA1400, AA1450; AA1450, AA1500; AA1475, AA1515; AA1475, AA1500; AA1500, AA1550; AA1515 to AA1515; AA1550, AA1600; AA1570, AA1590; AA1595, AA1610; AA1590- AA1650; AA1610, AA1645; AA1650, AA1690; AA1685, AA1770; AA1690, AA1720; AA1720, AA1745; AA1745, AA1770; AA1750, AA1800; AA1775, AA1810; AA1795, AA1850; AA1850, AA1900; AA1900, AA1950; AA1900, AA1920; AA1916, AA2021; AA1920, AA1940; AA1949, AA2124; AA1950-20 AA2000; AA1950, AA1985; AA2000, AA2050; AA2020, AA2045; AA2045- • · AA2100; AA2045, AA2070; AA2054, AA2223; AA2070, AA2100; AA2100- «« 4 AA2150; AA2150, AA2200; AA2200, AA2325; AA2250, AA2330; AA2265- ·: ··: AA2280; AA2280, AA2290; AA2287, AA2385; AA2300, AA2350; AA2350- AA2400; AA2345, AA2415; AA2345, AA2375; AA2348, AA2464; AA2370- * · *: ': 25 AA2410; AA2400, AA2450; AA2400, AA2425; AA2415, AA2450; AA2445- AA2500; AA2371, AA2502; AA2500, AA2550; AA2505, AA2540; AA2550- · ♦ · Σ AA2600; AA2560, AA2580; AA2600, AA2650; AA2620, AA2650; AA2650- • M! AA2700; AA2655, AA2670; AA2670, AA2700; AA2700, AA2750; AA2750- «·:. ·· ί AA2800; AA2755, AA2780; AA2780, AA2830; AA2785, AA2810; AA2796- 30 AA2886; AA2810, AA2825; AA2800, AA2850; AA2850, AA2900; AA2900- '\\\: AA2950; AA2910, AA2930; AA2925, AA2950; and the AA2945 end (C-terminus). • • * * • · I • · 78 105046 The recombinant vector enligt patent number 18, the coding sequence for the amino acid sequence of the obrutna group is the color coding sequence for the amino acid sequence Aa, - The amino acid sequence for the HCV-polyproteinet enligt figure 17 is: Recombinant vector according to claim 18, characterized in that said continuous amino acid sequence is selected from the group consisting of the continuous sequence designated AAx-AAyt and x and y representing the amino acid numbers in the HCV polyprotein shown in Figure 17: 20. The recombinant vector en patent patent code 19, the coding sequence for this amino acid sequence is the best sequence of the color coding sequence Aa1 - Aay der x och y betecknar amino-17 AA-15 en5 ; AA437-AA582; AA450-AA500; och AA2850-AA2900. 20 AA1650; AA1610, AA1645; AA1650, AA1690; AA1685, AA1770; AA1690- · AA1720; AA1720, AA1745; AA1745, AA1770; AA1750, AA1800; AA1775- * · «: v. AA1810; AA1795, AA1850; AA1850, AA1900; AA1900, AA1950; AA1900- • · AA1920; AA1916, AA2021; AA1920, AA1940; AA1949, AA2124; AA1950- AA2000; AA1950, AA1985; AA2000, AA2050; AA2020, AA2045; AA2045- • · 2s AA2100; AA2045, AA2070; AA2054, AA2223; AA2070, AA2100; AA2100- AA2150; AA2150, AA2200; AA2200, AA2325; AA2250, AA2330; AA2265- • · ·: AA2280; AA2280, AA2290; AA2287, AA2385; AA2300, AA2350; AA2350- • · ·: AA2400; AA2345, AA2415; AA2345, AA2375; AA2348, AA2464; AA2370- AA2410; AA2400, AA2450; AA2400, AA2425; AA2415, AA2450; AA2445- its AA2500; AA2371, AA2502; AA2500, AA2550; AA2505, AA2540; AA2550- AA2600; AA2560, AA2580; AA2600, AA2650; AA2620, AA2650; AA2650- AA2700; AA2655, AA2670; AA2670, AA2700; AA2700, AA2750; AA2750-8i. 105046 AA2800; AA2755, AA2780; AA2780, AA2830; AA2785, AA2810; AA2796- AA2886; AA2810, AA2825; AA2800, AA2850; AA2850, AA2900; AA2900- AA2950; AA2910, AA2930; AA2925, AA2950; and AA2945-slut (C-band). 8. Förfarande enligt patent krav 7, kernnetecknat därav att attda obrutna aminosyrase sequences and ur ovandejande group color of the obrutna sequence har formeln Aa, - Aay där x och y betecknar aminosyranummer i HCV-polyproteinet enligt AA50: AA; AA1-AA84; AA9-AA177; AA50-AA100; AA40-AA90; AA65-AA75; AA99-AA120; AA95-AA110; AA100-AA150; AA150-AA200; AA200-AA250; AA220-AA240; ιο AA245-AA265; AA250-AA300; AA290-AA330; AA290-AA305; AA300-AA350; AA310-AA330; AA350-AA400; AA400-AA450; AA2900, AA2950; AA2910, AA2930; AA2925, AA2950; and AA2945-slut (C-band). A recombinant vector according to claim 19, characterized in that the continuous amino acid sequence consists of an entire continuous sequence selected from the group consisting of AAx-AAy > and x and y representing the amino acid is numbers in the HCV polyprotein shown in Figure 17: AA405-AA495; AA437-AA582; AA450-AA500; and AA2850-AA2900. A host cell capable of producing a therapeutically active polypeptide comprising an HCV determinant of at least 8 amino acids, characterized in that it is transformed by a recombinant vector according to any one of claims 12 to 20. 1. Active substances polypeptides omfattande en obruten sequence om minst 8 amino acids of HCV-polyprotein and HCV-antigen V '25 determinant, colors sagda obrutna sequence is frän aminosyroma 1-450 eller aminosyroma 2887-2955 i polyproteinet enligt figur 17, kännetecknat därav att förfarandet omfattar »I» • 'feljande steg: • · · • · · *' * a) en recombinant ldcell tas i Bruk, vilkin är transformerad med ett I <expressionionssystem som kodar en polypeptides, and control element för, | | <30 expression innefattande en promotor som är kompatibel med Värdcellen; och • «« b) expression cell polypeptide, varefter '. peptidenisolerasochrenas. 79 105046 20 AA2150; AA2150, AA2200; AA2200, AA2325; AA2250, AA2330; AA2265- AA2280; AA2280, AA2290; AA2287, AA2385; AA2300, AA2350; AA2350- AA2400; AA2345, AA2415; AA2345, AA2375; AA2348, AA2464; AA2370- • «AA2410; AA2400, AA2450; AA2400, AA2425; AA2415, AA2450; AA2445-: V: AA2500; AA2371, AA2502; AA2500, AA2550; AA2505, AA2540; AA2550- • ·: T: 25 AA2600; AA2560, AA2580; AA2600, AA2650; AA2620, AA2650; AA2650- AA2700; AA2655, AA2670; AA2670, AA2700; AA2700, AA2750; AA2750-: AA2800; AA2755, AA2780; AA2780, AA2830; AA2785, AA2810; AA2796- • · · V: AA2886; AA2810, AA2825; AA2800, AA2850; AA2850, AA2900; AA2900- '· .1 ·: AA2950; AA2910, AA2930; AA2925, AA2950; and the AA2945 end (C-terminus). 30 t I · · • · • »· •« 1 75 105046 21. Värdcell activates polypeptides active polypeptides omfattande en HCV-determinant med δminstone 8 aminosyror, callus därav att den är transformerad ..; 20 med en recombinant vector enligt face av 12-20. «« I «i« i «i« i «i« i «i«, i «i« i «i« i «i« i «i« i «i« i «i«. · I «• III I ·« 4 9