ES2554561B1 - New baculovirus-derived promoters with high activity in baculovirus-based expression systems - Google Patents

Abstract

The present invention belongs to the field of biotechnology and comprises nucleic acid sequences, including promoters capable of increasing the quality and efficiency of recombinant protein production. Specifically, the present invention relates to a nucleic acid sequence suitable to function as a baculovirus promoter comprising: #a. the sequence SEQ ID NO .: 1 or its complementary sequence; or # b. a variant of any of the sequences in section a) that has at least 70% identity with said sequence.

Description

5

10

fifteen

twenty

25

30

DESCRIPTION

New promoters derived from baculovirus with high activity in

baculovirus-based expression

Technology Sector

The present invention belongs to the field of biotechnology and comprises nucleic acid sequences, including promoters capable of increasing the quality and efficacy of the production of recombinant proteins.

Background of the invention

The baculovirus-based expression system is a method of producing recombinant proteins that has a high capacity for expression. The recombinant proteins produced can be used for example as vaccines, therapeutic molecules or diagnostic agents. Baculoviruses are a type of virus that infect arthropods, especially insects. Recently, based on the sequence of certain genes conserved in all baculoviruses, a new division has been proposed in terms of the genera that make up the Baculoviridae family. Unlike the previous classification that was based on morphological characteristics and with which there was no correlation between the virus group and the type of host where they were, in this new classification there is a clear distinction in relation to the order to which the host insect With the new classification, the Baculoviridae family would consist of 4 genera: Alphabaculovirus (lepidopter-specific nucleopoliedrovirus), Betabaculovirus (lepidopter-specific granuloviruses), Gammabaculovirus (hymenopter-specific nucleopoliedrovirus) and Deltabaculovirus (nucleophiedge JA diphrometer, J-nucleopoliedrovirus) , Wang H., Hu Z., Wang Y. & Hauschild R. (2006), Molecular identification and phylogenetic analysis of baculoviruses from Lepidoptera. Virology 346, 180-193). The baculovirus-based vector most used in the industry for the expression of recombinant proteins comes from the Autographa californica Nucleopoliedrovirus multicapside baculovirus (AcMNPV). Spodoptera frugiperda 9 (Sf9) or 21 (Sf21) insect cells are two examples of cell lines susceptible to being infected with widely used recombinant baculovirus (Nettleship, JE et al, J. Struct. Biol. 2010, 172, 55- 56), and Trichoplusia ni (T. ni) insect larvae are used as biofactories for the production of recombinant proteins (Gomez-Casado, E. et al., Protein Exp. Purif. 2011, 79, 35-43) . Since the baculovirus-based expression system developed in the 1980s (Smith, G. E. et al., Mol. Cell Biol. 1983, 65 (3),

5

10

fifteen

twenty

25

30

2156-2165), hundreds of recombinant proteins have been produced using this system, from cytosolic enzymes to membrane proteins.

Protein synthesis in a baculovirus system has numerous advantages over synthesis in other microorganisms such as E.coli. After production and purification, the recombinant protein expressed by the baculovirus system has post-translational modifications such as formation of disulfide bonds, glycosylations, myristylations, acetylations, phosphorylations, ubiquitinations, etc. These factors clearly constitute an advance and an improvement in procedures for obtaining recombinant proteins with respect to previous procedures.

More recently, baculovirus vectors have been developed with promoters and amplifiers that allow the expression of genes in higher eukaryotic cells, such as human hepatocytes or CHO cells (hamster ovarian cancer).

The following scientific articles can summarize the state of the art with respect to these recombinant protein expression systems:

1: Fernandes F, Teixeira AP, Carinhas N, Carrondo MJ, Alves PM. Insect cells as a production platform of complex virus-like particles. Expert Rev Vaccines. 2013 Feb; 12 (2): 225-36.

2: Cox MM. Recombinant protein vaccines produced in insect cells. Vaccine 2012 Feb 27; 30 (10): 1759-66. 3: Hitchman RB, Locanto E, Possee RD, King LA. Optimizing the baculovirus expression vector system. Methods 2011 Sep; 55 (1): 52-7. 4: van Oers MM. Opportunities and challenges for the baculovirus expression system. J Invertebr Pathol. 2011 Jul; 107 Suppl: S3-15.

There are numerous commercially available technologies for the expression of recombinant proteins using the baculovirus-based expression system. As an example, some of them are mentioned below: "Bac-to-Bac®" (Invitrogen ™), "BacPAK ™" (Clontech ™), "FlashBAC ™" (Oxford Expression Technologies ™), "BacuVance ™"

(GenScript ™), “Bac-N-Blue DNATM” (Invitrogen ™), “BaculoDirect ™” (Invitrogen ™),

“BacVector®” 1000, 2000, 3000 (Novagen®), “DiamondBac ™” (Sigma-Aldrich®), “BaculoGold ™” (BD Biosciences ™) or “MultiBack” (ETH Zurich / Redbiotec AG).

Most baculovirus-based expression systems employ the polh promoter for the expression of recombinant proteins. The polh gene is not an essential gene for

5

10

fifteen

twenty

25

Virus replication in insect cells, so it can be removed from the genome without affecting virus production. Instead, the protection of interest is expressed.

There is an urgent need to develop new promoters that allow more efficient production of recombinant proteins in baculovirus-based expression systems.

Brief description of the invention

The present invention is based on the excellent properties of the promoters described below.

In particular, the inventors discovered that the nucleic acid sequence comprising:

to. the sequence SEQ ID NO .: 1 or its complementary sequence; or

b. a variant of any of the sequences in section a) which has at least 70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequences

It is suitable to function as a baculovirus promoter. Therefore, the present invention provides a nucleic acid sequence comprising SEQ ID NO .: 1 or its complementary sequence, suitable to function as a promoter in a baculovirus-based expression system.

The present invention relates to the nucleic acid sequence mentioned above, wherein said sequence comprises a nucleic acid sequence selected from the list consisting of:

to. the nucleic acid sequence SEQ ID NO .: 2, SEQ ID NO .: 4, SEQ ID NO .: 5, SEQ ID NO .: 6, SEQ ID NO .: 7, SEQ ID NO .: 8, SEQ ID NO .: 10, SEQ ID NO .: 12, SEQ ID NO .: 13, SEQ ID NO .: 14, SEQ ID NO .: 15, SEQ ID NO .: 17, SEQ ID NO .: 18, SEQ ID NO. : 19, SEQ ID NO .: 20, SEQ ID NO .: 22, SEQ ID NO .: 23, SEQ ID NO .: 24, SEQ ID NO .: 25, SEQ ID NO .: 27, SEQ ID NO .: 28, SEQ ID NO .: 29, or SEQ ID NO .: 30, SEQ ID NO .: 44 or its complementary sequences; or

5

10

fifteen

twenty

25

30

b. a variant of any of the sequences of section a) which has at least 70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequences.

The present invention also provides a nucleic acid sequence as described above, wherein said sequence is the nucleic acid sequence consisting of SEQ ID NO .: 2 or a variant thereof that has at least 70%, or a 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequence.

The present invention also provides a nucleic acid sequence as described above, wherein said sequence is the nucleic acid sequence consisting of SEQ ID NO .: 4 or a variant thereof that has at least 70%, or a 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequence.

The present invention also provides a nucleic acid sequence as described above, wherein said sequence is the nucleic acid sequence consisting of SEQ ID NO .: 5 or a variant thereof that has at least 70%, or a 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequence.

The present invention also provides a nucleic acid sequence as described above, wherein said sequence is the nucleic acid sequence consisting of SEQ ID NO .: 6 or a variant thereof that has at least 70%, or a 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequence.

The present invention also provides a nucleic acid sequence as described above, wherein said sequence is the nucleic acid sequence consisting of SEQ ID NO .: 18 or a variant thereof that has at least 70%, or a 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequence.

The present invention also provides a nucleic acid sequence as described above, wherein said sequence is the nucleic acid sequence consisting of SEQ ID NO .: 23 or a variant thereof that has at least 70%, or a 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequence.

The present invention also provides a nucleic acid sequence as described above, wherein said sequence is the nucleic acid sequence consisting of SEQ ID NO .: 28 or a variant thereof that has at least 70%, or a 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequence.

5

10

fifteen

twenty

25

30

The present invention also provides a nucleic acid sequence as described above, wherein said sequence is the nucleic acid sequence consisting of SEQ ID NO .: 29 or a variant thereof that has at least 70%, or a 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequence.

The present invention also provides a nucleic acid sequence as described above, wherein said sequence is the nucleic acid sequence consisting of SEQ ID NO .: 30 or a variant thereof that has at least 70%, or a 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequence.

The present invention also provides a nucleic acid sequence as described above, wherein said sequence is the nucleic acid sequence consisting of SEQ ID NO .: 44 or a variant thereof that has at least 70%, or a 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequence.

In addition, said promoter can be part of an expression cassette. Therefore, the present invention also provides an expression cassette comprising at least one nucleic acid sequence as defined above operatively linked to a nucleic acid sequence comprising a nucleotide sequence encoding a protein.

Sometimes the expression cassette additionally comprises one (or several) homologous recombination region (s), such as amplifiers (enhancers), operably linked to the promoter that controls the expression of the protein.

The present invention also relates to recombinant donation, transfer and / or bacmid vectors comprising the nucleic acid sequences or expression cassettes described above.

In addition, a bacuolovirus comprising a nucleic acid sequence or an expression cassette as described above is object of the present invention.

Reference is also made in the present invention to a cell, an insect or an insect larva comprising a baculovirus as described above, and / or a cell, an insect or insect larva comprising a nucleic acid sequence, a cassette of expression and / or a vector according to any of those mentioned above.

The cells can be eukaryotes or prokaryotes.

5

10

fifteen

twenty

25

The inventors further describe a culture medium comprising a nucleic acid sequence, an expression cassette, a cloning vector, a transfer vector, a bacmid, a recombinant baculovirus, a cell, an insect or an insect larva as previously mentioned.

The object of the present invention is a method for producing a protein comprising the steps of:

to. infecting insect cells with a baculovirus as described above, or transfecting or transducing them with the bacmid or with the cloning or transfer vector, or with an expression cassette mentioned above;

b. express the protein;

C. get said protein.

The present invention also provides a method of producing a protein comprising the steps of:

to. infecting insects or insect larvae with baculovirus as described above; or transfect or transduce them with the bacmid or with the cloning or transfer vector, or with an expression cassette mentioned above;

b. express the protein;

C. get said protein.

The present invention also relates to a recombinant protein obtainable by any of the methods mentioned above.

In a further aspect, the invention relates to the use of the protein described above in therapy or diagnosis.

The invention also describes the use of a nucleic acid sequence, an expression cassette, a cloning vector, a transfer vector, a bacmid, a recombinant baculovirus, a cell, an insect or an insect larva as described above in a method for the production of a protein.

Brief description of the figures

5

10

fifteen

twenty

25

30

Figure 1. Production of GFP (green fluorescent protein) in three insect cell lines (Sf21 (JL Vaughn, RH Goodwin, GJ Tompkins, P. McCawley. The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera; Noctuidae). In Vitro, 13 (1977), pp. 213-217), Se301 (K. Hara, M. Funakoshi, K. Tsuda, T. Kawarabata. New Spodoptera exigua cell lines susceptible to Spodoptera exigua nuclear polyhedrosis virus, In Vitro Cell, Dev. Biol. Anim., 29A (1993), pp. 904-907) and Hi5 (Wickham TJ, Davis T, Granados RR, Shuler ML, Wood HA (1992 ). "Screening of insect cell lines for the production of recombinant proteins and infectious virus in the baculovirus expression system". Biotechnol Prog. 8 (5): 391-396.)) Of the initial promoter (pSeL, L = length, SEQ ID NO .: 2), its version truncated in 3 '(pSeS, S = short, SEQ ID NO.:3). The polyhedrin promoter (pph, SEQ ID NO .: 11) was used as the "gold standard".

Figure 2. Production of GFP (“green fluorescent protein’ ”in three insect cell lines (Sf21 (A), Se301 (B) and Hi5 (C)). Serial deletions of the 5 'region of the pSeL promoter (pSeL-140, SEQ ID NO .: 4 and pSeL-120, SEQ ID NO .: 5) can increase protein production in different types of cells (Sf21 (A) , Se301 (B) and Hi5 (C)). The polyhedrin promoter (pph, SEQ ID NO .: 11) was used as the "gold standard".

Figure 3. Schematic representation of the different variants of some of the promoters mentioned in this description (pSeL, SEQ ID NO .: 2, pSeL-140, SEQ ID NO .: 4, pSeL-120, SEQ ID NO.:5 , pSeS, SEQ ID NO .: 3 and pph, SEQ ID NO.:11).

Figure 4. Production of GFP (“green fluorescent protein’ ”in three insect cell lines (Sf21, Se301 and Hi5). The combination of promoters (pph / pSeL-120 in the figure, SEQ ID NO .: 18) considerably increases the levels of protein production in these insect cells, compared to the pSeL promoter (SEQ ID NO.:2) , pSeL-120 (SEQ ID NO.:5) and polyhedrin promoter (pph, SEQ ID NO .: 11).

Figure 5. Production of GFP ("green fluorescent protein", fluorescent green protein) in larvae of T. ni. pSeL, (SEQ ID NO .: 2) and pSeL-120, (SEQ ID NO .: 5). The polyhedrin promoter (pph, SEQ ID NO .: 11) was used as "goldstandard" (standard reference model).

5

10

fifteen

twenty

25

30

Figure 6. Representation of the position of the pSeL-120 promoter in an alignment of its sequence with the homologous sequences in different species of baculovirus (Spodoptera exigua nucleopolyhedrovirus (SeMNPV), Spodoptera litoralis nucleopolyhedrovirus (SpliMNPV), Spodoptera frugiperda nucleopolyrrovrot (Agrotrothrotirus) ipsilon nucleopolyhedrovirus (AgipMNPV), Agrotis segetum nucleopolyhedrovirus (AgseMNPV), Bombyx mori nucleopolyhedrovirus (BmNPV), and Autographa californica nucleopolyhedrovirus (AcMNPV)) (upper panel). The bottom panel shows the sequence identity between the different viruses in the region represented in the alignment (promoter pSeL-120, SEQ ID NO.:5).

Figure 7. Sequences pSeL (SEQ ID NO.:2) and pSeS (SEQ ID NO .: 3) and their alignment, the difference between both being SEQ ID NO.:1 ("differential sequence").

Detailed description of the invention

Promoter

The present invention describes the use of new baculovirus promoters for the expression of heterologous proteins in insect cells or in insects (including insect larvae) using the baculovirus-based expression system. The nucleic acid sequence of the promoter is preferably derived from the genome of the spodoptera exigua multiple nucleopoliedrovirus (SeMNPV). The nucleic acid sequence of the promoter can also be derived from the genome of other viruses such as Spodoptera litoralis nucleopoliedrovirus (SpliMNPV), Spodoptera frugiperda nucleopoliedrovirus (SpfrMNPV), Agrotis ipsilon nucleopoliedrovirus (AgipMNPV), Agrotis segetum nucleopolyvirus (Polyvirus) ), and Autographa californica nucleopoliedrovirus (AcMNPV). In particular, the nucleic acid sequence of the promoter (or promoters) that derives (n) from the genome of the spodoptera exigua multiple nucleopolyhedrovirus (SeMNPV) is found in the 5 ‘region of the orf46, controlling the expression of said gene. In the transcriptome of Spodoptera exigua infected with SeMNPV there is a high presence of transcripts corresponding to the orf46 gene. In addition, the ORF46 protein is a structural protein. The new promoters have a strong activity in the baculovirus-based expression system, reaching higher expression levels than those achieved under other promoters of conventional use such as the polyhedrin, polh or pph promoter. The reduced size of its promoter sequence makes it possible to use it jointly with other promoters.

5

10

fifteen

twenty

25

In one aspect, the invention relates to a nucleic acid sequence, hereinafter nucleic acid sequence of the invention, suitable to function as a baculovirus promoter comprising:

to. the sequence SEQ ID NO .: 1 or its complementary sequence; or

b. a variant of any of the sequences of section a) which has at least 70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequences.

Examples of baculovirus promoters of the invention, comprising

a) SEQ ID NO .: 1 or its complementary sequence;

b) or a variant of any of the sequence of section a) that has at least 70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with those sequences

are SEQ ID NO .: 2, SEQ ID NO .: 4, SEQ ID NO .: 5, SEQ ID NO .: 6, SEQ ID NO .: 7, SEQ ID NO .: 8, SEQ ID NO .: 10, SEQ ID NO .: 12, SEQ ID NO .: 13, SEQ ID NO .: 14, SEQ ID NO .: 15, SEQ ID NO .: 17, SEQ ID NO .: 18, SEQ ID NO .: 19, SEQ ID NO .: 20, SEQ ID NO .: 22, SEQ ID NO .: 23, SEQ ID NO .: 24, SEQ ID NO. : 25, SEQ ID NO .: 27, SEQ ID NO .: 28, SEQ ID NO .: 29, SEQ ID NO .: 30, SEQ ID NO .: 44, or its complementary sequences, or its complementary sequences, or a variant of any of the above sequences (SEQ ID NOs .: 2, SEQ ID NOs .: 4-8, SEQ ID NO.:10, SEQ ID NOs .: 12-15, SEQ ID NOs .: 17-20, SEQ ID NOs .: 22-25, SEQ ID NOs .: 27-30 and SEQ ID NO .: 44) that have at least 70%, or 80%, or 90%, or 95 %, or 97%, or 99%, of identity with said sequences.

In an embodiment of the first aspect of the invention, the invention comprises a nucleic acid sequence, hereinafter nucleic acid sequence of the invention, suitable to function as a baculovirus promoter comprising:

to. the sequence SEQ ID NO .: 1 or its complementary sequence; or a variant thereof (SEQ ID NO .: 1 or its complementary sequence) which has at least 70%, or 80%, or 90%, or 95%, or 97%, or 99% , of identity with said sequences; Y

5

10

fifteen

twenty

25

b. the sequence SEQ ID NO .: 11, or its complementary sequence, or a variant thereof (SEQ ID NO .: 11, or its complementary sequence) which has at least 70%, or 80%, or 90% , or 95%, or 97%, or 99%, of identity with said sequences.

Examples of baculovirus promoters of the invention, comprising

to. the sequence SEQ ID NO .: 1 or its complementary sequence; or a variant thereof (SEQ ID NO .: 1 or its complementary sequence) which has at least 70%, or 80%, or 90%, or 95%, or 97%, or 99% , of identity with said sequences; Y

b. the sequence SEQ ID NO .: 11, or its complementary sequence, or a variant thereof (SEQ ID NO .: 11, or its complementary sequence) which has at least 70%, or 80%, or 90% , or 95%, or 97%, or 99%, of identity with said sequences

are SEQ ID NO .: 6, SEQ ID NO .: 7, SEQ ID NO .: 8, SEQ ID NO .: 10, SEQ ID NO .: 14, SEQ ID NO .: 15, SEQ ID NO .: 17, SEQ ID NO .: 18 and SEQ ID NO .: 44.

In another embodiment of the first aspect of the invention, the invention comprises a nucleic acid sequence, hereinafter nucleic acid sequence of the invention, suitable to function as a baculovirus promoter comprising:

to. the sequence SEQ ID NO .: 1 or its complementary sequence; or a variant thereof (SEQ ID NO .: 1 or its complementary sequence) which has at least 70%, or 80%, or 90%, or 95%, or 97%, or 99% , of identity with said sequences; Y

b. the sequence SEQ ID NO .: 31, or its complementary sequence, or a variant thereof (SEQ ID NO .: 31, or its complementary sequence) which has at least 70%, or 80%, or 90% , or 95%, or 97%, or 99%, of identity with said sequences.

Examples of baculovirus promoters of the invention, comprising these sequences (a and b) are SEQ ID NO .: 19, SEQ ID NO .: 20, SEQ ID NO .: 22, SEQ ID NO .: 23, SEQ ID NO .: 24, SEQ ID NO .: 25, SEQ ID NO .: 27 and SEQ ID NO .: 28.

5

10

fifteen

twenty

25

30

In the context of the present invention, the term "promoter" refers to a nucleic acid sequence to which RNA polymerase can bind to initiate transcription. This nucleic acid sequence may also comprise binding sites for various proteins that regulate transcription, such as transcription factors.

The terms "nucleic acid sequence", "nucleotide sequence", "nucleic acid" and "nucleic acid molecule" are used interchangeably herein and refer to a polymeric form of nucleotides of any length that may or may not be, Chemically or biochemically modified. They refer, therefore, to any polydeoxyribonucleotide or polyiribonucleotide, both single-stranded and double-stranded.

Nucleic acid molecules or sequences are said to be "complementary" if they can hybridize with one another with sufficient stability to allow them to remain aligned with one another under conventional conditions of "high restrictivity." Conventional restrictive conditions are described for example by Sambrock et al., 1989 (Molecular cloning. Vol. 2. New York: Cold spring harbor laboratory press), and by Hames et al., In: Nucleic Acid Hybridation, A Practical Approach , IRL Press, Washington, DC (1985).

In the context of the present invention, comparison of identity between sequences can be obtained using the ClustalW algorithm (Larkin M.A. et al., Bioinformatics 2007, 23 (21): 2947-2948).

In a particular embodiment, the nucleic acid sequence of the invention comprises a nucleic acid sequence selected from the list consisting of: SEQ ID NO .: 1, SEQ ID NO .: 2, SEQ ID NO .: 4, SEQ ID NO .: 5, SEQ ID NO .: 6, SEQ ID NO .: 7, SEQ ID NO .: 8, SEQ ID NO .: 10, SEQ ID NO .: 12, SEQ ID NO .: 13, SEQ ID NO .: 14, SEQ ID NO .: 15, SEQ ID NO .: 17, SEQ ID NO .: 18, SEQ ID NO .: 19, SEQ ID NO .: 20, SEQ ID NO .: 22, SEQ ID NO. : 23, SEQ ID NO .: 24, SEQ ID NO .: 25, SEQ ID NO .: 27, SEQ ID NO .: 28, SEQ ID NO .: 29, SEQ ID NO .: 30, SEQ ID NO .: 44, its complementary sequences or a variant of any of the previous sequences that has at least 70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with these sequences.

In another embodiment, the nucleic acid sequence of the invention consists of SEQ ID NO .: 1, or SEQ ID NO .: 2, or SEQ ID NO .: 4, or SEQ ID NO .: 5, or in SEQ ID NO .: 6, or in SEQ ID NO .: 7, or in SEQ ID NO .: 8, or in SEQ ID NO .: 10, or in SEQ ID NO .: 12, or in SEQ ID NO .: 13, or in SEQ ID NO .: 14, or in SEQ ID NO .: 15, or

5

10

fifteen

twenty

25

30

in SEQ ID NO .: 17, or in SEQ ID NO .: 18, or in SEQ ID NO .: 19, or in SEQ ID NO .: 20, or in SEQ ID NO .: 22, or in SEQ ID NO .: 23, or in SEQ ID NO .: 24, or in SEQ ID NO .: 25, or in SEQ ID NO .: 27, or in SEQ ID NO .: 28, or in SEQ ID NO .: 29, or in SEQ ID NO .: 30, in SEQ ID NO .: 44, its complementary sequences or a variant of any of the previous sequences that has at least 70%, or a 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequences.

Preferably, the nucleic acid sequence according to the present invention is the nucleic acid sequence comprising SEQ ID NO .: 2 or a variant of SEQ ID NO .: 2 which has at least 70%, or 80% , or 90%, or 95%, or 97%, or 99%, of identity with said sequence, or the complementary sequence of any of them.

Preferably, the nucleic acid sequence according to the present invention is the nucleic acid sequence comprising SEQ ID NO .: 5 or a variant of SEQ ID NO .: 5 which has at least 70%, or 80% , or 90%, or 95%, or 97%, or 99%, of identity with said sequence, or the complementary sequence of any of them.

Preferably, the nucleic acid sequence of the present invention is the nucleic acid sequence comprising SEQ ID NO .: 6 or a variant of SEQ ID NO .: 6 which has at least 70%, or 80% , or 90%, or 95%, or 97%, or 99%, of identity with said sequence, or the complementary sequence of any of them.

Preferably, the nucleic acid sequence of the present invention is the nucleic acid sequence comprising SEQ ID NO .: 18 or a variant of SEQ ID NO .: 18 which has at least 70%, or 80% , or 90%, or 95%, or 97%, or 99%, of identity with said sequence, or the complementary sequence of any of them.

Preferably, the nucleic acid sequence of the present invention is the nucleic acid sequence comprising SEQ ID NO .: 23 or a variant of SEQ ID NO .: 23 which has at least 70%, or 80% , or 90%, or 95%, or 97%, or 99%, of identity with said sequence, or the complementary sequence of any of them.

Preferably, the nucleic acid sequence of the present invention is the nucleic acid sequence comprising SEQ ID NO .: 28 or a variant of SEQ ID NO .: 28 which has at least 70%, or 80% , or 90%, or 95%, or 97%, or 99%, of identity with said sequence, or the complementary sequence of any of them.

5

10

fifteen

twenty

25

30

Preferably, the nucleic acid sequence of the present invention is the nucleic acid sequence comprising SEQ ID NO .: 29 or a variant of SEQ ID NO .: 29 which has at least 70%, or 80% , or 90%, or 95%, or 97%, or 99%, of identity with said sequence, or the complementary sequence of any of them.

Preferably, the nucleic acid sequence of the present invention is the nucleic acid sequence comprising SEQ ID NO .: 30 or a variant of SEQ ID NO .: 30 which has at least 70%, or 80% , or 90%, or 95%, or 97%, or 99%, of identity with said sequence, or the complementary sequence of any of them.

Preferably, the nucleic acid sequence of the present invention is the nucleic acid sequence comprising SEQ ID NO .: 44 or a variant of SEQ ID NO .: 45 which has at least 70%, or 80% , or 90%, or 95%, or 97%, or 99%, of identity with said sequence, or the complementary sequence of any of them.

Preferably the nucleic acid sequence is the nucleic acid sequence consisting of SEQ ID NO .: 2, or a variant thereof that has at least 70%, or 80%, or 90%, or a 95%, or 97%, or 99%, of identity with said sequence, or the complementary sequence of any of them.

Preferably the nucleic acid sequence is the nucleic acid sequence consisting of SEQ ID NO .: 5, or a variant thereof that has at least 70%, or 80%, or 90%, or a 95%, or 97%, or 99%, of identity with said sequence, or the complementary sequence of any of them.

Preferably the nucleic acid sequence is the nucleic acid sequence consisting of SEQ ID NO .: 6, or a variant thereof that has at least 70%, or 80%, or 90%, or a 95%, or 97%, or 99%, of identity with said sequence, or the complementary sequence of any of them.

Preferably the nucleic acid sequence is the nucleic acid sequence consisting of SEQ ID NO .: 18, or a variant thereof that has at least 70%, or 80%, or 90%, or a 95%, or 97%, or 99%, of identity with said sequence, or the complementary sequence of any of them.

Preferably the nucleic acid sequence is the nucleic acid sequence consisting of SEQ ID NO .: 23, or a variant thereof that has at least one

5

10

fifteen

twenty

25

30

70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequence, or the complementary sequence of any of them.

Preferably the nucleic acid sequence is the nucleic acid sequence consisting of SEQ ID NO .: 28, or a variant thereof that has at least one

70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said

sequence, or the complementary sequence of any of them.

Preferably the nucleic acid sequence is the nucleic acid sequence consisting of SEQ ID NO .: 29, or a variant thereof that has at least one

70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said

sequence, or the complementary sequence of any of them.

Preferably the nucleic acid sequence is the nucleic acid sequence consisting of SEQ ID NO .: 30, or a variant thereof that has at least one

70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said

sequence, or the complementary sequence of any of them.

Preferably the nucleic acid sequence is the nucleic acid sequence consisting of SEQ ID NO .: 44, or a variant thereof that has at least one

70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said

sequence, or the complementary sequence of any of them.

In the context of the present invention, the term "recombinant DNA" refers to a form of artificial DNA that has been designed by combining or inserting one or more strands of DNA, such that DNA that would not normally appear combined does.

In general, the nucleic acid sequences of the invention can be derived from the genome of Spodoptera exigua multiple nucleopoliedrovirus (SeMNPV), or from the genome of the Spodoptera litoralis nucleopoliedrovirus (SpliMNPV), or from the Spodoptera frugiperda (SpfrMPV, SpfrMP) of the genome of the Agrotis ipsilon nucleopoliedrovirus (AgipMNPV), or of the genome of the Agrotis segetum nucleopoliedrovirus (AgseMNPV), or of the Bombyx mori nucleopoliedrovirus genome (BmNPV), or of the Autographa californica nucleopoliedrovirus genome (AcMNPV).

Preferably, the nucleic acid sequences of the invention are derived from the genome of the spodoptera exigua multiple nucleopoliedrovirus (SeMNPV).

5

10

fifteen

twenty

25

30

In a particular embodiment of the present invention, the nucleic acid sequence includes 301 upstream nucleotides of the open reading frame (ORF) start codon corresponding to the gene: ORF46calyx / polyhedron envelope protein "or" polyhedron envelope protein calyx / pep ”(Genbank acc n AF169823.1). of the genome of Spodoptera exigua multiple nucleopoliedrovirus (SeMNPV), or of the genome of Spodoptera litoralis nucleopoliedrovirus (SpliMNPV), or of the genome of the

Spodoptera frugiperda nucleopoliedrovirus (SpfrMNPV), or genome of the

Agrotis ipsilon nucleopoliedrovirus (AgipMNPV), or of the genome of the Agrotis segetum nucleopoliedrovirus (AgseMNPV), or of the Bombyx mori nucleopoliedrovirus genome (BmNPV), or of the Autographa californica nucleopoliedrovirus genome (AcMNPV).

Preferably, the nucleic acid sequence includes 301 upstream nucleotides of the start codon of the open reading frame orf46 of the genome of the spodoptera exigua multiple nucleopolyhedrovirus multiple (SeMNPV).

Expression cassette

The nucleic acid sequences of the invention, such as the sequences depicted in SEQ ID NOs .: 1-2, SEQ ID NOs .: 4-8, SEQ ID NO.:10, SEQ ID NOs .: 1215, SEQ ID NOs .: 17-20, SEQ ID NOs .: 22-25, SEQ ID NOs .: 27-30 and SEQ ID NO .: 44, their complementary sequences or a variant of any of the previous sequences that has at least 70 %, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequences, may be operably linked to a nucleotide sequence encoding a protein of interest, constituting in this way an expression cassette.

As used in this description, the term "operably linked" means that the protein (s) is (are) expressed in the correct reading frame under the control of the promoter and the control or regulatory expression sequences.

Therefore, the invention provides an expression cassette comprising a nucleic acid sequence comprising any of the nucleotide sequences of the present invention, operably linked to a nucleic acid sequence comprising the nucleotide sequence encoding a protein.

In addition, optionally, the expression cassette may incorporate other control sequences or expression regulatory sequences. Control sequences are sequences that control and regulate transcription and, where appropriate, the translation of the protein of interest. In addition to promoters, they include sequences that encode transcriptional regulators,

5

10

fifteen

twenty

25

30

ribosome binding sequences (RBS) and / or transcription terminator sequences. Said expression control sequences may be functional in cells and prokaryotic organisms and / or in cells and eukaryotic organisms.

Therefore, the expression cassette of the present invention may additionally comprise a region of homologous recombination (hr), such as amplifiers (enhancers), bound to the promoter that controls the expression of the protein.

Homologous (hr) recombination regions in baculovirus, such as AcMNPV, are composed of units of about 70 bp repeated in tandem, whose central region houses a 28 bp semi-param characterized by containing an EcoRI target. Eight regions containing 2 to 8 repetitions of this unit have been identified. Its main function is to act as the origin of replication of the DNA vmco, the stabilization of the genome of the virus and the intensification of transcription.

For example, these homologous recombination regions are repeated in eight locations in the AcMNPV genome, with 2 to 8 repetitions on each side.

An amplifier or amplifier region (enhancer) in the context of the present invention is understood as a control sequence to which transcriptional regulatory elements bind, thereby increasing the level of transcription of the associated genes.

Advantageously, said expression cassette can also comprise a marker or gene that codes for a motif or phenotype that allows the selection of the host cell transformed with said expression cassette. Illustrative examples of said markers that could be present in the expression cassette of the invention include antibiotic resistance genes, genes for resistance to toxic compounds and, in general, all those that allow the selection of genetically transformed cells.

Preferably, the protein encoded in the expression cassette of the invention is selected from the following: protein vaccine, therapeutic protein, antibody, enzyme, cytokine, coagulation factor, anticoagulant, receptor, hormone, protein with diagnostic value or similar particle protections to virus (VLP).

The expression cassette may also comprise, if so desired, a nucleic acid sequence encoding a peptide capable of being used for the purpose of isolation or purification of the product of interest. Therefore, the expression cassette of the present invention comprises, if desired, a nucleic acid sequence comprising the

5

10

fifteen

twenty

25

30

nucleotide sequence encoding a peptide capable of being used for isolation or purification purposes. Said nucleic acid sequence may be located in any position as long as it does not alter the functionality of the product of interest.

Virtually any peptide or peptide sequence that allows isolation or purification of the peptide or fusion protein could be used. For example, polyhistidine sequences, peptide sequences that can be recognized by antibodies that can be used to purify the resulting fusion protein by immunoaffinity chromatography, tag peptides, etc. One or more sequences of this type may optionally be included in the expression cassette of the present invention.

If desired, the expression cassette may further comprise a nucleotide sequence encoding an amino acid sequence that can be specifically cleaved by enzymatic or chemical means in order to release the product of interest once the fusion protein is isolated. Virtually any amino acid sequence that can be cleaved by enzymatic or chemical means can be used, for example, protease recognition sites (enterokinase, Arg-C endoprotease, Glu-C endoprotease, Lys-C endoprotease, Coagulation factor Xa, etc) or sites susceptible to being specifically cleaved by chemical reagents (cyanogen bromide, etc.).

Vectors

The nucleic acid sequence of the invention or the expression cassette of the invention can be inserted into an appropriate vector. Thus the present invention relates to a recombinant vector, such as a cloning vector, transfer vector and / or recombinant bacmid comprising the nucleic acid sequences or the expression cassette of the invention.

A "cloning vector" refers to any vector suitable for cloning, which generally implies the presence of restriction sites, an origin of replication for its propagation in bacteria and a selection marker.

In the present invention, the cloning vector comprises the nucleic acid sequence of the invention. For example, the cloning vector comprises at least one sequence of the sequences represented in SEQ ID NOs .: 1-2, SEQ ID NOs .: 4-8, SEQ ID NO.:10, SEQ ID NOs .: 12-15 , SEQ ID NOs .: 17-20, SEQ ID NOs .: 22-25, SEQ ID NOs .: 27-30 and SEQ ID NO .: 44, their complementary sequences or a variant of any of the sequences

18

5

10

fifteen

twenty

25

30

35

previous that has at least 70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequences. For example, the cloning vector of the present invention comprises SEQ ID NO .: 1. For example, the cloning vector of the present invention comprises SEQ ID NO .: 2. For example, the cloning vector of the present Invention comprises SEQ ID NO .: 5. For example, the cloning vector of the present invention comprises SEQ ID NO .: 6. For example, the cloning vector of the present invention comprises SEQ ID NO .: 12. For example, the cloning vector of the present invention comprises SEQ ID NO .: 13. For example, the cloning vector of the present invention comprises SEQ ID NO .: 14. For example, the cloning vector of the present Invention comprises SEQ ID NO .: 18. For example, the cloning vector of the present invention comprises SEQ ID NO .: 23. For example, the cloning vector of the present invention comprises SEQ ID NO .: 28. For example, the cloning vector of the present invention comprises SEQ ID NO .: 29. For example, e The cloning vector of the present invention comprises SEQ ID NO .: 30. For example, the cloning vector of the present invention comprises SEQ ID NO .: 44. In addition, the present invention provides a vector comprising the cassette of expression of the present invention and can preferably be used to produce the bacmid, the recombinant baculovirus, the cell, the insect (or larva) or the culture medium of the invention.

The cloning vector comprising an expression cassette is also called a "donor vector." For example, the donor vector of the present invention comprises at least one sequence of the sequences depicted in SEQ ID NOs .: 1-2, SEQ ID NOs .: 4-8, SEQ ID NO.:10, SEQ ID NOs .: 12-15, SEQ ID NOs .: 17-20, SEQ ID NOs .: 22-25, SEQ ID NOs .: 27-30, SEQ ID NO .: 44, their complementary sequences or a variant of any of the above sequences which has at least 70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequences. For example, the donor vector of the present invention comprises SEQ ID NO .: 1. For example, the donor vector of the

This invention comprises SEQ ID NO .: 2. For example, the donor vector of the

This invention comprises SEQ ID NO .: 5. For example, the donor vector of the

This invention comprises SEQ ID NO .: 6. For example, the donor vector of the

This invention comprises SEQ ID NO .: 12. For example, the donor vector of the

This invention comprises SEQ ID NO .: 13. For example, the donor vector of the

This invention comprises SEQ ID NO .: 14. For example, the donor vector of the

This invention comprises SEQ ID NO .: 18. For example, the donor vector of the

This invention comprises SEQ ID NO .: 23. For example, the donor vector of the

This invention comprises SEQ ID NO .: 28. For example, the donor vector of the

5

10

fifteen

twenty

25

30

The present invention comprises SEQ ID NO .: 29. For example, the donor vector of the present invention comprises SEQ ID NO .: 30. For example, the donor vector of the present invention comprises SEQ ID NO .: 44.

In the context of the present invention, "transfer vector" refers to a donor vector suitable for integration or transposition in the baculovirus genome. The transfer vector generally allows the insertion of genetic material into the genome of a baculovirus.

Preferably, the transfer vector of the present invention comprises some of the nucleic acid sequences of the present invention, and / or any of the expression cassettes of the present invention as well as elements that allow their integration or transposition in the baculovirus genome. . The obtaining of said vector can be done by conventional methods known to those skilled in the art [eg, Sambrock et al., 1989, Molecular cloning. Vol. 2. New York: Cold spring harbor laboratory press]. For example, the obtaining of said vector can be done by the conventional method known as "Gateway System" (Hartley JL, Temple GF, Brasch MA. DNA cloning using in vitro site-specific recombination. Genome Res. 2000 Nov; 10 (11) : 1788-95). The transfer vector can transform cells comprising one or several copies of the baculovirus genome. For example, the transfer vector of the present invention comprises at least one sequence of the sequences depicted in SEQ ID Nos .: 1-2, SEQ ID NOs .: 4-8, SEQ ID NO.:10, SEQ ID NOs. : 12-15, SEQ ID NOs .: 17-20, SEQ ID NOs .: 22-25, SEQ ID NOs .: 27-30, SEQ ID NO .: 44, its complementary sequences or a variant of any of the sequences previous that has at least 70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequences. For example, the transfer vector of the present invention comprises SEQ ID NO .: 1. For example, the transfer vector of the present invention comprises SEQ ID NO .: 2. For example, the transfer vector of the present Invention comprises SEQ ID NO .: 5. For example, the transfer vector of the present invention comprises SEQ ID NO .: 6. For example, the transfer vector of the present invention comprises SEQ ID NO .: 12. For example, the transfer vector of the present invention comprises SEQ ID NO .: 13. For example, the transfer vector of the present invention comprises SEQ ID NO .: 14. For example, the transfer vector of the present Invention comprises SEQ ID NO .: 18. For example, the transfer vector of the present invention comprises SEQ ID NO .: 23. For example, the transfer vector of the present invention comprises SEQ ID NO .: 28. For example, the transfer vector of the

5

10

fifteen

twenty

25

30

The present invention comprises SEQ ID NO .: 29. For example, the transfer vector of the present invention comprises SEQ ID NO .: 30. For example, the transfer vector of the present invention comprises SEQ ID NO .: 44 .

The transfer vector of the present invention may be derived from one of the commercially available baculovirus-based expression systems "Bac-to-Bac®" (Invitrogen ™), "BacPAK ™" (Clontech ™), "FlashBAC ™" (Oxford Expression Technologies ™), “BacuVance ™” (GenScriptTM), “Bac-N-Blue DNATM” (InvitrogenTM), “BaculoDirect ™”

(InvitrogenTM), "BacVector®" 1000, 2000, 3000 (Novagen®), "DiamondBacTM" (Sigma-Aldrich®), "BaculoGold ™" (BD BiosciencesTM) or "MultiBack" (ETH Zurich / Redbiotec AG).

The donation, donor or transfer vectors of the present invention may be suitable for transforming or transducing prokaryotic cells. In addition, they may be suitable for transfecting or transducing eukaryotic cells, preferably insect cells, more preferably Sf21 and / or Hi5 and / or Sf9 and / or Se301 cells. The cloning and transfer vectors of the present invention may be suitable for transfecting or transducing insects or insect larvae, such as, for example, Bombyx mori and Trichoplusia or, preferably Trichoplusia or insect larvae.

The present invention also relates to the use of the vectors of the present invention to transform, transfect or transduce prokaryotic cells, eukaryotic cells, preferably insect cells, more preferably Sf21 and / or Hi5 and / or Sf9 and / or Se301 cells. Likewise, the present invention relates to the use of the cloning and transfer vectors of the present invention to transfect or transduce insects or insect larvae, such as Bombyx mori and Trichoplusia nor, preferably Trichoplusia ni insect larvae.

In the context of the present invention the term "transformation" is understood as the introduction of external genetic material into prokaryotic cells by plasmids, viral vectors (sometimes also referred to as transduction) or other tools for transfer.

In the context of the present invention, the term "transduction" is understood as the process by which exogenous genetic material is introduced into a prokaryotic or eukaryotic cell using a virus as a vector.

5

10

fifteen

twenty

25

30

In the context of the present invention the term "transfection" is understood as the introduction of external genetic material into eukaryotic cells or organisms by plasmids, viral vectors or other tools for transfer.

Bacmido

In one aspect of the invention the vector is a recombinant bacmid.

A "bacmido" as understood in the present invention is a plasmid comprising a nucleic acid sequence sufficient to generate a baculovirus.

The recombinant bacmid of the present invention comprises the nucleic acid sequence of the invention and / or the expression cassette according to the present invention. For example, the scope of the present invention comprises at least one sequence of the sequences depicted in SEQ ID NOs 1-2, SEQ ID NOs .: 4-8, SEQ ID NO.:10, SEQ ID NOs .: 12-15 , SEQ ID NOs .: 17-20, SEQ ID NOs .: 22-25, SEQ ID NOs .: 27-30, SEQ ID NO .: 44, its complementary sequences or a variant of any of the previous sequences it has minus 70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequences. For example, the scope of the present invention comprises SEQ ID NO .: 1. For example, the scope of the present invention comprises SEQ ID NO .: 2. For example, the scope of the present invention comprises SEQ ID NO. .: 5. For example, the scope of the present invention comprises SEQ ID NO .: 6. For example, the scope of the present invention comprises SEQ ID NO .: 12. For example, the scope of the present invention comprises SEQ ID NO .: 13. For example, the scope of the present invention comprises SEQ ID NO .: 14. For example, the scope of the present invention comprises SEQ ID NO .: 18. For example, the scope of The present invention comprises SEQ ID NO .: 23. For example, the scope of the present invention comprises SEQ ID NO .: 28. For example, the scope of the present invention comprises SEQ ID NO .: 29. For example , the bacmid of the present invention

comprises SEQ ID NO .: 30. For example, the scope of the present invention

It comprises SEQ ID NO .: 44. Bacmido is preferably suitable for producing a

recombinant baculovirus, a cell, an insect (or larva) or the culture medium of the

present invention.

The scope of the present invention may be suitable for transforming or transducing prokaryotic cells and / or transfecting or transducing eukaryotic cells, preferably insect cells. More preferably, it is suitable for transfecting Sf21 and / or Hi5 and / or Sf9 cells

5

10

fifteen

twenty

25

30

and / or Se301, or to transfect insects or insect larvae, preferably Trichoplusia ni. Therefore, the present invention relates to the use of the present invention to transform, transfect or transduce prokaryotic cells, eukaryotic cells, preferably insect cells, more preferably Sf21 and / or Hi5 and / or Sf9 and / or cells Se301. Likewise, the present invention relates to the use of the present invention to transfect insects or insect larvae, preferably Trichoplusia ni insect larvae.

Baculovirus

Therefore, the present invention relates to a baculovirus comprising a nucleic acid sequence or an expression cassette according to the present invention.

For example, the baculovirus of the invention comprises at least one sequence of the sequences depicted in SEQ ID NOs .: 1-2, SEQ ID NOs .: 4-8, SEQ ID NO.:10, SEQ ID NOs .: 12- 15, SEQ ID NOs .: 17-20, SEQ ID NOs .: 22-25, SEQ ID NOs .: 27-30, SEQ ID NO .: 44, its complementary sequences or a variant of any of the previous sequences it has at least 70%, or 80%, or 90%, or 95%, or 97%, or a

 99% of

 identity with said sequences. For example, the baculovirus of the present

 invention

 comprises SEQ ID NO .: 1. For example, the baculovirus of the present

 invention

 comprises SEQ ID NO .: 2. For example, the baculovirus of the present

 invention

 comprises SEQ ID NO .: 5. For example, the baculovirus of the present

 invention

 comprises SEQ ID NO .: 6. For example, the baculovirus of the present

 invention

 comprises SEQ ID NO .: 12. For example, the baculovirus of the present

 invention

 comprises SEQ ID NO .: 13. For example, the baculovirus of the present

 invention

 comprises SEQ ID NO .: 14. For example, the baculovirus of the present

 invention

 comprises SEQ ID NO .: 18. For example, the baculovirus of the present

 invention

 comprises SEQ ID NO .: 23. For example, the baculovirus of the present

 invention

 comprises SEQ ID NO .: 28. For example, the baculovirus of the present

 invention

 comprises SEQ ID NO .: 29. For example, the baculovirus of the present

 invention

 comprises SEQ ID NO .: 30. For example, the baculovirus of the present

Invention includes SEQ ID NO .: 44.

The baculovirus of the present invention can be derived from any baculovirus. For example, the baculovirus of the present invention may be derived from Spodoptera exigua multiple nucleopoliedrovirus (SeMNPV), or from Spodoptera litoralis nucleopoliedrovirus (SpliMNPV), or from Spodoptera frugiperda nucleopoliedrovirus (SpfrMNPV), or from

5

10

fifteen

twenty

25

30

Agrotis ipsilon nucleopoliedrovirus (AgipMNPV), or Agrotis segetum nucleopoliedrovirus (AgseMNPV), or Bombyx mori nucleopoliedrovirus (BmNPV), or Calipomic Autographa nucleopoliedrovirus (AcMNPV).

Preferably, the baculovirus of the present invention is derived from AcNMPV, BmNPV or SeMNPV.

The baculovirus of the present invention is suitable for infecting insect cells, insects and / or insect larvae. Preferably, the baculovirus of the present invention is suitable for infecting trichoplusia ni. Therefore the present invention relates to the use of the baculovirus of the present invention to infect insect cells, insect or insect larvae, preferably Trichoplusia ni insect larvae.

The baculovirus generation may be based on commercially available baculovirus-based expression systems: "Bac-to-Bac®" (Invitrogen ™), "BacPAK ™"

(Clontech ™), "FlashBAC ™" (Oxford Expression Technologies ™), "BacuVance ™"

(GenScript ™), “Bac-N-Blue DNATM” (Invitrogen ™), “BaculoDirect ™” (Invitrogen ™),

“BacVector®” 1000, 2000, 3000 (Novagen®), “DiamondBac ™” (Sigma-Aldrich®),

“BaculoGold ™” (BD Biosciences ™) or “MultiBack” (ETH Zurich / Redbiotec AG).

Cells

The recombinant vectors provided by this invention can be used to transform, transduce and / or transfect eukaryotic or prokaryotic cells. Therefore, in another aspect, the invention relates to a transformed, transduced or transfected host cell comprising the recombinant vector and / or the nucleic acid sequence provided by the invention. For example, the transformed, transduced and / or transfected cell of the present invention comprises at least one sequence of the sequences depicted in SEQ ID NOs .: 1-2, SEQ ID NOs .: 4-8, SEQ ID NO.:10 , SEQ ID NOs .: 1215, SEQ ID NOs .: 17-20, SEQ ID NOs .: 22-25, SEQ ID NOs .: 27-30, SEQ ID NO .: 44, its complementary sequences or a variant of any of the previous sequences that have at least 70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequences. For example, the transformed, transduced and / or transfected cell of the present invention comprises SEQ ID NO .: 1. For example, the transformed, transduced and / or transfected cell of the present invention comprises SEQ ID NO .: 2. For example, the transformed, transduced and / or transfected cell of the present invention comprises SEQ ID NO .: 5. For example, the transformed, transduced and / or cell

5

10

fifteen

twenty

25

30

Transfected of the present invention comprises SEQ ID NO .: 6. For example, the transformed, transduced and / or transfected cell of the present invention comprises SEQ ID NO .: 12. For example, the transformed, transduced and / or cell Transfected of the present invention comprises SEQ ID NO .: 13. For example, the transformed, transduced and / or transfected cell of the present invention comprises SEQ ID NO .: 14. For example the transformed, transduced and / or transfected cell of the present invention comprises SEQ ID NO .: 18. For example the transformed, transduced and / or transfected cell of the present invention comprises SEQ ID NO .: 23. For example, the transformed, transduced and / or transfected cell of The present invention comprises SEQ ID NO .: 28. For example, the transformed, transduced and / or transfected cell of the present invention comprises SEQ ID NO .: 29. For example, the transformed, transduced and / or transfected cell of the present invention bought hence SEQ ID NO .: 30. For example, the transformed, transduced and / or transfected cell of the present invention comprises SEQ ID NO .: 44.

Transformed, transduced or transfected cells can be obtained by conventional methods known to those skilled in the art, e.g. [Sambrock et al., 1989, cited supra, Hartley JL, Temple GF, Brasch MA. DNA cloning using in vitro site-specific recombination. Genome Res. 2000 Nov; 10 (11): 1788-95].

Accordingly, in another aspect, the invention relates to a transformed, transduced or transfected host cell comprising at least one nucleic acid sequence of the invention, an expression cassette provided by the present invention or a recombinant vector of the invention. invention.

The cell of the present invention can be infected with the baculovirus of the present invention. In the context of the present invention, the term "infection" is understood as a virus entry into the host cell that generates structural damage to the host.

Preferably, the cell of the present invention comprises one or several copies of the baculovirus genome, for obtaining recombinant bansides according to the present invention. In one aspect of the present invention, the transformed cell is Escherichia coli. For example, when the Bac-to-Bac® commercial baculovirus-based expression system is used, the cell used is DH10BacTM. In another aspect, the transduced, transfected or infected transformed cell is a eukaryotic cell, preferably an insect cell, such as Sf21, Hi5, Sf9 or Se301.

5

10

fifteen

twenty

25

30

35

The present invention further relates to a cell comprising a baculovirus according to the present invention. In another aspect, the invention provides a transgenic cell comprising, inserted in its genome, at least one nucleic acid sequence or an expression cassette provided by the present invention. For example, the transgenic cell of the present invention comprises, inserted into its genome, at least one sequence of the sequences depicted in SEQ ID NOs .: 1-2, SEQ ID NOs .: 4-8, SEQ ID NO.:10 , SEQ ID NOs .: 12-15, SEQ ID NOs .: 17-20, SEQ ID NOs .: 22-25, SEQ ID NOs .: 27-30, SEQ ID NO .: 44, their complementary sequences or a variant of any of the above sequences that have at least 70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequences. For example, the transgenic cell of the present invention comprises, inserted in its genome, SEQ ID NO .: 1. For example, the transgenic cell of the present invention comprises, inserted in its genome, SEQ ID NO .: 2. For example, the transgenic cell of the present invention comprises, inserted in its genome, SEQ ID NO .: 5. For example, the transgenic cell of the present invention comprises, inserted in its genome, SEQ ID NO .: 6. For example, the transgenic cell of the present invention comprises SEQ ID NO .: 12. For example, the transgenic cell of the present invention comprises SEQ ID NO .: 13. For example, the transgenic cell of the present invention comprises the SEQ ID NO .: 14. For example the transgenic cell of the present invention comprises SEQ ID NO .: 18. For example the transgenic cell of the present invention comprises SEQ ID NO .: 23. For example, the transgenic cell of The present invention comprises SEQ ID NO .: 28. For example, the Transgenic cell of the present invention comprises SEQ ID NO .: 29. For example, the transgenic cell of the present invention comprises SEQ ID NO .: 30. For example, the transgenic cell of the present invention comprises SEQ ID NO. : 44. In a particular embodiment said transgenic cell is a eukaryotic cell, preferably an animal cell, preferably an insect cell.

When the cell is an insect cell, it preferably belongs to a cell line derived from an insect of the genus Lepidoptera or Diptera. More preferably, it is a cell derived from any of the following: Trichoplusia ni, Spodoptera frugiperda, Ascalapha odorata, Bombyx mori, Drosophila melanogaster, Stigmene acrea and Aedes aegypti. Even more preferably, the cell is selected from the group of insect cells consisting of Hi-5TM, Sf9, Sf21, BTI-Tn5B-1, Tn368, ExpresSf + ®, BTI-TnAo38, ATC-10, Mimic ™ Sf9, SfSWT -1, SfSWT-3, SfSWT-5, TriEx ™, Se301 and Schneider's Drosophila Line 2. Preferably, the insect cell is Hi-5 ™, Sf9, Sf21 or Se301. The cell of the present invention can grow in monolayer or suspension cultures.

5

10

fifteen

twenty

25

30

Insects

In addition, the invention also provides a transgenic animal, particularly an insect or an insect larva comprising a nucleic acid sequence or an expression cassette, a vector or a band according to the present invention. For example, the insect or insect larva of the present invention comprises at least one sequence of the sequences depicted in SEQ ID NOs .: 1-2, SEQ ID NOs .: 4-8, SEQ ID NO.:10, SEQ ID NOs .: 12-15, SEQ ID NOs .: 17-20, SEQ ID NOs .: 22-25, SEQ ID NOs .: 27-30, SEQ ID NO .: 44, its complementary sequences or a variant of any of the previous sequences that have at least 70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequences. For example, the insect or insect larva of the present invention comprises SEQ ID NO .: 1. For example, the insect or insect larva of the present invention comprises SEQ ID NO .: 2. For example, the insect or insect larva of the present invention comprises SEQ ID NO .: 5. For example, the insect or insect larva of the present invention comprises SEQ ID NO .: 6. For example, the insect or insect larva of the present invention comprises SEQ ID NO .: 12. For example, the insect or insect larva of the present invention comprises SEQ ID NO .: 13. For example, the insect or insect larva of the present invention comprises SEQ ID NO .: 14. For example, the insect or insect larva of the present invention comprises SEQ ID NO .: 18. For example the insect or insect larva of the present invention comprises SEQ ID NO .: 23. For example the insect or insect larva of the present invention comprises SEQ ID NO .: 28. For example the insect or larva of in sect of the present invention comprises SEQ ID NO .: 29. For example, the insect or insect larva of the present invention comprises SEQ ID NO .: 30. For example, the insect or insect larva of the present invention comprises SEQ ID NO .: 44. Preferably, the insect or insect larva is capable of expressing and / or expressing the recombinant protein of interest. Therefore, the present invention also relates to the use of the insect or insect larva of the present invention for the production of recombinant proteins.

In another embodiment of the present invention, the insect (or the larva) has been infected, transfected, transduced or transformed with the nucleic acid sequence, the expression cassette, the cloning vector, the transfer vector, the bacmid or the Recombinant baculovirus of the present invention. For example, the insect (or larva) has been infected, transfected, transduced or transformed with at least one sequence of the sequences represented in SEQ ID NOs .: 1-2, SEQ ID NOs .: 4-8, SEQ ID NO .: 10, SEQ ID NOs .: 12-15, SEQ ID NOs .: 17-20, SEQ ID NOs .: 22-25, SEQ ID NOs .: 27-30, SEQ ID NO .:

5

10

fifteen

twenty

25

30

44, its complementary sequences or a variant of any of the previous sequences that has at least 70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with these sequences. For example, the insect (or larva) has been infected, transfected, transduced or transformed with SEQ ID NO .: 1. For example, the insect (or larva) has been infected, transfected, transduced or transformed with SEQ ID NO .: 2. For example, the insect (or larva) has been infected, transfected, transduced or transformed with SEQ ID NO .: 5. For example, the insect (or larva) has been infected, transfected, Transduced or transformed with SEQ ID NO .: 6. For example, the insect (or larva) has been infected, transfected, transduced or transformed with SEQ ID NO .: 12. For example, the insect (or larva) has been infected, transfected, transduced or transformed with SEQ ID NO .: 13. For example, the insect (or larva) has been infected, transfected, transduced or transformed with SEQ ID NO .: 14. For example, the insect (or larva) has been infected, transfected, transduced or transformed with SEQ ID NO .: 18. For example, the insect (or larva) has been infected, transfected, transduced or transformed with SEQ ID NO .: 23. For example, the insect (or larva) has been infected, transfected, transduced or transformed with SEQ ID NO .: 28. For example, the insect ( or the larva) has been infected, transfected, transduced or transformed with SEQ ID NO .: 29. For example, the insect (or the larva) has been infected, transfected, transduced or transformed with SEQ ID NO .: 30. For example, the insect (or the larva) has been infected, transfected, transduced or transformed with SEQ ID NO .: 44.

In a preferred embodiment of the present invention, the insect or insect larva comprises a baculovirus according to the present invention. The baculovirus can be administered to the insect, or to the larva orally (per os) or by injection as described for example in (Hughes PR and Wood HA (1996). In vivo production, stabilization and infectivity of Baculovirus preoccluded virions Applied and Environmental Microbiology, 62: 105-108; per os; Perez-Filgueira DM, Gonzalez-Camacho F, Gallardo C, Resino-Talavan P, Blanco E, Gomez-Casado E, et al. Optimization and validation of recombinant serological tests for African Swine Fever diagnosis based on detection of the p30 protein produced in Trichoplusia ni larvae. J Clin Microbiol 2006; 44 (9): 3114-21)).

Preferably, the insect or insect larva is a transgenic insect.

The insect is preferably a lepidopter and more preferably an insect selected from: Trichoplusia ni, Spodoptera frugiperda, Spodoptera exigua, Ascalapha odorata, Bombix mori, Rachiplusia ni and Stigmene acrea. In a preferred embodiment, the insect is a larva.

5

10

fifteen

twenty

25

30

Culture medium

In addition, the present invention provides a culture medium comprising a nucleic acid sequence, an expression cassette, a donation vector, a transfer vector, a bacmid, a recombinant baculovirus, a cell or an insect (or larva) according to The present invention.

Methods to produce the product of interest

Any of the sequences of the present invention can be used to produce products of interest. The invention also provides a method for expressing a gene that encodes a product of interest in a non-human animal, preferably in an insect or larva and more preferably in an insect larva. Therefore, in another particular embodiment, the invention provides a method of producing a product of interest that may be a recombinant protein, comprising the use of a nucleic acid sequence, an expression cassette, a cloning vector, a vector of transfer, a bacmid, a recombinant baculovirus, a cell or an insect (or insect larva) according to the present invention, and the obtaining of the recombinant protein or product of interest. In a particular embodiment, the present invention relates to a method of producing a protein comprising the steps of:

a) infecting insect cells with a baculovirus according to the present invention, or transfecting, transducing or transforming them with the bacmid, or with the cloning or transfer vector, or with an expression cassette according to the present invention;

b) express the protein;

c) obtain said protein.

In addition, the present invention provides a method of producing a protein comprising the steps of:

a) infecting insects or insect larvae with a baculovirus according to the present invention, or transfecting, transducing or transforming them with the bacmid, or with the cloning or transfer vector, or with an expression cassette according to the present invention;

b) express the protein;

5

10

fifteen

twenty

25

c) obtain said protein

The methods described in the present invention comprise the use of the insect cells, insects or larvae described in the present invention.

The transfection, transduction or transformation of cells, more preferably of insect cells, can be carried out by conventional methods. For a review of the genetic transfer to insects, including vectors, DNA transfer methods, etc., see, for example, Tomita, M. et al., Nature Biotechnology 2003, 21: 53-56 or Perez-Filgueira, M et al., Virology 2007, 364: 422-443.

The conditions for optimizing the culture of said cells or organisms will depend on the cell or organism used. If desired, the methods for producing a product of interest such as a recombinant protein provided by the present invention also include isolation and / or purification of said product of interest.

In general, the product of interest obtainable by the method of the present invention is in the form of a peptide or protein, preferably protein. Therefore, the present invention also provides a recombinant protein obtainable by the methods of the present invention. In a particular embodiment, the protein obtainable by the methods of the present invention is a recombinant protein for use in methods of treatment, therapy or diagnosis. Therefore the present invention relates to the use of the recombinant protein of the invention in therapy or diagnosis.

By way of example, the protein obtainable by the methods of the present invention may be a recombinant vaccine, a protein vaccine, a therapeutic protein, an antibody, an enzyme, a cytokine, a coagulation factor, an anticoagulant, a receptor, a hormone, a protein with diagnostic value or proteins of virus-like particles (VLP).

The present invention further relates to the use of a nucleic acid sequence, an expression cassette, a donation vector, a transfer vector, a bacmid, a recombinant baculovirus, a cell, an insect or an insect larva according to the present invention for the production of a protein.

SEQUENCE LIST

 SEQ ID NO .:

 Name:

 one

 Differential Sequence (aaaattaaatttttgctacaatata)

 2

 LMP promoter (atcatgtgtttgaacggcgactgtttggcggtatgcaggagcgtcgctacctcgaccgacgaaccggcggccttttt ggattttgtcaaaaagaacgacgcagcgaaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaatt gttactggaccgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactt tgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatata)

 3

 LMP promoter A-D or PSEs (atcatgtgtttgaacggcgactgtttggcggtatgcaggagcgtcgctacctcgaccgacgaaccggcggccttttt ggattttgtcaaaaagaacgacgcagcgaaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaatt gttactggaccgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactt tgttgtccattgctgatgatttattaagtcttttggca)

 4

 Promoter pSeL-140 (cgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccat tgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatata)

 5

 Promoter pSeL-120 (gttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttg gcaaaaattaaatttttgctacaatata)

 6

 LMP-120-promoter pph (gttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttg gcaaaaattaaatttttgctacaatataatcatggagataattaaaatgataaccatctcgcaaataaataagtatttta ctgttttcgtaacagttttgtaataaaaaaacctataaatattccggattattcataccgtcccaccatcgggcgcg)

 7

 Differential Sequence Promoter-pph (aaaattaaatttttgctacaatataatcatggagataattaaaatgataaccatctcgcaaataaataagtattttactg ttttcgtaacagttttgtaataaaaaaacctataaatattccggattattcataccgtcccaccatcgggccccccccgc

 8

 LMP-promoter pph (atcatgtgtttgaacggcgactgtttggcggtatgcaggagcgtcgctacctcgaccgacgaaccggcggccttttt ggattttgtcaaaaagaacgacgcagcgaaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaatt gttactggaccgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactt tgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatataatcatggagataattaaaatg ataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaaaaacctataaatattccggatta

 ttcataccgtcccaccatcgggcgcg)

 9

 LMP promoter A-D-pph (atcatgtgtttgaacggcgactgtttggcggtatgcaggagcgtcgctacctcgaccgacgaaccggcggccttttt ggattttgtcaaaaagaacgacgcagcgaaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaatt gttactggaccgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactt tgttgtccattgctgatgatttattaagtcttttggcaatcatggagataattaaaatgataaccatctcgcaaataaata agtattttactgttttcgtaacagttttgtaataaaaaaacctataaatattccggattattcataccgtcccaccatcggg CGCG)

 10

 LMP-140-promoter pph (cgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccat tgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatataatcatggagataattaaaatgataaccat ctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaaaaacctataaatattccggattattcatacc gtcccaccatcgggcgcg)

 eleven

 Promoter pph (atcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaa aaacctataaatattccggattattcataccgtcccaccatcgggcgcg)

 12

 LMP LMP-promoter (atcatgtgtttgaacggcgactgtttggcggtatgcaggagcgtcgctacctcgaccgacgaaccggcggccttttt ggattttgtcaaaaagaacgacgcagcgaaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaatt gttactggaccgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactt tgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatataatcatgtgtttgaacggcgac tgtttggcggtatgcaggagcgtcgctacctcgaccgacgaaccggcggcctttttggattttgtcaaaaagaacga cgcagcgaaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaattgttactggaccgaatgtacaat attgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttatt aagtcttttggcaaaaattaaatttttgctacaatata)

 13

 LMP LMP-promoter-LMP (atcatgtgtttgaacggcgactgtttggcggtatgcaggagcgtcgctacctcgaccgacgaaccggcggccttttt ggattttgtcaaaaagaacgacgcagcgaaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaatt gttactggaccgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactt tgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatataatcatgtgtttgaacggcgac tgtttggcggtatgcaggagcgtcgctacctcgaccgacgaaccggcggcctttttggattttgtcaaaaagaacga cgcagcgaaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaattgttactggaccgaatgtacaat attgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttatt aagtcttttggcaaaaattaaatttttgctacaatataatcatgtgtttgaacggcgactgtttggcggtatgcaggagc gtcgctacctcgaccgacgaaccggcggcctttttggattttgtcaaaaagaacgacgcagcgaaaacgccaatg

 ttgcaaattgtggaccggcacgaacacgttgaattgttactggaccgaatgtacaatattgttgaaatgttcaataatc aataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttacatatt

 14

 Promoter pph-Differential sequence (atcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaa aaacctataaatattccggattattcataccgtcccaccatcgggcgcgaaaattaaattattttgctaca

 fifteen

 Promoter pph-LMP (atcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaa aaacctataaatattccggattattcataccgtcccaccatcgggcgcgatcatgtgtttgaacggcgactgtttggcg gtatgcaggagcgtcgctacctcgaccgacgaaccggcggcctttttggattttgtcaaaaagaacgacgcagcg aaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaattgttactggaccgaatgtacaatattgttga aatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtctttt ggcaaaaattaaatttttgctacaatata)

 16

 Promoter pph-LMP A-D (atcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaa aaacctataaatattccggattattcataccgtcccaccatcgggcgcgatcatgtgtttgaacggcgactgtttggcg gtatgcaggagcgtcgctacctcgaccgacgaaccggcggcctttttggattttgtcaaaaagaacgacgcagcg aaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaattgttactggaccgaatgtacaatattgttga aatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtctttt GGCA)

 17

 Promoter pph-LMP-140 (atcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaa aaacctataaatattccggattattcataccgtcccaccatcgggcgcgcgaatgtacaatattgttgaaatgttcaat aatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttggcaaaaa ttaaatttttgctacaatata)

 18

 Promoter pph-LMP-120 (atcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaa gcagtctcgaggttcaataatcaataaacctctctattatcctttgtaaattttttatttactttgttgtccattgctgatcattta aaacctataaatattccggattattcataccgtcccaccatcgggcgcggatccaaggccactagtgcggccgctct ttaagtcttttggcaaaaattaaatttttgctacaatata)

 19

 Differential Sequence Promoter-p10 (aaaattaaatttttgctacaatataatacggacctttaattcaacccaacacaatatattatagttaaataagaattatt atcaaatcatttgtatattaattaaaatactatactgtaaattacattttatttacaatcactcgac)

 twenty

 Promoter pSeL-p10

 (Atcatgtgtttgaacggcgactgtttggcggtatgcaggagcgtcgctacctcgaccgacgaaccggcggccttttt ggattttgtcaaaaagaacgacgcagcgaaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaatt gttactggaccgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactt tgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatataatacggacctttaattcaacc caacacaatatattatagttaaataagaattattatcaaatcatttgtatattaattaaaatactatactgtaaattacatttt atttacaatcactcgac)

 twenty-one

 LMP promoter A-D-p10 (atcatgtgtttgaacggcgactgtttggcggtatgcaggagcgtcgctacctcgaccgacgaaccggcggccttttt ggattttgtcaaaaagaacgacgcagcgaaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaatt gttactggaccgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactt tgttgtccattgctgatgatttattaagtcttttggcaatacggacctttaattcaacccaacacaatatattatagttaaat aagaattattatcaaatcatttgtatattaattaaaatactatactgtaaattacattttatttacaatcactcgac)

 22

 LMP-140 promoter-p10 (cgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccat tgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatataatacggacctttaattcaacccaacacaa tatattatagttaaataagaattattatcaaatcatttgtatattaattaaaatactatactgtaaattacattttatttacaatc actcgac)

 2. 3

 LMP-120 promoter-p10 (gttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttg gcaaaaattaaatttttgctacaatataatacggacctttaattcaacccaacacaatatattatagttaaataagaatt attatcaaatcatttgtatattaattaaaatactatactgtaaattacattttatttacaatcactcgac)

 24

 Promoter p10-Differential sequence (atacggacctttaattcaacccaacacaatatattatagttaaataagaattattatcaaatcatttgtatattaattaaa atactatactgtaaattacattttatttacaatcactcgacaaaattaaatttttgctacaatata)

 25

 P10 promoter-LMP (atacggacctttaattcaacccaacacaatatattatagttaaataagaattattatcaaatcatttgtatattaattaaa gcgtcgctacctcgaccgacgaaccggcggcctttttggattttgtcaaaaagaacgacgcagcgaaaacgccaa atactatactgtaaattacattttatttacaatcactcgacatcatgtgtttgaacggcgactgtttggcggtatgcagga tgttgcaaattgtggaccggcacgaacacgttgaattgttactggaccgaatgtacaatattgttgaaatgttcaataat caataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttggcaaaaatta aatttttgctacaatata)

 26

 P10 promoter-LMP A-D (atactatactgtaaattacattttatttacaatcactcgacatcatgtgtttgaacggcgactgtttggcggtatgcagga atacggacctttaattcaacccaacacaatatattatagttaaataagaattattatcaaatcatttgtatattaattaaa gcgtcgctacctcgaccgacgaaccggcggcctttttggattttgtcaaaaagaacgacgcagcgaaaacgccaa

 tgttgcaaattgtggaccggcacgaacacgttgaattgttactggaccgaatgtacaatattgttgaaatgttcaataat caataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttggca)

 27

 P10 promoter-LMP-140 (atacggacctttaattcaacccaacacaatatattatagttaaataagaattattatcaaatcatttgtatattaattaaa atactatactgtaaattacattttatttacaatcactcgaccgaatgtacaatattgttgaaatgttcaataatcaataaac ctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgct acaatata)

 28

 P10 promoter-LMP-120 (atacggacctttaattcaacccaacacaatatattatagttaaataagaattattatcaaatcatttgtatattaattaaa atactatactgtaaattacattttatttacaatcactcgacgttcaataatcaataaacctctctattatgctttgtaaatttttt atttactttgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatata)

 29

 Promoter LMP-120-LMP-120 (gttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttg gcaaaaattaaatttttgctacaatatagttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgt ccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatata)

 30

 Promoter pSeL- 120-pSeL- 120-LMP-120 (gttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttg gcaaaaattaaatttttgctacaatatagttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgt ccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatatagttcaataatcaataaacctctctatt atgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatata)

 31

 Promoter p10 (atacggacctttaattcaacccaacacaatatattatagttaaataagaattattatcaaatcatttgtatattaattaaa atactatactgtaaattacattttatttacaatcactcgac)

 32

 PSeLF primer (ggatccgtatacatcatgtgtttgaacggcgactg)

 33

 PSeLR primer (gactagtatattgtagcaaaaatttaatttttgccaaaag)

 3. 4

 PSeS primer (ggatccgtatacatcatgtgtttgaacggcgactg)

 35

 PSeSR primer (gactagtgccaaaagacttaataaatcatcagc)

 36

 Primer pSeL-140F (tagtataccgaatgtacaatattgttg)

 37

 Primer pSeL-140R (ctgggtgtagcgtcgtaagc)

 38

 Primer pSeL-120F (tagtatacgttcaataatcaataaacctctc)

 39

 Primer pSeL-120R (ctgggtgtagcgtcgtaagc)

 40

 Primer pph-pSeLF (atctcgaggttcaataatcaataaacctctctattatcctttgtaaattttttatttactttgttgtccattgctgatcat)

 41

 Pph-pSeLR primer (ctgggtgtagcgtcgtaagc)

 42

 Multi-cloning site sequence (PL) (GGATCCaaggccactagtgcggccgctctgcagtctcgagcatgcggtaccaagcttGAATTC)

 43

 eGFP (enhanced GFP) (atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacg gccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgc accaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgc taccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccat cttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgc atcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaaca gccacaacgtctatatcatggccgacaagcagaagaacggcatcatggtgaacttcaagatccgccacaacatc gaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctg cccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtc ctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa)

 44

 Promoter pph-LMP-120 theoretical (atcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaa aaacctataaatattccggattattcataccgtcccaccatcgggcgcggttcaataatcaataaacctctctattatgc tttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatata)

F = forward

p

R = reverse

5

10

fifteen

twenty

25

30

Examples

Example 1. Materials and methods Cloning of GFP under the different promoters

In the vector pFB-PL-GFP (pph-GFP), the gene encoding the GFP protein (SEQ ID NO .: 43) was cloned under the control of the polyhedrin promoter (pph, SEQ ID NO .: 11), . This vector (pFB-PL-GFP (pph-GFP)) is a derivative of the pFasTBacl that expresses the GFP protein, and on which a multi-cloning site (PL) is inserted upstream of the GFP. The sequence of the multi-cloning site (PL) is

GGATCCaaggccactagtgcggccgctctgcagtctcgagcatgcggtaccaagcttGAATTC (SEQ ID NO .: 42). The DNA fragment corresponding to the pSeL and pSeS promoters was obtained by PCR amplification using as a template SeMNPV genome DNA and specific primers incorporating restriction sites for the BstZ17I and Spel enzymes (primers, SEQ ID NOs .: 32, 33 , 34, 35). Then the polyhedrin promoter in pph-GFP was replaced by the pSeL and pSeS promoters using the BstZ17I and Spel restriction sites (New England biolabs, Ipswich, USA) and generating the pSeL-GFP and pSeS-GFP vectors.

From the pSeL-GFP vector, the pSeL140 and pSeL120 fragment were amplified by PCR. For this, 2 specific primers were used, one including the corresponding 5 'region as well as a restriction site for BstZ17I (primers, SEQ ID NOs .: 36, 38) and a second primer that was designed to amplify the 3' gene region GFP which contains an AvrII restriction site (primers, SEQ ID NOs .: 37, 39). The pphGFP vector was digested with the BstZ17I and AvrII enzymes at 37 ° C for 3 hours, releasing the fragment containing the pph-GFP which was replaced by the previously generated fragments for pSeL140 (SEQ ID NO .: 4) and pSeL120 (SEQ ID NO .: 5) and giving rise to the vectors pSeL140-GFP and pSeL120-GFP, respectively.

For the generation of the construction containing the pph and the pSeL120 (SEQ ID NOs .: 11 and SEQ ID NO .: 5, respectively) in tandem (pph-pSeL-120-GFP) the fragment pSeL-120 (SEQ ID NO. : 5) was amplified by PCR with specific primers containing restriction sites XhoI and AvrII (primer sequences: SEQ ID NOs .: 40, 41). Said fragment was cloned into the open pph-GFP plasmid with said restriction enzymes. The resulting plasmid was named as pph-pSeL-120-GFP.

5

10

fifteen

twenty

25

30

Generation of recombinant baculoviruses

Recombinant baculoviruses were generated using the Bac-to-Bac® baculovirus expression system (Invitrogen, USA) following the manufacturer's instructions. Plasmids resulting from the previous step were used to transform E. coli DH10Bac ™ cells for transposition in the viral genome and generation of recombinant bacmids. The DNA of each of the recombinant bacmids obtained was purified following the protocol described in the Bac-to-Bac® (Invitrogen ™) manual, and was used to transfect Spodoptera frugiperda, Sf21 cells using Cellfectin® II Reagent (Invitrogen ™) as a transfection reagent, following the manufacturer's instructions. The generated viruses were collected after 3 days of incubation at 27 ° C. The viruses resulting from the transfection were amplified, again infecting Sf21 cells in order to obtain a viral stock.

Insect cell lines were grown in Grace’s Insect Medium (1X) (Gibco®, Life technologies ™) supplemented with 10% FBS (fetal bovine serum). The different virus stocks generated were quantified by quantitative PCR (qPCR) using primers specific for viral DNA polymerase.

Infection tests in insect cells

Three different types of insect cells were used for baculovirus infection tests: S. exigua, Se301; S. frugiperda, Sf21; and Trichoplusia ni, Hi5. Approximately 2x105 cells (70% confluence) were infected with each virus at a multiplicity of infection (MOI) 5, adding the virus solution directly on the cell culture medium, and at different times post infection, the Cells were collected by centrifugation at 3000 rpm for 5 minutes and the promoter activity was determined by quantifying their fluorescence.

Fluorescence assays

The cells obtained in the previous steps were lysed using a lysis buffer (50 mM Tris-HCl pH 7.5, 100 mM NaCl, 1 mM DTT, 5% glycerol) and the fluorescence emitted by the GFP reporter gene was measured at 535 nm after having been excited at 485 nm. Each value was obtained by making 4-5 measurements for each sample. The percentage of GFP fluorescence intensity is directly related to the GFP expression levels (it is understood that it works at lower concentrations than the saturation concentration, which is

5

10

fifteen

twenty

25

30

confirm for each measurement). The values shown are the average resulting from at least two independent trials.

Insect infection tests

Larvae were used in the fifth larval stage (the last before pupation) of the Trichoplusia ni (T. ni) lepidopter for all insect tests. They were inoculated with 5 µl of the recombinant baculoviruses containing 50,000 BVs and collected at 72 hpi (post infection hours). These larvae were kept at -20 ° C until use. The extraction of soluble proteins under native conditions was done by homogenizing the larvae in an extraction buffer composed of: 1x PBS, 0.01% Triton X-100, 1mM PMSF and 25mM DTT. For its processing, a Bag Mixer® blender type shredder (Interscience ™, France) was used. The homogenates were centrifuged 30 minutes at 1800 g and at 4 ° C. The sediment was discarded and the soluble fraction, filtered with miracloth (Calbiochem), (20 ^ g / well) was analyzed by fluorimetry, in the same way as the previous section is described. Each value was obtained by measuring each sample 4-5 times. The values shown are the average resulting from at least two independent trials.

Example 2. Expression of the GFP protein in Sf21, Se301 and Hi5 insect cells under the promoters pph, pSeL and pSeS.

S. exigua insect cells, Se301; S. frugiperda, Sf21; and Trichoplusia ni, Hi5 were infected with recombinant baculovirus incorporating the following expression cassettes (Figure 3):

- pph-GFP (pph in Figure 1)

- pSeL-GFP (pSeL in Figure 1)

- pSeS-GFP (pSeS in Figure 1)

The results are shown in Figure 1. The expression of GFP in cell lines Sf21 (A), Se301 (B) and Hi5 (C) is superior when this protein is expressed under the pSeL promoter (SEQ ID NO .: 2) that when the protein is expressed under the promoter pph (the “gold standard '(standard reference model, SEQ ID NO .: 11) up to 72 hours after infection. In addition, the expression of GFP in Hi5 is higher when the protein it is expressed under the pSeL promoter that when the protein is expressed under the pph promoter even after 72 hours after infection, these results show the suitability of this promoter (pSeL) for the expression of recombinant proteins in insect cells. GFP expression under the pSeS promoter (SEQ ID NO .: 3) was practically

39

5

10

fifteen

twenty

25

30

void after infection. Therefore, SEQ ID NO .: 1 is an essential sequence of the promoter of the invention (see Figure 7).

Example 3. Expression of the GFP protein in Sf21, Se301 and Hi5 insect cells under the promoters pph, pSeL, pSeL-140 and pSeL-120.

S. exigua insect cells, Se301; S. frugiperda, Sf21; and Trichoplusia ni, Hi5 were infected with recombinant baculovirus incorporating the following expression cassettes (Figure 3):

- pph-GFP (pph in Figure 2)

- pSeL-GFP (pSeL in Figure 2)

- pSeL-140-GFP (pSeL-140 in Figure 2)

- pSeL-120-GFP (pSeL-120 in Figure 2)

The results are seen in Figure 2. The expression of GFP in cell lines Sf21 (A), Se301 (B) and Hi5 (C) is superior when this protein is expressed under the promoter pSeL-120. In the Se301 cell line, the GFP expression levels under the promoters pSeL-120 (SEQ ID NO .: 5) and pSeL-140 (SEQ ID NO .: 4) are similar, and higher than the GFP expression levels when This protein is expressed under the promoter pSeL (SEQ ID NO .: 2) or pph (SEQ ID NO .: 11). Therefore, both promoters pSeL-120 and pSeL-140, and mainly pSeL-120 allow a high expression of the recombinant protein, well above the expression under the polyhedrin promoter ("gold standard").

Example 4. Expression of the GFP protein in Sf21, Se301 and Hi5 insect cells under the promoters pph, pSeL, pSeL-120 and pph-pSeL-120.

S. exigua insect cells, Se301, S. frugiperda, Sf21, and Trichoplusia ni, Hi5, were infected with recombinant baculovirus incorporating the following expression cassettes (Figure 3):

- pph-GFP (pph in Figure 4)

- pSeL-GFP (pSeL in Figure 4)

- pSeL-120-GFP (pSeL-120 in Figure 4)

- pph-pSeL-120-GFP (pph / pSeL-120 in Figure 4)

The results are seen in Figure 4. The expression of GFP in cell lines Sf21 (A), Se301 (B) and Hi5 (C) is superior when this protein is expressed under the pph- promoter

pSeL-120 (pph / pSeL-120 in Figure 4, SEQ ID NO.:18) that when expressed under

40

any of the other promoters (pSeL, SEQ ID NO .: 2 and pSeL-120, SEQ ID NO .: 5). The highest levels of expression are observed when the polyhedrin promoter (pph) and the pSeL-120 sequence are arranged in tandem (pph-pSeL-120, SEQ ID NO.:18). Therefore, the expression of recombinant proteins in insect cells is maximal when the sequence encoding said recombinant protein is under the control of the pph-pSeL-120 promoter (SEQ ID NO.:18).

Example 5. Expression of the GFP protein in insect larvae of T. ni

Larvae of T. nor in the fifth larval stage were inoculated with the recombinant baculovirus and collected at 72 hpi. Figure 5 shows the expression of the 10 GFP recombinant protein under the different promoters (different expression cassettes):

- pph-GFP (pph in Figure 5)

- pSeL-GFP (pSeL in Figure 5)

- pSeL-120-GFP (pSeL-120 in Figure 5)

Figure 5 demonstrates the utility of the new promoters (pSeL, SEQ ID NO .: 2 and pSeL-15 120, SEQ ID NO .: 5) for the expression of recombinant proteins in insect larvae

Claims (25)

5 10 fifteen twenty 25 1. Nucleic acid sequence suitable to function as a baculovirus promoter comprising: to. the sequence SEQ ID NO .: 1 or its complementary sequence; or b. a variant of any of the sequences in section a) that has at least 70% identity with said sequence. 2. Nucleic acid sequence according to claim 1, wherein said sequence comprises a nucleic acid sequence selected from the list consisting of: to. the nucleic acid sequence SEQ ID NO .: 2, or SEQ ID NO .: 4, or SEQ ID NO .: 5, or SEQ ID NO .: 6, or SEQ ID NO .: 7, or SEQ ID NO .: 8, or SEQ ID NO .: 10, or SEQ ID NO .: 12, or SEQ ID NO .: 13, or SEQ ID NO .: 14, or SEQ ID NO .: 15, or SEQ ID NO .: 17, or SEQ ID NO .: 18, or SEQ ID NO .: 19, or SEQ ID NO .: 20, or SEQ ID NO .: 22, or SEQ ID NO .: 23, or SEQ ID NO .: 24, or SEQ ID NO .: 25, or SEQ ID NO .: 27, or SEQ ID NO .: 28, or SEQ ID NO .: 29, or SEQ ID NO .: 30, or SEQ ID NO .: 44, or its complementary sequences ; or b. a variant of any of the sequences in section a) that has at least 70% identity with said sequences. 3. Nucleic acid sequence according to any one of claims 1 or 2, wherein said sequence comprises SEQ ID NO .: 5 or a variant of SEQ ID NO .: 5 which has at least 90% identity with said sequence, or its complementary sequence. 4. Nucleic acid sequence according to any one of claims 1 or 2, wherein said sequence consists of a nucleic acid sequence selected from the list consisting of the nucleic acid sequence SEQ ID NO .: 2, SEQ ID NO .: 5, SEQ ID NO .: 6, SEQ ID NO .: 12, SEQ ID NO .: 13, SEQ ID NO .: 14, SEQ ID NO .: 18, SEQ ID NO .: 23, SEQ ID NO .: 28, SEQ ID NO .: 29, SEQ ID NO .: 30, SEQ ID NO .: 44. 5. Expression cassette comprising a nucleic acid sequence as defined in any one of claims 1 to 4 operatively linked to a nucleic acid sequence comprising a nucleotide sequence encoding a protein. 5 10 fifteen twenty 25 6. Expression cassette according to claim 5, which additionally comprises a homologous recombination region (hr), such as amplifiers (enhancers), operably linked to the promoter that controls the expression of the protein. 7. Expression cassette according to claim 5 or 6 wherein the protein is selected from the following: protein vaccine, therapeutic protein, antibody, enzyme, cytokine, coagulation factor, anticoagulant, receptor, hormone, protein with diagnostic value or proteas of virus-like particles (VLP). 8. Cloning vector, transfer vector or recombinant bacmid comprising the nucleic acid sequences according to one or more of claims 1 to 4 and / or the expression cassette according to one or more of claims 5 to 7. 9. Vector according to claim 8 suitable for transforming or transducing prokaryotic cells. 10. Vector according to claim 8 suitable for transfecting or transducing eukaryotic cells. 11. Vector according to claim 10 suitable for transfecting or transducing insect cells, or insects or insect larvae. 12. Vector according to claim 11 wherein the transfected or transduced cells are Sf21, or Hi5, or Sf9, or Se301. 13. Vector according to claim 11 wherein the larvae belong to Trichoplusia ni. 14. Host cell transformed, transformed, transduced or transfected with the vector of any of claims 8 to 13, and / or with the expression cassette of any of claims 5 to 7. 15. Baculovirus comprising a nucleic acid sequence according to one or more of claims 1 to 4, and / or an expression cassette according to one or more of claims 5 to 7. 16. Baculovirus according to claim 15 suitable for infecting insect cells, insects or insect larvae. 17. Cell comprising a baculovirus according to claim 15 or 16. 5 10 fifteen twenty 25 18. Insect or insect larva comprising a nucleic acid sequence according to one or more of claims 1 to 4, and / or an expression cassette according to any one of claims 5 to 7. 19. Insect or insect larva comprising a baculovirus according to claim 15 or 16. 20. Culture medium comprising a nucleic acid sequence, an expression cassette, a cloning vector, a transfer vector, a bacmid, a recombinant baculovirus, a cell, an insect or insect larva according to one or more of the claims 1 to 19. 21. Method for producing a protein that comprises the steps of: to. infecting insect cells with a baculovirus according to any of claims 15 and / or 16, or transfecting or transducing them with the bacmid or with the cloning or transfer vector according to any of claims 8 to 13, or with an expression cassette according to one or more of claims 5 to 7; b. express the protein; C. get said protema. 22. Method to produce a protein that includes the steps of: to. infecting insects or insect larvae with baculovirus according to any of claims 15 and / or 16, or transfecting or transducing them with the bacmid or with the cloning or transfer vector according to any of claims 8 to 13, or with an expression cassette according to one or more of claims 5 to 7; b. express the protein; C. get said protema. 23. Recombinant protein obtainable by the method according to any of claims 21 or 22. 24. Use of the recombinant protein according to claim 23 in therapy or diagnosis. 25. Use of a nucleic acid sequence, an expression cassette, a cloning vector, a transfer vector, a bacmid, a recombinant baculovirus, a cell, an insect or an insect larva according to one or more of claims 1 to 19 for the production of a protein. 5