ES2554561B1 - New baculovirus-derived promoters with high activity in baculovirus-based expression systems - Google Patents
New baculovirus-derived promoters with high activity in baculovirus-based expression systems Download PDFInfo
- Publication number
- ES2554561B1 ES2554561B1 ES201430914A ES201430914A ES2554561B1 ES 2554561 B1 ES2554561 B1 ES 2554561B1 ES 201430914 A ES201430914 A ES 201430914A ES 201430914 A ES201430914 A ES 201430914A ES 2554561 B1 ES2554561 B1 ES 2554561B1
- Authority
- ES
- Spain
- Prior art keywords
- seq
- nucleic acid
- insect
- present
- acid sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
- C12N15/866—Baculoviral vectors
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Virology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
La presente invención pertenece al campo de la biotecnología y comprende secuencias de ácidos nucleicos, incluyendo promotores capaces de incrementar la calidad y eficacia de la producción de proteínas recombinantes. Específicamente, la presente invención se refiere a una secuencia de ácido nucleico adecuada para funcionar como un promotor de baculovirus que comprende:#a. la secuencia SEQ ID NO.: 1 ó su secuencia complementaria; o#b. una variante de cualquiera de las secuencias del apartado a) que posee al menos un 70% de identidad con dicha secuencia.The present invention belongs to the field of biotechnology and comprises nucleic acid sequences, including promoters capable of increasing the quality and efficiency of recombinant protein production. Specifically, the present invention relates to a nucleic acid sequence suitable to function as a baculovirus promoter comprising: #a. the sequence SEQ ID NO .: 1 or its complementary sequence; or # b. a variant of any of the sequences in section a) that has at least 70% identity with said sequence.
Description
55
1010
15fifteen
20twenty
2525
3030
DESCRIPCIONDESCRIPTION
Nuevos promotores derivados de baculovirus con elevada actividad en sistemas deNew promoters derived from baculovirus with high activity in
expresion basados en baculovirusbaculovirus-based expression
Sector de la tecnicaTechnology Sector
La presente invencion pertenece al campo de la biotecnolog^a y comprende secuencias de acidos nucleicos, incluyendo promotores capaces de incrementar la calidad y eficacia de la produccion de protemas recombinantes.The present invention belongs to the field of biotechnology and comprises nucleic acid sequences, including promoters capable of increasing the quality and efficacy of the production of recombinant proteins.
Antecedentes de la invencionBackground of the invention
El sistema de expresion basado en baculovirus es un metodo de produccion de protemas recombinantes que posee una elevada capacidad de expresion. Las protemas recombinantes producidas pueden usarse por ejemplo como vacunas, moleculas terapeuticas o agentes diagnosticos. Los baculovirus son un tipo de virus que infectan artropodos, especialmente insectos. Recientemente, basandose en la secuencia de ciertos genes conservados en todos los baculovirus, se ha propuesto una nueva division en cuanto a los generos que componen la familia Baculoviridae. A diferencia de la clasificacion anterior que se basaba en caracteristicas morfologicas y con la cual no existia ninguna correlacion entre el grupo de virus y el tipo de huesped donde se encontraban, en esta nueva clasificacion existe una clara distincion en relacion al orden al que pertenece el insecto huesped. Con la nueva clasificacion la familia Baculoviridae constaria de 4 generos: Alphabaculovirus (nucleopoliedrovirus espedficos de lepidopteros), Betabaculovirus (granuloviruses espedficos de lepidopteros), Gammabaculovirus (nucleopoliedrovirus espedficos de himenopteros) y Deltabaculovirus (nucleopoliedrovirus espedficos de dipteros) (Jehle J.A., Lange M., Wang H., Hu Z., Wang Y. & Hauschild R. (2006), Molecular identification and phylogenetic analysis of baculoviruses from Lepidoptera. Virology 346, 180-193). El vector basado en baculovirus mas empleado en la industria para la expresion de protemas recombinantes procede del baculovirus Nucleopoliedrovirus multicapside de Autographa californica (AcMNPV). Las celulas de insecto de Spodoptera frugiperda 9 (Sf9) o 21 (Sf21) son dos ejemplos de lmeas celulares susceptibles de ser infectadas con baculovirus recombinantes ampliamente utilizadas (Nettleship, J. E. et al, J. Struct. Biol. 2010, 172, 55-56), y las larvas de insecto de Trichoplusia ni (T. ni) se emplean como biofactorias para la produccion de protemas recombinantes (Gomez-Casado, E. et al., Protein Exp. Purif. 2011, 79, 35-43). Desde que el sistema de expresion basado en baculovirus se desarrollo en los anos 80 (Smith, G. E. et al., Mol. Cell Biol. 1983, 65(3),The baculovirus-based expression system is a method of producing recombinant proteins that has a high capacity for expression. The recombinant proteins produced can be used for example as vaccines, therapeutic molecules or diagnostic agents. Baculoviruses are a type of virus that infect arthropods, especially insects. Recently, based on the sequence of certain genes conserved in all baculoviruses, a new division has been proposed in terms of the genera that make up the Baculoviridae family. Unlike the previous classification that was based on morphological characteristics and with which there was no correlation between the virus group and the type of host where they were, in this new classification there is a clear distinction in relation to the order to which the host insect With the new classification, the Baculoviridae family would consist of 4 genera: Alphabaculovirus (lepidopter-specific nucleopoliedrovirus), Betabaculovirus (lepidopter-specific granuloviruses), Gammabaculovirus (hymenopter-specific nucleopoliedrovirus) and Deltabaculovirus (nucleophiedge JA diphrometer, J-nucleopoliedrovirus) , Wang H., Hu Z., Wang Y. & Hauschild R. (2006), Molecular identification and phylogenetic analysis of baculoviruses from Lepidoptera. Virology 346, 180-193). The baculovirus-based vector most used in the industry for the expression of recombinant proteins comes from the Autographa californica Nucleopoliedrovirus multicapside baculovirus (AcMNPV). Spodoptera frugiperda 9 (Sf9) or 21 (Sf21) insect cells are two examples of cell lines susceptible to being infected with widely used recombinant baculovirus (Nettleship, JE et al, J. Struct. Biol. 2010, 172, 55- 56), and Trichoplusia ni (T. ni) insect larvae are used as biofactories for the production of recombinant proteins (Gomez-Casado, E. et al., Protein Exp. Purif. 2011, 79, 35-43) . Since the baculovirus-based expression system developed in the 1980s (Smith, G. E. et al., Mol. Cell Biol. 1983, 65 (3),
55
1010
15fifteen
20twenty
2525
3030
2156-2165), cientos de protemas recombinantes se han producido empleando este sistema, desde enzimas citosolicas hasta protemas de membrana.2156-2165), hundreds of recombinant proteins have been produced using this system, from cytosolic enzymes to membrane proteins.
La smtesis de protemas en un sistema de baculovirus posee numerosas ventajas frente a la smtesis en otros microorganismos tales como E.coli. Tras la production y purification, la protema recombinante expresada por el sistema de baculovirus posee modificaciones post traduccionales tales como formation de enlaces disulfuro, glicosilaciones, miristilatciones, acetilaciones, fosforilaciones, ubiquitinaciones, etc. Estos factores constituyen claramente un adelanto y una mejora en procedimientos para la obtencion de protemas recombinantes respecto a procedimientos anteriores.Protein synthesis in a baculovirus system has numerous advantages over synthesis in other microorganisms such as E.coli. After production and purification, the recombinant protein expressed by the baculovirus system has post-translational modifications such as formation of disulfide bonds, glycosylations, myristylations, acetylations, phosphorylations, ubiquitinations, etc. These factors clearly constitute an advance and an improvement in procedures for obtaining recombinant proteins with respect to previous procedures.
Mas recientemente se han desarrollado vectores de baculovirus con promotores y amplificadores que permiten la expresion de genes en celulas de eucariotas superiores, tales como hepatocitos humanos o celulas CHO (cancer de ovario de hamster).More recently, baculovirus vectors have been developed with promoters and amplifiers that allow the expression of genes in higher eukaryotic cells, such as human hepatocytes or CHO cells (hamster ovarian cancer).
Los siguientes articulos cientificos pueden resumir el estado de la tecnica con respecto a estos sistemas de expresion de protemas recombinantes:The following scientific articles can summarize the state of the art with respect to these recombinant protein expression systems:
1: Fernandes F, Teixeira AP, Carinhas N, Carrondo MJ, Alves PM. Insect cells as a production platform of complex virus-like particles. Expert Rev Vaccines. 2013 Feb;12(2):225-36.1: Fernandes F, Teixeira AP, Carinhas N, Carrondo MJ, Alves PM. Insect cells as a production platform of complex virus-like particles. Expert Rev Vaccines. 2013 Feb; 12 (2): 225-36.
2: Cox MM. Recombinant protein vaccines produced in insect cells. Vaccine. 2012 Feb 27;30(10):1759-66. 3: Hitchman RB, Locanto E, Possee RD, King LA. Optimizing the baculovirus expression vector system. Methods. 2011 Sep;55(1):52-7. 4: van Oers MM. Opportunities and challenges for the baculovirus expression system. J Invertebr Pathol. 2011 Jul;107 Suppl:S3-15.2: Cox MM. Recombinant protein vaccines produced in insect cells. Vaccine 2012 Feb 27; 30 (10): 1759-66. 3: Hitchman RB, Locanto E, Possee RD, King LA. Optimizing the baculovirus expression vector system. Methods 2011 Sep; 55 (1): 52-7. 4: van Oers MM. Opportunities and challenges for the baculovirus expression system. J Invertebr Pathol. 2011 Jul; 107 Suppl: S3-15.
Existen numerosas tecnologias disponibles comercialmente para la expresion de protemas recombinantes empleando el sistema de expresion basado en baculovirus. A modo de ejemplo se citan a continuation algunas de ellas: “Bac-to-Bac®” (Invitrogen™), “BacPAK™” (Clontech™), “FlashBAC™” (Oxford Expression Technologies™), “BacuVance™”There are numerous commercially available technologies for the expression of recombinant proteins using the baculovirus-based expression system. As an example, some of them are mentioned below: "Bac-to-Bac®" (Invitrogen ™), "BacPAK ™" (Clontech ™), "FlashBAC ™" (Oxford Expression Technologies ™), "BacuVance ™"
(GenScript™), “Bac-N-Blue DNATM” (Invitrogen™), “BaculoDirect™” (Invitrogen™),(GenScript ™), “Bac-N-Blue DNATM” (Invitrogen ™), “BaculoDirect ™” (Invitrogen ™),
“BacVector®” 1000, 2000, 3000 (Novagen®), “DiamondBac™” (Sigma-Aldrich®), “BaculoGold™” (BD Biosciences™) o “MultiBack” (ETH Zurich/Redbiotec AG).“BacVector®” 1000, 2000, 3000 (Novagen®), “DiamondBac ™” (Sigma-Aldrich®), “BaculoGold ™” (BD Biosciences ™) or “MultiBack” (ETH Zurich / Redbiotec AG).
La mayoria de los sistemas de expreson basados en baculovirus emplean el promotor polh para la expresion de protemas recombinantes. El gen polh no es un gen esencial para laMost baculovirus-based expression systems employ the polh promoter for the expression of recombinant proteins. The polh gene is not an essential gene for
55
1010
15fifteen
20twenty
2525
replication del virus en celulas de insecto, por lo que puede ser retirado del genoma sin afectar la production de virus. En su lugar, se expresa la protema de interes.Virus replication in insect cells, so it can be removed from the genome without affecting virus production. Instead, the protection of interest is expressed.
Existe una necesidad imperiosa de desarrollar nuevos promotores que permitan una produccion mas eficaz de protemas recombinantes en sistemas de expresion basados en baculovirus.There is an urgent need to develop new promoters that allow more efficient production of recombinant proteins in baculovirus-based expression systems.
Breve description de la inventionBrief description of the invention
La presente invencion esta basada en las excelentes propiedades de los promotores que a continuacion se describen.The present invention is based on the excellent properties of the promoters described below.
En particular, los inventores descubieron que la secuencia de acido nucleico que comprende:In particular, the inventors discovered that the nucleic acid sequence comprising:
a. la secuencia SEQ ID NO.: 1 o su secuencia complementaria; oto. the sequence SEQ ID NO .: 1 or its complementary sequence; or
b. una variante de cualquiera de las secuencias del apartado a) que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dichas secuenciasb. a variant of any of the sequences in section a) which has at least 70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequences
es adecuada para funcionar como un promotor de baculovirus. Por lo tanto, la presente invencion proporciona una secuencia de acido nucleico que comprende la SEQ ID NO.: 1 o su secuencia complementaria, adecuada para funcionar como un promotor en un sistema de expresion basado en baculovirus.It is suitable to function as a baculovirus promoter. Therefore, the present invention provides a nucleic acid sequence comprising SEQ ID NO .: 1 or its complementary sequence, suitable to function as a promoter in a baculovirus-based expression system.
La presente invencion se refiere a la secuencia de acido nucleico mencionada anteriormente, donde dicha secuencia comprende una secuencia de acido nucleico seleccionada de la lista que consiste en:The present invention relates to the nucleic acid sequence mentioned above, wherein said sequence comprises a nucleic acid sequence selected from the list consisting of:
a. la secuencia de acido nucleico SEQ ID NO.: 2, SEQ ID NO.: 4, SEQ ID NO.: 5, SEQ ID NO.: 6, SEQ ID NO.: 7, SEQ ID NO.: 8, SEQ ID NO.: 10, SEQ ID NO.: 12, SEQ ID NO.: 13, SEQ ID NO.: 14, SEQ ID NO.: 15, SEQ ID NO.: 17, SEQ ID NO.: 18, SEQ ID NO.: 19, SEQ ID NO.: 20, SEQ ID NO.: 22, SEQ ID NO.: 23, SEQ ID NO.: 24, SEQ ID NO.: 25, SEQ ID NO.: 27, SEQ ID NO.: 28, SEQ ID NO.: 29, o SEQ ID NO.: 30, SEQ ID NO.: 44 o sus secuencias complementarias; oto. the nucleic acid sequence SEQ ID NO .: 2, SEQ ID NO .: 4, SEQ ID NO .: 5, SEQ ID NO .: 6, SEQ ID NO .: 7, SEQ ID NO .: 8, SEQ ID NO .: 10, SEQ ID NO .: 12, SEQ ID NO .: 13, SEQ ID NO .: 14, SEQ ID NO .: 15, SEQ ID NO .: 17, SEQ ID NO .: 18, SEQ ID NO. : 19, SEQ ID NO .: 20, SEQ ID NO .: 22, SEQ ID NO .: 23, SEQ ID NO .: 24, SEQ ID NO .: 25, SEQ ID NO .: 27, SEQ ID NO .: 28, SEQ ID NO .: 29, or SEQ ID NO .: 30, SEQ ID NO .: 44 or its complementary sequences; or
55
1010
15fifteen
20twenty
2525
3030
b. una variante de cualquiera de las secuencias del apartado a) que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dichas secuencias.b. a variant of any of the sequences of section a) which has at least 70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequences.
La presente invencion proporciona ademas una secuencia de acido nucleico segun lo descrito anteriormente, donde dicha secuencia es la secuencia de acido nucleico que consiste en la SEQ ID NO.: 2 o una variante de la misma que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dicha secuencia.The present invention also provides a nucleic acid sequence as described above, wherein said sequence is the nucleic acid sequence consisting of SEQ ID NO .: 2 or a variant thereof that has at least 70%, or a 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequence.
La presente invencion proporciona ademas una secuencia de acido nucleico segun lo descrito anteriormente, donde dicha secuencia es la secuencia de acido nucleico que consiste en la SEQ ID NO.: 4 o una variante de la misma que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dicha secuencia.The present invention also provides a nucleic acid sequence as described above, wherein said sequence is the nucleic acid sequence consisting of SEQ ID NO .: 4 or a variant thereof that has at least 70%, or a 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequence.
La presente invencion proporciona ademas una secuencia de acido nucleico segun lo descrito anteriormente, donde dicha secuencia es la secuencia de acido nucleico que consiste en la SEQ ID NO.: 5 o una variante de la misma que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dicha secuencia.The present invention also provides a nucleic acid sequence as described above, wherein said sequence is the nucleic acid sequence consisting of SEQ ID NO .: 5 or a variant thereof that has at least 70%, or a 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequence.
La presente invencion proporciona ademas una secuencia de acido nucleico segun lo descrito anteriormente, donde dicha secuencia es la secuencia de acido nucleico que consiste en la SEQ ID NO.: 6 o una variante de la misma que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dicha secuencia.The present invention also provides a nucleic acid sequence as described above, wherein said sequence is the nucleic acid sequence consisting of SEQ ID NO .: 6 or a variant thereof that has at least 70%, or a 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequence.
La presente invencion proporciona ademas una secuencia de acido nucleico segun lo descrito anteriormente, donde dicha secuencia es la secuencia de acido nucleico que consiste en la SEQ ID NO.: 18 o una variante de la misma que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dicha secuencia.The present invention also provides a nucleic acid sequence as described above, wherein said sequence is the nucleic acid sequence consisting of SEQ ID NO .: 18 or a variant thereof that has at least 70%, or a 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequence.
La presente invencion proporciona ademas una secuencia de acido nucleico segun lo descrito anteriormente, donde dicha secuencia es la secuencia de acido nucleico que consiste en la SEQ ID NO.: 23 o una variante de la misma que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dicha secuencia.The present invention also provides a nucleic acid sequence as described above, wherein said sequence is the nucleic acid sequence consisting of SEQ ID NO .: 23 or a variant thereof that has at least 70%, or a 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequence.
La presente invencion proporciona ademas una secuencia de acido nucleico segun lo descrito anteriormente, donde dicha secuencia es la secuencia de acido nucleico que consiste en la SEQ ID NO.: 28 o una variante de la misma que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dicha secuencia.The present invention also provides a nucleic acid sequence as described above, wherein said sequence is the nucleic acid sequence consisting of SEQ ID NO .: 28 or a variant thereof that has at least 70%, or a 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequence.
55
1010
15fifteen
20twenty
2525
3030
La presente invention proporciona ademas una secuencia de acido nucleico segun lo descrito anteriormente, donde dicha secuencia es la secuencia de acido nucleico que consiste en la SEQ ID NO.: 29 o una variante de la misma que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dicha secuencia.The present invention also provides a nucleic acid sequence as described above, wherein said sequence is the nucleic acid sequence consisting of SEQ ID NO .: 29 or a variant thereof that has at least 70%, or a 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequence.
La presente invencion proporciona ademas una secuencia de acido nucleico segun lo descrito anteriormente, donde dicha secuencia es la secuencia de acido nucleico que consiste en la SEQ ID NO.: 30 o una variante de la misma que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dicha secuencia.The present invention also provides a nucleic acid sequence as described above, wherein said sequence is the nucleic acid sequence consisting of SEQ ID NO .: 30 or a variant thereof that has at least 70%, or a 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequence.
La presente invencion proporciona ademas una secuencia de acido nucleico segun lo descrito anteriormente, donde dicha secuencia es la secuencia de acido nucleico que consiste en la SEQ ID NO.: 44 o una variante de la misma que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dicha secuencia.The present invention also provides a nucleic acid sequence as described above, wherein said sequence is the nucleic acid sequence consisting of SEQ ID NO .: 44 or a variant thereof that has at least 70%, or a 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequence.
Ademas, dicho promotor puede formar parte de un casete de expresion. Por lo tanto, la presente invencion proporciona ademas un casete de expresion que comprende, al menos, una secuencia de acido nucleico tal y como se define anteriormente operativamente unida a una secuencia de acido nucleico que comprende una secuencia de nucleotidos que codifica una protema.In addition, said promoter can be part of an expression cassette. Therefore, the present invention also provides an expression cassette comprising at least one nucleic acid sequence as defined above operatively linked to a nucleic acid sequence comprising a nucleotide sequence encoding a protein.
En ocasiones el casete de expresion comprende adicionalmente una (o varias) region(es) de recombination homologa (hr), como amplificadores (enhancers), operativamente unida(s) al promotor que controla la expresion de la protema.Sometimes the expression cassette additionally comprises one (or several) homologous recombination region (s), such as amplifiers (enhancers), operably linked to the promoter that controls the expression of the protein.
La presente invencion tambien se refiere a vectores de donation, de transferencia y/o bacmidos recombinantes que comprenden las secuencias de acido nucleico o casetes de expresion descritos anteriormente.The present invention also relates to recombinant donation, transfer and / or bacmid vectors comprising the nucleic acid sequences or expression cassettes described above.
Ademas es objeto de la presente invencion un bacuolovirus que comprende una una secuencia de acido nucleico o un casete de expresion segun lo descrito anteriormente.In addition, a bacuolovirus comprising a nucleic acid sequence or an expression cassette as described above is object of the present invention.
Tambien se hace referencia en la presente invencion a una celula, un insecto o una larva de insecto que comprende un baculovirus segun lo descrito anteriormente, y/o una celula, un insecto o larva de insecto que comprende una secuencia de acido nucleico, un casete de expresion y/o un vector segun cualquiera de los mencionados anteriormente.Reference is also made in the present invention to a cell, an insect or an insect larva comprising a baculovirus as described above, and / or a cell, an insect or insect larva comprising a nucleic acid sequence, a cassette of expression and / or a vector according to any of those mentioned above.
Las celulas pueden ser eucariotas o procariotas.The cells can be eukaryotes or prokaryotes.
55
1010
15fifteen
20twenty
2525
Los inventores describen ademas un medio de cultivo que comprende una secuencia de acido nucleico, un casete de expresion, un vector de clonacion, un vector de transferencia, un bacmido, un baculovirus recombinante, una celula, un insecto o una larva de insecto segun lo mencionado anteriormente.The inventors further describe a culture medium comprising a nucleic acid sequence, an expression cassette, a cloning vector, a transfer vector, a bacmid, a recombinant baculovirus, a cell, an insect or an insect larva as previously mentioned.
Es objeto de la presente invention un metodo para producir una proteina que comprende los pasos de:The object of the present invention is a method for producing a protein comprising the steps of:
a. infectar celulas de insecto con un baculovirus segun descrito anteriormente, o trasnfectarlas o transducirlas con el bacmido o con el vector de clonacion o de transferencia, o con un casete de expresion mencionados anteriormente;to. infecting insect cells with a baculovirus as described above, or transfecting or transducing them with the bacmid or with the cloning or transfer vector, or with an expression cassette mentioned above;
b. expresar la proteina;b. express the protein;
c. obtener dicha proteina.C. get said protein.
La presente invencion proporciona tambien un metodo para producir una proteina que comprende los pasos de:The present invention also provides a method of producing a protein comprising the steps of:
a. infectar insectos o larvas de insecto con baculovirus segun lo descrito anteriormente; o trasnfectarlas o transducirlas con el bacmido o con el vector de clonacion o de transferencia, o con un casete de expresion mencionados anteriormente;to. infecting insects or insect larvae with baculovirus as described above; or transfect or transduce them with the bacmid or with the cloning or transfer vector, or with an expression cassette mentioned above;
b. expresar la proteina;b. express the protein;
c. obtener dicha proteina.C. get said protein.
La presente invencion tambien se refiere a una proteina recombinante obtenible mediante cualquiera de los metodos mencionados anteriormente.The present invention also relates to a recombinant protein obtainable by any of the methods mentioned above.
En un aspecto adicional, la invencion se refiere al uso de la proteina descrita anteriormente en terapia o diagnostico.In a further aspect, the invention relates to the use of the protein described above in therapy or diagnosis.
La invencion tambien describe el uso de una secuencia de acido nucleico, un casete de expresion, un vector de clonacion, un vector de transferencia, un bacmido, un baculovirus recombinante, una celula, un insecto o una larva de insecto segun lo descrito anteriormente en un metodo para la production de una proteina.The invention also describes the use of a nucleic acid sequence, an expression cassette, a cloning vector, a transfer vector, a bacmid, a recombinant baculovirus, a cell, an insect or an insect larva as described above in a method for the production of a protein.
Breve description de las figurasBrief description of the figures
55
1010
15fifteen
20twenty
2525
3030
Figura 1. Production de GFP (de sus siglas en ingles, “green fluorescent protein’’, protema verde fluorescente) en tres lmeas celulares de insecto (Sf21 (J.L. Vaughn, R.H. Goodwin, G.J. Tompkins, P. McCawley. The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera; Noctuidae). In Vitro, 13 (1977), pp. 213-217), Se301 (K. Hara, M. Funakoshi, K. Tsuda, T. Kawarabata. New Spodoptera exigua cell lines susceptible to Spodoptera exigua nuclear polyhedrosis virus. In Vitro Cell. Dev. Biol. Anim., 29A (1993), pp. 904-907) y Hi5 (Wickham TJ, Davis T, Granados RR, Shuler ML, Wood HA (1992). "Screening of insect cell lines for the production of recombinant proteins and infectious virus in the baculovirus expression system". Biotechnol Prog. 8 (5): 391-396.)) del promotor inicial (pSeL, L = largo, SEQ ID NO.: 2), su version truncada en 3' (pSeS, S = corto, SEQ ID NO.:3). Se empleo el promotor de polihedrina (pph, SEQ ID NO.: 11) como “gold standard’ (modelo de referencia estandard).Figure 1. Production of GFP (green fluorescent protein) in three insect cell lines (Sf21 (JL Vaughn, RH Goodwin, GJ Tompkins, P. McCawley. The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera; Noctuidae). In Vitro, 13 (1977), pp. 213-217), Se301 (K. Hara, M. Funakoshi, K. Tsuda, T. Kawarabata. New Spodoptera exigua cell lines susceptible to Spodoptera exigua nuclear polyhedrosis virus, In Vitro Cell, Dev. Biol. Anim., 29A (1993), pp. 904-907) and Hi5 (Wickham TJ, Davis T, Granados RR, Shuler ML, Wood HA (1992 ). "Screening of insect cell lines for the production of recombinant proteins and infectious virus in the baculovirus expression system". Biotechnol Prog. 8 (5): 391-396.)) Of the initial promoter (pSeL, L = length, SEQ ID NO .: 2), its version truncated in 3 '(pSeS, S = short, SEQ ID NO.:3). The polyhedrin promoter (pph, SEQ ID NO .: 11) was used as the "gold standard".
Figura 2. Produccion de GFP (de sus siglas en ingles, “green fluorescent protein’’, protema verde fluorescente) en tres lmeas celulares de insecto (Sf21 (A), Se301 (B) y Hi5 (C)). Deleciones en serie de la region 5 'del promotor pSeL (pSeL-140, SEQ ID NO.: 4 y pSeL- 120, SEQ ID NO.: 5) pueden aumentar la produccion de protemas en diferentes tipos de celulas (Sf21 (A), Se301 (B) y Hi5 (C)). Se empleo el promotor de polihedrina (pph, SEQ ID NO.: 11) como “gold standard’ (modelo de referencia estandard).Figure 2. Production of GFP (“green fluorescent protein’ ”in three insect cell lines (Sf21 (A), Se301 (B) and Hi5 (C)). Serial deletions of the 5 'region of the pSeL promoter (pSeL-140, SEQ ID NO .: 4 and pSeL-120, SEQ ID NO .: 5) can increase protein production in different types of cells (Sf21 (A) , Se301 (B) and Hi5 (C)). The polyhedrin promoter (pph, SEQ ID NO .: 11) was used as the "gold standard".
Figura 3. Representation esquematica de las diferentes variantes de algunos de los promotores mencionados en la presente description (pSeL, SEQ ID NO.: 2, pSeL-140, SEQ ID NO.: 4, pSeL-120, SEQ ID NO.:5, pSeS, SEQ ID NO.: 3 y pph, SEQ ID NO.:11).Figure 3. Schematic representation of the different variants of some of the promoters mentioned in this description (pSeL, SEQ ID NO .: 2, pSeL-140, SEQ ID NO .: 4, pSeL-120, SEQ ID NO.:5 , pSeS, SEQ ID NO .: 3 and pph, SEQ ID NO.:11).
Figura 4. Produccion de GFP (de sus siglas en ingles, “green fluorescent protein’’, protema verde fluorescente) en tres lmeas celulares de insecto (Sf21, Se301 y Hi5). La combination de los promotores (pph/pSeL-120 en la figura, SEQ ID NO.: 18) aumenta considerablemente los niveles de produccion de protema en estas celulas de insecto, en comparacion con el promotor pSeL (SEQ ID NO.:2), pSeL-120 (SEQ ID NO.:5) y promotor de polihedrina (pph, SEQ ID NO.: 11).Figure 4. Production of GFP (“green fluorescent protein’ ”in three insect cell lines (Sf21, Se301 and Hi5). The combination of promoters (pph / pSeL-120 in the figure, SEQ ID NO .: 18) considerably increases the levels of protein production in these insect cells, compared to the pSeL promoter (SEQ ID NO.:2) , pSeL-120 (SEQ ID NO.:5) and polyhedrin promoter (pph, SEQ ID NO .: 11).
Figura 5. Produccion de GFP (de sus siglas en ingles, “green fluorescent protein’’, protema verde fluorescente) en larvas de T. ni. pSeL, (SEQ ID NO.: 2) y pSeL-120, (SEQ ID NO.: 5). Se empleo el promotor de polihedrina (pph, SEQ ID NO.: 11) como “goldstandard’ (modelo de referencia estandard).Figure 5. Production of GFP ("green fluorescent protein", fluorescent green protein) in larvae of T. ni. pSeL, (SEQ ID NO .: 2) and pSeL-120, (SEQ ID NO .: 5). The polyhedrin promoter (pph, SEQ ID NO .: 11) was used as "goldstandard" (standard reference model).
55
1010
15fifteen
20twenty
2525
3030
Figura 6. Representation de la position del promotor pSeL-120 en una alineacion de su secuencia con las secuencias homologas en diferentes especies de baculovirus (Spodoptera exigua nucleopolyhedrovirus (SeMNPV), Spodoptera litoralis nucleopolyhedrovirus (SpliMNPV), Spodoptera frugiperda nucleopolyhedrovirus (SpfrMNPV), Agrotis ipsilon nucleopolyhedrovirus (AgipMNPV), Agrotis segetum nucleopolyhedrovirus (AgseMNPV), Bombyx mori nucleopolyhedrovirus (BmNPV), and Autographa californica nucleopolyhedrovirus (AcMNPV)) (panel superior). El panel inferior muestra la identidad de secuencias entre los diferentes virus de la region representada en la alineacion (promotor pSeL-120, SEQ ID NO.:5).Figure 6. Representation of the position of the pSeL-120 promoter in an alignment of its sequence with the homologous sequences in different species of baculovirus (Spodoptera exigua nucleopolyhedrovirus (SeMNPV), Spodoptera litoralis nucleopolyhedrovirus (SpliMNPV), Spodoptera frugiperda nucleopolyrrovrot (Agrotrothrotirus) ipsilon nucleopolyhedrovirus (AgipMNPV), Agrotis segetum nucleopolyhedrovirus (AgseMNPV), Bombyx mori nucleopolyhedrovirus (BmNPV), and Autographa californica nucleopolyhedrovirus (AcMNPV)) (upper panel). The bottom panel shows the sequence identity between the different viruses in the region represented in the alignment (promoter pSeL-120, SEQ ID NO.:5).
Figura 7. Secuencias pSeL (SEQ ID NO.:2) y pSeS (SEQ ID NO.: 3) y su alineamiento, siendo la diferencia entre ambos la SEQ ID NO.:1 ("secuencia diferencial”).Figure 7. Sequences pSeL (SEQ ID NO.:2) and pSeS (SEQ ID NO .: 3) and their alignment, the difference between both being SEQ ID NO.:1 ("differential sequence").
Description detallada de la inventionDetailed description of the invention
PromotorPromoter
La presente invencion describe el uso de nuevos promotores de baculovirus para la expresion de protemas heterologas en celulas de insecto o en insectos (incluyendo larvas de insecto) empleando el sistema de expresion basado en baculovirus. La secuencia de acido nucleico del promotor deriva preferiblemente del genoma del nucleopoliedrovirus multiple de Spodoptera exigua (SeMNPV). La secuencia de acido nucleico del promotor puede tambien derivar del genoma de otros virus tales como Spodoptera litoralis nucleopoliedrovirus (SpliMNPV), Spodoptera frugiperda nucleopoliedrovirus (SpfrMNPV), Agrotis ipsilon nucleopoliedrovirus (AgipMNPV), Agrotis segetum nucleopoliedrovirus (AgseMNPV), Bombyx mori nucleopoliedrovirus (BmNPV), y Autographa californica nucleopoliedrovirus (AcMNPV). En particular, la secuencia de acido nucleico del promotor (o promotores) que deriva(n) del genoma del nucleopolyhedrovirus multiple de Spodoptera exigua (SeMNPV), se encuentra en en la region 5‘ de la orf46, controlando la expresion de dicho gen. En el transcriptoma de Spodoptera exigua infectado con SeMNPV hay una elevada presencia de transcritos correspondientes al gen orf46. Ademas, la protema ORF46 es una protema estructural. Los nuevos promotores presentan una actividad fuerte en el sistema de expresion basado en baculovirus, alcanzandose niveles de expresion superiores a los alcanzados bajo otros promotores de uso convencional como el promotor de polihedrina, polh o pph. El reducido tamano de su secuencia promotora hace posible su utilization conjunta con otros promotores.The present invention describes the use of new baculovirus promoters for the expression of heterologous proteins in insect cells or in insects (including insect larvae) using the baculovirus-based expression system. The nucleic acid sequence of the promoter is preferably derived from the genome of the spodoptera exigua multiple nucleopoliedrovirus (SeMNPV). The nucleic acid sequence of the promoter can also be derived from the genome of other viruses such as Spodoptera litoralis nucleopoliedrovirus (SpliMNPV), Spodoptera frugiperda nucleopoliedrovirus (SpfrMNPV), Agrotis ipsilon nucleopoliedrovirus (AgipMNPV), Agrotis segetum nucleopolyvirus (Polyvirus) ), and Autographa californica nucleopoliedrovirus (AcMNPV). In particular, the nucleic acid sequence of the promoter (or promoters) that derives (n) from the genome of the spodoptera exigua multiple nucleopolyhedrovirus (SeMNPV) is found in the 5 ‘region of the orf46, controlling the expression of said gene. In the transcriptome of Spodoptera exigua infected with SeMNPV there is a high presence of transcripts corresponding to the orf46 gene. In addition, the ORF46 protein is a structural protein. The new promoters have a strong activity in the baculovirus-based expression system, reaching higher expression levels than those achieved under other promoters of conventional use such as the polyhedrin, polh or pph promoter. The reduced size of its promoter sequence makes it possible to use it jointly with other promoters.
55
1010
15fifteen
20twenty
2525
En un aspecto, la invencion se relaciona con una secuencia de acido nucleico, en adelante secuencia de acido nucleico de la invencion, adecuada para funcionar como un promotor de baculovirus que comprende:In one aspect, the invention relates to a nucleic acid sequence, hereinafter nucleic acid sequence of the invention, suitable to function as a baculovirus promoter comprising:
a. la secuencia SEQ ID NO.: 1 o su secuencia complementaria; oto. the sequence SEQ ID NO .: 1 or its complementary sequence; or
b. una variante de cualquiera de las secuencia del apartado a) que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dichas secuencias.b. a variant of any of the sequences of section a) which has at least 70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequences.
Ejemplos de promotores de baculovirus de la invencion, que comprendenExamples of baculovirus promoters of the invention, comprising
a) la SEQ ID NO.: 1 o su secuencia complementaria;a) SEQ ID NO .: 1 or its complementary sequence;
b) o una variante de cualquiera de las secuencia del apartado a) que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dichas secuenciasb) or a variant of any of the sequence of section a) that has at least 70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with those sequences
son la SEQ ID NO.: 2, la SEQ ID NO.: 4, la SEQ ID NO.: 5, la SEQ ID NO.: 6, la SEQ ID NO.: 7, la SEQ ID NO.: 8, la SEQ ID NO.: 10, la SEQ ID NO.: 12, la SEQ ID NO.: 13, la SEQ ID NO.: 14, la SEQ ID NO.: 15, la SEQ ID NO.: 17, la SEQ ID NO.: 18, la SEQ ID NO.: 19, la SEQ ID NO.: 20, la SEQ ID NO.: 22, la SEQ ID NO.: 23, la SEQ ID NO.: 24, la SEQ ID NO.: 25, la SEQ ID NO.: 27, la SEQ ID NO.: 28, la SEQ ID NO.: 29, la SEQ ID NO.: 30, la SEQ ID NO.: 44, o sus secuencias complementarias, o sus secuencias complementarias, o una variante de cualquiera de las secuencias anteriores (SEQ ID NOs.: 2, SEQ ID NOs.: 4-8, SEQ ID NO.:10, SEQ ID NOs.: 12-15, SEQ ID NOs.: 17-20, SEQ ID NOs.: 22-25, SEQ ID NOs.: 27-30 y SEQ ID NO.: 44) que poseen al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dichas secuencias.are SEQ ID NO .: 2, SEQ ID NO .: 4, SEQ ID NO .: 5, SEQ ID NO .: 6, SEQ ID NO .: 7, SEQ ID NO .: 8, SEQ ID NO .: 10, SEQ ID NO .: 12, SEQ ID NO .: 13, SEQ ID NO .: 14, SEQ ID NO .: 15, SEQ ID NO .: 17, SEQ ID NO .: 18, SEQ ID NO .: 19, SEQ ID NO .: 20, SEQ ID NO .: 22, SEQ ID NO .: 23, SEQ ID NO .: 24, SEQ ID NO. : 25, SEQ ID NO .: 27, SEQ ID NO .: 28, SEQ ID NO .: 29, SEQ ID NO .: 30, SEQ ID NO .: 44, or its complementary sequences, or its complementary sequences, or a variant of any of the above sequences (SEQ ID NOs .: 2, SEQ ID NOs .: 4-8, SEQ ID NO.:10, SEQ ID NOs .: 12-15, SEQ ID NOs .: 17-20, SEQ ID NOs .: 22-25, SEQ ID NOs .: 27-30 and SEQ ID NO .: 44) that have at least 70%, or 80%, or 90%, or 95 %, or 97%, or 99%, of identity with said sequences.
En una realization del primer aspecto de la invencion, la invencion comprende una secuencia de acido nucleico, en adelante secuencia de acido nucleico de la invencion, adecuada para funcionar como un promotor de baculovirus que comprende:In an embodiment of the first aspect of the invention, the invention comprises a nucleic acid sequence, hereinafter nucleic acid sequence of the invention, suitable to function as a baculovirus promoter comprising:
a. la secuencia SEQ ID NO.: 1 o su secuencia complementaria; o una variante de las mismas (SEQ ID NO.: 1 o su secuencia complementaria) que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dichas secuencias; yto. the sequence SEQ ID NO .: 1 or its complementary sequence; or a variant thereof (SEQ ID NO .: 1 or its complementary sequence) which has at least 70%, or 80%, or 90%, or 95%, or 97%, or 99% , of identity with said sequences; Y
55
1010
15fifteen
20twenty
2525
b. la secuencia SEQ ID NO.: 11, o su secuencia complementaria, o una variante de las mismas (SEQ ID NO.: 11, o su secuencia complementaria) que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dichas secuencias.b. the sequence SEQ ID NO .: 11, or its complementary sequence, or a variant thereof (SEQ ID NO .: 11, or its complementary sequence) which has at least 70%, or 80%, or 90% , or 95%, or 97%, or 99%, of identity with said sequences.
Ejemplos de promotores de baculovirus de la invencion, que comprendenExamples of baculovirus promoters of the invention, comprising
a. la secuencia SEQ ID NO.: 1 o su secuencia complementaria; o una variante de las mismas (SEQ ID NO.: 1 o su secuencia complementaria) que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dichas secuencias; yto. the sequence SEQ ID NO .: 1 or its complementary sequence; or a variant thereof (SEQ ID NO .: 1 or its complementary sequence) which has at least 70%, or 80%, or 90%, or 95%, or 97%, or 99% , of identity with said sequences; Y
b. la secuencia SEQ ID NO.: 11, o su secuencia complementaria, o una variante de las mismas (SEQ ID NO.: 11, o su secuencia complementaria) que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dichas secuenciasb. the sequence SEQ ID NO .: 11, or its complementary sequence, or a variant thereof (SEQ ID NO .: 11, or its complementary sequence) which has at least 70%, or 80%, or 90% , or 95%, or 97%, or 99%, of identity with said sequences
son la SEQ ID NO.: 6, la SEQ ID NO.: 7, la SEQ ID NO.: 8, la SEQ ID NO.: 10, la SEQ ID NO.: 14, la SEQ ID NO.: 15, la SEQ ID NO.: 17,la SEQ ID NO.: 18 y la SEQ ID NO.: 44.are SEQ ID NO .: 6, SEQ ID NO .: 7, SEQ ID NO .: 8, SEQ ID NO .: 10, SEQ ID NO .: 14, SEQ ID NO .: 15, SEQ ID NO .: 17, SEQ ID NO .: 18 and SEQ ID NO .: 44.
En otra realization del primer aspecto de la invencion, la invencion comprende una secuencia de acido nucleico, en adelante secuencia de acido nucleico de la invencion, adecuada para funcionar como un promotor de baculovirus que comprende:In another embodiment of the first aspect of the invention, the invention comprises a nucleic acid sequence, hereinafter nucleic acid sequence of the invention, suitable to function as a baculovirus promoter comprising:
a. la secuencia SEQ ID NO.: 1 o su secuencia complementaria; o una variante de las mismas (SEQ ID NO.: 1 o su secuencia complementaria) que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dichas secuencias; yto. the sequence SEQ ID NO .: 1 or its complementary sequence; or a variant thereof (SEQ ID NO .: 1 or its complementary sequence) which has at least 70%, or 80%, or 90%, or 95%, or 97%, or 99% , of identity with said sequences; Y
b. la secuencia SEQ ID NO.: 31, o su secuencia complementaria, o una variante de las mismas (SEQ ID NO.: 31, o su secuencia complementaria) que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dichas secuencias.b. the sequence SEQ ID NO .: 31, or its complementary sequence, or a variant thereof (SEQ ID NO .: 31, or its complementary sequence) which has at least 70%, or 80%, or 90% , or 95%, or 97%, or 99%, of identity with said sequences.
Ejemplos de promotores de baculovirus de la invencion, que comprenden estas secuencias (a y b) son la SEQ ID NO.: 19, la SEQ ID NO.: 20, la SEQ ID NO.: 22, la SEQ ID NO.: 23, la SEQ ID NO.: 24, la SEQ ID NO.: 25, la SEQ ID NO.: 27 y la SEQ ID NO.: 28.Examples of baculovirus promoters of the invention, comprising these sequences (a and b) are SEQ ID NO .: 19, SEQ ID NO .: 20, SEQ ID NO .: 22, SEQ ID NO .: 23, SEQ ID NO .: 24, SEQ ID NO .: 25, SEQ ID NO .: 27 and SEQ ID NO .: 28.
55
1010
15fifteen
20twenty
2525
3030
En el contexto de la presente invencion, el termino “promotor” se refiere a una secuencia de acido nucleico a la que la ARN polimerasa puede unirse para iniciar la transcripcion. Esta secuencia de acido nucleico puede ademas comprender sitios de union para varias protemas que regulan la transcripcion, como por ejemplo factores de transcripcion.In the context of the present invention, the term "promoter" refers to a nucleic acid sequence to which RNA polymerase can bind to initiate transcription. This nucleic acid sequence may also comprise binding sites for various proteins that regulate transcription, such as transcription factors.
Los terminos "secuencia de acido nucleico", "secuencia de nucleotidos", "acido nucleico" y "molecula de acido nucleico" se usan aqu de manera intercambiable y se refieren a una forma polimerica de nucleotidos de cualquier longitud que pueden estar o no, quimica o bioqwmicamente modificados. Se refieren, por tanto, a cualquier polidesoxirribonucleotido o polirribonucleotido, tanto de cadena sencilla como de doble hebra.The terms "nucleic acid sequence", "nucleotide sequence", "nucleic acid" and "nucleic acid molecule" are used interchangeably herein and refer to a polymeric form of nucleotides of any length that may or may not be, Chemically or biochemically modified. They refer, therefore, to any polydeoxyribonucleotide or polyiribonucleotide, both single-stranded and double-stranded.
Se dice que las moleculas o secuencias de acido nucleico son "complementarias" si se pueden hibridar una con la otra con suficiente estabilidad para permitirlas permanecer alineadas una con la otra en condiciones convencionales de "alta restrictividad". Las condiciones de restrictividad convencionales se describen por ejemplo por Sambrock y col., 1989 (Molecular cloning. Vol. 2. New York: Cold spring harbor laboratory press), y por Hames y col., en: Nucleic Acid Hybridation, A Practical Approach, IRL Press, Washington, DC (1985).Nucleic acid molecules or sequences are said to be "complementary" if they can hybridize with one another with sufficient stability to allow them to remain aligned with one another under conventional conditions of "high restrictivity." Conventional restrictive conditions are described for example by Sambrock et al., 1989 (Molecular cloning. Vol. 2. New York: Cold spring harbor laboratory press), and by Hames et al., In: Nucleic Acid Hybridation, A Practical Approach , IRL Press, Washington, DC (1985).
En el contexto de la presente invencion, la comparacion de identidad entre secuencias se puede obtener usando el algoritmo ClustalW (Larkin M.A. et al., Bioinformatics 2007, 23(21):2947-2948).In the context of the present invention, comparison of identity between sequences can be obtained using the ClustalW algorithm (Larkin M.A. et al., Bioinformatics 2007, 23 (21): 2947-2948).
En una realization particular, la secuencia de acido nucleico de la invencion comprende una secuencia de acido nucleico seleccionada de la lista que consiste en: SEQ ID NO.: 1, SEQ ID NO.: 2, SEQ ID NO.: 4, SEQ ID NO.: 5, SEQ ID NO.: 6, SEQ ID NO.: 7, SEQ ID NO.: 8, SEQ ID NO.: 10, SEQ ID NO.: 12, SEQ ID NO.: 13, SEQ ID NO.: 14, SEQ ID NO.: 15, SEQ ID NO.: 17, SEQ ID NO.: 18, SEQ ID NO.: 19, SEQ ID NO.: 20, SEQ ID NO.: 22, SEQ ID NO.: 23, SEQ ID NO.: 24, SEQ ID NO.: 25, SEQ ID NO.: 27, SEQ ID NO.: 28, SEQ ID NO.: 29, SEQ ID NO.: 30, SEQ ID NO.: 44, sus secuencias complementarias o una variante de cualquiera de las secuencias anteriores que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dichas secuencias.In a particular embodiment, the nucleic acid sequence of the invention comprises a nucleic acid sequence selected from the list consisting of: SEQ ID NO .: 1, SEQ ID NO .: 2, SEQ ID NO .: 4, SEQ ID NO .: 5, SEQ ID NO .: 6, SEQ ID NO .: 7, SEQ ID NO .: 8, SEQ ID NO .: 10, SEQ ID NO .: 12, SEQ ID NO .: 13, SEQ ID NO .: 14, SEQ ID NO .: 15, SEQ ID NO .: 17, SEQ ID NO .: 18, SEQ ID NO .: 19, SEQ ID NO .: 20, SEQ ID NO .: 22, SEQ ID NO. : 23, SEQ ID NO .: 24, SEQ ID NO .: 25, SEQ ID NO .: 27, SEQ ID NO .: 28, SEQ ID NO .: 29, SEQ ID NO .: 30, SEQ ID NO .: 44, its complementary sequences or a variant of any of the previous sequences that has at least 70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with these sequences.
En otra realizacion, la secuencia de acido nucleico de la invencion consiste en la SEQ ID NO.: 1, o en la SEQ ID NO.: 2, o en la SEQ ID NO.: 4, o en la SEQ ID NO.: 5, o en la SEQ ID NO.: 6, o en la SEQ ID NO.: 7, o en la SEQ ID NO.: 8, o en la SEQ ID NO.: 10, o en la SEQ ID NO.: 12, o en la SEQ ID NO.: 13, o en la SEQ ID NO.: 14, o en la SEQ ID NO.: 15, oIn another embodiment, the nucleic acid sequence of the invention consists of SEQ ID NO .: 1, or SEQ ID NO .: 2, or SEQ ID NO .: 4, or SEQ ID NO .: 5, or in SEQ ID NO .: 6, or in SEQ ID NO .: 7, or in SEQ ID NO .: 8, or in SEQ ID NO .: 10, or in SEQ ID NO .: 12, or in SEQ ID NO .: 13, or in SEQ ID NO .: 14, or in SEQ ID NO .: 15, or
55
1010
15fifteen
20twenty
2525
3030
en la SEQ ID NO.: 17, o en la SEQ ID NO.: 18, o en la SEQ ID NO.: 19, o en la SEQ ID NO.: 20, o en la SEQ ID NO.: 22, o en la SEQ ID NO.: 23, o en la SEQ ID NO.: 24, o en la SEQ ID NO.: 25, o en la SEQ ID NO.: 27, o en la SEQ ID NO.: 28, o en la SEQ ID NO.: 29, o en la SEQ ID NO.: 30, en la SEQ ID NO.: 44, sus secuencias complementarias o una variante de cualquiera de las secuencias anteriores que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dichas secuencias.in SEQ ID NO .: 17, or in SEQ ID NO .: 18, or in SEQ ID NO .: 19, or in SEQ ID NO .: 20, or in SEQ ID NO .: 22, or in SEQ ID NO .: 23, or in SEQ ID NO .: 24, or in SEQ ID NO .: 25, or in SEQ ID NO .: 27, or in SEQ ID NO .: 28, or in SEQ ID NO .: 29, or in SEQ ID NO .: 30, in SEQ ID NO .: 44, its complementary sequences or a variant of any of the previous sequences that has at least 70%, or a 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequences.
Preferentemente, la secuencia de acido nucleico segun la presente invencion es la secuencia de acido nucleico que comprende la SEQ ID NO.: 2 o una variante de la SEQ ID NO.: 2 que que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dicha secuencia, o la secuencia complementaria de alguna de ellas.Preferably, the nucleic acid sequence according to the present invention is the nucleic acid sequence comprising SEQ ID NO .: 2 or a variant of SEQ ID NO .: 2 which has at least 70%, or 80% , or 90%, or 95%, or 97%, or 99%, of identity with said sequence, or the complementary sequence of any of them.
Preferentemente, la secuencia de acido nucleico segun la presente invencion es la secuencia de acido nucleico que comprende la SEQ ID NO.: 5 o una variante de la SEQ ID NO.: 5 que que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dicha secuencia, o la secuencia complementaria de alguna de ellas.Preferably, the nucleic acid sequence according to the present invention is the nucleic acid sequence comprising SEQ ID NO .: 5 or a variant of SEQ ID NO .: 5 which has at least 70%, or 80% , or 90%, or 95%, or 97%, or 99%, of identity with said sequence, or the complementary sequence of any of them.
Preferentemente, la secuencia de acido nucleico de la presente invencion es la secuencia de acido nucleico que comprende la SEQ ID NO.: 6 o una variante de la SEQ ID NO.: 6 que que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dicha secuencia, o la secuencia complementaria de alguna de ellas.Preferably, the nucleic acid sequence of the present invention is the nucleic acid sequence comprising SEQ ID NO .: 6 or a variant of SEQ ID NO .: 6 which has at least 70%, or 80% , or 90%, or 95%, or 97%, or 99%, of identity with said sequence, or the complementary sequence of any of them.
Preferentemente, la secuencia de acido nucleico de la presente invencion es la secuencia de acido nucleico que comprende la SEQ ID NO.: 18 o una variante de la SEQ ID NO.: 18 que que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dicha secuencia, o la secuencia complementaria de alguna de ellas.Preferably, the nucleic acid sequence of the present invention is the nucleic acid sequence comprising SEQ ID NO .: 18 or a variant of SEQ ID NO .: 18 which has at least 70%, or 80% , or 90%, or 95%, or 97%, or 99%, of identity with said sequence, or the complementary sequence of any of them.
Preferentemente, la secuencia de acido nucleico de la presente invencion es la secuencia de acido nucleico que comprende la SEQ ID NO.: 23 o una variante de la SEQ ID NO.: 23 que que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dicha secuencia, o la secuencia complementaria de alguna de ellas.Preferably, the nucleic acid sequence of the present invention is the nucleic acid sequence comprising SEQ ID NO .: 23 or a variant of SEQ ID NO .: 23 which has at least 70%, or 80% , or 90%, or 95%, or 97%, or 99%, of identity with said sequence, or the complementary sequence of any of them.
Preferentemente, la secuencia de acido nucleico de la presente invencion es la secuencia de acido nucleico que comprende la SEQ ID NO.: 28 o una variante de la SEQ ID NO.: 28 que que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dicha secuencia, o la secuencia complementaria de alguna de ellas.Preferably, the nucleic acid sequence of the present invention is the nucleic acid sequence comprising SEQ ID NO .: 28 or a variant of SEQ ID NO .: 28 which has at least 70%, or 80% , or 90%, or 95%, or 97%, or 99%, of identity with said sequence, or the complementary sequence of any of them.
55
1010
15fifteen
20twenty
2525
3030
Preferentemente, la secuencia de acido nucleico de la presente invencion es la secuencia de acido nucleico que comprende la SEQ ID NO.: 29 o una variante de la SEQ ID NO.: 29 que que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dicha secuencia, o la secuencia complementaria de alguna de ellas.Preferably, the nucleic acid sequence of the present invention is the nucleic acid sequence comprising SEQ ID NO .: 29 or a variant of SEQ ID NO .: 29 which has at least 70%, or 80% , or 90%, or 95%, or 97%, or 99%, of identity with said sequence, or the complementary sequence of any of them.
Preferentemente, la secuencia de acido nucleico de la presente invencion es la secuencia de acido nucleico que comprende la SEQ ID NO.: 30 o una variante de la SEQ ID NO.: 30 que que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dicha secuencia, o la secuencia complementaria de alguna de ellas.Preferably, the nucleic acid sequence of the present invention is the nucleic acid sequence comprising SEQ ID NO .: 30 or a variant of SEQ ID NO .: 30 which has at least 70%, or 80% , or 90%, or 95%, or 97%, or 99%, of identity with said sequence, or the complementary sequence of any of them.
Preferentemente, la secuencia de acido nucleico de la presente invencion es la secuencia de acido nucleico que comprende la SEQ ID NO.: 44 o una variante de la SEQ ID NO.: 45 que que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dicha secuencia, o la secuencia complementaria de alguna de ellas.Preferably, the nucleic acid sequence of the present invention is the nucleic acid sequence comprising SEQ ID NO .: 44 or a variant of SEQ ID NO .: 45 which has at least 70%, or 80% , or 90%, or 95%, or 97%, or 99%, of identity with said sequence, or the complementary sequence of any of them.
Preferentemente la secuencia de acido nucleico es la secuencia de acido nucleico que consiste en la SEQ ID NO.: 2, o una variante de la misma que que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dicha secuencia, o la secuencia complementaria de alguna de ellas.Preferably the nucleic acid sequence is the nucleic acid sequence consisting of SEQ ID NO .: 2, or a variant thereof that has at least 70%, or 80%, or 90%, or a 95%, or 97%, or 99%, of identity with said sequence, or the complementary sequence of any of them.
Preferentemente la secuencia de acido nucleico es la secuencia de acido nucleico que consiste en la SEQ ID NO.: 5, o una variante de la misma que que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dicha secuencia, o la secuencia complementaria de alguna de ellas.Preferably the nucleic acid sequence is the nucleic acid sequence consisting of SEQ ID NO .: 5, or a variant thereof that has at least 70%, or 80%, or 90%, or a 95%, or 97%, or 99%, of identity with said sequence, or the complementary sequence of any of them.
Preferentemente la secuencia de acido nucleico es la secuencia de acido nucleico que consiste en la SEQ ID NO.: 6, o una variante de la misma que que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dicha secuencia, o la secuencia complementaria de alguna de ellas.Preferably the nucleic acid sequence is the nucleic acid sequence consisting of SEQ ID NO .: 6, or a variant thereof that has at least 70%, or 80%, or 90%, or a 95%, or 97%, or 99%, of identity with said sequence, or the complementary sequence of any of them.
Preferentemente la secuencia de acido nucleico es la secuencia de acido nucleico que consiste en la SEQ ID NO.: 18, o una variante de la misma que que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dicha secuencia, o la secuencia complementaria de alguna de ellas.Preferably the nucleic acid sequence is the nucleic acid sequence consisting of SEQ ID NO .: 18, or a variant thereof that has at least 70%, or 80%, or 90%, or a 95%, or 97%, or 99%, of identity with said sequence, or the complementary sequence of any of them.
Preferentemente la secuencia de acido nucleico es la secuencia de acido nucleico que consiste en la SEQ ID NO.: 23, o una variante de la misma que que posee al menos unPreferably the nucleic acid sequence is the nucleic acid sequence consisting of SEQ ID NO .: 23, or a variant thereof that has at least one
55
1010
15fifteen
20twenty
2525
3030
70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dicha secuencia, o la secuencia complementaria de alguna de ellas.70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequence, or the complementary sequence of any of them.
Preferentemente la secuencia de acido nucleico es la secuencia de acido nucleico que consiste en la SEQ ID NO.: 28, o una variante de la misma que que posee al menos unPreferably the nucleic acid sequence is the nucleic acid sequence consisting of SEQ ID NO .: 28, or a variant thereof that has at least one
70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dicha70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said
secuencia, o la secuencia complementaria de alguna de ellas.sequence, or the complementary sequence of any of them.
Preferentemente la secuencia de acido nucleico es la secuencia de acido nucleico que consiste en la SEQ ID NO.: 29, o una variante de la misma que que posee al menos unPreferably the nucleic acid sequence is the nucleic acid sequence consisting of SEQ ID NO .: 29, or a variant thereof that has at least one
70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dicha70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said
secuencia, o la secuencia complementaria de alguna de ellas.sequence, or the complementary sequence of any of them.
Preferentemente la secuencia de acido nucleico es la secuencia de acido nucleico que consiste en la SEQ ID NO.: 30, o una variante de la misma que que posee al menos unPreferably the nucleic acid sequence is the nucleic acid sequence consisting of SEQ ID NO .: 30, or a variant thereof that has at least one
70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dicha70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said
secuencia, o la secuencia complementaria de alguna de ellas.sequence, or the complementary sequence of any of them.
Preferentemente la secuencia de acido nucleico es la secuencia de acido nucleico que consiste en la SEQ ID NO.: 44, o una variante de la misma que que posee al menos unPreferably the nucleic acid sequence is the nucleic acid sequence consisting of SEQ ID NO .: 44, or a variant thereof that has at least one
70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dicha70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said
secuencia, o la secuencia complementaria de alguna de ellas.sequence, or the complementary sequence of any of them.
En el contexto de la presente invencion, el termino "ADN recombinante” se refiere a una forma de ADN artifical que ha sido disenado combinando o insertando una o mas hebras de ADN, de tal manera que ADN que normalmente no apareceria combinado, lo hace.In the context of the present invention, the term "recombinant DNA" refers to a form of artificial DNA that has been designed by combining or inserting one or more strands of DNA, such that DNA that would not normally appear combined does.
En general, las secuencias de acido nucleico de la invencion pueden derivar del genoma del nucleopoliedrovirus multiple de Spodoptera exigua (SeMNPV), o del genoma del nucleopoliedrovirus de Spodoptera litoralis (SpliMNPV), o del genoma del nucleopolyhedrovirus de Spodoptera frugiperda (SpfrMNPV), o del genoma del nucleopoliedrovirus de Agrotis ipsilon (AgipMNPV), o del genoma del nucleopoliedrovirus Agrotis segetum de (AgseMNPV), o del genoma del nucleopoliedrovirus de Bombyx mori (BmNPV), o del genoma del nucleopoliedrovirus de Autographa californica (AcMNPV).In general, the nucleic acid sequences of the invention can be derived from the genome of Spodoptera exigua multiple nucleopoliedrovirus (SeMNPV), or from the genome of the Spodoptera litoralis nucleopoliedrovirus (SpliMNPV), or from the Spodoptera frugiperda (SpfrMPV, SpfrMP) of the genome of the Agrotis ipsilon nucleopoliedrovirus (AgipMNPV), or of the genome of the Agrotis segetum nucleopoliedrovirus (AgseMNPV), or of the Bombyx mori nucleopoliedrovirus genome (BmNPV), or of the Autographa californica nucleopoliedrovirus genome (AcMNPV).
Preferiblemente, las secuencias de acido nucleico de la invencion derivan del genoma del nucleopoliedrovirus multiple de Spodoptera exigua (SeMNPV).Preferably, the nucleic acid sequences of the invention are derived from the genome of the spodoptera exigua multiple nucleopoliedrovirus (SeMNPV).
55
1010
15fifteen
20twenty
2525
3030
En una realization particular de la presente invention, la secuencia de acido nucleico incluye 301 nucleotidos aguas arriba (upstream) del codon de inicio del marco abierto de lectura (ORF) correspondiente al gen: ORF46calyx / polyhedron envelope protein" o „polyhedron envelope protein calyx/pep” (Genbank acc n AF169823.1). del genoma del nucleopoliedrovirus multiple de Spodoptera exigua (SeMNPV), o del genoma del nucleopoliedrovirus de Spodoptera litoralis (SpliMNPV), o del genoma delIn a particular embodiment of the present invention, the nucleic acid sequence includes 301 upstream nucleotides of the open reading frame (ORF) start codon corresponding to the gene: ORF46calyx / polyhedron envelope protein "or" polyhedron envelope protein calyx / pep ”(Genbank acc n AF169823.1). of the genome of Spodoptera exigua multiple nucleopoliedrovirus (SeMNPV), or of the genome of Spodoptera litoralis nucleopoliedrovirus (SpliMNPV), or of the genome of the
nucleopoliedrovirus de Spodoptera frugiperda (SpfrMNPV), o del genoma delSpodoptera frugiperda nucleopoliedrovirus (SpfrMNPV), or genome of the
nucleopoliedrovirus de Agrotis ipsilon (AgipMNPV), o del genoma del nucleopoliedrovirus de Agrotis segetum (AgseMNPV), o del genoma del nucleopoliedrovirus de Bombyx mori (BmNPV), o del genoma del nucleopoliedrovirus de Autographa californica (AcMNPV).Agrotis ipsilon nucleopoliedrovirus (AgipMNPV), or of the genome of the Agrotis segetum nucleopoliedrovirus (AgseMNPV), or of the Bombyx mori nucleopoliedrovirus genome (BmNPV), or of the Autographa californica nucleopoliedrovirus genome (AcMNPV).
Preferentemente, la secuencia de acido nucleico incluye 301 nucleotidos aguas arriba (upstream) del codon de inicio del marco abierto de lectura orf46 del genoma del nucleopolyhedrovirus multiple Spodoptera exigua (SeMNPV).Preferably, the nucleic acid sequence includes 301 upstream nucleotides of the start codon of the open reading frame orf46 of the genome of the spodoptera exigua multiple nucleopolyhedrovirus multiple (SeMNPV).
Casete de expresionExpression cassette
Las secuencias de acido nucleico de la invencion, como por ejemplo las secuencias representadas en SEQ ID NOs.: 1-2, SEQ ID NOs.: 4-8, SEQ ID NO.:10, SEQ ID NOs.: 1215, SEQ ID NOs.: 17-20, SEQ ID NOs.: 22-25, SEQ ID NOs.: 27-30 y SEQ ID NO.: 44, sus secuencias complementarias o una variante de cualquiera de las secuencias anteriores que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dichas secuencias, pueden estar operativamente unidas a una secuencia de nucleotidos que codifica una protema de interes, constituyendo de este modo un casete de expresion.The nucleic acid sequences of the invention, such as the sequences depicted in SEQ ID NOs .: 1-2, SEQ ID NOs .: 4-8, SEQ ID NO.:10, SEQ ID NOs .: 1215, SEQ ID NOs .: 17-20, SEQ ID NOs .: 22-25, SEQ ID NOs .: 27-30 and SEQ ID NO .: 44, their complementary sequences or a variant of any of the previous sequences that has at least 70 %, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequences, may be operably linked to a nucleotide sequence encoding a protein of interest, constituting in this way an expression cassette.
Tal y como se utiliza en esta description, el termino "operativamente unida” significa que la protema o protemas es (son) expresada(s) en el marco de lectura correcto bajo el control del promotor y las secuencias de control o reguladoras de expresion.As used in this description, the term "operably linked" means that the protein (s) is (are) expressed in the correct reading frame under the control of the promoter and the control or regulatory expression sequences.
Por lo tanto, la invencion proporciona un casete de expresion que comprende una secuencia de acido nucleico que comprende cualquiera de las secuencias de nucleotidos de la presente invencion, operativamente unida a una secuencia de acido nucleico que comprende la secuencia de nucleotidos que codifica una protema.Therefore, the invention provides an expression cassette comprising a nucleic acid sequence comprising any of the nucleotide sequences of the present invention, operably linked to a nucleic acid sequence comprising the nucleotide sequence encoding a protein.
Ademas, opcionalmente, el casete de expresion puede incorporar otras secuencias de control o secuencias reguladoras de la expresion. Las secuencias de control son secuencias que controlan y regulan la transcription y, en su caso, la traduction de la protema de interes. Ademas de promotores, incluyen secuencias que codifican reguladores transcripcionales,In addition, optionally, the expression cassette may incorporate other control sequences or expression regulatory sequences. Control sequences are sequences that control and regulate transcription and, where appropriate, the translation of the protein of interest. In addition to promoters, they include sequences that encode transcriptional regulators,
55
1010
15fifteen
20twenty
2525
3030
secuencias de union a ribosomas (RBS) y/o secuencias terminadoras de transcripcion. Dichas secuencias de control de expresion pueden ser funcionales en celulas y organismos procariotas y/o en celulas y organismos eucariotas.ribosome binding sequences (RBS) and / or transcription terminator sequences. Said expression control sequences may be functional in cells and prokaryotic organisms and / or in cells and eukaryotic organisms.
Por lo tanto, el casete de expresion de la presente invention puede comprender adicionalmente una region de recombination homologa (hr), como amplificadores (enhancers), unida al promotor que controla la expresion de la protema.Therefore, the expression cassette of the present invention may additionally comprise a region of homologous recombination (hr), such as amplifiers (enhancers), bound to the promoter that controls the expression of the protein.
Las regiones de recombinacion homologa (hr) en baculovirus, como por ejemplo en AcMNPV, se componen de unidades de unas 70 pb repetidas en tandem, cuya region central alberga un semipalmdromo de 28 pb caracterizado por contener una diana EcoRI. Se han identificado 8 regiones que contienen de 2 a 8 repeticiones de esta unidad. Su principal funcion es la de actuar como origen de replication del DNA vmco, la estabilizacion del genoma del virus y la intensification de la transcripcion.Homologous (hr) recombination regions in baculovirus, such as AcMNPV, are composed of units of about 70 bp repeated in tandem, whose central region houses a 28 bp semi-param characterized by containing an EcoRI target. Eight regions containing 2 to 8 repetitions of this unit have been identified. Its main function is to act as the origin of replication of the DNA vmco, the stabilization of the genome of the virus and the intensification of transcription.
Por ejemplo, estas regiones de recombinacion homologa se repiten en ocho localizaciones en el genoma de AcMNPV, con de 2 a 8 repeticiones en cada uno de los lados.For example, these homologous recombination regions are repeated in eight locations in the AcMNPV genome, with 2 to 8 repetitions on each side.
Un amplificador o region amplificadora (enhancer) en el contexto de la presente invencion se entiende como una secuencia de control a la cual se unen elementos reguladores de la transcripcion, aumentando asi el nivel de transcripcion de los genes asociados.An amplifier or amplifier region (enhancer) in the context of the present invention is understood as a control sequence to which transcriptional regulatory elements bind, thereby increasing the level of transcription of the associated genes.
Ventajosamente, dicho casete de expresion puede ademas comprender un marcador o gen que codifica para un motivo o fenotipo que permite la selection de la celula hospedadora transformada con dicho casete de expresion. Ejemplos ilustrativos de dichos marcadores que podrian estar presentes en el casete de expresion de la invencion incluyen genes de resistencia a antibioticos, genes de resistencia a compuestos toxicos y, en general, todos aquellos que permitan seleccionar las celulas transformadas geneticamente.Advantageously, said expression cassette can also comprise a marker or gene that codes for a motif or phenotype that allows the selection of the host cell transformed with said expression cassette. Illustrative examples of said markers that could be present in the expression cassette of the invention include antibiotic resistance genes, genes for resistance to toxic compounds and, in general, all those that allow the selection of genetically transformed cells.
Preferentemente, la protema codificada en el casete de expresion de la invencion se selecciona entre las siguientes: vacuna proteica, protema terapeutica, anticuerpo, enzima, citoquina, factor de coagulation, anticoagulante, receptor, hormona, protema con valor diagnostico o protemas de partmulas similares a virus (VLP).Preferably, the protein encoded in the expression cassette of the invention is selected from the following: protein vaccine, therapeutic protein, antibody, enzyme, cytokine, coagulation factor, anticoagulant, receptor, hormone, protein with diagnostic value or similar particle protections to virus (VLP).
El casete de expresion puede ademas comprender, si asi se desea, una secuencia de acido nucleico que codifica un peptido susceptible de ser utilizado con fines de aislamiento o purification del producto de interes. Por lo tanto, el casete de expresion de la presente invencion comprende, si se desea, una secuencia de acido nucleico que comprende laThe expression cassette may also comprise, if so desired, a nucleic acid sequence encoding a peptide capable of being used for the purpose of isolation or purification of the product of interest. Therefore, the expression cassette of the present invention comprises, if desired, a nucleic acid sequence comprising the
55
1010
15fifteen
20twenty
2525
3030
secuencia de nucleotidos que codifica un peptido susceptible de ser utilizado con fines de aislamiento o purificacion. Dicha secuencia de acido nucleico puede estar situada en cualquier posicion siempre que no altere la funcionalidad del producto de interes.nucleotide sequence encoding a peptide capable of being used for isolation or purification purposes. Said nucleic acid sequence may be located in any position as long as it does not alter the functionality of the product of interest.
Practicamente cualquier peptido o secuencia peptidica que permita el aislamiento o purificacion del peptido o protema de fusion podria ser empleado. Por ejemplo, secuencias de polihistidina, secuencias peptidicas susceptibles de ser reconocidas por anticuerpos que puedan servir para purificar la protema de fusion resultante por cromatografia de immunoafinidad, peptidos etiqueta, etc. Una o mas secuencias de este tipo pueden ser inclddas, opcionalmente, en el casete de expresion de la presente invencion.Virtually any peptide or peptide sequence that allows isolation or purification of the peptide or fusion protein could be used. For example, polyhistidine sequences, peptide sequences that can be recognized by antibodies that can be used to purify the resulting fusion protein by immunoaffinity chromatography, tag peptides, etc. One or more sequences of this type may optionally be included in the expression cassette of the present invention.
Si se desea, el casete de expresion puede comprender ademas una secuencia de nucleotidos que codifica una secuencia de aminoacidos susceptible de ser escindida espedficamente por medios enzimaticos o qdmicos con el fin de liberar el producto de interes una vez aislada la protema de fusion. Practicamente cualquier secuencia de aminoacidos susceptible de ser escindida por medios enzimaticos o qdmicos puede ser empleada, como por ejemplo, sitios de reconocimiento de proteasas (enteroquinasa, Arg-C endoproteasa, Glu-C endoproteasa, Lys-C endoproteasa, Factor de coagulacion Xa, etc) o sitios susceptibles de ser espedficamente escindidos por reactivos qdmicos (bromuro de cianogeno, etc.).If desired, the expression cassette may further comprise a nucleotide sequence encoding an amino acid sequence that can be specifically cleaved by enzymatic or chemical means in order to release the product of interest once the fusion protein is isolated. Virtually any amino acid sequence that can be cleaved by enzymatic or chemical means can be used, for example, protease recognition sites (enterokinase, Arg-C endoprotease, Glu-C endoprotease, Lys-C endoprotease, Coagulation factor Xa, etc) or sites susceptible to being specifically cleaved by chemical reagents (cyanogen bromide, etc.).
VectoresVectors
La secuencia de acido nucleico de la invencion o el casete de expresion de la invencion pueden ser insertados en un vector apropiado. Por tanto la presente invencion se relaciona con un vector recombinante, tal y como un vector de clonacion, vector de transferencia y/o bacmido recombinante que comprende las secuencias de acido nucleico o el casete de expresion de la invencion.The nucleic acid sequence of the invention or the expression cassette of the invention can be inserted into an appropriate vector. Thus the present invention relates to a recombinant vector, such as a cloning vector, transfer vector and / or recombinant bacmid comprising the nucleic acid sequences or the expression cassette of the invention.
Un “vector de clonacion” se refiere a cualquier vector adecuado para clonar, lo que generalmente supone la presencia de sitios de restriccion, un origen de replicacion para su propagacion en bacterias y un marcador de seleccion.A "cloning vector" refers to any vector suitable for cloning, which generally implies the presence of restriction sites, an origin of replication for its propagation in bacteria and a selection marker.
En la presente invencion, el vector de clonacion comprende la secuencia de acido nucleico de la invencion. Por ejemplo, el vector de clonacion comprende al menos una secuencia de las secuencias representadas en SEQ ID NOs.: 1-2, SEQ ID NOs.: 4-8, SEQ ID NO.:10, SEQ ID NOs.: 12-15, SEQ ID NOs.: 17-20, SEQ ID NOs.: 22-25, SEQ ID NOs.: 27-30 y SEQ ID NO.: 44, sus secuencias complementarias o una variante de cualquiera de las secuenciasIn the present invention, the cloning vector comprises the nucleic acid sequence of the invention. For example, the cloning vector comprises at least one sequence of the sequences represented in SEQ ID NOs .: 1-2, SEQ ID NOs .: 4-8, SEQ ID NO.:10, SEQ ID NOs .: 12-15 , SEQ ID NOs .: 17-20, SEQ ID NOs .: 22-25, SEQ ID NOs .: 27-30 and SEQ ID NO .: 44, their complementary sequences or a variant of any of the sequences
1818
55
1010
15fifteen
20twenty
2525
3030
3535
anteriores que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dichas secuencias. Por ejemplo, el vector de clonacion de la presente invention comprende la SEQ ID NO.: 1. Por ejemplo, el vector de clonacion de la presente invencion comprende la SEQ ID NO.: 2. Por ejemplo, el vector de clonacion de la presente invencion comprende la SEQ ID NO.: 5. Por ejemplo, el vector de clonacion de la presente invencion comprende la SEQ ID NO.: 6. Por ejemplo, el vector de clonacion de la presente invencion comprende la SEQ ID NO.: 12. Por ejemplo, el vector de clonacion de la presente invencion comprende la SEQ ID NO.: 13. Por ejemplo, el vector de clonacion de la presente invencion comprende la SEQ ID NO.: 14. Por ejemplo, el vector de clonacion de la presente invencion comprende la SEQ ID NO.: 18. Por ejemplo, el vector de clonacion de la presente invencion comprende la SEQ ID NO.: 23. Por ejemplo, el vector de clonacion de la presente invencion comprende la SEQ ID NO.: 28. Por ejemplo, el vector de clonacion de la presente invencion comprende la SEQ ID NO.: 29. Por ejemplo, el vector de clonacion de la presente invencion comprende la SEQ ID NO.: 30. Por ejemplo, el vector de clonacion de la presente invencion comprende la SEQ ID NO.: 44. Ademas, la presente invencion proporciona un vector que comprende el casete de expresion de la presente invencion y puede ser empleado preferentemente para producir el bacmido, el baculovirus recombinante, la celula, el insecto (o larva) o el medio de cultivo de la invencion.previous that has at least 70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequences. For example, the cloning vector of the present invention comprises SEQ ID NO .: 1. For example, the cloning vector of the present invention comprises SEQ ID NO .: 2. For example, the cloning vector of the present Invention comprises SEQ ID NO .: 5. For example, the cloning vector of the present invention comprises SEQ ID NO .: 6. For example, the cloning vector of the present invention comprises SEQ ID NO .: 12. For example, the cloning vector of the present invention comprises SEQ ID NO .: 13. For example, the cloning vector of the present invention comprises SEQ ID NO .: 14. For example, the cloning vector of the present Invention comprises SEQ ID NO .: 18. For example, the cloning vector of the present invention comprises SEQ ID NO .: 23. For example, the cloning vector of the present invention comprises SEQ ID NO .: 28. For example, the cloning vector of the present invention comprises SEQ ID NO .: 29. For example, e The cloning vector of the present invention comprises SEQ ID NO .: 30. For example, the cloning vector of the present invention comprises SEQ ID NO .: 44. In addition, the present invention provides a vector comprising the cassette of expression of the present invention and can preferably be used to produce the bacmid, the recombinant baculovirus, the cell, the insect (or larva) or the culture medium of the invention.
El vector de clonacion que comprende un casete de expresion se denomina tambien “vector donador”. Por ejemplo, el vector donador de la presente invencion comprende al menos una secuencia de las secuencias representadas en SEQ ID NOs.: 1-2, SEQ ID NOs.: 4-8, SEQ ID NO.:10, SEQ ID NOs.: 12-15, SEQ ID NOs.: 17-20, SEQ ID NOs.: 22-25, SEQ ID NOs.: 27-30, SEQ ID NO.: 44, sus secuencias complementarias o una variante de cualquiera de las secuencias anteriores que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dichas secuencias. Por ejemplo, el vector donador de la presente invencion comprende la SEQ ID NO.: 1. Por ejemplo, el vector donador de laThe cloning vector comprising an expression cassette is also called a "donor vector." For example, the donor vector of the present invention comprises at least one sequence of the sequences depicted in SEQ ID NOs .: 1-2, SEQ ID NOs .: 4-8, SEQ ID NO.:10, SEQ ID NOs .: 12-15, SEQ ID NOs .: 17-20, SEQ ID NOs .: 22-25, SEQ ID NOs .: 27-30, SEQ ID NO .: 44, their complementary sequences or a variant of any of the above sequences which has at least 70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequences. For example, the donor vector of the present invention comprises SEQ ID NO .: 1. For example, the donor vector of the
presente invencion comprende la SEQ ID NO.: 2. Por ejemplo, el vector donador de la
This invention comprises SEQ ID NO .: 2. For example, the donor vector of the
presente invencion comprende la SEQ ID NO.: 5. Por ejemplo, el vector donador de la
This invention comprises SEQ ID NO .: 5. For example, the donor vector of the
presente invencion comprende la SEQ ID NO.: 6. Por ejemplo, el vector donador de la
This invention comprises SEQ ID NO .: 6. For example, the donor vector of the
presente invencion comprende la SEQ ID NO.: 12. Por ejemplo, el vector donador de la
This invention comprises SEQ ID NO .: 12. For example, the donor vector of the
presente invencion comprende la SEQ ID NO.: 13. Por ejemplo, el vector donador de la
This invention comprises SEQ ID NO .: 13. For example, the donor vector of the
presente invencion comprende la SEQ ID NO.: 14. Por ejemplo, el vector donador de la
This invention comprises SEQ ID NO .: 14. For example, the donor vector of the
presente invencion comprende la SEQ ID NO.: 18. Por ejemplo, el vector donador de la
This invention comprises SEQ ID NO .: 18. For example, the donor vector of the
presente invencion comprende la SEQ ID NO.: 23. Por ejemplo, el vector donador de la
This invention comprises SEQ ID NO .: 23. For example, the donor vector of the
presente invencion comprende la SEQ ID NO.: 28. Por ejemplo, el vector donador de la
This invention comprises SEQ ID NO .: 28. For example, the donor vector of the
55
1010
15fifteen
20twenty
2525
3030
presente invention comprende la SEQ ID NO.: 29. Por ejemplo, el vector donador de la presente invencion comprende la SEQ ID NO.: 30. Por ejemplo, el vector donador de la presente invencion comprende la SEQ ID NO.: 44.The present invention comprises SEQ ID NO .: 29. For example, the donor vector of the present invention comprises SEQ ID NO .: 30. For example, the donor vector of the present invention comprises SEQ ID NO .: 44.
En el contexto de la presente invencion, “vector de transferencia” hace referencia a un vector donador adecuado para su integration o transposition en el genoma de baculovirus. El vector de transferencia permite generalmente la insertion de material genetico en el genoma de un baculovirus.In the context of the present invention, "transfer vector" refers to a donor vector suitable for integration or transposition in the baculovirus genome. The transfer vector generally allows the insertion of genetic material into the genome of a baculovirus.
Preferentemente, el vector de transferencia de la presente invencion comprende alguna de las secuencias de acido nucleico de la presente invencion, y/o alguno de los casetes de expresion de la presente invencion asi como elementos que permitan su integracion o transposicion en el genoma de baculovirus. La obtencion de dicho vector puede hacerse por metodos convencionales conocidos por tecnicos en la materia [por ejemplo, Sambrock et al., 1989, Molecular cloning. Vol. 2. New York: Cold spring harbor laboratory press]. Por ejemplo, la obtencion de dicho vector puede hacerse mediante el metodo convencional conocido como “Sistema Gateway” (Hartley JL, Temple GF, Brasch MA. DNA cloning using in vitro site-specific recombination. Genome Res. 2000 Nov;10(11):1788-95). El vector de transferencia puede transformar celulas que comprenden una o varias copias del genoma de baculovirus. Por ejemplo, el vector de transferencia de la presente invencion comprende al menos una secuencia de las secuencias representadas en SEQ ID Nos.: 1-2, SEQ ID NOs.: 4-8, SEQ ID NO.:10, SEQ ID NOs.: 12-15, SEQ ID NOs.: 17-20, SEQ ID NOs.: 22-25, SEQ ID NOs.: 27-30, SEQ ID NO.: 44, sus secuencias complementarias o una variante de cualquiera de las secuencias anteriores que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dichas secuencias. Por ejemplo, el vector de transferencia de la presente invencion comprende la SEQ ID NO.: 1. Por ejemplo, el vector de transferencia de la presente invencion comprende la SEQ ID NO.: 2. Por ejemplo, el vector de transferencia de la presente invencion comprende la SEQ ID NO.: 5. Por ejemplo, el vector de transferencia de la presente invencion comprende la SEQ ID NO.: 6. Por ejemplo, el vector de transferencia de la presente invencion comprende la SEQ ID NO.: 12. Por ejemplo, el vector de transferencia de la presente invencion comprende la SEQ ID NO.: 13. Por ejemplo, el vector de transferencia de la presente invencion comprende la SEQ ID NO.: 14. Por ejemplo, el vector de transferencia de la presente invencion comprende la SEQ ID NO.: 18. Por ejemplo, el vector de transferencia de la presente invencion comprende la SEQ ID NO.: 23. Por ejemplo, el vector de transferencia de la presente invencion comprende la SEQ ID NO.: 28. Por ejemplo, el vector de transferencia de laPreferably, the transfer vector of the present invention comprises some of the nucleic acid sequences of the present invention, and / or any of the expression cassettes of the present invention as well as elements that allow their integration or transposition in the baculovirus genome. . The obtaining of said vector can be done by conventional methods known to those skilled in the art [eg, Sambrock et al., 1989, Molecular cloning. Vol. 2. New York: Cold spring harbor laboratory press]. For example, the obtaining of said vector can be done by the conventional method known as "Gateway System" (Hartley JL, Temple GF, Brasch MA. DNA cloning using in vitro site-specific recombination. Genome Res. 2000 Nov; 10 (11) : 1788-95). The transfer vector can transform cells comprising one or several copies of the baculovirus genome. For example, the transfer vector of the present invention comprises at least one sequence of the sequences depicted in SEQ ID Nos .: 1-2, SEQ ID NOs .: 4-8, SEQ ID NO.:10, SEQ ID NOs. : 12-15, SEQ ID NOs .: 17-20, SEQ ID NOs .: 22-25, SEQ ID NOs .: 27-30, SEQ ID NO .: 44, its complementary sequences or a variant of any of the sequences previous that has at least 70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequences. For example, the transfer vector of the present invention comprises SEQ ID NO .: 1. For example, the transfer vector of the present invention comprises SEQ ID NO .: 2. For example, the transfer vector of the present Invention comprises SEQ ID NO .: 5. For example, the transfer vector of the present invention comprises SEQ ID NO .: 6. For example, the transfer vector of the present invention comprises SEQ ID NO .: 12. For example, the transfer vector of the present invention comprises SEQ ID NO .: 13. For example, the transfer vector of the present invention comprises SEQ ID NO .: 14. For example, the transfer vector of the present Invention comprises SEQ ID NO .: 18. For example, the transfer vector of the present invention comprises SEQ ID NO .: 23. For example, the transfer vector of the present invention comprises SEQ ID NO .: 28. For example, the transfer vector of the
55
1010
15fifteen
20twenty
2525
3030
presente invention comprende la SEQ ID NO.: 29. Por ejemplo, el vector de transferencia de la presente invencion comprende la SEQ ID NO.: 30. Por ejemplo, el vector de transferencia de la presente invencion comprende la SEQ ID NO.: 44.The present invention comprises SEQ ID NO .: 29. For example, the transfer vector of the present invention comprises SEQ ID NO .: 30. For example, the transfer vector of the present invention comprises SEQ ID NO .: 44 .
El vector de transferencia de la presente invencion puede derivar de alguno de los sistemas de expresion basados en baculovirus disponibles comercialmente “Bac-to-Bac®” (Invitrogen™), “BacPAK™” (Clontech™), “FlashBAC™” (Oxford Expression Technologies™), “BacuVance™” (GenScriptTM), “Bac-N-Blue DNATM” (InvitrogenTM), “BaculoDirect™”The transfer vector of the present invention may be derived from one of the commercially available baculovirus-based expression systems "Bac-to-Bac®" (Invitrogen ™), "BacPAK ™" (Clontech ™), "FlashBAC ™" (Oxford Expression Technologies ™), “BacuVance ™” (GenScriptTM), “Bac-N-Blue DNATM” (InvitrogenTM), “BaculoDirect ™”
(InvitrogenTM), “BacVector®” 1000, 2000, 3000 (Novagen®), “DiamondBacTM” (Sigma- Aldrich®), “BaculoGold™” (BD BiosciencesTM) or “MultiBack” (ETH Zurich/Redbiotec AG).(InvitrogenTM), "BacVector®" 1000, 2000, 3000 (Novagen®), "DiamondBacTM" (Sigma-Aldrich®), "BaculoGold ™" (BD BiosciencesTM) or "MultiBack" (ETH Zurich / Redbiotec AG).
Los vectores de donation, donadores o de transferencia de la presente invencion pueden ser adecuados para transformar o transducir celulas procariotas. Ademas, pueden ser adecuados para transfectar o transducir celulas eucariotas, preferentemente celulas de insecto, mas preferentemente celulas Sf21 y/o Hi5 y/o Sf9 y/o Se301. Los vectores de clonacion y transferencia de la presente invencion pueden ser adecuados para transfectar o transducir insectos o larvas de insecto, como por ejemplo Bombyx mori y Trichoplusia ni, preferentemente larvas de insecto de Trichoplusia ni.The donation, donor or transfer vectors of the present invention may be suitable for transforming or transducing prokaryotic cells. In addition, they may be suitable for transfecting or transducing eukaryotic cells, preferably insect cells, more preferably Sf21 and / or Hi5 and / or Sf9 and / or Se301 cells. The cloning and transfer vectors of the present invention may be suitable for transfecting or transducing insects or insect larvae, such as, for example, Bombyx mori and Trichoplusia or, preferably Trichoplusia or insect larvae.
La presente invencion tambien se refiere al uso de los vectores de la presente invencion para transformar, transfectar o transducir celulas procariotas, celulas eucariotas, preferentemente celulas de insecto, mas preferentemente celulas Sf21 y/o Hi5 y/o Sf9 y/o Se301. Asi mismo, la presente invencion se refiere al uso de los vectores de clonacion y transferencia de la presente invencion para transfectar o transducir insectos o larvas de insecto, como por ejemplo Bombyx mori y Trichoplusia ni, preferentemente larvas de insecto de Trichoplusia ni.The present invention also relates to the use of the vectors of the present invention to transform, transfect or transduce prokaryotic cells, eukaryotic cells, preferably insect cells, more preferably Sf21 and / or Hi5 and / or Sf9 and / or Se301 cells. Likewise, the present invention relates to the use of the cloning and transfer vectors of the present invention to transfect or transduce insects or insect larvae, such as Bombyx mori and Trichoplusia nor, preferably Trichoplusia ni insect larvae.
En el contexto de la presente invencion el termino “transformacion” se entiende como la introduction de material genetico externo en celulas procariotas mediante plasmidos, vectores virales (en ocasiones tambien referido como transduction) u otras herramientas para la transferencia.In the context of the present invention the term "transformation" is understood as the introduction of external genetic material into prokaryotic cells by plasmids, viral vectors (sometimes also referred to as transduction) or other tools for transfer.
En el contexto de la presente invencion, el termino “transduccion” se entiende como el proceso por el cual se introduce material genetico exogeno en una celula procariota u eucariota utilizando un virus como vector.In the context of the present invention, the term "transduction" is understood as the process by which exogenous genetic material is introduced into a prokaryotic or eukaryotic cell using a virus as a vector.
55
1010
15fifteen
20twenty
2525
3030
En el contexto de la presente invention el termino “transfection” se entiende como la introduction de material genetico externo en celulas eucariotas u organismos mediante plasmidos, vectores virales u otras herramientas para la transferencia.In the context of the present invention the term "transfection" is understood as the introduction of external genetic material into eukaryotic cells or organisms by plasmids, viral vectors or other tools for transfer.
BacmidoBacmido
En un aspecto de la invencion el vector es un bacmido recombinante.In one aspect of the invention the vector is a recombinant bacmid.
Un “bacmido” tal y como se entiende en la presente invencion es un plasmido que comprende una secuencia de acido nucleico suficiente como para generar un baculovirus.A "bacmido" as understood in the present invention is a plasmid comprising a nucleic acid sequence sufficient to generate a baculovirus.
El bacmido recombinante de la presente invencion comprende la secuencia de acido nucleico de la invencion y/o el casete de expresion de acuerdo con la presente invencion. Por ejemplo, el bacmido de la presente invencion comprende al menos una secuencia de las secuencias representadas en SEQ ID NOs 1-2, SEQ ID NOs.: 4-8, SEQ ID NO.:10, SEQ ID NOs.: 12-15, SEQ ID NOs.: 17-20, SEQ ID NOs.: 22-25, SEQ ID NOs.: 27-30, SEQ ID NO.: 44, sus secuencias complementarias o una variante de cualquiera de las secuencias anteriores que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dichas secuencias. Por ejemplo, el bacmido de la presente invencion comprende la SEQ ID NO.: 1. Por ejemplo, el bacmido de la presente invencion comprende la SEQ ID NO.: 2. Por ejemplo, el bacmido de la presente invencion comprende la SEQ ID NO.: 5. Por ejemplo, el bacmido de la presente invencion comprende la SEQ ID NO.: 6. Por ejemplo, el bacmido de la presente invencion comprende la SEQ ID NO.: 12. Por ejemplo, el bacmido de la presente invencion comprende la SEQ ID NO.: 13. Por ejemplo, el bacmido de la presente invencion comprende la SEQ ID NO.: 14. Por ejemplo, el bacmido de la presente invencion comprende la SEQ ID NO.: 18. Por ejemplo, el bacmido de la presente invencion comprende la SEQ ID NO.: 23. Por ejemplo, el bacmido de la presente invencion comprende la SEQ ID NO.: 28. Por ejemplo, el bacmido de la presente invencion comprende la SEQ ID NO.: 29. Por ejemplo, el bacmido de la presente invencionThe recombinant bacmid of the present invention comprises the nucleic acid sequence of the invention and / or the expression cassette according to the present invention. For example, the scope of the present invention comprises at least one sequence of the sequences depicted in SEQ ID NOs 1-2, SEQ ID NOs .: 4-8, SEQ ID NO.:10, SEQ ID NOs .: 12-15 , SEQ ID NOs .: 17-20, SEQ ID NOs .: 22-25, SEQ ID NOs .: 27-30, SEQ ID NO .: 44, its complementary sequences or a variant of any of the previous sequences it has minus 70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequences. For example, the scope of the present invention comprises SEQ ID NO .: 1. For example, the scope of the present invention comprises SEQ ID NO .: 2. For example, the scope of the present invention comprises SEQ ID NO. .: 5. For example, the scope of the present invention comprises SEQ ID NO .: 6. For example, the scope of the present invention comprises SEQ ID NO .: 12. For example, the scope of the present invention comprises SEQ ID NO .: 13. For example, the scope of the present invention comprises SEQ ID NO .: 14. For example, the scope of the present invention comprises SEQ ID NO .: 18. For example, the scope of The present invention comprises SEQ ID NO .: 23. For example, the scope of the present invention comprises SEQ ID NO .: 28. For example, the scope of the present invention comprises SEQ ID NO .: 29. For example , the bacmid of the present invention
comprende la SEQ ID NO.: 30. Por ejemplo, el bacmido de la presente invencioncomprises SEQ ID NO .: 30. For example, the scope of the present invention
comprende la SEQ ID NO.: 44. El bacmido es preferentemente adecuado para producir unIt comprises SEQ ID NO .: 44. Bacmido is preferably suitable for producing a
baculovirus recombinante, una celula, un insecto (o larva) o el medio de cultivo de larecombinant baculovirus, a cell, an insect (or larva) or the culture medium of the
presente invencion.present invention.
El bacmido de la presente invencion puede ser adecuado para transformar o transducir celulas procariotas y/o transfectar o transducir celulas eucariotas, preferentemente celulas de insecto. Mas preferentemente, es adecuado para transfectar celulas Sf21 y/o Hi5 y/o Sf9The scope of the present invention may be suitable for transforming or transducing prokaryotic cells and / or transfecting or transducing eukaryotic cells, preferably insect cells. More preferably, it is suitable for transfecting Sf21 and / or Hi5 and / or Sf9 cells
55
1010
15fifteen
20twenty
2525
3030
y/o Se301, o para transfectar insectos o larvas de insecto, preferentemente larvas de insecto de Trichoplusia ni. Por lo tanto, la presente invencion se refiere al uso del bacmido de la presente invencion para transformar, transfectar o transducir celulas celulas procariotas, celulas eucariotas, preferentemente celulas de insecto, mas preferentemente celulas Sf21 y/o Hi5 y/o Sf9 y/o Se301. As^ mismo, la presente invencion se refiere al uso del bacmido de la presente invencion para transfectar insectos o larvas de insecto, preferentemente larvas de insecto de Trichoplusia ni.and / or Se301, or to transfect insects or insect larvae, preferably Trichoplusia ni. Therefore, the present invention relates to the use of the present invention to transform, transfect or transduce prokaryotic cells, eukaryotic cells, preferably insect cells, more preferably Sf21 and / or Hi5 and / or Sf9 and / or cells Se301. Likewise, the present invention relates to the use of the present invention to transfect insects or insect larvae, preferably Trichoplusia ni insect larvae.
BaculovirusBaculovirus
Por lo tanto, la presente invencion se relaciona con un baculovirus que comprende una secuencia de acido nucleico o un casete de expresion segun la presente invencion.Therefore, the present invention relates to a baculovirus comprising a nucleic acid sequence or an expression cassette according to the present invention.
Por ejemplo, el baculovirus de la invencion comprende al menos una secuencia de las secuencias representadas en SEQ ID NOs.: 1-2, SEQ ID NOs.: 4-8, SEQ ID NO.:10, SEQ ID NOs.: 12-15, SEQ ID NOs.: 17-20, SEQ ID NOs.: 22-25, SEQ ID NOs.: 27-30, SEQ ID NO.: 44, sus secuencias complementarias o una variante de cualquiera de las secuencias anteriores que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o unFor example, the baculovirus of the invention comprises at least one sequence of the sequences depicted in SEQ ID NOs .: 1-2, SEQ ID NOs .: 4-8, SEQ ID NO.:10, SEQ ID NOs .: 12- 15, SEQ ID NOs .: 17-20, SEQ ID NOs .: 22-25, SEQ ID NOs .: 27-30, SEQ ID NO .: 44, its complementary sequences or a variant of any of the previous sequences it has at least 70%, or 80%, or 90%, or 95%, or 97%, or a
- 99%, de 99% of
- identidad con d dichas secuencias. Por ejemplo, el baculovirus de la presente identity with said sequences. For example, the baculovirus of the present
- invencion invention
- comprende la SEQ ID NO.: 1. Por ejemplo, el baculovirus de la presente comprises SEQ ID NO .: 1. For example, the baculovirus of the present
- invencion invention
- comprende la SEQ ID NO.: 2. Por ejemplo, el baculovirus de la presente comprises SEQ ID NO .: 2. For example, the baculovirus of the present
- invencion invention
- comprende la SEQ ID NO.: 5. Por ejemplo, el baculovirus de la presente comprises SEQ ID NO .: 5. For example, the baculovirus of the present
- invencion invention
- comprende la SEQ ID NO.: 6. Por ejemplo, el baculovirus de la presente comprises SEQ ID NO .: 6. For example, the baculovirus of the present
- invencion invention
- comprende la SEQ ID NO.: 12. Por ejemplo, el baculovirus de la presente comprises SEQ ID NO .: 12. For example, the baculovirus of the present
- invencion invention
- comprende la SEQ ID NO.: 13. Por ejemplo, el baculovirus de la presente comprises SEQ ID NO .: 13. For example, the baculovirus of the present
- invencion invention
- comprende la SEQ ID NO.: 14. Por ejemplo, el baculovirus de la presente comprises SEQ ID NO .: 14. For example, the baculovirus of the present
- invencion invention
- comprende la SEQ ID NO.: 18. Por ejemplo, el baculovirus de la presente comprises SEQ ID NO .: 18. For example, the baculovirus of the present
- invencion invention
- comprende la SEQ ID NO.: 23. Por ejemplo, el baculovirus de la presente comprises SEQ ID NO .: 23. For example, the baculovirus of the present
- invencion invention
- comprende la SEQ ID NO.: 28. Por ejemplo, el baculovirus de la presente comprises SEQ ID NO .: 28. For example, the baculovirus of the present
- invencion invention
- comprende la SEQ ID NO.: 29. Por ejemplo, el baculovirus de la presente comprises SEQ ID NO .: 29. For example, the baculovirus of the present
- invencion invention
- comprende la SEQ ID NO.: 30. Por ejemplo, el baculovirus de la presente comprises SEQ ID NO .: 30. For example, the baculovirus of the present
invencion comprende la SEQ ID NO.: 44.Invention includes SEQ ID NO .: 44.
El baculovirus de la presente invencion puede derivar de cualquier baculovirus. Por ejemplo, el baculovirus de la presente invencion puede derivar de nucleopoliedrovirus multiple Spodoptera exigua (SeMNPV), o de nucleopoliedrovirus Spodoptera litoralis (SpliMNPV), o de nucleopoliedrovirus Spodoptera frugiperda (SpfrMNPV), o deThe baculovirus of the present invention can be derived from any baculovirus. For example, the baculovirus of the present invention may be derived from Spodoptera exigua multiple nucleopoliedrovirus (SeMNPV), or from Spodoptera litoralis nucleopoliedrovirus (SpliMNPV), or from Spodoptera frugiperda nucleopoliedrovirus (SpfrMNPV), or from
55
1010
15fifteen
20twenty
2525
3030
nucleopoliedrovirus Agrotis ipsilon (AgipMNPV), o de nucleopoliedrovirus Agrotis segetum (AgseMNPV), o de nucleopoliedrovirus Bombyx mori (BmNPV), o de nucleopoliedrovirus Autographa califomica (AcMNPV).Agrotis ipsilon nucleopoliedrovirus (AgipMNPV), or Agrotis segetum nucleopoliedrovirus (AgseMNPV), or Bombyx mori nucleopoliedrovirus (BmNPV), or Calipomic Autographa nucleopoliedrovirus (AcMNPV).
Preferentemente, el baculovirus de la presente invention deriva de AcNMPV, BmNPV o SeMNPV.Preferably, the baculovirus of the present invention is derived from AcNMPV, BmNPV or SeMNPV.
El baculovirus de la presente invencion es adecuado para infectar celulas de insecto, insectos y/o larvas de insecto. Preferentemente, el baculovirus de la presente invencion es adecuado infectar larvas de insecto de Trichoplusia ni. Por lo tanto la presente invencion se refiere al uso del baculovirus de la presente invencion para infectar celulas de insecto, insectoso larvas de insecto, preferentemente larvas de insecto de Trichoplusia ni.The baculovirus of the present invention is suitable for infecting insect cells, insects and / or insect larvae. Preferably, the baculovirus of the present invention is suitable for infecting trichoplusia ni. Therefore the present invention relates to the use of the baculovirus of the present invention to infect insect cells, insect or insect larvae, preferably Trichoplusia ni insect larvae.
La generation de baculovirus puede estar basada en sistemas de expresion basados en baculovirus disponibles comercialmente: “Bac-to-Bac®” (Invitrogen™), “BacPAK™”The baculovirus generation may be based on commercially available baculovirus-based expression systems: "Bac-to-Bac®" (Invitrogen ™), "BacPAK ™"
(Clontech™), “FlashBAC™” (Oxford Expression Technologies™), “BacuVance™”(Clontech ™), "FlashBAC ™" (Oxford Expression Technologies ™), "BacuVance ™"
(GenScript™), “Bac-N-Blue DNATM” (Invitrogen™), “BaculoDirect™” (Invitrogen™),(GenScript ™), “Bac-N-Blue DNATM” (Invitrogen ™), “BaculoDirect ™” (Invitrogen ™),
“BacVector®” 1000, 2000, 3000 (Novagen®), “DiamondBac™” (Sigma-Aldrich®),“BacVector®” 1000, 2000, 3000 (Novagen®), “DiamondBac ™” (Sigma-Aldrich®),
“BaculoGold™” (BD Biosciences™) or “MultiBack” (ETH Zurich/Redbiotec AG).“BaculoGold ™” (BD Biosciences ™) or “MultiBack” (ETH Zurich / Redbiotec AG).
CelulasCells
Los vectores recombinantes proporcionados por esta invencion pueden ser utilizados para transformar, transducir y/o transfectar celulas eucariotas o procariotas. Por tanto, en otro aspecto, la invencion se relaciona con una celula huesped transformada, transducida o transfectada que comprende el vector recombinante y/o la secuencia de acido nucleico proporcionada por la invencion. Por ejemplo, la celula transformada, transducida y/o transfectada de la presente invencion comprende al menos una secuencia de las secuencias representadas en SEQ ID NOs.: 1-2, SEQ ID NOs.: 4-8, SEQ ID NO.:10, SEQ ID NOs.: 1215, SEQ ID NOs.: 17-20, SEQ ID NOs.: 22-25, SEQ ID NOs.: 27-30, SEQ ID NO.: 44, sus secuencias complementarias o una variante de cualquiera de las secuencias anteriores que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dichas secuencias. Por ejemplo, la celula transformada, transducida y/o transfectada de la presente invencion comprende la SEQ ID NO.: 1. Por ejemplo, la celula transformada, transducida y/o transfectada de la presente invencion comprende la SEQ ID NO.: 2. Por ejemplo, la celula transformada, transducida y/o transfectada de la presente invencion comprende la SEQ ID NO.: 5. Por ejemplo, la celula transformada, transducida y/oThe recombinant vectors provided by this invention can be used to transform, transduce and / or transfect eukaryotic or prokaryotic cells. Therefore, in another aspect, the invention relates to a transformed, transduced or transfected host cell comprising the recombinant vector and / or the nucleic acid sequence provided by the invention. For example, the transformed, transduced and / or transfected cell of the present invention comprises at least one sequence of the sequences depicted in SEQ ID NOs .: 1-2, SEQ ID NOs .: 4-8, SEQ ID NO.:10 , SEQ ID NOs .: 1215, SEQ ID NOs .: 17-20, SEQ ID NOs .: 22-25, SEQ ID NOs .: 27-30, SEQ ID NO .: 44, its complementary sequences or a variant of any of the previous sequences that have at least 70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequences. For example, the transformed, transduced and / or transfected cell of the present invention comprises SEQ ID NO .: 1. For example, the transformed, transduced and / or transfected cell of the present invention comprises SEQ ID NO .: 2. For example, the transformed, transduced and / or transfected cell of the present invention comprises SEQ ID NO .: 5. For example, the transformed, transduced and / or cell
55
1010
15fifteen
20twenty
2525
3030
transfectada de la presente invention comprende la SEQ ID NO.: 6. Por ejemplo, la celula transformada, transducida y/o transfectada de la presente invencion comprende la SEQ ID NO.: 12. Por ejemplo, la celula transformada, transducida y/o transfectada de la presente invencion comprende la SEQ ID NO.: 13. Por ejemplo, la celula transformada, transducida y/o transfectada de la presente invencion comprende la SEQ ID NO.: 14. Por ejemplo la celula transformada, transducida y/o transfectada de la presente invencion comprende la SEQ ID NO.: 18. Por ejemplo la celula transformada, transducida y/o transfectada de la presente invencion comprende la SEQ ID NO.: 23. Por ejemplo, la celula transformada, transducida y/o transfectada de la presente invencion comprende la SEQ ID NO.: 28. Por ejemplo, la celula transformada, transducida y/o transfectada de la presente invencion comprende la SEQ ID NO.: 29. Por ejemplo, la celula transformada, transducida y/o transfectada de la presente invencion comprende la SEQ ID NO.: 30. Por ejemplo, la celula transformada, transducida y/o transfectada de la presente invencion comprende la SEQ ID NO.: 44.Transfected of the present invention comprises SEQ ID NO .: 6. For example, the transformed, transduced and / or transfected cell of the present invention comprises SEQ ID NO .: 12. For example, the transformed, transduced and / or cell Transfected of the present invention comprises SEQ ID NO .: 13. For example, the transformed, transduced and / or transfected cell of the present invention comprises SEQ ID NO .: 14. For example the transformed, transduced and / or transfected cell of the present invention comprises SEQ ID NO .: 18. For example the transformed, transduced and / or transfected cell of the present invention comprises SEQ ID NO .: 23. For example, the transformed, transduced and / or transfected cell of The present invention comprises SEQ ID NO .: 28. For example, the transformed, transduced and / or transfected cell of the present invention comprises SEQ ID NO .: 29. For example, the transformed, transduced and / or transfected cell of the present invention bought hence SEQ ID NO .: 30. For example, the transformed, transduced and / or transfected cell of the present invention comprises SEQ ID NO .: 44.
Se pueden obtener celulas transformadas, transducidas o transfectadas mediante metodos convencionales conocidos por los tecnicos en la materia, e.g. [Sambrock et al., 1989, citado supra, Hartley JL, Temple GF, Brasch MA. DNA cloning using in vitro site-specific recombination. Genome Res. 2000 Nov;10(11):1788-95].Transformed, transduced or transfected cells can be obtained by conventional methods known to those skilled in the art, e.g. [Sambrock et al., 1989, cited supra, Hartley JL, Temple GF, Brasch MA. DNA cloning using in vitro site-specific recombination. Genome Res. 2000 Nov; 10 (11): 1788-95].
Por consiguiente, en otro aspecto, la invencion se relaciona con una celula huesped transformada, transducida o transfectada que comprende, al menos, una secuencia de acido nucleico de la invencion, un casete de expresion proporcionado por la presente invencion o un vector recombinante de la invencion.Accordingly, in another aspect, the invention relates to a transformed, transduced or transfected host cell comprising at least one nucleic acid sequence of the invention, an expression cassette provided by the present invention or a recombinant vector of the invention. invention.
La celula de la presente invencion puede ser infectada con el baculovirus de la presente invencion. En el contexto de la presente invencion, el termino “infection” se entiende como entrada de virus en la celula hospedadora que genera un dano estructural del hospedero.The cell of the present invention can be infected with the baculovirus of the present invention. In the context of the present invention, the term "infection" is understood as a virus entry into the host cell that generates structural damage to the host.
Preferentemente, la celula de la presente invencion comprende una o varias copias del genoma del baculovirus, para la obtencion de bacmidos recombinantes segun la presente invencion. En un aspecto de la presente invencion, la celula transformada es Escherichia coli. Por ejemplo, cuando se emplea el sistema de expresion basado en baculovirus comecial Bac-to-Bac®, la celula empleada es DH10BacTM. En otro aspecto, la celula transformada transducida, transfectada o infectada es una celula eucariota, preferentemente una celula de insecto, como por ejemplo Sf21, Hi5, Sf9 o Se301.Preferably, the cell of the present invention comprises one or several copies of the baculovirus genome, for obtaining recombinant bansides according to the present invention. In one aspect of the present invention, the transformed cell is Escherichia coli. For example, when the Bac-to-Bac® commercial baculovirus-based expression system is used, the cell used is DH10BacTM. In another aspect, the transduced, transfected or infected transformed cell is a eukaryotic cell, preferably an insect cell, such as Sf21, Hi5, Sf9 or Se301.
55
1010
15fifteen
20twenty
2525
3030
3535
La presente invention se refiere ademas a una celula que comprende un baculovirus segun la presente invencion. En otro aspecto, la invencion proporciona una celula transgenica que comprende, insertada en su genoma, al menos, una secuencia de acido nucleico o un casete de expresion proporcionados por la presente invencion. Por ejemplo, la celula transgenica de la presente invencion comprende, insertada en su genoma, al menos una secuencia de las secuencias representadas en SEQ ID NOs.: 1-2, SEQ ID NOs.: 4-8, SEQ ID NO.:10, SEQ ID NOs.: 12-15, SEQ ID NOs.: 17-20, SEQ ID NOs.: 22-25, SEQ ID NOs.: 27-30, SEQ ID NO.: 44, sus secuencias complementarias o una variante de cualquiera de las secuencias anteriores que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dichas secuencias. Por ejemplo, la celula transgenica de la presente invencion comprende, insertada en su genoma, la SEQ ID NO.: 1. Por ejemplo, la celula transgenica de la presente invencion comprende, insertada en su genoma, la SEQ ID NO.: 2. Por ejemplo, la celula transgenica de la presente invencion comprende, insertada en su genoma, la SEQ ID NO.: 5. Por ejemplo, la celula transgenica de la presente invencion comprende, insertada en su genoma, la SEQ ID NO.: 6. Por ejemplo, la celula transgenica de la presente invencion comprende la SEQ ID NO.: 12. Por ejemplo, la celula transgenica de la presente invencion comprende la SEQ ID NO.: 13. Por ejemplo, la celula transgenica de la presente invencion comprende la SEQ ID NO.: 14. Por ejemplo la celula transgenica de la presente invencion comprende la SEQ ID NO.: 18. Por ejemplo la celula transgenica de la presente invencion comprende la SEQ ID NO.: 23. Por ejemplo, la celula transgenica de la presente invencion comprende la SEQ ID NO.: 28. Por ejemplo, la celula transgenica de la presente invencion comprende la SEQ ID NO.: 29. Por ejemplo, la celula transgenica de la presente invencion comprende la SEQ ID NO.: 30. Por ejemplo, la celula transgenica de la presente invencion comprende la SEQ ID NO.: 44. En una realization particular dicha celula transgenica es una celula eucariota, preferentemente una celula animal, preferentemente una celula de insecto.The present invention further relates to a cell comprising a baculovirus according to the present invention. In another aspect, the invention provides a transgenic cell comprising, inserted in its genome, at least one nucleic acid sequence or an expression cassette provided by the present invention. For example, the transgenic cell of the present invention comprises, inserted into its genome, at least one sequence of the sequences depicted in SEQ ID NOs .: 1-2, SEQ ID NOs .: 4-8, SEQ ID NO.:10 , SEQ ID NOs .: 12-15, SEQ ID NOs .: 17-20, SEQ ID NOs .: 22-25, SEQ ID NOs .: 27-30, SEQ ID NO .: 44, their complementary sequences or a variant of any of the above sequences that have at least 70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequences. For example, the transgenic cell of the present invention comprises, inserted in its genome, SEQ ID NO .: 1. For example, the transgenic cell of the present invention comprises, inserted in its genome, SEQ ID NO .: 2. For example, the transgenic cell of the present invention comprises, inserted in its genome, SEQ ID NO .: 5. For example, the transgenic cell of the present invention comprises, inserted in its genome, SEQ ID NO .: 6. For example, the transgenic cell of the present invention comprises SEQ ID NO .: 12. For example, the transgenic cell of the present invention comprises SEQ ID NO .: 13. For example, the transgenic cell of the present invention comprises the SEQ ID NO .: 14. For example the transgenic cell of the present invention comprises SEQ ID NO .: 18. For example the transgenic cell of the present invention comprises SEQ ID NO .: 23. For example, the transgenic cell of The present invention comprises SEQ ID NO .: 28. For example, the Transgenic cell of the present invention comprises SEQ ID NO .: 29. For example, the transgenic cell of the present invention comprises SEQ ID NO .: 30. For example, the transgenic cell of the present invention comprises SEQ ID NO. : 44. In a particular embodiment said transgenic cell is a eukaryotic cell, preferably an animal cell, preferably an insect cell.
Cuando la celula es una celula de insecto, pertenece preferentemente a una lmea celular derivada de un insecto del genero Lepidoptera o Diptera. Mas preferentemente, se trata de una celula que deriva de alguna de las siguientes: Trichoplusia ni, Spodoptera frugiperda, Ascalapha odorata, Bombyx mori, Drosophila melanogaster, Stigmene acrea y Aedes aegypti. Aun mas preferentemente, la celula se selecciona de entre el grupo de celulas de insecto consistente en Hi-5TM, Sf9, Sf21, BTI-Tn5B-1, Tn368, ExpresSf+®, BTI-TnAo38, ATC- 10, Mimic™ Sf9, SfSWT-1, SfSWT-3, SfSWT-5, TriEx™, Se301y Schneider's Drosophila Line 2. Preferentemente, la celula de insecto es Hi-5™, Sf9, Sf21 o Se301. La celula de la presente invencion puede crecer en cultivos en monocapa o en suspension.When the cell is an insect cell, it preferably belongs to a cell line derived from an insect of the genus Lepidoptera or Diptera. More preferably, it is a cell derived from any of the following: Trichoplusia ni, Spodoptera frugiperda, Ascalapha odorata, Bombyx mori, Drosophila melanogaster, Stigmene acrea and Aedes aegypti. Even more preferably, the cell is selected from the group of insect cells consisting of Hi-5TM, Sf9, Sf21, BTI-Tn5B-1, Tn368, ExpresSf + ®, BTI-TnAo38, ATC-10, Mimic ™ Sf9, SfSWT -1, SfSWT-3, SfSWT-5, TriEx ™, Se301 and Schneider's Drosophila Line 2. Preferably, the insect cell is Hi-5 ™, Sf9, Sf21 or Se301. The cell of the present invention can grow in monolayer or suspension cultures.
55
1010
15fifteen
20twenty
2525
3030
InsectosInsects
Ademas, la invention tambien proporciona un animal transgenico, particularmente un insecto o una larva de insecto que comprende una secuencia de acido nucleico o un casete de expresion, un vector o un bacmido segun la presente invencion. Por ejemplo, el insecto o larva de insecto de la presente invencion comprende al menos una secuencia de las secuencias representadas en SEQ ID NOs.: 1-2, SEQ ID NOs.: 4-8, SEQ ID NO.:10, SEQ ID NOs.: 12-15, SEQ ID NOs.: 17-20, SEQ ID NOs.: 22-25, SEQ ID NOs.: 27-30, SEQ ID NO.: 44, sus secuencias complementarias o una variante de cualquiera de las secuencias anteriores que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dichas secuencias. Por ejemplo, el insecto o larva de insecto de la presente invencion comprende la SEQ ID NO.: 1. Por ejemplo, el insecto o larva de insecto de la presente invencion comprende la SEQ ID NO.: 2. Por ejemplo, el insecto o larva de insecto de la presente invencion comprende la SEQ ID NO.: 5. Por ejemplo, el insecto o larva de insecto de la presente invencion comprende la SEQ ID NO.: 6. Por ejemplo, el insecto o larva de insecto de la presente invencion comprende la SEQ ID NO.: 12. Por ejemplo, el insecto o larva de insecto de la presente invencion comprende la SEQ ID NO.: 13. Por ejemplo, el insecto o larva de insecto de la presente invencion comprende la SEQ ID NO.: 14. Por ejemplo, el insecto o larva de insecto de la presente invencion comprende la SEQ ID NO.: 18. Por ejemplo el insecto o larva de insecto de la presente invencion comprende la SEQ ID NO.: 23. Por ejemplo el insecto o larva de insecto de la presente invencion comprende la SEQ ID NO.: 28. Por ejemplo el insecto o larva de insecto de la presente invencion comprende la SEQ ID NO.: 29. Por ejemplo, el insecto o larva de insecto de la presente invencion comprende la SEQ ID NO.: 30. Por ejemplo, el insecto o larva de insecto de la presente invencion comprende la SEQ ID NO.: 44. Preferentemente, el insecto o larva de insecto es capaz de expresar y/o expresa la protema recombinante de interes. Por lo tanto, la presente invencion se refiere ademas al uso del insecto o larva de insecto de la presente invencion para la production de protemas recombinantes.In addition, the invention also provides a transgenic animal, particularly an insect or an insect larva comprising a nucleic acid sequence or an expression cassette, a vector or a band according to the present invention. For example, the insect or insect larva of the present invention comprises at least one sequence of the sequences depicted in SEQ ID NOs .: 1-2, SEQ ID NOs .: 4-8, SEQ ID NO.:10, SEQ ID NOs .: 12-15, SEQ ID NOs .: 17-20, SEQ ID NOs .: 22-25, SEQ ID NOs .: 27-30, SEQ ID NO .: 44, its complementary sequences or a variant of any of the previous sequences that have at least 70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with said sequences. For example, the insect or insect larva of the present invention comprises SEQ ID NO .: 1. For example, the insect or insect larva of the present invention comprises SEQ ID NO .: 2. For example, the insect or insect larva of the present invention comprises SEQ ID NO .: 5. For example, the insect or insect larva of the present invention comprises SEQ ID NO .: 6. For example, the insect or insect larva of the present invention comprises SEQ ID NO .: 12. For example, the insect or insect larva of the present invention comprises SEQ ID NO .: 13. For example, the insect or insect larva of the present invention comprises SEQ ID NO .: 14. For example, the insect or insect larva of the present invention comprises SEQ ID NO .: 18. For example the insect or insect larva of the present invention comprises SEQ ID NO .: 23. For example the insect or insect larva of the present invention comprises SEQ ID NO .: 28. For example the insect or larva of in sect of the present invention comprises SEQ ID NO .: 29. For example, the insect or insect larva of the present invention comprises SEQ ID NO .: 30. For example, the insect or insect larva of the present invention comprises SEQ ID NO .: 44. Preferably, the insect or insect larva is capable of expressing and / or expressing the recombinant protein of interest. Therefore, the present invention also relates to the use of the insect or insect larva of the present invention for the production of recombinant proteins.
En otra realization de la presente invencion, el insecto (o la larva) ha sido infectado, transfectado, transducido o transformado con la secuencia de acido nucleico, el casete de expresion, el vector de clonacion, el vector de transferencia, el bacmido o el baculovirus recombinante de la presente invencion. Por ejemplo, el insecto (o la larva) ha sido infectado, transfectado, transducido o transformado con al menos una secuencia de las secuencias representadas en SEQ ID NOs.: 1-2, SEQ ID NOs.: 4-8, SEQ ID NO.:10, SEQ ID NOs.: 12-15, SEQ ID NOs.: 17-20, SEQ ID NOs.: 22-25, SEQ ID NOs.: 27-30, SEQ ID NO.:In another embodiment of the present invention, the insect (or the larva) has been infected, transfected, transduced or transformed with the nucleic acid sequence, the expression cassette, the cloning vector, the transfer vector, the bacmid or the Recombinant baculovirus of the present invention. For example, the insect (or larva) has been infected, transfected, transduced or transformed with at least one sequence of the sequences represented in SEQ ID NOs .: 1-2, SEQ ID NOs .: 4-8, SEQ ID NO .: 10, SEQ ID NOs .: 12-15, SEQ ID NOs .: 17-20, SEQ ID NOs .: 22-25, SEQ ID NOs .: 27-30, SEQ ID NO .:
55
1010
15fifteen
20twenty
2525
3030
44, sus secuencias complementarias o una variante de cualquiera de las secuencias anteriores que posee al menos un 70%, o un 80%, o un 90%, o un 95%, o un 97%, o un 99%, de identidad con dichas secuencias. Por ejemplo, el insecto (o la larva) ha sido infectado, transfectado, transducido o transformado con la SEQ ID NO.: 1. Por ejemplo, el insecto (o la larva) ha sido infectado, transfectado, transducido o transformado con la SEQ ID NO.: 2. Por ejemplo, el insecto (o la larva) ha sido infectado, transfectado, transducido o transformado con la SEQ ID NO.: 5. Por ejemplo, el insecto (o la larva) ha sido infectado, transfectado, transducido o transformado con la SEQ ID NO.: 6. Por ejemplo, el insecto (o la larva) ha sido infectado, transfectado, transducido o transformado con la SEQ ID NO.: 12. Por ejemplo, el insecto (o la larva) ha sido infectado, transfectado, transducido o transformado con la SEQ ID NO.: 13. Por ejemplo, el insecto (o la larva) ha sido infectado, transfectado, transducido o transformado con la SEQ ID NO.: 14. Por ejemplo, el insecto (o la larva) ha sido infectado, transfectado, transducido o transformado con la SEQ ID NO.: 18. Por ejemplo, el insecto (o la larva) ha sido infectado, transfectado, transducido o transformado con la SEQ ID NO.: 23. Por ejemplo, el insecto (o la larva) ha sido infectado, transfectado, transducido o transformado con la SEQ ID NO.: 28. Por ejemplo, el insecto (o la larva) ha sido infectado, transfectado, transducido o transformado con la SEQ ID NO.: 29. Por ejemplo, el insecto (o la larva) ha sido infectado, transfectado, transducido o transformado con la SEQ ID NO.: 30. Por ejemplo, el insecto (o la larva) ha sido infectado, transfectado, transducido o transformado con la SEQ ID NO.: 44.44, its complementary sequences or a variant of any of the previous sequences that has at least 70%, or 80%, or 90%, or 95%, or 97%, or 99%, of identity with these sequences. For example, the insect (or larva) has been infected, transfected, transduced or transformed with SEQ ID NO .: 1. For example, the insect (or larva) has been infected, transfected, transduced or transformed with SEQ ID NO .: 2. For example, the insect (or larva) has been infected, transfected, transduced or transformed with SEQ ID NO .: 5. For example, the insect (or larva) has been infected, transfected, Transduced or transformed with SEQ ID NO .: 6. For example, the insect (or larva) has been infected, transfected, transduced or transformed with SEQ ID NO .: 12. For example, the insect (or larva) has been infected, transfected, transduced or transformed with SEQ ID NO .: 13. For example, the insect (or larva) has been infected, transfected, transduced or transformed with SEQ ID NO .: 14. For example, the insect (or larva) has been infected, transfected, transduced or transformed with SEQ ID NO .: 18. For example, the insect (or larva) has been infected, transfected, transduced or transformed with SEQ ID NO .: 23. For example, the insect (or larva) has been infected, transfected, transduced or transformed with SEQ ID NO .: 28. For example, the insect ( or the larva) has been infected, transfected, transduced or transformed with SEQ ID NO .: 29. For example, the insect (or the larva) has been infected, transfected, transduced or transformed with SEQ ID NO .: 30. For example, the insect (or the larva) has been infected, transfected, transduced or transformed with SEQ ID NO .: 44.
En una realizacion preferida de la presente invencion, el insecto o larva de insecto comprende un baculovirus segun la presente invencion. El baculovirus se puede administrar al insecto, o a la larva por via oral (per os) o mediante inyeccion tal y como se describe por ejemplo en (Hughes P.R and Wood H.A. (1996). In vivo production, stabilization and infectivity of Baculovirus preoccluded virions. Applied and Environmental Microbiology, 62: 105-108; per os; Perez-Filgueira DM, Gonzalez-Camacho F, Gallardo C, Resino-Talavan P, Blanco E, Gomez-Casado E, et al. Optimization and validation of recombinant serological tests for African Swine Fever diagnosis based on detection of the p30 protein produced in Trichoplusia ni larvae. J Clin Microbiol 2006;44(9):3114-21)).In a preferred embodiment of the present invention, the insect or insect larva comprises a baculovirus according to the present invention. The baculovirus can be administered to the insect, or to the larva orally (per os) or by injection as described for example in (Hughes PR and Wood HA (1996). In vivo production, stabilization and infectivity of Baculovirus preoccluded virions Applied and Environmental Microbiology, 62: 105-108; per os; Perez-Filgueira DM, Gonzalez-Camacho F, Gallardo C, Resino-Talavan P, Blanco E, Gomez-Casado E, et al. Optimization and validation of recombinant serological tests for African Swine Fever diagnosis based on detection of the p30 protein produced in Trichoplusia ni larvae. J Clin Microbiol 2006; 44 (9): 3114-21)).
Preferentemente, el insecto o larva de insecto es un insecto transgenico.Preferably, the insect or insect larva is a transgenic insect.
El insecto es preferentemente un lepidoptero y mas preferentemente un insecto seleccionado de entre: Trichoplusia ni, Spodoptera frugiperda, Spodoptera exigua, Ascalapha odorata, Bombix mori, Rachiplusia ni y Stigmene acrea. En una realizacion preferida, el insecto es una larva.The insect is preferably a lepidopter and more preferably an insect selected from: Trichoplusia ni, Spodoptera frugiperda, Spodoptera exigua, Ascalapha odorata, Bombix mori, Rachiplusia ni and Stigmene acrea. In a preferred embodiment, the insect is a larva.
55
1010
15fifteen
20twenty
2525
3030
Medio de cultivoCulture medium
Ademas, la presente invention proporciona un medio de cultivo que comprende una secuencia de acido nucleico, un casete de expresion, un vector de donation, un vector de transferencia, un bacmido, un baculovirus recombinante, una celula o un insecto (o larva) segun la presente invencion.In addition, the present invention provides a culture medium comprising a nucleic acid sequence, an expression cassette, a donation vector, a transfer vector, a bacmid, a recombinant baculovirus, a cell or an insect (or larva) according to The present invention.
Metodos para producir el producto de interesMethods to produce the product of interest
Cualquiera de las secuencias de la presente invencion pueden ser utilizadas para producir productos de interes. La invencion tambien proporciona un metodo para expresar un gen que codifica un producto de interes en un animal no humano, preferentemente en un insecto o larva y mas preferentemente en una larva de insecto. Por tanto, en otra realization particular, la invencion proporciona un metodo para producir un producto de interes que puede ser una protema recombinante, que comprende el uso de una secuencia de acido nucleico, un casete de expresion, un vector de clonacion, un vector de transferencia, un bacmido, un baculovirus recombinante, una celula o un insecto (o larva de insecto) segun la presente invencion, y la obtencion de la protema recombinante o producto de interes. En una realizacion particular, la presente invencion se relaciona con un metodo para producir una protema que comprende los pasos de:Any of the sequences of the present invention can be used to produce products of interest. The invention also provides a method for expressing a gene that encodes a product of interest in a non-human animal, preferably in an insect or larva and more preferably in an insect larva. Therefore, in another particular embodiment, the invention provides a method of producing a product of interest that may be a recombinant protein, comprising the use of a nucleic acid sequence, an expression cassette, a cloning vector, a vector of transfer, a bacmid, a recombinant baculovirus, a cell or an insect (or insect larva) according to the present invention, and the obtaining of the recombinant protein or product of interest. In a particular embodiment, the present invention relates to a method of producing a protein comprising the steps of:
a) infectar celulas de insecto con un baculovirus segun la presente invencion, o transfectarlas, transducirlas o transformarlas con el bacmido, o con el vector de clonacion o de transferencia, o con un casete de expresion segun la presente invencion;a) infecting insect cells with a baculovirus according to the present invention, or transfecting, transducing or transforming them with the bacmid, or with the cloning or transfer vector, or with an expression cassette according to the present invention;
b) expresar la protema;b) express the protein;
c) obtener dicha protema.c) obtain said protein.
Ademas, la presente invencion proporciona un metodo para producir una protema que comprende los pasos de:In addition, the present invention provides a method of producing a protein comprising the steps of:
a) infectar insectos o larvas de insecto con un baculovirus segun la presente invencion, o transfectarlas, transducirlas o transformarlas con el bacmido, o con el vector de clonacion o de transferencia, o con un casete de expresion segun la presente invencion;a) infecting insects or insect larvae with a baculovirus according to the present invention, or transfecting, transducing or transforming them with the bacmid, or with the cloning or transfer vector, or with an expression cassette according to the present invention;
b) expresar la protema;b) express the protein;
55
1010
15fifteen
20twenty
2525
c) obtener dicha protemac) obtain said protein
Los metodos descritos en la presente invention comprenden el uso de las celulas, insectos o larvas de insecto descritos en la presente invencion.The methods described in the present invention comprise the use of the insect cells, insects or larvae described in the present invention.
La transfection, transduction o transformation de celulas, mas preferentemente de celulas de insecto, puede realizarse por metodos convencionales. Para una revision de la transferencia genica a insectos, incluyendo vectores, metodos de transferencia de ADN, etc., vease, por ejemplo, Tomita, M. et al., Nature Biotechnology 2003, 21:53-56 o Perez- Filgueira, M et al., Virology 2007, 364:422-443.The transfection, transduction or transformation of cells, more preferably of insect cells, can be carried out by conventional methods. For a review of the genetic transfer to insects, including vectors, DNA transfer methods, etc., see, for example, Tomita, M. et al., Nature Biotechnology 2003, 21: 53-56 or Perez-Filgueira, M et al., Virology 2007, 364: 422-443.
Las condiciones para optimizar el cultivo de dichas celulas u organismos dependeran de la celula u organismo utilizado. Si se desea, los metodos para producir un producto de interes como por ejemplo una protema recombinante proporcionados por la presente invencion incluyen, ademas, el aislamiento y/o purification de dicho producto de interes.The conditions for optimizing the culture of said cells or organisms will depend on the cell or organism used. If desired, the methods for producing a product of interest such as a recombinant protein provided by the present invention also include isolation and / or purification of said product of interest.
En general, el producto de interes obtenible por el metodo de la presente invencion se encuentra en forma de peptido o protema, preferentemente protema. Por lo tanto, la presente invencion proporciona ademas una protema recombinante obtenible mediante los metodos de la presente invencion. En una realization particular, la protema obtenible mediante los metodos de la presente invencion es una protema recombinante para su uso en metodos de tratamiento, terapia o diagnostico. Por lo tanto la presente invencion se refiere al uso de la protema recombinante de la invencion en terapia o diagnostico.In general, the product of interest obtainable by the method of the present invention is in the form of a peptide or protein, preferably protein. Therefore, the present invention also provides a recombinant protein obtainable by the methods of the present invention. In a particular embodiment, the protein obtainable by the methods of the present invention is a recombinant protein for use in methods of treatment, therapy or diagnosis. Therefore the present invention relates to the use of the recombinant protein of the invention in therapy or diagnosis.
A modo de ejemplo, la protema obtenible por los metodos de la presente invencion puede ser una vacuna recombinante, una vacuna proteica, una protema terapeutica, un anticuerpo, una enzima, una citoquina, un factor de coagulation, un anticoagulante, un receptor, una hormona, una protema con valor diagnostico o protemas de partmulas similares a virus (VLP).By way of example, the protein obtainable by the methods of the present invention may be a recombinant vaccine, a protein vaccine, a therapeutic protein, an antibody, an enzyme, a cytokine, a coagulation factor, an anticoagulant, a receptor, a hormone, a protein with diagnostic value or proteins of virus-like particles (VLP).
La presente invencion se refiere ademas el uso de una secuencia de acido nucleico, un casete de expresion, un vector de donation, un vector de transferencia, un bacmido, un baculovirus recombinante, una celula, un insecto o una larva de insecto segun segun la presente invencion para la production de una protema.The present invention further relates to the use of a nucleic acid sequence, an expression cassette, a donation vector, a transfer vector, a bacmid, a recombinant baculovirus, a cell, an insect or an insect larva according to the present invention for the production of a protein.
LISTADO DE SECUENCIASSEQUENCE LIST
- SEQ ID NO.: SEQ ID NO .:
- Nombre: Name:
- 1 one
- Secuencia diferencial (aaaattaaatttttgctacaatata) Differential Sequence (aaaattaaatttttgctacaatata)
- 2 2
- Promotor pSeL (atcatgtgtttgaacggcgactgtttggcggtatgcaggagcgtcgctacctcgaccgacgaaccggcggccttttt ggattttgtcaaaaagaacgacgcagcgaaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaatt gttactggaccgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactt tgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatata) LMP promoter (atcatgtgtttgaacggcgactgtttggcggtatgcaggagcgtcgctacctcgaccgacgaaccggcggccttttt ggattttgtcaaaaagaacgacgcagcgaaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaatt gttactggaccgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactt tgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatata)
- 3 3
- Promotor pSeL A-D o pSeS (atcatgtgtttgaacggcgactgtttggcggtatgcaggagcgtcgctacctcgaccgacgaaccggcggccttttt ggattttgtcaaaaagaacgacgcagcgaaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaatt gttactggaccgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactt tgttgtccattgctgatgatttattaagtcttttggca) LMP promoter A-D or PSEs (atcatgtgtttgaacggcgactgtttggcggtatgcaggagcgtcgctacctcgaccgacgaaccggcggccttttt ggattttgtcaaaaagaacgacgcagcgaaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaatt gttactggaccgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactt tgttgtccattgctgatgatttattaagtcttttggca)
- 4 4
- Promotor pSeL-140 (cgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccat tgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatata) Promoter pSeL-140 (cgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccat tgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatata)
- 5 5
- Promotor pSeL-120 (gttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttg gcaaaaattaaatttttgctacaatata) Promoter pSeL-120 (gttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttg gcaaaaattaaatttttgctacaatata)
- 6 6
- Promotor pSeL-120-pph (gttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttg gcaaaaattaaatttttgctacaatataatcatggagataattaaaatgataaccatctcgcaaataaataagtatttta ctgttttcgtaacagttttgtaataaaaaaacctataaatattccggattattcataccgtcccaccatcgggcgcg) LMP-120-promoter pph (gttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttg gcaaaaattaaatttttgctacaatataatcatggagataattaaaatgataaccatctcgcaaataaataagtatttta ctgttttcgtaacagttttgtaataaaaaaacctataaatattccggattattcataccgtcccaccatcgggcgcg)
- 7 7
- Promotor Secuencia diferencial-pph (aaaattaaatttttgctacaatataatcatggagataattaaaatgataaccatctcgcaaataaataagtattttactg ttttcgtaacagttttgtaataaaaaaacctataaatattccggattattcataccgtcccaccatcgggcgcg) Differential Sequence Promoter-pph (aaaattaaatttttgctacaatataatcatggagataattaaaatgataaccatctcgcaaataaataagtattttactg ttttcgtaacagttttgtaataaaaaaacctataaatattccggattattcataccgtcccaccatcgggccccccccgc
- 8 8
- Promotor pSeL-pph (atcatgtgtttgaacggcgactgtttggcggtatgcaggagcgtcgctacctcgaccgacgaaccggcggccttttt ggattttgtcaaaaagaacgacgcagcgaaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaatt gttactggaccgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactt tgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatataatcatggagataattaaaatg ataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaaaaacctataaatattccggatta LMP-promoter pph (atcatgtgtttgaacggcgactgtttggcggtatgcaggagcgtcgctacctcgaccgacgaaccggcggccttttt ggattttgtcaaaaagaacgacgcagcgaaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaatt gttactggaccgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactt tgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatataatcatggagataattaaaatg ataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaaaaacctataaatattccggatta
- ttcataccgtcccaccatcgggcgcg) ttcataccgtcccaccatcgggcgcg)
- 9 9
- Promotor pSeL A-D-pph (atcatgtgtttgaacggcgactgtttggcggtatgcaggagcgtcgctacctcgaccgacgaaccggcggccttttt ggattttgtcaaaaagaacgacgcagcgaaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaatt gttactggaccgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactt tgttgtccattgctgatgatttattaagtcttttggcaatcatggagataattaaaatgataaccatctcgcaaataaata agtattttactgttttcgtaacagttttgtaataaaaaaacctataaatattccggattattcataccgtcccaccatcggg cgcg) LMP promoter A-D-pph (atcatgtgtttgaacggcgactgtttggcggtatgcaggagcgtcgctacctcgaccgacgaaccggcggccttttt ggattttgtcaaaaagaacgacgcagcgaaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaatt gttactggaccgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactt tgttgtccattgctgatgatttattaagtcttttggcaatcatggagataattaaaatgataaccatctcgcaaataaata agtattttactgttttcgtaacagttttgtaataaaaaaacctataaatattccggattattcataccgtcccaccatcggg CGCG)
- 10 10
- Promotor pSeL-140-pph (cgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccat tgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatataatcatggagataattaaaatgataaccat ctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaaaaacctataaatattccggattattcatacc gtcccaccatcgggcgcg) LMP-140-promoter pph (cgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccat tgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatataatcatggagataattaaaatgataaccat ctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaaaaacctataaatattccggattattcatacc gtcccaccatcgggcgcg)
- 11 eleven
- Promotor pph (atcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaa aaacctataaatattccggattattcataccgtcccaccatcgggcgcg) Promoter pph (atcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaa aaacctataaatattccggattattcataccgtcccaccatcgggcgcg)
- 12 12
- Promotor pSeL-pSeL (atcatgtgtttgaacggcgactgtttggcggtatgcaggagcgtcgctacctcgaccgacgaaccggcggccttttt ggattttgtcaaaaagaacgacgcagcgaaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaatt gttactggaccgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactt tgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatataatcatgtgtttgaacggcgac tgtttggcggtatgcaggagcgtcgctacctcgaccgacgaaccggcggcctttttggattttgtcaaaaagaacga cgcagcgaaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaattgttactggaccgaatgtacaat attgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttatt aagtcttttggcaaaaattaaatttttgctacaatata) LMP LMP-promoter (atcatgtgtttgaacggcgactgtttggcggtatgcaggagcgtcgctacctcgaccgacgaaccggcggccttttt ggattttgtcaaaaagaacgacgcagcgaaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaatt gttactggaccgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactt tgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatataatcatgtgtttgaacggcgac tgtttggcggtatgcaggagcgtcgctacctcgaccgacgaaccggcggcctttttggattttgtcaaaaagaacga cgcagcgaaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaattgttactggaccgaatgtacaat attgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttatt aagtcttttggcaaaaattaaatttttgctacaatata)
- 13 13
- Promotor pSeL-pSeL-pSeL (atcatgtgtttgaacggcgactgtttggcggtatgcaggagcgtcgctacctcgaccgacgaaccggcggccttttt ggattttgtcaaaaagaacgacgcagcgaaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaatt gttactggaccgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactt tgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatataatcatgtgtttgaacggcgac tgtttggcggtatgcaggagcgtcgctacctcgaccgacgaaccggcggcctttttggattttgtcaaaaagaacga cgcagcgaaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaattgttactggaccgaatgtacaat attgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttatt aagtcttttggcaaaaattaaatttttgctacaatataatcatgtgtttgaacggcgactgtttggcggtatgcaggagc gtcgctacctcgaccgacgaaccggcggcctttttggattttgtcaaaaagaacgacgcagcgaaaacgccaatg LMP LMP-promoter-LMP (atcatgtgtttgaacggcgactgtttggcggtatgcaggagcgtcgctacctcgaccgacgaaccggcggccttttt ggattttgtcaaaaagaacgacgcagcgaaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaatt gttactggaccgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactt tgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatataatcatgtgtttgaacggcgac tgtttggcggtatgcaggagcgtcgctacctcgaccgacgaaccggcggcctttttggattttgtcaaaaagaacga cgcagcgaaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaattgttactggaccgaatgtacaat attgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttatt aagtcttttggcaaaaattaaatttttgctacaatataatcatgtgtttgaacggcgactgtttggcggtatgcaggagc gtcgctacctcgaccgacgaaccggcggcctttttggattttgtcaaaaagaacgacgcagcgaaaacgccaatg
- ttgcaaattgtggaccggcacgaacacgttgaattgttactggaccgaatgtacaatattgttgaaatgttcaataatc aataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttggcaaaaattaa atttttgctacaatata) ttgcaaattgtggaccggcacgaacacgttgaattgttactggaccgaatgtacaatattgttgaaatgttcaataatc aataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttacatatt
- 14 14
- Promotor pph-Secuencia diferencial (atcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaa aaacctataaatattccggattattcataccgtcccaccatcgggcgcgaaaattaaatttttgctacaatata) Promoter pph-Differential sequence (atcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaa aaacctataaatattccggattattcataccgtcccaccatcgggcgcgaaaattaaattattttgctaca
- 15 fifteen
- Promotor pph-pSeL (atcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaa aaacctataaatattccggattattcataccgtcccaccatcgggcgcgatcatgtgtttgaacggcgactgtttggcg gtatgcaggagcgtcgctacctcgaccgacgaaccggcggcctttttggattttgtcaaaaagaacgacgcagcg aaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaattgttactggaccgaatgtacaatattgttga aatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtctttt ggcaaaaattaaatttttgctacaatata) Promoter pph-LMP (atcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaa aaacctataaatattccggattattcataccgtcccaccatcgggcgcgatcatgtgtttgaacggcgactgtttggcg gtatgcaggagcgtcgctacctcgaccgacgaaccggcggcctttttggattttgtcaaaaagaacgacgcagcg aaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaattgttactggaccgaatgtacaatattgttga aatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtctttt ggcaaaaattaaatttttgctacaatata)
- 16 16
- Promotor pph-pSeL A-D (atcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaa aaacctataaatattccggattattcataccgtcccaccatcgggcgcgatcatgtgtttgaacggcgactgtttggcg gtatgcaggagcgtcgctacctcgaccgacgaaccggcggcctttttggattttgtcaaaaagaacgacgcagcg aaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaattgttactggaccgaatgtacaatattgttga aatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtctttt ggca) Promoter pph-LMP A-D (atcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaa aaacctataaatattccggattattcataccgtcccaccatcgggcgcgatcatgtgtttgaacggcgactgtttggcg gtatgcaggagcgtcgctacctcgaccgacgaaccggcggcctttttggattttgtcaaaaagaacgacgcagcg aaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaattgttactggaccgaatgtacaatattgttga aatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtctttt GGCA)
- 17 17
- Promotor pph-pSeL-140 (atcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaa aaacctataaatattccggattattcataccgtcccaccatcgggcgcgcgaatgtacaatattgttgaaatgttcaat aatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttggcaaaaa ttaaatttttgctacaatata) Promoter pph-LMP-140 (atcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaa aaacctataaatattccggattattcataccgtcccaccatcgggcgcgcgaatgtacaatattgttgaaatgttcaat aatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttggcaaaaa ttaaatttttgctacaatata)
- 18 18
- Promotor pph-pSeL-120 (atcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaa aaacctataaatattccggattattcataccgtcccaccatcgggcgcggatccaaggccactagtgcggccgctct gcagtctcgaggttcaataatcaataaacctctctattatcctttgtaaattttttatttactttgttgtccattgctgatcattta ttaagtcttttggcaaaaattaaatttttgctacaatata) Promoter pph-LMP-120 (atcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaa gcagtctcgaggttcaataatcaataaacctctctattatcctttgtaaattttttatttactttgttgtccattgctgatcattta aaacctataaatattccggattattcataccgtcccaccatcgggcgcggatccaaggccactagtgcggccgctct ttaagtcttttggcaaaaattaaatttttgctacaatata)
- 19 19
- Promotor Secuencia diferencial-p10 (aaaattaaatttttgctacaatataatacggacctttaattcaacccaacacaatatattatagttaaataagaattatt atcaaatcatttgtatattaattaaaatactatactgtaaattacattttatttacaatcactcgac) Differential Sequence Promoter-p10 (aaaattaaatttttgctacaatataatacggacctttaattcaacccaacacaatatattatagttaaataagaattatt atcaaatcatttgtatattaattaaaatactatactgtaaattacattttatttacaatcactcgac)
- 20 twenty
- Promotor pSeL-p10 Promoter pSeL-p10
- (atcatgtgtttgaacggcgactgtttggcggtatgcaggagcgtcgctacctcgaccgacgaaccggcggccttttt ggattttgtcaaaaagaacgacgcagcgaaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaatt gttactggaccgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactt tgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatataatacggacctttaattcaacc caacacaatatattatagttaaataagaattattatcaaatcatttgtatattaattaaaatactatactgtaaattacatttt atttacaatcactcgac) (Atcatgtgtttgaacggcgactgtttggcggtatgcaggagcgtcgctacctcgaccgacgaaccggcggccttttt ggattttgtcaaaaagaacgacgcagcgaaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaatt gttactggaccgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactt tgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatataatacggacctttaattcaacc caacacaatatattatagttaaataagaattattatcaaatcatttgtatattaattaaaatactatactgtaaattacatttt atttacaatcactcgac)
- 21 twenty-one
- Promotor pSeL A-D-p10 (atcatgtgtttgaacggcgactgtttggcggtatgcaggagcgtcgctacctcgaccgacgaaccggcggccttttt ggattttgtcaaaaagaacgacgcagcgaaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaatt gttactggaccgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactt tgttgtccattgctgatgatttattaagtcttttggcaatacggacctttaattcaacccaacacaatatattatagttaaat aagaattattatcaaatcatttgtatattaattaaaatactatactgtaaattacattttatttacaatcactcgac) LMP promoter A-D-p10 (atcatgtgtttgaacggcgactgtttggcggtatgcaggagcgtcgctacctcgaccgacgaaccggcggccttttt ggattttgtcaaaaagaacgacgcagcgaaaacgccaatgttgcaaattgtggaccggcacgaacacgttgaatt gttactggaccgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactt tgttgtccattgctgatgatttattaagtcttttggcaatacggacctttaattcaacccaacacaatatattatagttaaat aagaattattatcaaatcatttgtatattaattaaaatactatactgtaaattacattttatttacaatcactcgac)
- 22 22
- Promotor pSeL-140-p10 (cgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccat tgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatataatacggacctttaattcaacccaacacaa tatattatagttaaataagaattattatcaaatcatttgtatattaattaaaatactatactgtaaattacattttatttacaatc actcgac) LMP-140 promoter-p10 (cgaatgtacaatattgttgaaatgttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccat tgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatataatacggacctttaattcaacccaacacaa tatattatagttaaataagaattattatcaaatcatttgtatattaattaaaatactatactgtaaattacattttatttacaatc actcgac)
- 23 2. 3
- Promotor pSeL-120-p10 (gttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttg gcaaaaattaaatttttgctacaatataatacggacctttaattcaacccaacacaatatattatagttaaataagaatt attatcaaatcatttgtatattaattaaaatactatactgtaaattacattttatttacaatcactcgac) LMP-120 promoter-p10 (gttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttg gcaaaaattaaatttttgctacaatataatacggacctttaattcaacccaacacaatatattatagttaaataagaatt attatcaaatcatttgtatattaattaaaatactatactgtaaattacattttatttacaatcactcgac)
- 24 24
- Promotor p10-Secuencia diferencial (atacggacctttaattcaacccaacacaatatattatagttaaataagaattattatcaaatcatttgtatattaattaaa atactatactgtaaattacattttatttacaatcactcgacaaaattaaatttttgctacaatata) Promoter p10-Differential sequence (atacggacctttaattcaacccaacacaatatattatagttaaataagaattattatcaaatcatttgtatattaattaaa atactatactgtaaattacattttatttacaatcactcgacaaaattaaatttttgctacaatata)
- 25 25
- Promotor p10-pSeL (atacggacctttaattcaacccaacacaatatattatagttaaataagaattattatcaaatcatttgtatattaattaaa atactatactgtaaattacattttatttacaatcactcgacatcatgtgtttgaacggcgactgtttggcggtatgcagga gcgtcgctacctcgaccgacgaaccggcggcctttttggattttgtcaaaaagaacgacgcagcgaaaacgccaa tgttgcaaattgtggaccggcacgaacacgttgaattgttactggaccgaatgtacaatattgttgaaatgttcaataat caataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttggcaaaaatta aatttttgctacaatata) P10 promoter-LMP (atacggacctttaattcaacccaacacaatatattatagttaaataagaattattatcaaatcatttgtatattaattaaa gcgtcgctacctcgaccgacgaaccggcggcctttttggattttgtcaaaaagaacgacgcagcgaaaacgccaa atactatactgtaaattacattttatttacaatcactcgacatcatgtgtttgaacggcgactgtttggcggtatgcagga tgttgcaaattgtggaccggcacgaacacgttgaattgttactggaccgaatgtacaatattgttgaaatgttcaataat caataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttggcaaaaatta aatttttgctacaatata)
- 26 26
- Promotor p10-pSeL A-D (atacggacctttaattcaacccaacacaatatattatagttaaataagaattattatcaaatcatttgtatattaattaaa atactatactgtaaattacattttatttacaatcactcgacatcatgtgtttgaacggcgactgtttggcggtatgcagga gcgtcgctacctcgaccgacgaaccggcggcctttttggattttgtcaaaaagaacgacgcagcgaaaacgccaa P10 promoter-LMP A-D (atactatactgtaaattacattttatttacaatcactcgacatcatgtgtttgaacggcgactgtttggcggtatgcagga atacggacctttaattcaacccaacacaatatattatagttaaataagaattattatcaaatcatttgtatattaattaaa gcgtcgctacctcgaccgacgaaccggcggcctttttggattttgtcaaaaagaacgacgcagcgaaaacgccaa
- tgttgcaaattgtggaccggcacgaacacgttgaattgttactggaccgaatgtacaatattgttgaaatgttcaataat caataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttggca) tgttgcaaattgtggaccggcacgaacacgttgaattgttactggaccgaatgtacaatattgttgaaatgttcaataat caataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttggca)
- 27 27
- Promotor p10-pSeL-140 (atacggacctttaattcaacccaacacaatatattatagttaaataagaattattatcaaatcatttgtatattaattaaa atactatactgtaaattacattttatttacaatcactcgaccgaatgtacaatattgttgaaatgttcaataatcaataaac ctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgct acaatata) P10 promoter-LMP-140 (atacggacctttaattcaacccaacacaatatattatagttaaataagaattattatcaaatcatttgtatattaattaaa atactatactgtaaattacattttatttacaatcactcgaccgaatgtacaatattgttgaaatgttcaataatcaataaac ctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgct acaatata)
- 28 28
- Promotor p10-pSeL-120 (atacggacctttaattcaacccaacacaatatattatagttaaataagaattattatcaaatcatttgtatattaattaaa atactatactgtaaattacattttatttacaatcactcgacgttcaataatcaataaacctctctattatgctttgtaaatttttt atttactttgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatata) P10 promoter-LMP-120 (atacggacctttaattcaacccaacacaatatattatagttaaataagaattattatcaaatcatttgtatattaattaaa atactatactgtaaattacattttatttacaatcactcgacgttcaataatcaataaacctctctattatgctttgtaaatttttt atttactttgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatata)
- 29 29
- Promotor pSeL-120-pSeL-120 (gttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttg gcaaaaattaaatttttgctacaatatagttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgt ccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatata) Promoter LMP-120-LMP-120 (gttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttg gcaaaaattaaatttttgctacaatatagttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgt ccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatata)
- 30 30
- Promotor pSeL- 120-pSeL- 120-pSeL-120 (gttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttg gcaaaaattaaatttttgctacaatatagttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgt ccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatatagttcaataatcaataaacctctctatt atgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatata ) Promoter pSeL- 120-pSeL- 120-LMP-120 (gttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttg gcaaaaattaaatttttgctacaatatagttcaataatcaataaacctctctattatgctttgtaaattttttatttactttgttgt ccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatatagttcaataatcaataaacctctctatt atgctttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatata)
- 31 31
- Promotor p10 (atacggacctttaattcaacccaacacaatatattatagttaaataagaattattatcaaatcatttgtatattaattaaa atactatactgtaaattacattttatttacaatcactcgac) Promoter p10 (atacggacctttaattcaacccaacacaatatattatagttaaataagaattattatcaaatcatttgtatattaattaaa atactatactgtaaattacattttatttacaatcactcgac)
- 32 32
- Cebador pSeLF (ggatccgtatacatcatgtgtttgaacggcgactg) PSeLF primer (ggatccgtatacatcatgtgtttgaacggcgactg)
- 33 33
- Cebador pSeLR (gactagtatattgtagcaaaaatttaatttttgccaaaag) PSeLR primer (gactagtatattgtagcaaaaatttaatttttgccaaaag)
- 34 3. 4
- Cebador pSeS (ggatccgtatacatcatgtgtttgaacggcgactg) PSeS primer (ggatccgtatacatcatgtgtttgaacggcgactg)
- 35 35
- Cebador pSeSR (gactagtgccaaaagacttaataaatcatcagc) PSeSR primer (gactagtgccaaaagacttaataaatcatcagc)
- 36 36
- Cebador pSeL-140F (tagtataccgaatgtacaatattgttg) Primer pSeL-140F (tagtataccgaatgtacaatattgttg)
- 37 37
- Cebador pSeL-140R (ctgggtgtagcgtcgtaagc) Primer pSeL-140R (ctgggtgtagcgtcgtaagc)
- 38 38
- Cebador pSeL-120F (tagtatacgttcaataatcaataaacctctc) Primer pSeL-120F (tagtatacgttcaataatcaataaacctctc)
- 39 39
- Cebador pSeL-120R (ctgggtgtagcgtcgtaagc) Primer pSeL-120R (ctgggtgtagcgtcgtaagc)
- 40 40
- Cebador pph-pSeLF (atctcgaggttcaataatcaataaacctctctattatcctttgtaaattttttatttactttgttgtccattgctgatcat) Primer pph-pSeLF (atctcgaggttcaataatcaataaacctctctattatcctttgtaaattttttatttactttgttgtccattgctgatcat)
- 41 41
- Cebador pph-pSeLR (ctgggtgtagcgtcgtaagc) Pph-pSeLR primer (ctgggtgtagcgtcgtaagc)
- 42 42
- Secuencia del sitio multiclonaje (PL) (GGATCCaaggccactagtgcggccgctctgcagtctcgagcatgcggtaccaagcttGAATTC) Multi-cloning site sequence (PL) (GGATCCaaggccactagtgcggccgctctgcagtctcgagcatgcggtaccaagcttGAATTC)
- 43 43
- eGFP (enhanced GFP) (atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacg gccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgc accaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgc taccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccat cttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgc atcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaaca gccacaacgtctatatcatggccgacaagcagaagaacggcatcatggtgaacttcaagatccgccacaacatc gaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctg cccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtc ctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa) eGFP (enhanced GFP) (atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacg gccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgc accaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgc taccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccat cttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgc atcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaaca gccacaacgtctatatcatggccgacaagcagaagaacggcatcatggtgaacttcaagatccgccacaacatc gaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctg cccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtc ctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa)
- 44 44
- Promotor pph-pSeL-120 teorico (atcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaa aaacctataaatattccggattattcataccgtcccaccatcgggcgcggttcaataatcaataaacctctctattatgc tttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatata) Promoter pph-LMP-120 theoretical (atcatggagataattaaaatgataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaataaaa aaacctataaatattccggattattcataccgtcccaccatcgggcgcggttcaataatcaataaacctctctattatgc tttgtaaattttttatttactttgttgtccattgctgatgatttattaagtcttttggcaaaaattaaatttttgctacaatata)
F = forwardF = forward
pp
R = reverseR = reverse
55
1010
15fifteen
20twenty
2525
3030
EjemplosExamples
Ejemplo 1. Materiales y metodos Clonacion de GFP bajo los distintos promotoresExample 1. Materials and methods Cloning of GFP under the different promoters
En el vector pFB-PL-GFP (pph-GFP), el gen que codifica para la protema GFP (SEQ ID NO.: 43) fue clonado bajo el control del promotor de poliedrina (pph, SEQ ID NO.: 11),. Este vector (pFB-PL-GFP (pph-GFP)) es un derivado del pFasTBacl que expresa la protema GFP, y sobre el que se inserto, aguas arriba de la GFP, un sitio de multi-clonaje (PL). La secuencia del sitio multiclonaje (PL) esIn the vector pFB-PL-GFP (pph-GFP), the gene encoding the GFP protein (SEQ ID NO .: 43) was cloned under the control of the polyhedrin promoter (pph, SEQ ID NO .: 11), . This vector (pFB-PL-GFP (pph-GFP)) is a derivative of the pFasTBacl that expresses the GFP protein, and on which a multi-cloning site (PL) is inserted upstream of the GFP. The sequence of the multi-cloning site (PL) is
GGATCCaaggccactagtgcggccgctctgcagtctcgagcatgcggtaccaagcttGAATTC (SEQ ID NO.: 42). El fragmento de ADN correspondiente a los promotores pSeL y pSeS se obtuvo mediante amplificacion por PCR usando como molde ADN del genoma de SeMNPV y cebadores espedficos que incorporaban sitios de restriccion para los enzimas BstZ17I y Spel (cebadores, SEQ ID NOs.: 32, 33, 34, 35). Despues el promotor de poliedrina en pph- GFP fue sustituido por los promotores pSeL y pSeS empleando los sitios de restriccion BstZ17I y Spel (New England biolabs, Ipswich, EUA) y generando los vectores pSeL-GFP y pSeS-GFP.GGATCCaaggccactagtgcggccgctctgcagtctcgagcatgcggtaccaagcttGAATTC (SEQ ID NO .: 42). The DNA fragment corresponding to the pSeL and pSeS promoters was obtained by PCR amplification using as a template SeMNPV genome DNA and specific primers incorporating restriction sites for the BstZ17I and Spel enzymes (primers, SEQ ID NOs .: 32, 33 , 34, 35). Then the polyhedrin promoter in pph-GFP was replaced by the pSeL and pSeS promoters using the BstZ17I and Spel restriction sites (New England biolabs, Ipswich, USA) and generating the pSeL-GFP and pSeS-GFP vectors.
A partir del vector pSeL-GFP, se amplificaron mediante PCR el fragmento pSeL140 y pSeL120. Para ello se emplearon 2 cebadores espedficos, uno incluyendo la region 5’ correspondiente asi como un sitio de restriccion para BstZ17I (cebadores, SEQ ID NOs.: 36, 38) y un segundo cebador que fue disenado para amplificar la region 3’ de gen GFP la cual conteda un sitio de restriccion AvrII (cebadores, SEQ ID NOs.: 37, 39). El vector pphGFP fue digerido con los enzimas BstZ17I y AvrII a 37°C durante 3 horas, liberando el fragmento conteniendo el pph-GFP el cual fue reemplazado por los fragmentos generados previamente para pSeL140 (SEQ ID NO.: 4) y pSeL120 (SEQ ID NO.: 5) y dando lugar a los vectores pSeL140-GFP y pSeL120-GFP, respectivamente.From the pSeL-GFP vector, the pSeL140 and pSeL120 fragment were amplified by PCR. For this, 2 specific primers were used, one including the corresponding 5 'region as well as a restriction site for BstZ17I (primers, SEQ ID NOs .: 36, 38) and a second primer that was designed to amplify the 3' gene region GFP which contains an AvrII restriction site (primers, SEQ ID NOs .: 37, 39). The pphGFP vector was digested with the BstZ17I and AvrII enzymes at 37 ° C for 3 hours, releasing the fragment containing the pph-GFP which was replaced by the previously generated fragments for pSeL140 (SEQ ID NO .: 4) and pSeL120 (SEQ ID NO .: 5) and giving rise to the vectors pSeL140-GFP and pSeL120-GFP, respectively.
Para la generacion de la construccion conteniendo el pph y el pSeL120 (SEQ ID NOs.: 11 y SEQ ID NO.: 5, respectivamente) en tandem (pph-pSeL-120-GFP) el fragmento pSeL-120 (SEQ ID NO.: 5) fue amplificado mediante PCR con cebadores espedficos que contedan los sitios de restriccion XhoI y AvrII (secuencias de los cebadores: SEQ ID NOs.: 40, 41). Dicho fragmento se clono en el plasmido pph-GFP abierto con dichos enzimas de restriccion. El plasmido resultante se nombro como pph-pSeL-120-GFP.For the generation of the construction containing the pph and the pSeL120 (SEQ ID NOs .: 11 and SEQ ID NO .: 5, respectively) in tandem (pph-pSeL-120-GFP) the fragment pSeL-120 (SEQ ID NO. : 5) was amplified by PCR with specific primers containing restriction sites XhoI and AvrII (primer sequences: SEQ ID NOs .: 40, 41). Said fragment was cloned into the open pph-GFP plasmid with said restriction enzymes. The resulting plasmid was named as pph-pSeL-120-GFP.
55
1010
15fifteen
20twenty
2525
3030
Generation de los baculovirus recombinantesGeneration of recombinant baculoviruses
Los baculovirus recombinantes se generaron empleando el sistema de expresion en baculovirus Bac-to-Bac® (Invitrogen, USA) siguiendo las instrucciones del fabricante. Los plasmidos resultantes del paso previo se usaron para transformar celulas de E. coli DH10Bac™ para la transposition en el genoma viral y generacion de los bacmidos recombinantes. El ADN de cada uno de los bacmidos recombinantes obtenidos se purifico siguiendo el protocolo descrito en el manual Bac-to-Bac® (Invitrogen™), y se empleo para transfectar celulas de Spodoptera frugiperda, Sf21 empleando Cellfectin® II Reagent (Invitrogen™) como reactivo de transfection, siguiendo las instrucciones del fabricante. Los virus generados se recogieron tras 3 dias de incubation a 27°C. Los virus resultantes de la transfeccion se amplificaron, infectando de nuevo celulas Sf21 para poder obtener asi un stock viral.Recombinant baculoviruses were generated using the Bac-to-Bac® baculovirus expression system (Invitrogen, USA) following the manufacturer's instructions. Plasmids resulting from the previous step were used to transform E. coli DH10Bac ™ cells for transposition in the viral genome and generation of recombinant bacmids. The DNA of each of the recombinant bacmids obtained was purified following the protocol described in the Bac-to-Bac® (Invitrogen ™) manual, and was used to transfect Spodoptera frugiperda, Sf21 cells using Cellfectin® II Reagent (Invitrogen ™) as a transfection reagent, following the manufacturer's instructions. The generated viruses were collected after 3 days of incubation at 27 ° C. The viruses resulting from the transfection were amplified, again infecting Sf21 cells in order to obtain a viral stock.
Las lmeas celulares de insecto se crecieron en Grace’s Insect Medium (1X) (Gibco®, Life technologies™) suplementado con FBS (suero bovino fetal) 10%. Los diferentes stocks de virus generados se cuantificaron mediante PCR cuantitativa (qPCR) empleando cebadores espedficos para la ADN polimerasa viral.Insect cell lines were grown in Grace’s Insect Medium (1X) (Gibco®, Life technologies ™) supplemented with 10% FBS (fetal bovine serum). The different virus stocks generated were quantified by quantitative PCR (qPCR) using primers specific for viral DNA polymerase.
Ensayos de infection en celulas de insectoInfection tests in insect cells
Para los ensayos de infeccion con baculovirus se emplearon tres tipos de celulas de insecto diferentes: S. exigua, Se301; S. frugiperda, Sf21; y Trichoplusia ni, Hi5. Aproximadamente 2x105 celulas (70% de confluencia) se infectaron con cada uno de los virus a una multiplicidad de infeccion (MOI) 5, anadiendo la solution de virus directamente sobre el medio de cultivo de las celulas, y a los distintos tiempos post infeccion, las celulas se recogieron mediante centrifugation a 3000 rpm durante 5 minutos y la actividad promotora se determino mediante la cuantificacion de su fluorescencia.Three different types of insect cells were used for baculovirus infection tests: S. exigua, Se301; S. frugiperda, Sf21; and Trichoplusia ni, Hi5. Approximately 2x105 cells (70% confluence) were infected with each virus at a multiplicity of infection (MOI) 5, adding the virus solution directly on the cell culture medium, and at different times post infection, the Cells were collected by centrifugation at 3000 rpm for 5 minutes and the promoter activity was determined by quantifying their fluorescence.
Ensayos fluorescenciaFluorescence assays
Las celulas obtenidas en los pasos previos se lisaron empleando un tampon de lisis (50 mM Tris-HCl pH 7.5, 100 mM NaCl, 1 mM DTT, 5% glicerol) y se midio la fluorescencia emitida por el gen reportero GFP a 535 nm tras haber sido excitado a 485 nm. Cada valor se obtuvo haciendo 4-5 medidas para cada muestra. El porcentaje de intensidad de fluorescencia GFP esta directamente relacionado con los niveles de expresion de GFP (se entiende que se trabaja a concentraciones mas bajas que la concentration de saturation, lo cual seThe cells obtained in the previous steps were lysed using a lysis buffer (50 mM Tris-HCl pH 7.5, 100 mM NaCl, 1 mM DTT, 5% glycerol) and the fluorescence emitted by the GFP reporter gene was measured at 535 nm after having been excited at 485 nm. Each value was obtained by making 4-5 measurements for each sample. The percentage of GFP fluorescence intensity is directly related to the GFP expression levels (it is understood that it works at lower concentrations than the saturation concentration, which is
55
1010
15fifteen
20twenty
2525
3030
confirma para cada medida). Los valores que se muestran son el promedio resultante de al menos dos ensayos independientes.confirm for each measurement). The values shown are the average resulting from at least two independent trials.
Ensayos de infection en insectoInsect infection tests
Se usaron larvas en el quinto estadio larvario (el ultimo antes de la pupation) del lepidoptero Trichoplusia ni (T. ni) para todos los ensayos con insectos. Se inocularon con 5 ^l de los baculovirus recombinantes conteniendo 50,000 BVs y se recolectaron a las 72 hpi (horas post infeccion). Estas larvas se mantuvieron a -20°C hasta su uso. La extracion de las protemas solubles en condiciones nativas se hizo homogenizando las larvas en un tampon de extraction compuesto por: PBS 1x, 0.01% de Triton X-100, 1mM de PMSF y DTT 25 mM. Para su procesado se uso un triturador del tipo Bag Mixer® blender (Interscience™, France). Los homogenizados se centrifugaron 30 minutos a 1800 g y a 4 °C. Se descarto el sedimento y la fraction soluble, filtrada con miracloth (Calbiochem), (20 ^g/pocillo) se analizo por fluorimetria, del mismo modo que se describe el apartado anterior. Cada valor se obtuvo midiendo cada muestra 4-5 veces. Los valores que se muestran son el promedio resultante de al menos dos ensayos independientes.Larvae were used in the fifth larval stage (the last before pupation) of the Trichoplusia ni (T. ni) lepidopter for all insect tests. They were inoculated with 5 µl of the recombinant baculoviruses containing 50,000 BVs and collected at 72 hpi (post infection hours). These larvae were kept at -20 ° C until use. The extraction of soluble proteins under native conditions was done by homogenizing the larvae in an extraction buffer composed of: 1x PBS, 0.01% Triton X-100, 1mM PMSF and 25mM DTT. For its processing, a Bag Mixer® blender type shredder (Interscience ™, France) was used. The homogenates were centrifuged 30 minutes at 1800 g and at 4 ° C. The sediment was discarded and the soluble fraction, filtered with miracloth (Calbiochem), (20 ^ g / well) was analyzed by fluorimetry, in the same way as the previous section is described. Each value was obtained by measuring each sample 4-5 times. The values shown are the average resulting from at least two independent trials.
Ejemplo 2. Expresion de la protema GFP en celulas de insecto Sf21, Se301 y Hi5 bajo los promotores pph, pSeL y pSeS.Example 2. Expression of the GFP protein in Sf21, Se301 and Hi5 insect cells under the promoters pph, pSeL and pSeS.
Las celulas de insecto de S. exigua, Se301; S. frugiperda, Sf21; y Trichoplusia ni, Hi5 se infectaron con baculovirus recombinantes que incorporaban los siguientes casetes de expresion (Figura 3):S. exigua insect cells, Se301; S. frugiperda, Sf21; and Trichoplusia ni, Hi5 were infected with recombinant baculovirus incorporating the following expression cassettes (Figure 3):
- pph-GFP (pph en la Figura 1)- pph-GFP (pph in Figure 1)
- pSeL-GFP (pSeL en la Figura 1)- pSeL-GFP (pSeL in Figure 1)
- pSeS-GFP (pSeS en la Figura 1)- pSeS-GFP (pSeS in Figure 1)
Los resultados se observan en la Figura 1. La expresion de GFP en las lmeas celulares Sf21 (A), Se301 (B) y Hi5 (C) es superior cuando esta proteina se expresa bajo el promotor pSeL (SEQ ID NO.: 2) que cuando la proteina se expresa bajo el promotor pph (el “gold standard’ (modelo de referencia estandar, SEQ ID NO.: 11) hasta 72 horas despues de la infeccion. Ademas, la expresion de GFP en Hi5 es superior cuando la proteina se expresa bajo el promotor pSeL que cuando la proteina se expresa bajo el promotor pph incluso despues de 72 horas tras la infeccion. Estos resultados muestran la idoneidad de este promotor (pSeL) para la expresion de protemas recombinantes en celulas de insecto. Ademas, la expresion de GFP bajo el promotor pSeS (SEQ ID NO.: 3) fue practicamenteThe results are shown in Figure 1. The expression of GFP in cell lines Sf21 (A), Se301 (B) and Hi5 (C) is superior when this protein is expressed under the pSeL promoter (SEQ ID NO .: 2) that when the protein is expressed under the promoter pph (the “gold standard '(standard reference model, SEQ ID NO .: 11) up to 72 hours after infection. In addition, the expression of GFP in Hi5 is higher when the protein it is expressed under the pSeL promoter that when the protein is expressed under the pph promoter even after 72 hours after infection, these results show the suitability of this promoter (pSeL) for the expression of recombinant proteins in insect cells. GFP expression under the pSeS promoter (SEQ ID NO .: 3) was practically
3939
55
1010
15fifteen
20twenty
2525
3030
nula tras la infeccion. Por lo tanto, la SEQ ID NO.: 1 es una secuencia esencial del promotor de la invencion (ver Figura 7).void after infection. Therefore, SEQ ID NO .: 1 is an essential sequence of the promoter of the invention (see Figure 7).
Ejemplo 3. Expresion de la protema GFP en celulas de insecto Sf21, Se301 y Hi5 bajo los promotores pph, pSeL, pSeL-140 y pSeL-120.Example 3. Expression of the GFP protein in Sf21, Se301 and Hi5 insect cells under the promoters pph, pSeL, pSeL-140 and pSeL-120.
Las celulas de insecto de S. exigua, Se301; S. frugiperda, Sf21; y Trichoplusia ni, Hi5 se infectaron con baculovirus recombinantes que incorporaban los siguientes casetes de expresion (Figura 3):S. exigua insect cells, Se301; S. frugiperda, Sf21; and Trichoplusia ni, Hi5 were infected with recombinant baculovirus incorporating the following expression cassettes (Figure 3):
- pph-GFP (pph en la Figura 2)- pph-GFP (pph in Figure 2)
- pSeL-GFP (pSeL en la Figura 2)- pSeL-GFP (pSeL in Figure 2)
- pSeL-140-GFP (pSeL-140 en la Figura 2)- pSeL-140-GFP (pSeL-140 in Figure 2)
- pSeL-120-GFP (pSeL-120 en la Figura 2)- pSeL-120-GFP (pSeL-120 in Figure 2)
Los resultados se observan en la Figura 2. La expresion de GFP en las lmeas celulares Sf21 (A), Se301 (B) y Hi5 (C) es superior cuando esta proteina se expresa bajo el promotor pSeL-120. En la lmea celular Se301 los niveles de expresion de GFP bajo los promotores pSeL-120 (SEQ ID NO.: 5) y pSeL-140 (SEQ ID NO.: 4) son parecidos, y superiores a los niveles de expresion de GFP cuando esta proteina se expresa bajo el promotor pSeL (SEQ ID NO.: 2) o pph (SEQ ID NO.: 11). Por lo tanto, ambos promotores pSeL-120 y pSeL-140, y principalmente pSeL-120 permiten una elevada expresion de la proteina recombinante, bastante superior a la expresion bajo el promotor polihedrina (“gold standard’).The results are seen in Figure 2. The expression of GFP in cell lines Sf21 (A), Se301 (B) and Hi5 (C) is superior when this protein is expressed under the promoter pSeL-120. In the Se301 cell line, the GFP expression levels under the promoters pSeL-120 (SEQ ID NO .: 5) and pSeL-140 (SEQ ID NO .: 4) are similar, and higher than the GFP expression levels when This protein is expressed under the promoter pSeL (SEQ ID NO .: 2) or pph (SEQ ID NO .: 11). Therefore, both promoters pSeL-120 and pSeL-140, and mainly pSeL-120 allow a high expression of the recombinant protein, well above the expression under the polyhedrin promoter ("gold standard").
Ejemplo 4. Expresion de la proteina GFP en celulas de insecto Sf21, Se301 y Hi5 bajo los promotores pph, pSeL, pSeL-120 y pph-pSeL-120.Example 4. Expression of the GFP protein in Sf21, Se301 and Hi5 insect cells under the promoters pph, pSeL, pSeL-120 and pph-pSeL-120.
Las celulas de insecto de S. exigua, Se301, S. frugiperda, Sf21, y Trichoplusia ni, Hi5, se infectaron con baculovirus recombinantes que incorporaban los siguientes casetes de expresion (Figura 3):S. exigua insect cells, Se301, S. frugiperda, Sf21, and Trichoplusia ni, Hi5, were infected with recombinant baculovirus incorporating the following expression cassettes (Figure 3):
- pph-GFP (pph en la Figura 4)- pph-GFP (pph in Figure 4)
- pSeL-GFP (pSeL en la Figura 4)- pSeL-GFP (pSeL in Figure 4)
- pSeL-120-GFP (pSeL-120 en la Figura 4)- pSeL-120-GFP (pSeL-120 in Figure 4)
- pph-pSeL-120-GFP (pph/pSeL-120 en la Figura 4)- pph-pSeL-120-GFP (pph / pSeL-120 in Figure 4)
Los resultados se observan en la Figura 4. La expresion de GFP en las lmeas celulares Sf21 (A), Se301 (B) y Hi5 (C) es superior cuando esta proteina se expresa bajo el promotor pph-The results are seen in Figure 4. The expression of GFP in cell lines Sf21 (A), Se301 (B) and Hi5 (C) is superior when this protein is expressed under the pph- promoter
pSeL-120 (pph/pSeL-120 en la Figura 4, SEQ ID NO.:18) que cuando se expresa bajopSeL-120 (pph / pSeL-120 in Figure 4, SEQ ID NO.:18) that when expressed under
4040
cualquiera de los otros promotores (pSeL, SEQ ID NO.: 2 y pSeL-120, SEQ ID NO.: 5). Se observan los mayores niveles de expresion cuando el promotor de polihedrina (pph) y la secuencia pSeL-120 y se disponen en tandem (pph-pSeL-120, SEQ ID NO.:18). Por lo tanto, la expresion de protemas recombinantes en celulas de insecto es maxima cuando la 5 secuencia que codifica para dicha protema recombinante esta bajo el control del promotor pph-pSeL-120 (SEQ ID NO.:18).any of the other promoters (pSeL, SEQ ID NO .: 2 and pSeL-120, SEQ ID NO .: 5). The highest levels of expression are observed when the polyhedrin promoter (pph) and the pSeL-120 sequence are arranged in tandem (pph-pSeL-120, SEQ ID NO.:18). Therefore, the expression of recombinant proteins in insect cells is maximal when the sequence encoding said recombinant protein is under the control of the pph-pSeL-120 promoter (SEQ ID NO.:18).
Ejemplo 5. Expresion de la protema GFP en larvas de insecto de T. niExample 5. Expression of the GFP protein in insect larvae of T. ni
Larvas de T. ni en el quinto estadio larvario se inocularon con los baculovirus recombinantes y se recolectaron a las 72 hpi. La Figura 5 muestra la expresion de la proteina recombinante 10 GFP bajo los distintos promotores (distintos casetes de expresion):Larvae of T. nor in the fifth larval stage were inoculated with the recombinant baculovirus and collected at 72 hpi. Figure 5 shows the expression of the 10 GFP recombinant protein under the different promoters (different expression cassettes):
- pph-GFP (pph en la Figura 5)- pph-GFP (pph in Figure 5)
- pSeL-GFP (pSeL en la Figura 5)- pSeL-GFP (pSeL in Figure 5)
- pSeL-120-GFP (pSeL-120 en la Figura 5)- pSeL-120-GFP (pSeL-120 in Figure 5)
La Figura 5 demuestra la utilidad de los nuevos promotores (pSeL, SEQ ID NO.: 2 y pSeL- 15 120, SEQ ID NO.: 5) para la expresion de protemas recombinantes en larvas de insectoFigure 5 demonstrates the utility of the new promoters (pSeL, SEQ ID NO .: 2 and pSeL-15 120, SEQ ID NO .: 5) for the expression of recombinant proteins in insect larvae
Claims (25)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
ES201430914A ES2554561B1 (en) | 2014-06-16 | 2014-06-16 | New baculovirus-derived promoters with high activity in baculovirus-based expression systems |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
ES201430914A ES2554561B1 (en) | 2014-06-16 | 2014-06-16 | New baculovirus-derived promoters with high activity in baculovirus-based expression systems |
Publications (2)
Publication Number | Publication Date |
---|---|
ES2554561A1 ES2554561A1 (en) | 2015-12-21 |
ES2554561B1 true ES2554561B1 (en) | 2016-09-30 |
Family
ID=54846299
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
ES201430914A Expired - Fee Related ES2554561B1 (en) | 2014-06-16 | 2014-06-16 | New baculovirus-derived promoters with high activity in baculovirus-based expression systems |
Country Status (1)
Country | Link |
---|---|
ES (1) | ES2554561B1 (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2021236908A2 (en) | 2020-05-20 | 2021-11-25 | Biomarin Pharmaceutical Inc. | Use of regulatory proteins for the production of adeno-associated virus |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
PT2858489T (en) * | 2011-06-10 | 2016-12-14 | Alternative Gene Expression Sl | Recombinant dna elements for the expression of recombinant proteins in a host cell |
ES2612854T3 (en) * | 2012-06-12 | 2017-05-19 | Alternative Gene Expression, S.L. | Recombinant DNA elements for the expression of recombinant proteins in a host cell |
-
2014
- 2014-06-16 ES ES201430914A patent/ES2554561B1/en not_active Expired - Fee Related
Also Published As
Publication number | Publication date |
---|---|
ES2554561A1 (en) | 2015-12-21 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Van Oers et al. | Thirty years of baculovirus–insect cell protein expression: from dark horse to mainstream technology | |
US20200002683A1 (en) | Baculovirus-based production of biopharmaceuticals free of contaminating baculoviral virions | |
JP7266306B2 (en) | Expression of Recombinant Proteins in Trichoplusia ni Pupae | |
EP2858490B1 (en) | Recombinant dna elements for the expression of recombinant proteins in insects | |
EP2928290B1 (en) | Baculovirus system for expressing proteins forming virus-like particles | |
Possee et al. | Recent developments in the use of baculovirus expression vectors | |
Bleckmann et al. | Identification of essential genetic baculoviral elements for recombinant protein expression by transactivation in Sf21 insect cells | |
BRPI0823074A2 (en) | method for developing polynucleotide regulatory sequences, polynucleotide regulatory sequences, use of polynucleotide regulatory sequences, expression vector, transformed or transfected cells, transfected insect larvae, method for producing recombinant proteins, use of expression vector, and use of insect larvae | |
US9701983B2 (en) | Baculoviral DNA elements for the expression of recombinant proteins in a host insect | |
ES2554561B1 (en) | New baculovirus-derived promoters with high activity in baculovirus-based expression systems | |
WO2014086973A1 (en) | Enhanced production of the porcine circovirus capsid protein by a baculovirus vector expression system | |
Lai et al. | AcMNPV PKIP is associated with nucleocapsid of budded virions and involved in nucleocapsid assembly | |
Wang et al. | Bombyx mori nucleopolyhedrovirus protein Bm11 is involved in occlusion body production and occlusion-derived virus embedding | |
Guijarro-Pardo et al. | In vivo production of recombinant proteins using occluded recombinant AcMNPV-derived baculovirus vectors | |
TWI633186B (en) | Used to enhance the performance of proteins, calories, vectors and viruses | |
Shang | Polyhedrin gene expression on protein production and polyhedra | |
Jauhar | Characterization of Alternative Promoters to Stagger and Control Multiple Gene Expression and Protein Production in the Baculovirus-Insect Cell System | |
Li et al. | Expression, purification and activity determination of protein kinase D1 in baculovirus expression system |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
FG2A | Definitive protection |
Ref document number: 2554561 Country of ref document: ES Kind code of ref document: B1 Effective date: 20160930 |
|
FD2A | Announcement of lapse in spain |
Effective date: 20210929 |