WO2021236908A2 - Use of regulatory proteins for the production of adeno-associated virus - Google Patents

Abstract

The present disclosure provides method and host cell constructs for the production of infectious virions of adeno-associated virus (AAV) in host cells modified to include a nucleotide sequence encoding a regulatory protein and an expression control element operably linked to the nucleotide sequence. The host cells are transformed with recombinant polynucleotide constructs so that the cells produce AAV capsid proteins, large and small AAV Rep proteins, one or more regulatory protein proteins, and helper proteins. The disclosure further provides for the production and formulation of insect-cell-derived AAV into a pharmaceutical composition and the medical use of the composition to achieve gene-therapy.

Description

USE OF REGULATORY PROTEINS FOR THE PRODUCTION OF ADENO-

ASSOCIATED VIRUS

REFERENCE TO SEQUENCE LISTING

[0001] The Sequence Listing concurrently submitted herewith as a text file named "6439- 0120PW01_ST25.txt" created on May 19, 2021, and having a size of 122,240 bytes is herein incorporated by reference pursuant to 37 CE.R. § 1.52(e)(5).

FIELD OF THE INVENTION

[0002] The field of the disclosure relates, in general, to improving production of adeno- associated virus (AAV) vectors in host cells using regulatory proteins.

BACKGROUND

[0003] AAV is a small, replication-defective, non-enveloped animal virus that infects humans and some other primate species. Several features of AAV make this virus an attractive vehicle for delivery of therapeutic proteins by gene therapy, including, for example, that AAV is not known to cause human disease and induces a mild immune response, and that AAV can infect both dividing and quiescent cells without integrating into the host cell genome.

[0004] AAV includes a capsid that includes VP1, VP2, and VP3 proteins, which in the native viral genome are produced at the appropriate ratio by alternate splicing of the cap gene and alternate translation initiation at non- AUG start codons. The AAV Rep gene encodes proteins (Rep68, Rep78, Rep40, and Rep52) that are thought essential for regulating viral replication of the native virus in known host cells. An alternative open reading frame (ORF) in the Cap gene encodes the assembly activating protein (AAP), thought to promote capsid assembly, possibly by targeting VP proteins to the host cell nucleolus for capsid assembly. (Sonntag et al, Proc Natl Acad Sci USA 2010, 107(22): 10220-10225). According to Sonntag, AAP stimulates transport of unassembled VP proteins to the host cell nucleolus for capsid assembly and the nucleolus may provide factors used in the assembly process and proposes chaperones, nucleophosmin, and nucleolin as candidates for such factors.

[0005] The AAV viral genome is a single stranded deoxyribonucleic acid (DNA) of about 4.7 kb with two 145 nucleotide (nt) inverted terminal repeats (ITRs). The virus relies on cellular proteins for genome replication including polymerase. [0006] AAV has been successfully produced in mammalian cells lines such as HEK293 cells, and in insect cells using baculovirus. See Smith et al. Molecular Therapy (2009) 17 11, 1888— 1896 for a discussion of insect cell/baculovirus systems. For use in gene therapy, the Rep and Cap genes can be expressed in trans, thus increasing the size of heterologous genes that can be packaged into the AAV vector. A helper virus or helper virus gene products produced recombinantly by the host cell is generally used for AAV production. Adenovirus and Herpes simplex virus are typically used. Alternatively, helper factors are produced by host cell transgenes. Adenovirus helper factors include El A, E1B, E2A, E40RF6, and VA. In the case of HEK293 cells, the cells already have the El A/E lb gene so helper factors E2A, E40RF6 and VA ribonucleic acids (RNAs) are provided as transgenes. See, for example, U.S, Patent Application Publication No. US2014/0377224. AAV are known to exist in a variety of serotypes (e.g., AAV1-AAV13).

[0007] Vector production at laboratory scale requires the interaction of several biological inputs (e.g. plasmids, viral inoculum, auxiliary helper genes, and host cells) within a controlled cell culture environment (Aponte-Ubillus et al., 2018). This process is currently carried out using mammalian cells (e.g., HEK293 and BHK cells) or insect cells (e.g., Sf9) genetically modified to express AAV proteins. For example, Sf9 cells are routinely used for commercial production of recombinant proteins, vaccines, biologies or gene delivery vehicles such as recombinant adeno- associated virus (rAAV) vectors. Expression of the capsid proteins VPl, VP2, and VP3 leads to the formation of viral capsids in the nucleolus (Samulski and Muzyczka, 2014). The expression of the non- structural proteins Rep78/68 and Rep52/40 triggers rAAV DNA replication and encapsidation of the generated single-stranded sequence (Balakrishnan and Jayandharan, 2014). In mammalian cells, the expression of auxiliary adenovirus or herpesvirus proteins is necessary to complement rAAV production; the identified helper genes participate as trans-activating agents of AAV promoters, or modifiers of the host cell milieu (Geoffroy and Salvetti, 2005).

SUMMARY

[0008] In accordance with various embodiments, improved methods for producing infectious rAAV virions is disclosed. [0009] In various embodiments, methods for producing infectious rAAV are provided and comprise the step of culturing an insect host cell having one or more vectors for rAAV virion production. The insect host cell is modified to express at least one regulatory protein.

[0010] In one embodiment, the insect host cell is modified to express a regulatory protein and the expression of the regulatory protein increases rAAV virion production in the insect host cell relative to rAAV virion production in an insect host cell without the modification.

[0011] In one embodiment, the insect host cell is modified to express a regulatory protein and the expression of the regulatory protein increases the infectivity of rAAV virions relative to rAAV virions produced in an insect host cell without the modification when the rAAV virions infect cells under same or comparative conditions.

[0012] In one embodiment, the insect host cell is modified to express a regulatory protein and the expression of the regulatory protein increases or decreases incorporation of at least one of VP1, VP2, and VP3 proteins into capsids of rAAV virions relative to incorporation of at least one of VP1, VP2, and VP3 proteins into capsids of rAAV virions produced in an insect host cell without the modification.

[0013] In one embodiment, the insect host cell is modified to express a regulatory protein and the expression of the regulatory protein decreases production of rAAV capsids devoid of encapsulated vector genomes relative to production of rAAV capsids devoid of encapsulated vector genomes in an insect host cell without the modification.

[0014] In one embodiment, the insect host cell is modified to express a regulatory protein and the expression of the regulatory protein increases post translational modifications of at least one of VP1, VP2, VP3 proteins, or vector genomes that are incorporated into or within the capsids of rAAV virions relative to post translational modifications of at least one of VP1, VP2, VP3 proteins, or vector genomes incorporated into or within capsids of rAAV virions produced in an insect host cell without the modification. In another embodiment, expression of the regulatory protein increases post translational modifications of Rep proteins.

[0015] In one embodiment, the insect host cell is modified to express a regulatory protein and an insect host cell without the modification does not generate rAAV virions or generates an undetectable concentration of rAAV virions. In a refinement, the insect host cell without the modification does not generate capsids encoded by the one or more vectors for rAAV virion production or generates an undetectable concentration of capsids encoded by the one or more vectors for rAAV virion production.

[0016] The methods of various embodiments include preparing rAAV vector genomes and expressing Cap and Rep proteins in a host cell such that rAAV virions having a capsid and encapsidated vector genome are produced. The rAAV vector genomes are replicated from a nucleotide sequence and the Cap and Rep proteins are expressed from nucleotide sequences. The methods also include providing a baculovirus shuttle vector (e.g. bacmid) in a host cell to produce recombinant baculovirus (rBV) virions. The host cell is modified to include a nucleotide sequence encoding a regulatory protein and an expression control element operably linked to the nucleotide sequence. The regulatory protein is a recombinant protein from the host cell or homologue thereof or a recombinant protein from a virus. The expression control element controls expression of the regulatory protein such that the expression of the regulatory protein in the modified host cell during the production of rAAV virions is greater or lower than the expression of the regulatory protein in a host cell without the modification. The altered expression of the regulatory protein in modified host cell increases the production of rAAV virions.

[0017] In one embodiment, there is an insect cell infected with i) a first baculovirus including a nucleotide sequence encoding an rAAV vector genome, ii) a second baculovirus including nucleotide sequences encoding Cap and Rep proteins; and iii) a third baculovirus including a nucleotide sequence encoding a regulatory protein and an expression control element operably linked to the nucleotide sequence encoding the regulatory protein. The infected insect cell generates the rAAV vector genomes and expresses the Cap and Rep proteins to produce rAAV virions having a capsid and encapsidated vector genome. In a refinement, the first or second baculovirus includes the nucleotide sequence encoding the regulatory protein and the expression control element. In an alternative embodiment, the nucleotide sequence encoding the regulatory protein and the expression control element are integrated within the genome of the infected insect cell such that the regulatory protein is constitutively or inducibly expressed. [0018] In another embodiment, there is an insect cell transfected with a bacmid having a nucleotide sequence encoding the regulatory protein and an expression control element operably linked to the nucleotide sequence to generate a baculovirus.

[0019] In another embodiment, there is a fungal cell transformed with i) a first plasmid including an rAAV vector genome, ii) a second plasmid including nucleotide sequences encoding Cap and Rep proteins; and iii) a third plasmid including a nucleotide sequence encoding a regulatory protein and an expression control element operably linked to the nucleotide sequence encoding the regulatory protein. The transformed fungal cell generates the rAAV vector genome and expresses Cap and Rep proteins to produce rAAV virions having a capsid and encapsidated vector genome. In a refinement, the first or second plasmid includes the nucleotide sequence encoding the regulatory protein and the expression control element. In an alternative embodiment, the nucleotide sequence encoding the regulatory protein and the expression control element are integrated within the genome of the transformed fungal cell such that the regulatory protein is constitutively or inducibly expressed.

[0020] In various embodiments, methods for producing infectious rAAV are provided and comprise the step of culturing a mammalian host cell having one or more vectors for rAAV virion production. The mammalian host cell is modified to express at least one regulatory protein.

[0021] In one embodiment, the mammalian host cell is modified to express a regulatory protein selected from at least one of HSP40, HSP90, NUC, NSR1, TOP2, GEN1, and AAP5 and expression of the regulatory protein increases rAAV virion production in the mammalian host cell relative to rAAV virion production in a mammalian host cell without the modification.

[0022] In one embodiment, the mammalian host cell is modified to express a regulatory protein selected from at least one of HSP40, HSP90, NUC, NSR1, TOP2, GEN1, and AAP5 and the expression of the regulatory protein increases the infectivity of rAAV virions relative to rAAV virions produced in an mammalian host cell without the modification when the rAAV virions infect cells under same or comparative conditions.

[0023] In one embodiment, the mammalian host cell is modified to express a regulatory protein selected from at least one of HSP40, HSP90, NUC, NSR1, TOP2, GEN1, and AAP5 and the expression of the regulatory protein increases or decreases incorporation of at least one of VP1, VP2, and VP3 proteins into capsids of rAAV virions relative to incorporation of at least one of VP1, VP2, and VP3 proteins into capsids of rAAV virions produced in a mammalian host cell without the modification.

[0024] In one embodiment, the mammalian host cell is modified to express a regulatory protein selected from at least one of HSP40, HSP90, NUC, NSR1, TOP2, GEN1, and AAP5 and the expression of the regulatory protein decreases production of rAAV capsids devoid of encapsulated vector genomes relative to production of rAAV capsids devoid of encapsulated vector genomes in a mammalian host cell without the modification.

[0025] In one embodiment, the mammalian host cell is modified to express a regulatory protein selected from at least one of HSP40, HSP90, NUC, NSR1, TOP2, GEN1, and AAP5 and the expression of the regulatory protein alters post translational modifications of at least one of VPl, VP2, VP3 proteins, or vector genomes that are incorporated into or within the capsids of rAAV virions relative to post translational modifications of at least one of VPl, VP2, VP3 proteins, or vector genomes that are incorporated into the capsids of rAAV produced in an mammalian host cell without the modification. In another embodiment, expression of the regulatory protein alters post translational modifications of Rep proteins.

[0026] In one embodiment, the mammalian host cell is modified to express a regulatory protein selected from at least one of HSP40, HSP90, NUC, NSR1, TOP2, GEN1, and AAP5 and a mammalian host cell without the modification does not generate rAAV virions or generates an undetectable concentration of rAAV virions. In a refinement, a mammalian host cell without the modification does not generate capsids encoded by the one or more vectors for rAAV virion production or generates an undetectable concentration of capsids encoded by the one or more vectors for rAAV virion production.

[0027] In another embodiment, there is a mammalian cell transfected with i) a first plasmid including an rAAV vector genome, ii) a second plasmid including nucleotide sequences encoding Cap and Rep proteins; and iii) a third plasmid including a nucleotide sequence encoding a regulatory protein and an expression control element operably linked to the nucleotide sequence encoding the regulatory protein. The transfected mammalian cell replicates the rAAV vector genome and expresses the Cap and Rep proteins to produce AAV virions having a capsid and encapsidated vector genome. In a refinement, the first or second plasmid includes the nucleotide sequence encoding the regulatory protein and the expression control element. In an alternative embodiment, the nucleotide sequence encoding the regulatory protein and the expression control element are integrated within the genome of the transfected mammalian cell such that the regulatory protein is constitutively or inducibly expressed.

[0028] In one embodiment, there is a mammalian cell infected with i) a first virus including a nucleotide sequence encoding an rAAV vector genome, ii) a second virus including nucleotide sequences encoding Cap and Rep proteins; and iii) a third virus including a nucleotide sequence encoding a regulatory protein and an expression control element operably linked to the nucleotide sequence encoding the regulatory protein. The infected mammalian cell replicates the AAV vector genome and expresses the AAV Cap and Rep proteins to produce AAV virions having a capsid and encapsidated vector genome. In a refinement, the first or second virus includes the nucleotide sequence encoding the regulatory protein and the expression control element. In an alternative embodiment, the nucleotide sequence encoding the regulatory protein and the expression control element are integrated within the genome of the infected mammalian cell such that the regulatory protein is constitutively or inducibly expressed.

[0029] In another embodiment, there is a host cell modified to express a regulatory protein at a level such that the expression of the host protein in the modified host cell is greater or less than expression of the regulatory protein in a host cell without the modification. In a refinement, the modification of the host cell further includes providing inducible elements that allow for controlling expression for the regulatory protein to the level.

[0030] In the disclosed methods and host cells of different embodiments, the regulatory protein includes an amino acid sequence that is at least 85%, 90%, 95%, or 99% identical to any one of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, or 20, or an amino acid sequence of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, or 20, or an amino acid sequence encoded by a nucleotide sequence this is at least 85%, 90%, 95%, or 99% identical to any one of SEQ ID NO: 1, 3, 5, 7,

9, 11, 13, 15, 17, or 19, or an amino acid sequence encoded by a nucleotide sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, or 19. For example, a bacmid, viral genome, or plasmid includes a nucleotide sequence this is at least 85%, 90%, 95%, or 99% identical to any one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, or 19 or includes a nucleotide sequence of SEQ ID NO: 1, 3, 5,

7, 9, 11, 13, 15, 17, or 19. [0031] In the disclosed methods and host cells of different embodiments, the expression control element is a promoter including a nucleotide sequence that is that is at least 85%, 90%, 95%, or 99% identical to any one of SEQ ID NO: 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, or a nucleotide sequence of SEQ ID NO: 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30. For example, a bacmid, viral genome, or plasmid includes a nucleotide sequence this is at least 85%, 90%, 95%, or 99% identical to any one of SEQ ID NO: 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 or includes a nucleotide sequence of SEQ ID NO: 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30.

[0032] Exemplary insect host cells are insect cell lines derived from Spodoptera frugiperda , Aedes albopictus , Bombyxmori , Trichoplusia ni , Ascalapha odorata, Drosphila, Anophele ,

Culex , or Aedes. In addition, the insect host cell is Sf9, High Five, Se301, SeIZD2109, SeUCRl, Sf900+, Sf21, BTI-TN-5B1-4, MG-1, Tn368, HzAml, BM-N, Ha2302, Hz2E5, or Ao38. Exemplary mammalian host cells are mammalian cell lines derived from humans and include HEK293, HeLa, CHO, NS0, SP2/0, PER.C6, Vero, RD, BHK, HT 1080, A549, Cos-7, ARPE- 19, or MRC-5 cells. Exemplary fungal host cells are derived from a yeast host cell, such as a host cell of the species Saccharomyces cerevisiae , and includes strains such as YPH501, RSY12 or YRS5 CT.

[0033] In a more specific embodiment, the host cell has helper genes or expresses helper proteins encoded by helper genes. Examples of helper genes includes, optionally selected from genes expressing adenoviral helper genes, El, El A, E1B, E2A, E4, VA, or an immunophilin homologue, the immunophilin homologue optionally being Spodoptera frugiperda FKBP46, or human FKBP52.

[0034] The Cap proteins can be VP1 and VP3, or VP1, VP2, and VP3. The VP1, VP2 or VP3 genes can express capsid proteins of AAV serotypes AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV 12, AAV13, Bba21, Bba26, Bba27, Bba29, Bba30, Bba31, Bba32, Bba33, Bba34, Bba35, Bba36, Bba37, Bba38, Bba41, Bba42, Bba43, Bba44, Bcel4, Bcel5, Bcel6, Bcel7, Bcel8, Bce20, Bce35, Bce36, Bce39, Bce40, Bce41, Bce42, Bce43, Bce44, Bce45, Bce46, Bey20, Bey22, Bey23, Bma42, Bma43, Bpol, Bpo2,

Bpo3, Bpo4, Bpo6, Bpo8, Bpol3, Bpol8, Bpo20, Bpo23, Bpo24, Bpo27, Bpo28, Bpo29, Bpo33, Bpo35, Bpo36, Bpo37, Brh26, Brh27, Brh28, Brh29, Brh30, Brh31, Brh32, Brh33, Bfml7, Bfml8, Bfm20, Bfm21, Bfm24, Bfm25, Bfm27, Bfm32, Bfm33, Bfm34, Bfm35, AAV-rhlO, AAV-rh39, AAV-rh43, or AAVanc80L65. In another embodiment, the VP1, VP2, or VP3 genes express a capsid of a mixed serotype wherein at the VP1, VP2, and VP3 genes do not all come from the same serotype. Exemplary capsids are provided in International Application No. WO 2018/022608 and WO 2019/222136, both of which are incorporated herein in its entirety.

[0035] The Rep proteins for vector genome replication include a combination of at least one large Rep protein optionally selected from the group consisting of Rep78 and Rep68, together with at least one small Rep protein, optionally selected from the group consisting of Rep52 and Rep40. For example, the combination of large and small Rep can be Rep78 and Rep 52.

[0036] In any of these embodiments, the vector genome can include an exogenous polynucleotide interposed between a first AAV inverted terminal repeat and a second AAV inverted terminal repeat. The exogenous polynucleotide can include (in sequence and operably linked) a promoter, an exogenous gene, and a polyadenylation sequence.

[0037] As a result of using the disclosed method, the virions are infectious such that upon incubating a HEK293 cell in the presence of a virion solution containing 10⁷ (10^{^}7, 1E07) viral genomes, the exogenous gene is expressed in detectable amounts by the cell. Alternately, the virions are infectious such that upon incubating a HEK293 cell in the presence of a virion solution containing 10^{^}6 viral genomes, the exogenous gene is expressed in detectable amounts by the cell.

[0038] In the various embodiments, the rAAV viral genome is encapsidated as can be determined by treatment of the virions with benzonase and detecting an intact vector genome by Southern blotting.

[0039] In various embodiments, one or more of the VP1, VP2, VP3, Rep, AAP, and/or helper genes are codon optimized for expression in an insect cell.

[0040] In specific embodiments, the exogenous polynucleotide can express a serpin, a clotting factor, a muscle protein, a metabolic enzyme, a growth factor, a cytokine, an anti-angiogenic protein, an interferon, an interleukin, a neurotrophic factor, a metabolic hormone, an antisense RNA, a micro RNA (miRNA), or an interfering RNA (RNAi). In related embodiments, the exogenous gene expresses alpha-one antitrypsin, clotting factor IX, clotting factor VIII, clotting factor VII, dystrophin, alpha- sarcoglycan, beta- sarcoglycan, delta- sarcoglycan, epsilon- sarcoglycan, tyrosine hydroxylase, aromatic acid decarboxylase, GTP cyclohydrolase I, erythropoietin, aspartoacylase (ASP A), Nerve growth factor (NGF), lysosomal beta- glucuronidase (GUSB), insulin, alpha-synuclein, basic fibroblast growth factor (FGF-2), IGF1, alpha-galactosidase A (alpha-gal A), neurotrophin-3, Neuroglobin (Ngb), angiogenic proteins (vascular endothelial growth factor (VEGF165)), GM-CSF (granulocyte-macrophage colony- stimulating factor), M-CSF (macrophage colony-stimulating factor), a tumor necrosis factor, a growth factors, TGF-beta, IL-10, IL-13, IL-4, platelet-derived growth factor, CNTF (ciliary Neurotrophic factor), brain-derived neurotrophic factor (BDNF), or GDNF (glial cell line derived neurotrophic factor).

[0041] In some embodiments, the nucleotide sequences encoding Cap, Rep, or AAP protein or helper gene are maintained episomally using selection markers and optionally under control of regulatory sequences. The nucleotide sequences encoding Cap, Rep, or AAP protein or helper gene can be maintained on a plurality of plasmids. Alternately, the nucleotide sequences encoding the Cap, Rep, or AAP protein or helper gene are integrated into the chromosome of the host cell, optionally under control of host cell regulatory sequences.

[0042] An embodiment further includes purifying the rAAV virions produced by the disclosed the host cell. The purified rAAV virions can be formulated as a pharmaceutical product. The formulating can include dilution in saline with optional buffer, carrier, and/or stabilizer.

[0043] In a further embodiment, there is an rAAV pharmaceutical product produced by one of these methods. The rAAV pharmaceutical product can be used for treating a mammalian subject by infecting the mammalian subject with the AAV pharmaceutical product.

BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figures 1A, IB, 1C, and ID provide data from a proteomic profiling study. Fig. 1A provides an outline of the experiment. Fig. IB and Fig. 1C provide the time-course for generating yeast biomass (B) and pH monitoring (C) of all shake flasks conditions. Fig. ID provides normalized AAV protein expression in yeast samples on day 3 post galactose induction, detected by mass spectrometry. [0045] Figures 2A and 2B provide data from the principal component analysis. Dynamic profile analysis of rAAV and control yeast strains at day 0 post galactose induction (Fig. 2A) and at days 2 and 3 post galactose induction (Fig. 2 B).

[0046] Figure 3 A is a heat map analysis of a subset of 304 proteins that showed statistically significant change among conditions (p-value <5x10-5). The color represents the degree of variation in protein expression (log2 change) between day 0 and day 3 post-induction within the control strain (column A), day 0 and day 3 post-induction within the rAAV-producing recombinant strain (column B), and between both strains on days 2-3 post-induction (column C).

[0047] Figure 3B provides predicted protein interaction network performed in STRING software. The analysis was done based on a subset of 134 proteins with differential protein expression. A high confidence factor (0.7) was used for the analysis. Proteins from relevant biological processes are color-coded: Protein refolding (red), cytoplasmic translation (green), gluconeogenesis (blue), and carboxylic acid metabolic processes (yellow).

[0048] Figures 4A and 4B provide rAAV2 vector yield results in yeast strains which overexpresses a host chaperone protein. Sequences encoding the different host chaperone proteins were operably linked to a galactose inducible promoter. Nineteen strains were generated by transforming the control rAAV-producing strain with an additional 2-micron (Fig. 4A) or CEN (Fig. 4B) plasmid containing a GALIO-X host protein expression cassette. Benzonase- resistant vector yield results from each clone is presented as vector titer relative to the control mean value. Bars represent mean and standard deviation (n=4). Asterisk represents conditions that are significantly higher than the control values, based on a paired, one-tailed t-test (p<0.05).

[0049] Figures 5A and 5B provides rAAV-Green Fluorescent Protein (GFP) vector production in Sf9 cells overexpressing selected protein folding chaperones (HSP40, HSC70, HSP40/70). Three rBV strains (rBV-GFP, rBV-RepCap, rBV-HSP) were used to infect Sf9 cells. In the HSP40-70 condition, rBV-HSP40 and rBV-HSC70 were combined. Crude supernatant was harvested at 120h post-infection and analyzed by digital drop polymerase chain reaction (ddPCR) after benzonase digestion (Fig. 5A). Per cell productivity was calculated by the ratio of vector genome (vg) titer on harvest day by peak cell density (Fig. 5B).

[0050] Figure 6 provides the rAAV vg titer produced in Sf9 cells overexpressing a regulatory protein (HSP40, HSC70, Nuc, NSR1, enhanced green fluorescent protein (EGFP), AAP5, TOP2, GEN1). AAV production Sf9 cells overexpressing a regulatory protein was undertaken twice. The vg titers from the productions are denoted as Repl and Rep2. The cells denoted as “empty” did not express a recombinant regulatory protein. The bacmids and rBVs has sequences encoding regulatory proteins and the sequences were operably linked to the polyhedrin promoter.

[0051] Figure 7 provides rAAV vg titer produced in Sf9 cells overexpressing either HSP40, HSC70 or TOP2 or expressing both HSP40 and HSC70 (denoted as “2 genes”) or expressing three genes encoding regulatory proteins (HSP40, HSC70 and TOP2; denoted as “3 genes”).

The cells denoted as “empty” did not express a recombinant regulatory protein.

[0052] Figure 8 provides the rAAV vg titer in Sf9 cell pellets. The Sf9 cells overexpressing either HSP40, HSC70 or TOP2 or expressing both HSP40 and HSC70 (denoted as “2 genes”) or expressing three genes encoding regulatory proteins (HSP40, HSC70 and TOP2; denoted as “3 genes”). The cells denoted as “empty” did not express a recombinant regulatory protein.

[0053] Figure 9 provides the rAAV vg titer produced in Sf9 cells overexpressing a regulatory protein (HSP40, HSC70 or TOP2). The cells denoted as “empty” did not express a recombinant regulatory protein.

DETAILED DESCRIPTION

[0054] As required, detailed embodiments of the present disclosure are disclosed herein; however, it is to be understood that the disclosed embodiments are merely exemplary and may be embodied in various and alternative forms.

[0055] Except in the examples, or where otherwise expressly indicated, all numerical quantities in this description indicating amounts of material or conditions of reaction and/or use are to be understood as modified by the word “about”. The first definition of an acronym or other abbreviation applies to all subsequent uses herein of the same abbreviation and applies mutatis mutandis to normal grammatical variations of the initially defined abbreviation; and, unless expressly stated to the contrary, measurement of a property is determined by the same technique as previously or later referenced for the same property.

[0056] Unless indicated otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present disclosure belongs. [0057] It is also to be understood that this disclosure is not limited to the specific embodiments and methods described below, as specific components and/or conditions may, of course, vary. Furthermore, the terminology used herein is used only for describing particular embodiments and is not intended to be limiting in any way.

[0058] It must also be noted that, as used in the specification and the appended claims, the singular form "a," "an," and "the" comprise plural referents unless the context clearly indicates otherwise. For example, reference to a component in the singular is intended to comprise a plurality of components.

[0059] The terms “or” and “and” can be used interchangeably and can be understood to mean “and/or”.

[0060] The term “comprising” is synonymous with “including,” “having,” “containing,” or “characterized by.” These terms are inclusive and open-ended and do not exclude additional, unrecited elements or method steps.

[0061] The phrase “consisting of’ excludes any element, step, or ingredient not specified in the claim. When this phrase appears in a clause of the body of a claim, rather than immediately following the preamble, it limits only the element set forth in that clause; other elements are not excluded from the claim as a whole.

[0062] The phrase “consisting essentially of’ limits the scope of a claim to the specified materials or steps, plus those that do not materially affect the basic and novel characteristic(s) of the claimed subject matter.

[0063] The terms “comprising”, “consisting of’, and “consisting essentially of’ can be alternatively used. When one of these three terms is used, the presently disclosed and claimed subject matter can include the use of either of the other two terms.

[0064] Throughout this application, where publications are referenced, the disclosures of these publications in their entireties are hereby incorporated by reference into this application to more fully describe the state of the art to which this invention pertains.

[0065] The provided methods of generating rAAV using a host cell modified to express a regulatory protein. For example, the disclosed methods include using a host insect cell including three baculovirus vectors, i) a first baculovirus vector including nucleotide sequences encoding Rep and Cap (rBV-Cap-Red), ii) a second baculovirus vector including a nucleotide sequence for generating the rAAV genome and iii) a third baculovirus vector including a nucleotide sequence encoding a regulatory protein (e.g. a chaperone host protein) (rBV-host prot). In other examples, the disclosed methods include using a host mammalian or yeast cell including three plasmids or viruses, i) a first plasmid/virus including nucleotide sequences encoding Rep and Cap , ii) a second plasmid/virus including a nucleotide sequence for generating the rAAV genome and iii) a third plasmid/virus including a nucleotide sequence encoding a regulatory protein (e.g. a chaperone host protein). Inclusion of the third baculovirus vector, plasmid, or virus resulted in enhanced expression of a regulatory protein that improves AAV production. In the examples, the rAAV vector genome includes a nucleotide sequence encoding a green fluorescent protein (GFP) but the nucleotide sequence encoding GFP may be substituted with any exogenous polynucleotide of interest.

General Techniques

[0066] The practice of the present methods will employ, unless otherwise indicated, conventional techniques of cell biology, molecular biology, cell culture, virology, and the like which are in the skill of one in the art. These techniques are fully disclosed in current literature and reference is made specifically to Sambrook, Fritsch and Maniatis eds., “Molecular Cloning, A Laboratory Manual”, 2nd Ed., Cold Spring Harbor Laboratory Press (1989); Celis J. E. “Cell Biology, A Laboratory Handbook” Academic Press, Inc. (1994) and Bahnson et al, J. of Virol. Methods, 54:131-143 (1995). Furthermore, all publications and patent applications cited in this specification are indicative of the level of skill of those skilled in the art to which these methods pertain and are hereby incorporated by reference in their entirety.

Definitions:

[0067] The term “regulatory protein” refers to proteins that influence biological processes within the host cell such as, for example, protein refolding, cytoplasmic translation, gluconeogenesis, or carboxylic acid metabolic processes. Altering the expression of these proteins in host cells can improve rAAV production. For example, overexpression or increased expression of a regulatory protein improves rAAV production. In other examples, decreased expression of a regulatory protein improves rAAV production. Examples of regulatory proteins include host chaperone proteins (e.g. heat shock/chaperone proteins), topoisomerases, nucleolins, endonucleases such as Holliday junction endonucleases, or viral proteins that alters cellular processes within host cells.

[0068] The term “host chaperone protein” refers to proteins capable of assisting in the covalent folding or unfolding, or the assembly or disassembly or other macromolecular structures under physiological or stress conditions. Examples of host chaperone proteins include heat shock protein 40 (HSP40), heat shock cognate 70 (HSC70), and heat shock protein 90 (Hsp90). The host chaperone proteins include proteins from different organisms such as Spodoptera frugiperda (e.g. Sf-HSP40, Sf-HSC70, or Sf-HSP90). The host chaperone genes of interest are homologs of known yeast and human chaperone proteins. These homologs were identified in Spodoptera frugiperda , Spodoptera litura and Saccharomyces cerevisiae. The following Spodoptera frugiperda (Sf) heat shock proteins (HSP) were identified in a yeast proteomic screen and were predicted to improve capsid protein production and folding: Sf- HSP40 has about 47% amino acid sequence identity to yeast YDJl protein. Sf-HSC70 has about 67% amino acid sequence identity to yeast SSA1. Sf-HSP90 has about 62% amino acid sequence identity to yeast HSP82.

[0069] In one example, Sf-HSP40 includes the amino acid sequence of SEQ ID NO: 2, which may be encoded by the nucleotide sequence of SEQ ID NO: 1.

[0070] In one example, Sf-HSC70 includes the amino acid sequence of SEQ ID NO: 4, which may be encoded by the nucleotide sequence of SEQ ID NO: 3.

[0071] In one example, Sf-HSP90 includes the amino acid sequence of SEQ ID NO: 6, which may be encoded by the nucleotide sequence of SEQ ID NO: 5.

[0072] The term “topoisom erase” refers to enzymes that modulate the topological state of nucleic acids. For example, type II topoisomerases (TOP2) regulate the winding of DNA by passing an intact double helix through a transient double-stranded break. The topoisomerase includes enzymes from different organisms such as Saccharomyces cerevisiae (Sc-TOP2) or Spodoptera litura (S1-TOP2). Spodoptera litua (SI) and Saccharomyces cerevisiae (Sc) topoisomerase II (TOP2) proteins were identified in a yeast genetic screen: Sc-TOP2 and Sl- TOP2. The proteins were TOP2 protein is predicted to improve AAV DNA replication and encapsidation. [0073] In one example, Sc-TOP2 includes the amino acid sequence of SEQ ID NO: 8, which may be encoded by the nucleotide sequence of SEQ ID NO: 7.

[0074] In one example, S1-TOP2 includes the amino acid sequence of SEQ ID NO: 10, which may be encoded by the nucleotide sequence of SEQ ID NO: 9.

[0075] The term “nucleolin” refers to phosphoproteins involved in the synthesis and maturation of ribosomes. Nucleolins induce chromatin by binding to histone HI. The nucleolins includes phosphoproteins from different organisms such as NSR1 from Saccharomyces cerevisiae (Sc-NSRl) or Nucleolin from humans (Hs-nucleolin). Nucleolin (Nuc) protein is known to interact with AAV capsids. Thus, expression of this protein improves capsid assembly and localization in the nucleolus. Saccharomyces cerevisiae and human (Hs) nucleolin were identified: Sc-NSRl and Hs-nucleolin.

[0076] In one example, Sc-NSRl includes the amino acid sequence of SEQ ID NO: 12, which may be encoded by the nucleotide sequence of SEQ ID NO: 11.

[0077] In one example, Hs-nucelolin includes the amino acid sequence of SEQ ID NO: 14, which may be encoded by the nucleotide sequence of SEQ ID NO: 13.

[0078] The term “endonuclease” refers to enzymes that are capable of cleaving phosphodiester bonds within a polynucleotide chain. For example, Holliday junction endonucleases performs endonucleolytic cleavage to catalyze the formation of separate recombinant DNA molecules and chromosomal separation after a crossover event at the Holliday junction. The Holliday junction endonucleases includes endonucleases from different organisms such as YEN1 from Saccharomyces cerevisiae (Sc-YENl) or Nucleolin from humans (Hs-GENl). Saccharomyces cerevisiae and human Holiday junction endonucleases were identified: Sc-YEN 1 and Hs-GEN 1. These endonucleases improve recue of AAV DNA from the baculovirus vector.

[0079] In one example, Sc-YENl includes the amino acid sequence of SEQ ID NO: 16, which may be encoded by the nucleotide sequence of SEQ ID NO: 15.

[0080] In one example, Hs-GENl includes the amino acid sequence of SEQ ID NO: 18, which may be encoded by the nucleotide sequence of SEQ ID NO: 17.

[0081] Viral proteins are proteins that alter cellular processes within host cells. For example, AAP is required for capsid assembly of AAV. AAP includes different AAV serotypes such as AAV5 (e.g. AAP-5 or AAP5). Enhanced AAP expression improves capsid production, especially in cases where the AAP expression from the Cap gene might be suboptimal.

[0082] In one example, AAP5 includes the amino acid sequence of SEQ ID NO: 20, which may be encoded by the nucleotide sequence of SEQ ID NO: 19.

[0083] Proteomic changes in the translation machinery were identified during AAV production. By looking at host proteins involved in protein biosynthesis, it was observed that several ribosomal subunit proteins, transfer RNA (tRNA) transferases, RNA polymerases, and some elongation factors were downregulated, which suggest that a general suppression of translation due to cellular stress could have taken place. This phenomenon could also have been worsened by environmental causes such as the lack of nonfermentable carbon sources or another limiting nutrient in media, which tends to impact processes related to ribosome biogenesis and translational activity (Ashe and Bill, 2011; Gasch, 2003). We also found multiple changes in proteins associated to gluconeogenesis such as ENOl, EN02, MDH2, PCK1, and PCK2 were observed. It is unclear what the major driver for this change is; however, formation of secondary metabolic products like ethanol and trehalose could have shifted this expression pattern. Ethanol is a common byproduct during yeast consumption of glucose. This component tends to be used right after yeast diauxic shift, once glucose or the primary fermentable carbon source is depleted (Peng et al, 2015). It has been reported that ethanol consumption drives the expression of factors that reduces gluconeogenesis activity (Soontomgun et al, 2007). Moreover, yeast accumulates trehalose during recombinant protein production, a mechanism that is believed to mitigate stress (D’Amore et al, 1991). An increment in protein TPS1, directly involved in trehalose production, influences gluconeogenesis as part of the general stress response (Deroover et al, 2016).

[0084] An additional function of the host cell proteins highlighted in this analysis is related to protein degradation. During the profiling analysis, changes in proteins that are components of the proteasome subunits such as RPN6 and PRE7 were identified. Many cytoplasmic chaperones participate in ubiquitin-dependent and independent degradation processes, which include proteasome activity (Ben-Nissan and Sharon, 2014; Santamaria et al, 2003). The increased expression of this set of proteins suggests that protein degradation activities might have taken place during AAV protein expression, likely by proteasome activity on misfolded AAV proteins such as capsids. Empirical knowledge from western blot analysis showed VP capsid proteins of multiple sizes besides the three expected sizes, which would support the notion of potential protein degradation events occurring at the cytosol. Host cell proteins that get upregulated due to oxidative stress were also identified. Thioredoxins, catalases, superoxide dismutases, and glutathione transferases usually play an important role during oxidative stress (Gasch, 2003). GAD1 and GTT1 showed significantly increased protein levels after galactose induction. These two proteins participate in the metabolism of glutamate and glutathione, respectively; which indirectly impacts the intracellular redox potential and modulates the stress generated by toxic oxidants (Coleman et al., 2001; Collinson and Grant, 2003; Grant, 2001). Other overexpressed proteins were CCP1, GRE3, and AHP1. These proteins, present in cytosolic and mitochondrial compartments, are expressed under stress conditions, and are implicated in different metabolic routes that protect cells against oxidant damage (Aguilera and Prieto, 2001; Charizanis et al., 1999; Lee et al., 1999). Increased expression of some of these antioxidant proteins, however, has been associated to diauxic shift in yeast strains. Since this metabolic event is common in strains that grow in glucose-galactose media transitions (Murphy et al., 2015), it is plausible to think that the specific increase of some of these proteins might have been triggered by metabolic events different from AAV production.

[0085] A protein overexpression strategy was designed based on the analysis of proteome changes and their potential implications on rAAV production. It was hypothesized that additional expression of host cell proteins would benefit stress-free cell metabolism. Results shown in the yeast model using low-copy and high-copy number plasmids supported the utility of the AAV-producing yeast strain for proteomics-guided optimization. In few cases such as YDJ1, protein overexpression using high copy number plasmids led to a vector yield lower than the one obtained with the control strain, suggesting that modulation of chaperone/host protein levels is required to achieve optimal yields. Vector titer improvement was evidenced after overexpression of proteins related to protein folding, response to oxidative stress, and regulation of gene expression. More importantly, improved results translated into insect cells when the respective protein folding homologues were overexpressed. These results might indicate that protein folding takes place during AAV production among different systems, and that the extent of foldase protein activity might lead to more efficient vector production at a cellular level.

[0086] “Encodes,” “encoded” and “encoding” refer to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, complementary DNA (cDNA), or messenger RNA (mRNA), to serve as templates for synthesis of other polymers and macromolecules in biological processes. Thus, a gene encodes a protein if transcription and translation of mRNA produced by that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and non-coding strand, used as the template for transcription, of a gene or cDNA can be referred to as encoding the protein or other product of that gene or cDNA.

[0087] The term “expression control element” refers to a nucleic acid sequence in a polynucleotide that is capable of regulating the expression of a nucleotide sequence to which it is operably linked thereto. “Operatively linked” refers to a functional relationship between two parts in which the activity of one-part (e.g., the ability to regulate transcription) results in an action on the other part (e.g., transcription of the sequence). An expression control element is “operably linked” to a nucleotide sequence when the element controls and regulates the transcription and/or the translation of the nucleotide sequence. Examples of an expression control element includes sequences of promoters (e.g., inducible or constitutive), enhancers, transcription terminators, a start codon (i.e., ATG), splicing signals for introns, stop codons, internal ribosome entry sites, transcription terminators, homology region elements (e.g. homology region 2 from Autographa californica multicapsid nucleopolyhedrovirus (AcMNPV)), AAV regulatory elements (e.g. Rep binding element), etc.

[0088] The term “promoter” or “promoter polynucleotide” is understood to mean a regulatory sequence/element or control sequence/element that is capable of binding/recruiting an RNA polymerase and initiating transcription of sequence downstream or in a 3' direction from the promoter. A promoter can be, for example, constitutively active or always on or inducible in which the promoter is active or inactive in the presence of an external stimulus. The promoter is capable of expressing proteins at high concentration. For example, the transcript level of the promoter is about or is at least about 1.5-fold, 2-fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 5.5-fold, 6-fold, 6.5-fold, 7-fold, 7.5-fold, 8-fold, 8.5-fold, 9-fold, 9.5-fold, 10-fold, 10.5- fold, 11-fold, 11.5-fold, 12-fold, 12.5-fold, 13-fold, 13.5-fold, 14-fold, 14.5-fold, 15-fold, 15.5- fold, 16-fold, 16.5-fold, 17-fold, 17.5-fold, 18-fold, 18.5-fold, 19-fold, 19.5-fold, 20-fold, 50- fold, 100-fold, 250-fold, 500-fold, 1000-fold, 2000-fold, 2500-fold, 3000-fold, 3500-fold, 4000- fold, 4500-fold, 5000-fold, 5500-fold, 6000-fold, 6500-fold, 7000-fold, 7500-fold, 8000-fold, 8500-fold, 9000-fold, 9500-fold, or 10000-fold higher than a transcript level of a native promoter for an operon encoding the regulatory protein. In different examples, the transcript level of the constitutive promoter polynucleotide is a range between any two levels listed above. The promoter can also be positioned to other expression control element(s) to control transcript expression. For example, an expression cassette with a promoter, homology region element, and/or AAV regulatory element can be stably incorporated into the genome of an insect cell such that baculovirus infection of an insect cell induces transcript expression from the expression cassette (See US2012/0100606).

[0089] Examples of promoters active in insect cells include the polyhedrin (Polh) promoter, DIE1 promoter, p5 promoter, plO promoter, the p40 promoter, metallothionein promoter, 39K promoter, p6.9 promoter, and orf46 promoter. Examples of promoters active in fungal cells include the galactose promoters, Gall promoter, Gal7 promoter, Gal 10 promoter, Pisl promoter, Mal62 promoter, Pckl promoter, Cupl promoter, Tefl promoter, DDI2 promoter, Pgkl promoter, Adhl promoter, and Adh2 promoter. Examples of promoters active in mammalian cells include SV40 promoter, CMV promoter, UBC promoter, EF1A promoter, PGK promoter, TRE (Tet, Tet-On, Tet-Off) promoter, Cumate controlled systems (CuR/CuO) (See US2004/0205834), and the temperature-induced HSP70 promoter.

[0090] In one example, the polyhedrin promoter includes the nucleotide sequence of SEQ ID NO: 21.

[0091] In one example, the plO promoter includes the nucleotide sequence of SEQ ID NO: 22. [0092] In one example, the 39k promoter includes the nucleotide sequence of SEQ ID NO: 23.

[0093] In one example, the p6.9 promoter includes the nucleotide sequence of SEQ ID NO:

24.

[0094] In one example, the DIE1 promoter includes the nucleotide sequence of SEQ ID NO:

25.

[0095] In one example, the orf46 promoter includes the nucleotide sequence of SEQ ID NO:

26. In another example, the orf46 promoter includes nt 163 to nt 301 of SEQ ID NO: 26. In another example, the orf46 promoter includes nt 186 to nt 301 of SEQ ID NO: 26. Other examples of the orf46 promoter are disclosed in Martinez- Solis, Maria, et al., PeerJ 4 (2016): e2183 and ES2554561, both of which are incorporated by reference in their entireties.

[0096] In one example, the Gall promoter includes the nucleotide sequence of SEQ ID NO:

27.

[0097] In one example, the Gal7 promoter includes the nucleotide sequence of SEQ ID NO:

28.

[0098] In one example, the Gal 10 promoter includes the nucleotide sequence of SEQ ID NO:

29.

[0099] In one example, the Adhl promoter includes the nucleotide sequence of SEQ ID NO:

30.

[00100] In one example, the Adh2 promoter includes the nucleotide sequence of SEQ ID NO:

31.

[00101] The terms “percent identity” or “percent identical” in the context of two or more polynucleotide or polypeptide amino acid sequences, refer to the percentage of nucleotides or amino acid residues that are the same, when compared and aligned for maximum correspondence. The comparison of the aligned sequences can be of at least at least 20 positions, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may comprise additions or deletions (i.e. gaps) of 20 percent or less, usually 5 to 15 percent, or 10 to 12 percent, as compared to the reference sequences (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid bases or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the reference sequence (i.e. the window size) and multiplying the results by 100 to yield the percentage of sequence identity. Also for example, percent identity can be determined using NCBI blastn (nucleotides) or blastp (amino acids) using the default settings. For blastp, the default settings are (automatically adjust parameters for short input sequences, expect threshold=10, word size=3, max matched in a query range=0, matrix=BLOSUM62, gap costs=Existence: 11 Extension: 1, compositional adjustments = conditional compositional score matrix adjustment. For blastn, the blastn algorithm is used (rather than the less computationally intensive megablast or discontinuous megablast). Alternatively

[00102] “Expression vector” refers to a vector including a recombinant polynucleotide including expression control sequences operatively linked to a nucleotide sequence to be expressed. An expression vector includes sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in vitro expression system.

Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes), artificial chromosomes, and viruses that incorporate the recombinant polynucleotide.

[00103] As used herein, an “AAV vector”, “rAAV vector”, “vector genome”, or “rAAV vector genome” refers to nucleic acids, either single-stranded or double-stranded, having an AAV 5' inverted terminal repeat (ITR) sequence and an AAV 3' ITR flanking a protein-coding sequence (preferably a functional therapeutic protein-encoding sequence; e.g., FVIII, FIX, and PAH) operably linked to transcription regulatory elements that are heterologous to the AAV viral genome, i.e., one or more promoters and/or enhancers and, optionally, a polyadenylation sequence and/or one or more introns inserted between exons of the protein-coding sequence. A single- stranded rAAV vector refers to nucleic acids that are present in the genome of an AAV virus particle and can be either the sense strand or the anti-sense strand of the nucleic acid sequences disclosed herein. The size of such single-stranded nucleic acids is provided in bases. A double-stranded rAAV vector refers to nucleic acids that are present in the DNA of plasmids, e.g., pUC19, or genome of a double-stranded virus, e.g., baculovirus, used to express or transfer the rAAV vector nucleic acids. The size of such double-stranded nucleic acids in provided in base pairs (bp).

[00104] An “rAAV virion”, “rAAV viral particle”, “rAAV vector particle”, or “AAV virus” refers to a viral particle composed of at least one capsid or Cap protein and an encapsidated rAAV vector genome as described herein. If the particle includes a heterologous polynucleotide (i.e., a polynucleotide other than a wild-type AAV genome such as a transgene to be delivered to a mammalian cell), it is typically referred to as an “rAAV vector particle” or simply an “rAAV vector”. Thus, production of AAV vector particles necessarily includes production of rAAV vector, as such a vector is contained within an rAAV vector particle. [00105] The terms “transduction” and “transduce” refers to the transfer of genetic material (e.g., vector genome) from an rAAV into a recipient cell and the expression transgene from the rAAV genetic material in the recipient cell. The transfer of the genetic material is mediated through an rAAV particle infecting a recipient cell. To this end, the term “potency” refers to the level of transgene expression in a recipient cell or recipient cells infected by rAAV particles. Thus, an rAAV having a greater potency highlights that a recipient cell infected by rAAV has greater transgene expression.

[00106] “Capsid” refers to the structure in which the rAAV vector is packaged. The capsid includes VP1 proteins or VP3 proteins, but more typically, all three of VP1, VP2, and VP3 proteins, as found in native AAV. The sequence of the capsid proteins determines the serotype of the rAAV virions. rAAV virions include those derived from a number of AAV serotypes, including AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV 12, AAV13, Bba21, Bba26, Bba27, Bba29, Bba30, Bba31, Bba32, Bba33, Bba34, Bba35, Bba36, Bba37, Bba38, Bba41, Bba42, Bba43, Bba44, Bcel4, Bcel5, Bcel6, Bcel7, Bcel8, Bce20, Bce35, Bce36, Bce39, Bce40, Bce41, Bce42, Bce43, Bce44, Bce45, Bce46, Bey20, Bey22, Bey23, Bma42, Bma43, Bpol, Bpo2, Bpo3, Bpo4, Bpo6, Bpo8, Bpol3, Bpol8, Bpo20, Bpo23, Bpo24, Bpo27, Bpo28, Bpo29, Bpo33, Bpo35, Bpo36, Bpo37, Brh26, Brh27, Brh28, Brh29, Brh30, Brh31, Brh32, Brh33, Bfml7, Bfml8, Bfm20, Bfm21, Bfm24, Bfm25, Bfm27, Bfm32, Bfm33, Bfm34, Bfm35, AAV-rhlO, AAV-rh39, AAV-rh43, AAVanc80L65, or any variants thereof (see, e.g., U.S. Patent No. 8,318,480 for its disclosure of non-natural mixed serotypes). Exemplary capsids are also provided in International Application No. WO 2018/022608 and WO 2019/222136, which are incorporated herein in its entirety. The capsid proteins can also be variants of natural VP1, VP2 and VP3, including mutated, chimeric or shuffled proteins. The capsid proteins can be those of rh.lO or other subtype within the various clades of AAV; various clades and subtypes are disclosed, for example, in U.S. Patent No. 7,906,111.

[00107] The term “inverted terminal repeat” or “ITR” as used herein refers to the art- recognized regions found at the 5' and 3' termini of the rAAV genome which function in cis as origins of DNA replication and as packaging signals for the viral genome. AAV ITRs, together with the Rep coding region, provide for efficient excision and rescue from, and integration of a nucleotide sequence interposed between two flanking ITRs into a host cell genome. Sequences of certain AAV-associated ITRs are disclosed by Yan et al., J. Virol. 79(l):364-379 (2005).

[00108] “Pharmaceutical product” refers to a product suitable for pharmaceutical use in a subject animal, including humans and mammals. For example, the pharmaceutical product is an rAAV virion.

[00109] “Pharmaceutical composition” refers to a composition suitable for pharmaceutical use in a subject animal, including humans and mammals. A pharmaceutical composition includes a pharmacologically effective amount of a pharmaceutical product, such as an AAV virion, and also includes a pharmaceutically acceptable carrier. A pharmaceutical composition encompasses a composition including the active ingredient(s), and the inert ingredient(s) that make up the carrier, as well as any product which results, directly or indirectly, from combination, complexation or aggregation of any two or more of the ingredients, or from dissociation of one or more of the ingredients, or from other types of reactions or interactions of one or more of the ingredients. Accordingly, the pharmaceutical compositions encompass any composition made by admixing a virion provided herein and a pharmaceutically acceptable carrier.

[00110] “Pharmaceutically acceptable carrier” refers to any of the standard pharmaceutical excipients, vehicles, diluents, stabilizers, preservatives, solubilizers, emulsifiers, adjuvants and/or carriers, such as, for example and not for limitation, a phosphate buffered saline solution, 5% aqueous solution of dextrose, and emulsions, such as an oil/water or water/oil emulsion, and various types of wetting agents and/or adjuvants. Suitable pharmaceutical carriers and formulations are described in Remington's Pharmaceutical Sciences, 19th Ed. (Mack Publishing Co., Easton, 1995). Pharmaceutical carriers to be used can depend upon the intended mode of administration of the active agent. Typical modes of administration include enteral (e.g., oral) or parenteral (e.g., subcutaneous, intramuscular, intravenous or intraperitoneal injection; or topical, transdermal, or transmucosal administration). A “pharmaceutically acceptable salt” is a salt that can be formulated into an oxalate degrading enzyme composition for pharmaceutical use including, e.g., metal salts (sodium, potassium, magnesium, calcium, etc.) and salts of ammonia or organic amines.

[00111] “Pharmaceutically acceptable” or “pharmacologically acceptable” mean a material which is not biologically or otherwise undesirable, i.e., the material can be administered to an individual without causing any undesirable biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained.

[00112] “Recombinant polynucleotide” refers to a polynucleotide having sequences that are not naturally joined together. An amplified or assembled recombinant polynucleotide can be included in a suitable vector, and the vector can be used to transform a suitable host cell. A host cell that includes the recombinant polynucleotide is referred to as a “recombinant host cell.” The gene is then expressed in the recombinant host cell to produce, e.g., a “recombinant polypeptide.” A recombinant polynucleotide can serve a non-coding function (e.g., promoter, origin of replication, ribosome-binding site, etc.) as well.

[00113] As used herein, the term “subject” encompasses mammals and non-mammals. Examples of mammals include, but are not limited to, any member of the mammalian class: humans, non-human primates such as chimpanzees, and other apes and monkey species; farm animals such as cattle, horses, sheep, goats, swine; domestic animals such as rabbits, dogs, and cats; laboratory animals including rodents, such as rats, mice and guinea pigs, and the like. Examples of non-mammals include, but are not limited to, birds, fish, and the like. The term does not denote a particular age or gender.

[00114] A “variant” of a polypeptide includes an amino acid sequence wherein one or more amino acid residues are inserted into, deleted from and/or substituted into the amino acid sequence relative to another polypeptide sequence. Variants include fusion proteins.

[00115] In general, infectious rAAV particles are produced in a “host cell.” The host cell has been modified to include multiple biologically active polynucleotides encoding the AAV capsid, AAV Rep proteins, AAV vector genome, and one or more host chaperone proteins so as to result in packaging (encapsidation) of the viral genome into an infectious virion. Exemplary regulatory proteins include HSP40, HSC70, NUC, NSR1, EGFP, AAP, TOP2, and GENl. In an embodiment, the host cell also includes one or more polynucleotides that produce one or more helper proteins such as an immunophilin analogue and an Adenovirus or Herpes simplex virus helper protein.

[00116] In an embodiment, the host cell is an insect cell, yeast cell, or mammalian cells. Techniques known to one skilled in the art for expressing foreign genes in insect host cells or mammalian host cells can be used to practice the invention. Methodology for molecular engineering and expression of polypeptides in insect cells is described, for example, in Summers and Smith. A Manual of Methods for Baculovirus Vectors and Insect Culture Procedures, Texas Agricultural Experimental Station Bull. No. 7555, College Station, Tex. (1986); Luckow. 1991. In Prokop et al, Cloning and Expression of Heterologous Genes in Insect Cells with Baculovirus Vectors' Recombinant DNA Technology and Applications, 97-152 (1986); King, L. A. and R. D. Possee, The baculovirus expression system, Chapman and Hall, United Kingdom (1992); O'Reilly, D. R., L. K. Miller, V. A. Luckow, Baculovirus Expression Vectors: A Laboratory Manual, New York (1992); W.H. Freeman and Richardson, C. D., Baculovirus Expression Protocols, Methods in Molecular Biology, volume 39 (1995); U.S. Pat. No. 4,745,051;

US2003148506; and WO 03/074714. A particularly suitable promoter for transcription of a nucleotide sequence encoding an AAV capsid protein is e.g. the polyhedron promoter.

However, other promoters that are active in insect cells are known in the art, e.g. the plO, p35 or IE-1 promoters and further promoters described in the above references are also contemplated.

[00117] Use of insect cells for expression of heterologous proteins is well documented, as are methods of introducing nucleic acids, such as vectors, e.g., insect-cell compatible vectors, into such cells and methods of maintaining such cells in culture. See, for example, METHODS IN MOLECULAR BIOLOGY, ed. Richard, Humana Press, NJ (1995); O'Reilly et al, BACULOVIRUS EXPRESSION VECTORS, A LABORATORY MANUAL, Oxford Univ. Press (1994); Samulski et al, J. Vir. 63:3822-8 (1989); Kajigaya et al, Proc. Nat'l. Acad. Sci. USA 88:4646-50 (1991); Ruffing et al, J. Vir. 66:6922-30 (1992); Kimbauer et al, Vir. 219:37- 44 (1996); Zhao et al, Vir. 272:382-93 (2000); and Samulski et al, U.S. Pat. No. 6,204,059. In some embodiments, the nucleic acid construct encoding rAAV in insect cells is an insect cell- compatible vector. An "insect cell-compatible vector" or "vector" as used herein refers to a nucleic acid molecule capable of productive transformation or transfection of an insect or insect cell. Exemplary biological vectors include plasmids, linear nucleic acid molecules, and recombinant viruses. Any vector can be employed as long as it is insect cell-compatible. The vector may integrate into the insect cell’s genome but the presence of the vector in the insect cell need not be permanent and transient episomal vectors are also included. The vectors can be introduced by any means known, for example by chemical treatment of the cells, electroporation, or infection. In some embodiments, the vector is a baculovirus, a viral vector, or a plasmid. In a more preferred embodiment, the vector is a baculovirus, i.e. the construct is a baculoviral vector. Baculoviral vectors and methods for their use are described in the above cited references on molecular engineering of insect cells.

[00118] Baculoviruses, such as rBV, are enveloped DNA viruses of arthropods, two members of which are well known expression vectors for producing recombinant proteins in cell cultures. Baculoviruses have circular double-stranded genomes (80-200 kbp) which can be engineered to allow the delivery of large genomic content to specific cells. The viruses used as a vector are generally AcMNPV or Bombyx mori (BmNPV) (Kato et al, Appl. Microbiol. Biotechnol. 85(3):459-470 (2010)). Baculoviruses are commonly used for the infection of insect cells for the expression of recombinant proteins. In particular, expression of heterologous genes in insects can be accomplished as described in for instance U.S. Pat. No. 4,745,051; Friesen et al, Curr. Top. Microbiol. Immunol. 131:31-49. (1986); EP 127,839; EP 155,476; Miller et al, Ann. Rev. of Microbiol. 42: 177-199 (1988); Carbonell et al, Gene 73(2):409-18 (1988); Maeda et al, Nature 315(6020):592-4 (1985); Lebacq-Verheyden et al, Mol. Cell. Biol. 8(8):3129-35 (1988); Smith et al, Proc. Natl. Acad. Sci. USA. 82(24):8404-8 (1985); Miyajima et al, Gene 58(2-3):273-81 (1987); and Martin et al, DNA 7(2):99-106 (1988). Numerous baculovirus strains and variants and corresponding permissive insect host cells that can be used for protein production are described in Luckow et al, Nature Biotechnology 6:47-55 (1988), and Maeda et al, Nature 315(6020):592-4 (1985).

[00119] In an embodiment, the host cell is a fungal cell. Fungal cells with known genetic systems for use in biotechnology include Pichia pastoris and Saccharomyces cerevisiae as well as filamentous fungi such as species of Aspergillus, Trichodermam and Myceliophthor a (e.g., Myceliophthora thermophila Cl ). Examples are given below using the Saccharomyces cerevisiae model system.

[00120] The host cells can be transformed to achieve stably maintained episomes or chromosomal integration of various recombinant genetic elements. Homologous recombination from a vector such as a plasmid can be used for chromosomal integration. See, e.g., Rothstein, R., “Targeting, disruption, replacement, and allele rescue: Integrative DNA transformation in yeast” Methods in Enzymology vol. 194, 1991, pp. 281-301. For example, a VP, Rep, AAP or helper transgene can be fused to a selection marker such as a hygromycin resistance gene (hph) with a flanking sequence targeting a neutral site such as TY retrotransposon (i.e., a site that when disrupted does not unduly interfere with the vitality of the host cell). This can be repeated for different genes with additional selection markers and integration sites.

[00121] The genetic elements include genes Cap, Rep, and other proteins needed to produce infectious AAV virions. The recombinant genes can be based on cDNA of the natural proteins. Whereas mRNAs in the native AAV result from alternative splicing and ORFs, an advantage of the host cell and genetic systems described here is that each gene product can be encoded on a discrete expression cassette with its own expression control and coding polynucleotide sequences.

[00122] The genetic elements can be codon optimized for the host cell. For example, genes for Cap, Rep, AAP, and/or helper gene(s) can be codon optimized for an insect cell. The methodology generally consists of identifying codons in the wild-type sequence that are not commonly associated with highly expressed insect genes and replacing them with optimal codons for high expression in insect cells. The new gene sequence is then inspected for undesired sequences generated by these codon replacements. Undesirable sequences are eliminated by substitution of the existing codons with different codons coding for the same amino acid. The synthetic gene segments are then tested for improved expression. For example, the starting gene can have at least 1%, 5%, 10%, or 20% of native codons substituted with a more frequent codon of the host cell based on a codon usage study.

Recombinant AA V Particles

[00123] As used herein, the term "AAV" is a standard abbreviation for adeno-associated virus. Adeno-associated virus is a single-stranded DNA parvovirus that grows only in cells in which certain functions are provided by a co-infecting helper virus. There are currently thirteen serotypes of AAV that have been characterized. General information and reviews of AAV can be found in, for example, Carter, 1989, Handbook of Parvoviruses, Vol. 1, pp. 169-228; and Berns, 1990, Virology, pp. 1743-1764, Raven Press, (New York). However, it is fully expected that these same principles will be applicable to additional AAV serotypes since it is well known that the various serotypes are quite closely related, both structurally and functionally, even at the genetic level. (See, e.g ., Blacklowe, 1988, pp. 165-174 of Parvoviruses and Human Disease, J. R. Pattison, ed.; and Rose, Comprehensive Virology 3:1-61 (1974)). For example, all AAV serotypes apparently exhibit very similar replication properties mediated by homologous rep genes; and all bear three related capsid proteins. The degree of relatedness is further suggested by heteroduplex analysis which reveals extensive cross-hybridization between serotypes along the length of the genome; and the presence of analogous self-annealing segments at the termini that correspond to ITRs. The similar infectivity patterns also suggest that the replication functions in each serotype are under similar regulatory control.

[00124] AAV “Rep” and “Cap” genes are genes encoding replication and encapsidation proteins (i.e. Rep and Cap), respectively. AAV Rep and Cap genes have been found in all AAV serotypes examined to date and are described herein and in the references cited. In wild-type AAV, the rep and cap genes are generally found adjacent to each other in the viral genome (i.e., they are "coupled" together as adjoining or overlapping transcriptional units), and they are generally conserved among AAV serotypes. AAV rep and cap genes are also individually and collectively referred to as "AAV packaging genes." The AAV cap genes encode Cap proteins which are capable of packaging AAV vectors in the presence of rep and adeno helper function and are capable of binding target cellular receptors. In some embodiments, the AAV cap gene encodes a capsid protein having an amino acid sequence derived from a particular AAV serotype.

[00125] The nucleotide sequences employed for the production of rAAV virions can be derived from the genome of any AAV serotype. Generally, the AAV serotypes have genomic sequences of significant homology at the amino acid and the nucleic acid levels, provide a similar set of genetic functions, produce virions which are essentially physically and functionally equivalent, and replicate and assemble by practically identical mechanisms. For the genomic sequence of AAV serotypes and a discussion of the genomic similarities. (See, e.g. , GenBank Accession number U89790; GenBank Accession number JO 1901; GenBank Accession number AF043303; GenBank Accession number AF085716; Chiorini et al, J. Vir. (1997) vol. 71, pp. 6823-6833; Srivastava et al, J. Vir. (1983) vol. 45, pp. 555-564; Chiorini et al, J. Vir. (1999) vol. 73, pp. 1309-1319; Rutledge et al, J. Vir. (1998) vol. 72, pp. 309-319; and Wu et al, J. Vir. (2000) vol. 74, pp. 8635-8647).

[00126] The genomic organization of all known AAV serotypes is very similar. The genome of AAV is a linear, single-stranded DNA molecule that is less than about 5,000 nucleotides (nt) in length. ITRs flank the unique coding nucleotide sequences for the non- structural replication (Rep) proteins and the structural (VP) proteins. The VP proteins form the capsid. The terminal 145 nt are self-complementary and are organized so that an energetically stable intramolecular duplex forming a T-shaped hairpin may be formed. These hairpin structures function as an origin for viral DNA replication, serving as primers for the cellular DNA polymerase complex. The Rep genes encode the Rep proteins, Rep78, Rep68, Rep52, and Rep40. Rep78 and Rep68 are transcribed from the p5 promoter, and Rep 52 and Rep40 are transcribed from the pl9 promoter. The cap genes encode the VP proteins, VPl, VP2, and VP3. The cap genes are transcribed from the p40 promoter. The ITRs employed in the disclosed vectors may correspond to the same serotype as the associated cap genes or may differ. In a particularly preferred embodiment, the ITRs employed in the disclosed vectors correspond to an AAV2 serotype and the cap genes correspond to an AAV5 serotype.

[00127] In some embodiments, a nucleic acid sequence encoding an AAV capsid protein is operably linked to expression control sequences for expression in a specific cell type, such as Sf9 or HEK cells. Techniques known to one skilled in the art for expressing foreign genes in insect host cells or mammalian host cells can be used herein. Methodology for molecular engineering and expression of polypeptides in insect cells is described, for example, in Summers and Smith (1986) A Manual of Methods for Baculovirus Vectors and Insect Culture Procedures, Texas Agricultural Experimental Station Bull. No. 7555, College Station, Tex.; Luckow (1991) In Prokop et al, Cloning and Expression of Heterologous Genes in Insect Cells with Baculovirus Vectors' Recombinant DNA Technology and Applications, 97-152; King, L. A. and R. D. Possee (1992) The baculovirus expression system, Chapman and Hall, United Kingdom; O'Reilly, D. R., L. K. Miller, V. A. Luckow (1992) Baculovirus Expression Vectors: A Laboratory Manual, New York; W.H. Freeman and Richardson, C. D. (1995) Baculovirus Expression Protocols, Methods in Molecular Biology, volume 39; U.S. Pat. No. 4,745,051; US2003148506; and WO 03/074714, all of which are incorporated by reference in their entireties. A particularly suitable promoter for transcription of a nucleotide sequence encoding an AAV capsid protein is e.g. the polyhedron promoter. However, other promoters that are active in insect cells are known in the art, e.g. the plO, p35 or IE-1 promoters and further promoters described in the above references are also contemplated.

[00128] Use of insect cells for expression of heterologous proteins is well documented, as are methods of introducing nucleic acids, such as vectors, e.g., insect-cell compatible vectors, into such cells and methods of maintaining such cells in culture. (See, e.g. , METHODS IN MOLECULAR BIOLOGY, ed. Richard, Humana Press, N J (1995); O'Reilly et al.,

BACULO VIRUS EXPRESSION VECTORS, A LABORATORY MANUAL, Oxford Univ. Press (1994); Samulski et al., J. Vir. (1989) vol. 63, pp.3822-3828; Kajigaya et al., Proc. Nat'l. Acad. Sci. USA (1991) vol. 88, pp. 4646-4650; Ruffing et al., J. Vir. (1992) vol. 66, pp. 6922- 6930; Kirnbauer et al., Vir. (1996) vol. 219, pp. 37-44; Zhao et al., Vir. (2000) vol. 272, pp. 382- 393; and U.S. Pat. No. 6,204,059). In some embodiments, the nucleic acid construct encoding AAV in insect cells is an insect cell -compatible vector. An "insect cell-compatible vector" or "vector" as used herein refers to a nucleic acid molecule capable of productive transformation or transfection of an insect or insect cell. Exemplary biological vectors include plasmids, linear nucleic acid molecules, and recombinant viruses. Any vector can be employed as long as it is insect cell -compatible. The vector may integrate into the insect cells genome but the presence of the vector in the insect cell need not be permanent and transient episomal vectors are also included. The vectors can be introduced by any means known, for example by chemical treatment of the cells, electroporation, or infection. In some embodiments, the vector is a baculovirus, a viral vector, or a plasmid. In a more preferred embodiment, the vector is a baculovirus, i.e. the construct is a baculoviral vector. Baculoviral vectors and methods for their use are described in the above cited references on molecular engineering of insect cells.

[00129] The baculovirus shuttle vector or bacmids are used for generating baculoviruses. Bacmids propagate in bacteria such as Escherichia coli as a large plasmid. When transfected into insect cells, the bacmids generate baculovirus.

Methods for Producing Recombinant AA Vs

[00130] The present disclosure provides materials and methods for producing rAAV virions in insect, fungal, or mammalian cells. In some embodiments, the viral construct further includes a promoter and a restriction site downstream of the promoter to allow insertion of a polynucleotide encoding one or more proteins of interest, wherein the promoter and the restriction site are located downstream of the 5' AAV ITR and upstream of the 3' AAV ITR. In some embodiments, the viral construct further incudes a posttranscriptional regulatory element downstream of the restriction site and upstream of the 3' AAV ITR. In some embodiments, the viral construct further includes a polynucleotide inserted at the restriction site and operably linked with the promoter, where the polynucleotide includes the coding region of a protein of interest. As a skilled artisan will appreciate, any one of the AAV vectors disclosed in the present application can be used in the method as the viral construct to produce the rAAV virions.

[00131] The term “vector” is understood to refer to any genetic element, such as a plasmid, phage, transposon, cosmid, bacmid, mini-plasmid (e.g., plasmid devoid of bacterial elements), Doggybone DNA (e.g., minimal, closed-linear constructs), chromosome, virus, virion, etc., which is capable of replication when associated with the proper control elements and which can transfer gene sequences between cells.

[00132] The term “AAV helper” refer to AAV-derived coding sequences which can be expressed to provide AAV gene products that, in turn, function in trans for productive AAV replication. Thus, AAV helper functions include both of the major AAV open reading frames (ORFs), rep and cap. The Rep expression products have been shown to possess many functions, including, among others: recognition, binding and nicking of the AAV origin of DNA replication; DNA helicase activity; and modulation of transcription from AAV (or other heterologous) promoters. The Cap expression products supply necessary packaging functions. AAV helper functions are used herein to complement AAV functions in trans that are missing from AAV genome vectors.

[00133] The term “non-AAV helper function” refers to non-AAV derived viral and/or cellular functions upon which AAV is dependent for its replication. Thus, the term captures proteins and RNAs that are required in AAV replication, including those moieties involved in activation of AAV gene transcription, stage specific AAV mRNA splicing, AAV DNA replication, synthesis of Cap expression products and AAV capsid assembly. Viral-based accessory functions can be derived from any of the known helper viruses such as adenovirus, herpesvirus (other than herpes simplex virus type-1) and vaccinia virus.

[00134] The term “non-AAV helper function vector” refers generally to a nucleic acid molecule that includes nucleotide sequences providing accessory functions. An accessory function vector can be transfected into a suitable host cell, wherein the vector is then capable of supporting AAV virion production in the host cell. Expressly excluded from the term are infectious viral particles as they exist in nature, such as adenovirus, herpesvirus or vaccinia virus particles. Thus, accessory function vectors can be in the form of a plasmid, phage, transposon or cosmid. In particular, it has been demonstrated that the full-complement of adenovirus genes are not required for accessory helper functions. For example, adenovirus mutants incapable of DNA replication and late gene synthesis have been shown to be permissive for AAV replication. Ito et al., (1970) J. Gen. Virol. 9:243; Ishibashi et al, (1971) Virology 45:317. Similarly, mutants within the E2B and E3 regions have been shown to support AAV replication, indicating that the E2B and E3 regions are probably not involved in providing accessory functions. Carter et al., (1983) Virology 126:505. However, adenoviruses defective in the El region, or having a deleted E4 region, are unable to support AAV replication. Thus, El A and E4 regions are likely required for AAV replication, either directly or indirectly. Laughlin et al., (1982). J. Virol. 41:868; Janik et al., (1981) Proc. Natl. Acad. Sci. USA 78:1925; Carter et al., (1983) Virology 126:505. Other characterized Ad mutants include: E1B (Laughlin et al. (1982), supra; Janik et al. (1981), supra; Ostrove et al., (1980) Virology 104:502); E2A (Handa et al., (1975) J. Gen. Virol. 29:239;

Strauss et al., (1976) J. Virol. 17:140; Myers et al., (1980) J. Virol. 35:665; Jay et al., (1981)

Proc. Natl. Acad. Sci. USA 78:2927; Myers et al., (1981) J. Biol. Chem. 256:567); E2B (Carter, Adeno- Associated Virus Helper Functions, in I CRC Handbook of Parvoviruses (P. Tijssen ed., 1990)); E3 (Carter et al. (1983), supra); and E4 (Carter et al. (1983), supra; Carter (1995)). Although studies of the accessory functions provided by adenoviruses having mutations in the E1B coding region have produced conflicting results, Samulski et al., (1988) J. Virol. 62:206- 210, recently reported that ElB55k is required for AAV virion production, while ElB19k is not. In addition, International Publication WO 97/17458 and Matshushita et al., (1998) Gene Therapy 5:938-945, describe accessory function vectors encoding various Ad genes. Particularly preferred accessory function vectors comprise an adenovirus VA RNA coding region, an adenovirus E4 ORF6 coding region, an adenovirus E2A 72 kD coding region, an adenovirus El A coding region, and an adenovirus E1B region lacking an intact ElB55k coding region. Such vectors are described in International Publication No. WO 01/83797.

[00135] In some embodiments, the helper functions are provided by one or more helper plasmids or helper viruses including adenoviral or baculoviral helper genes. Non-limiting examples of the adenoviral or baculoviral helper genes include, but are not limited to, El A, E1B, E2A, E4 and VA, which can provide helper functions to AAV packaging.

[00136] Helper viruses of AAV are known in the art and include, for example, viruses from the family Adenoviridae and the family Herpesviridae. Examples of helper viruses of AAV include, but are not limited to, SAdV-13 helper virus and SAdV-13-like helper virus described in US Publication No. 2011/0201088 (the disclosure of which is incorporated herein by reference), helper vectors pHELP (Applied Viromics). A skilled artisan will appreciate that any helper virus or helper plasmid of AAV that can provide adequate helper function to AAV can be used herein.

[00137] In some embodiments, the AAV cap genes are present in a plasmid. The plasmid can further include an AAV rep gene which may or may not correspond to the same serotype as the cap genes. The cap genes and/or rep gene from any AAV serotype (including, but not limited to, AAV1 (NCBI Reference Sequence No./Genbank Accession No. NC_002077.1), AAV2 (NCBI Reference Sequence No./Genbank Accession No. NC_001401.2), AAV3 (NCBI Reference Sequence No./Genbank Accession No. NC_001729.1), AAV3B (NCBI Reference Sequence No./Genbank Accession No. AF028705.1), AAV4 (NCBI Reference Sequence No./Genbank Accession No. NC_001829.1), AAV5 (NCBI Reference Sequence No./Genbank Accession No. NC_006152.1), AAV6 (NCBI Reference Sequence No./Genbank Accession No. AF028704-1), AAV7 (NCBI Reference Sequence No./Genbank Accession No. NC_006260.1), AAV8 (NCBI Reference Sequence No./Genbank Accession No. NC_006261.1), AAV9 (NCBI Reference Sequence No./Genbank Accession No. AX7S3250.1), AAV10 (NCBI Reference Sequence No./Genbank Accession No. AY631965.1), AAV11 (NCBI Reference Sequence No./Genbank Accession No. AY631966.1), AAV12 (NCBI Reference Sequence No./Genbank Accession No. DQ813647.1), AAV13 (NCBI Reference Sequence No./Genbank Accession No. EU28SS62.1), Bba21, Bba26, Bba27, Bba29, Bba30, Bba31, Bba32, Bba33, Bba34, Bba35, Bba36, Bba37, Bba38, Bba41, Bba42, Bba43, Bba44, Bcel4, Bcel5, Bcel6, Bcel7, Bcel8, Bce20, Bce35, Bce36, Bce39, Bce40, Bce41, Bce42, Bce43, Bce44, Bce45, Bce46, Bey20, Bey22, Bey23, Bma42, Bma43, Bpol, Bpo2, Bpo3, Bpo4, Bpo6, Bpo8, Bpol3, Bpol8, Bpo20, Bpo23, Bpo24, Bpo27, Bpo28, Bpo29, Bpo33, Bpo35, Bpo36, Bpo37, Brh26, Brh27, Brh28, Brh29, Brh30, Brh31, Brh32, Brh33, Bfml7, Bfml8, Bfm20, Bfm21, Bfm24, Bfm25, Bfm27, Bfm32, Bfm33, Bfm34, Bfm35, AAV-rhlO, AAV-rh39, AAV-rh43, AAVanc80L65, or any variants thereof) can be used herein to produce the recombinant AAV Exemplary capsids are also provided in International Application No. WO 2018/022608 and WO 2019/222136, which are incorporated herein in its entirety. Each NCBI Reference Sequence Number or Genbank Accession Numbers provided above is also incorporated by reference herein. In some embodiments, the AAV cap genes encode a capsid from serotype 1, serotype 2, serotype 3, serotype 3B, serotype 4, serotype 5, serotype 6, serotype 7, serotype 8, serotype 9, serotype 10, serotype 11, serotype 12, serotype 13, or a variant thereof.

[00138] In some embodiments, the insect or mammalian cell can be transfected with the helper plasmid or helper virus, the viral construct and the plasmid encoding the AAV cap genes; and the rAAV particles can be collected at various time points after co-transfection. For example, the rAAV particles can be collected at about 12 hours, about 24 hours, about 36 hours, about 48 hours, about 72 hours, about 96 hours, about 120 hours, about 144 hours, about 168 hours, about 192 hours, about 216 hours, about 240 hours, or a time between any of these two time points after the co-transfection.

[00139] In various embodiments, the culturing step of any aspect or embodiment occurs in a volume of at least 5 milliliter (mL), at least 10 mL, at least 20 mL, at least 50 mL, at least 100 mL, at least 500 mL, at least 1 liter (L), at least 10 L, at least 50 L, at least 100L, at least 250 L, at least 500 L, at least 1000 L, at least 1500 L, at least 2000 L, or at least 2500 L.

[00140] In examples, the culturing step can occur in a shake flask or shake flasks. In various embodiments, the culturing step of any aspect or embodiment occurs in a volume of 5 mL, 10 mL, 20 mL, 30 mL, 40 mL, 50 mL, 60 mL, 70 mL, 80 mL, 90 mL, 100 mL, 200 mL, 300 mL, 400 mL, 500 mL, 600 mL, 700 mL, 800 mL, 900 mL, 1 L, 2 L, 3 L, 4 L, or 5 L. In other embodiments, the volume of the culturing step is a range between any two volumes provided above.

[00141] In other examples, the culturing step can occur in a bioreactor or bioreactors. In various embodiments, the culturing step of any aspect or embodiment occurs in a volume of 1 L, 2 L, 3 L, 4 L, 5 L, 6L, 7L, 8 L, 9 L, 10 L, 11 L, 12 L, 13 L, 14 L, 15 L, 16 L, 17 L, 18 L, 19 L,

20 L, 21 L, 22 L, 23 L, 24 L, 25 L, 26 L, 27 L, 28 L, 29 L, 30 L, 31 L, 32 L, 33 L, 34 L, 35 L, 36

L, 37 L, 38 L, 39 L, 40 L, 41 L, 42 L, 43 L, 44 L, 45 L, 46 L, 47 L, 48 L, 49 L, 50 L, 51 L, 52 L,

53 L, 54 L, 55 L, 56 L, 57 L, 58 L, 59 L, 60 L, 61 L, 62 L, 63 L, 64 L, 65 L, 66 L, 67 L, 68 L, 69

L, 70 L, 71 L, 72 L, 73 L, 74 L, 75 L, 76 L, 77 L, 78 L, 79 L, 80 L, 81 L, 82 L, 83 L, 84 L, 85 L,

86 L, 87 L, 88 L, 89 L, 90 L, 91 L, 92 L, 93 L, 94 L, 95 L, 96 L, 97 L, 98 L, 99 L, 100 L, 110 L, 120 L, 130 L, 140 L, 150 L, 160 L, 170 L, 180 L, 190 L, 200 L, 210 L, 220 L, 230 L, 240 L, 250 L, 260 L, 270 L, 280 L, 290 L, 300 L, 310 L, 320 L, 330 L, 340 L, 350 L, 360 L, 370 L, 380 L, 390 L, 400 L, 410 L, 420 L, 430 L, 440 L, 450 L, 460 L, 470 L, 480 L, 490 L, 500 L, 510 L, 520 L, 530 L, 540 L, 550 L, 560 L, 570 L, 580 L, 590 L, 600 L, 610 L, 620 L, 630 L, 640 L, 650 L, 660 L, 670 L, 680 L, 690 L, 700 L, 710 L, 720 L, 730 L, 740 L, 750 L, 760 L, 770 L, 780 L, 790 L, 800 L, 810 L, 820 L, 830 L, 840 L, 850 L, 860 L, 870 L, 880 L, 890 L, 900 L, 910 L, 920 L, 930 L, 940 L, 950 L, 960 L, 970 L, 980 L, 990 L, 1000 L, 1010 L, 1020 L, 1030 L, 1040 L, 1050 L, 1060 L, 1070 L, 1080 L, 1090 L, 1100 L, 1110 L, 1120 L, 1130 L, 1140 L, 1150 L, 1160 L, 1170 L, 1180 L, 1190 L, 1200 L, 1210 L, 1220 L, 1230 L, 1240 L, 1250 L, 1260 L, 1270 L, 1280 L, 1290 L, 1300 L, 1310 L, 1320 L, 1330 L, 1340 L, 1350 L, 1360 L, 1370 L, 1380 L, 1390 L, 1400 L, 1410 L, 1420 L, 1430 L, 1440 L, 1450 L, 1460 L, 1470 L, 1480 L, 1490 L, 1500 L, 1510 L, 1520 L, 1530 L, 1540 L, 1550 L, 1560 L, 1570 L, 1580 L, 1590 L, 1600 L, 1610 L, 1620 L, 1630 L, 1640 L, 1650 L, 1660 L, 1670 L, 1680 L, 1690 L, 1700 L, 1710 L, 1720 L, 1730 L, 1740 L, 1750 L, 1760 L, 1770 L, 1780 L, 1790 L, 1800 L, 1810 L, 1820 L, 1830 L, 1840 L, 1850 L, 1860 L, 1870 L, 1880 L, 1890 L, 1900 L, 1910 L, 1920 L, 1930 L, 1940 L, 1950 L, 1960 L, 1970 L, 1980 L, 1990 L, 2000 L, 2010 L, 2020 L, 2030 L, 2040 L, 2050 L, 2060 L, 2070 L, 2080 L, 2090 L, 2100 L, 2110 L, 2120 L, 2130 L, 2140 L, 2150 L, 2160 L, 2170 L, 2180 L, 2190 L, 2200 L, 2210 L, 2220 L, 2230 L, 2240 L, 2250 L, 2260 L, 2270 L, 2280 L, 2290 L, 2300 L, 2310 L, 2320 L, 2330 L, 2340 L, 2350 L, 2360 L, 2370 L, 2380 L, 2390 L, 2400 L, 2410 L, 2420 L, 2430 L, 2440 L, 2450 L, 2460 L, 2470 L, 2480 L, 2490 L, 2500 L, 2510 L, 2520 L, 2530 L, 2540 L, 2550 L, 2560 L, 2570 L, 2580 L, 2590 L, 2600 L, 2610 L, 2620 L, 2630 L, 2640 L, 2650 L, 2660 L, 2670 L, 2680 L, 2690 L, 2700 L, 2710 L, 2720 L, 2730 L, 2740 L, 2750 L, 2760 L, 2770 L, 2780 L, 2790 L, 2800 L, 2810 L, 2820 L, 2830 L, 2840 L, 2850 L, 2860 L, 2870 L, 2880 L, 2890 L, 2900 L, 2910 L, 2920 L, 2930 L, 2940 L, 2950 L, 2960 L, 2970 L, 2980 L, 2990 L, or 3000 L. In other embodiments, the volume of the culturing step is a range between any two volumes provided above.

[00142] rAAV particles can also be produced using methods disclosed in various embodiments. In some instances, rAAV particles can be produced by using an insect or mammalian cell that stably expresses some of the necessary components for rAAV particle production. For example, a plasmid (or multiple plasmids) including AAV rep and cap genes, and a selectable marker, such as a neomycin resistance gene, can be integrated into the genome of the cell. In another example, a plasmid (or multiple plasmids) including a regulatory protein and a selectable marker, such as a neomycin resistance gene, can be integrated into the genome of the cell. The insect, fungal, or mammalian cell can then be co-infected with a helper virus (e.g., adenovirus or baculovirus providing the helper functions) and the viral vector including the 5' and 3' AAV ITR (and the nucleotide sequence encoding the heterologous protein, if desired). The advantages of this method are that the cells are selectable and are suitable for large-scale production of the rAAV. As another non-limiting example, adenovirus or baculovirus rather than plasmids can be used to introduce a host regulatory gene, rep gene, and cap gene into packaging cells. As yet another non-limiting example, both the viral vector containing the 5' and 3' AAV ITRs, the host regulatory gene, or the rep-cap genes can be stably integrated into the DNA of producer cells, and the helper functions can be provided by a wild-type adenovirus to produce the rAAV.

[00143] In various embodiments, the virus or virions encoding the regulatory protein of any embodiment such as rBV infects a host cell at a multiplicity of infection (MOI) of less than 1, 5, 10, 100, 250, 500, or 1000. In various embodiments, the MOI is a range between any two MOIs listed above. For example, the MOI range is 1 to 5 or 1 to 1000.

[00144] In various embodiments, the modified expression of the regulatory protein increases rAAV production by at least 10%, at least 50%, at least 100%, at least 500%, at least 1000%, at least 5000%, or at least 10000%.

[00145] In various embodiments, the modified expression of the regulatory protein increases the potency or infectivity of the rAAV virions by at least 10%, at least 50%, at least 100%, or at least 500%.

[00146] In various embodiments, the modified expression of the regulatory protein increases the incorporation of VP1 proteins, where the VP1 proteins are 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, or 50% of capsid proteins. In other embodiments, the VP1 protein percentage is a range between any two percentages provided above.

[00147] In various embodiments, the modified expression of the regulatory protein increases the incorporation of VP1 proteins, where the average number of VP1 proteins in the capsids is

1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24,

24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 30.5, 31, 31.5, 32, 32.5, 33, 33.5, 34, 34.5, 35, 35.5, 36, 36.5, 37, 37.5, 38, 38.5, 39, 39.5, or 40. In other embodiments, the average number of VP1 proteins in the capsids is a range between two values provided above. In other embodiments, the VP1 protein per rAAV capsid is at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, 5 to 10, 6 to 9, 5, 6, 7, 8, 9, or 10.

[00148] In various embodiments, the modified expression of the regulatory protein alters the ratio of VP1, VP2, and VP3 proteins of the capsids relative to the capsids produced in a host cell without the modification.

[00149] In various embodiments, the modified expression of the regulatory protein decreases production of rAAV capsids devoid of encapsulated vector genomes by at least 0.1%, 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 99%+, or 100%. In other embodiments, the decreases production of rAAV capsids devoid of encapsulated vector genomes is a range between any two percentages provided above. It is noted that rAAV capsids devoid of encapsulated vector genomes are therapeutically ineffective such that the rAAV capsids are incapable of infecting cells or a cell infected with therapeutically ineffective rAAV particles are unable to express (e.g. by transcription and/or by translation) an element (e.g. nucleotide sequence, protein, etc.) of interest. Therapeutically ineffective rAAV particles can contribute to decreased effectiveness per unit dose of capsid and can increase the risk of an immune response due to a needed increased amount of foreign proteins being introduced into the patient for an effective amount of heavy/full/partially full capsid.

[00150] In various embodiments, the modified expression of the regulatory protein alters post translational modifications of at least one of VP1, VP2, and VP3 proteins that are incorporated into the capsids of rAAV virions relative to post translational modifications of at least one of VP1, VP2, and VP3 proteins incorporated into capsids of rAAV virions produced in an insect host cell without the modification. In other embodiments, the modified expression of the regulatory protein alters post translational modifications of vector genomes such that the number of capsids having vector genomes are increased. In further embodiments, the modified expression of the regulatory protein alters post translational modifications of Rep proteins. Post translational modifications refers to the covalent and generally enzymatic modification of proteins following protein biosynthesis. Examples of post translational modifications include phosphorylation, glycosylation, hydroxylation, methylation, acylation, acetylation, amidation, alkylation, ubiquitination, and amide bond formation. Post translational modifications can also include increased folding of proteins and nucleotides.

[00151] In various embodiments, the modified expression of the regulatory protein allows for the production rAAV virions or capsids. It is noted that in testing different capsid sequences, some capsids are unable to be recombinantly expressed by cells that do not have the modified expression of the regulatory protein or insect host cell without the modification generates an undetectable concentration of rAAV virions. The term “undetectable” refers concentrations below the limit of detection of analytical techniques such as, for example, PCR (e.g., ddPCR), enzyme-linked immunosorbent assay, size exclusion chromatography-high performance liquid chromatography (SEC-HPLC), and potency assays (e.g., measuring expression of transgenes in cell infected with rAAV virions).

Cell Types Used in AA V Production

[00152] The rAAV particles including the AAV vectors of the invention may be produced using any invertebrate cell type which allows for production of AAV or biologic products and which can be maintained in culture. For example, the insect cell line used can be from Spodoptera frugiperda , such as Sf9, Sf21, Sf900+, drosophila cell lines, mosquito cell lines, e.g., Aedes albopictus derived cell lines, domestic silkworm cell lines, e.g., Bombyxmori cell lines, Trichophma ni cell lines such as High Five cells or Lepidoptera cell lines such as Ascalapha odorata cell lines. Exemplary insect cells are cells from the insect species which are susceptible to baculovirus infection, including High Five, Sf9, Sf-RVN, Se301, SeIZD2109, SeUCRl, Sf900+, Sf21, BTI-TN-5B1-4, MG-1, Tn368, HzAml, BM-N, Ha2302, Hz2E5 and Ao38.

[00153] In another aspect of the invention, the methods of the invention are also carried out with any mammalian cell type which allows for replication of AAV or production of biologic products, and which can be maintained in culture. Exemplary mammalian cells used can be HEK293, HeLa, CHO, NS0, SP2/0, PER.C6, Vero, RD, BHK, HT 1080, A549, Cos-7, ARPE-19 and MRC-5 cells.

[00154] In another aspect of the invention, the methods of the invention are also carried out with any fungal cell type which allows for replication of rAAV or production of biologic products, and which can be maintained in culture. Exemplary fungal host cells are derived from a yeast host cell, such as a host cell of the species Saccharomyces cerevisiae , and includes strains such as YPH501, RSY12 or YRS5 CT.

[00155] Control sequences. The description below discloses the recombinant production of VP1, VP2, VP3, large and small Rep, AAP, helper proteins, and exogenous payload genes; these are coupled to appropriate expression control sequences. These expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (poly A) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product. A great number of expression control sequences, including promoters which are native, constitutive, inducible and/or tissue-specific, are known in the art and may be utilized. Useful promoters in yeast include GALl, GALIO, GAL7, ADH2, TEF1, TDH3, and ADH1.

[00156] Viral genome. According to embodiments of the present invention, the rAAV virions produced can have a recombinant viral genome. The genome typically includes two inverted terminal repeats and one or more genes exogenous to AAV along with genetic control sequences to cause the exogenous gene(s) to be expressed. In this context, the “gene” can encode a protein via mRNA or pre-mRNA, or can produce a regulatory polynucleotide (e.g., antisense, RNAi, miRNA, etc.).

[00157] Exogenous gene/polynucleotide. As is known in the art, the rAAV can be infectious to a human or other mammalian subject such that the gene is expressed in vivo in the subject after infection, thereby conferring a therapeutic or experimental effect. The exogenous gene coding sequences can include start and stop sequences and be operably linked to expression control sequences; e.g., a promoter, and a polyadenylation sequence. The exogenous (payload) gene can express a growth factor, a neurotrophic factor, a serpin, a clotting factor, a metabolic enzyme, a cytokine, an interferon, an interleukin, an anti -angiogenic protein, a structural protein or other peptide or protein, or a regulatory polynucleotide. For example, the exogenous gene can express alpha-one antitrypsin, clotting factor IX, clotting factor VIII, clotting factor VII, dystrophin, alpha- sarcoglycan, beta- sarcoglycan, delta- sarcoglycan, epsilon-sarcoglycan, tyrosine hydroxylase, aromatic acid decarboxylase, GTP cyclohydrolase I, erythropoietin, aspartoacylase (ASP A), Nerve growth factor (NGF), lysosomal beta-glucuronidase (GUSB), insulin, alpha- synuclein, basic fibroblast growth factor (FGF-2), IGF1, alpha-galactosidase A (alpha-gal A), neurotrophin-3, Neuroglobin (Ngb), angoigenic proteins (vascular endothelial growth factor (VEGF165)), GM-CSF (granulocyte-macrophage colony-stimulating factor), M-CSF (macrophage colony-stimulating factor), a tumor necrosis factor, a growth factors, TGF-beta, IL- 10, IL-13, IL-4, platelet-derived growth factor, CNTF (ciliary Neurotrophic factor), brain- derived neurotrophic factor (BDNF), and GDNF (glial cell line derived neurotrophic factor), a RNAi, miRNA, or antisense RNA.

[00158] Capsid Proteins/AAV Serotypes. The host cell produces recombinant capsid proteins sufficient to form a capsid. This includes at least VP1 and VP3 proteins, but more typically, all three of VP1, VP2, and VP3 proteins, as found in native AAV. The sequence of the capsid proteins determines the serotype of the AAV virions produced by the host cell. rAAV vectors and virions useful in the invention include those derived from a number of AAV serotypes, including 1, 2, 3, 3B, 4, 5, 6, 7, 8 , 9, 10, 11, 12, 13 or mixed serotypes (see, e.g., US Patent No. 8318480 for its disclosure of non-natural mixed serotypes). The capsid proteins can also be variants of natural VPl, VP2 and VP3, including mutated, chimeric or shuffled proteins. The capsid proteins can be those of rh.10 or other subtype within the various clades of AAV; various clades and subtypes are disclosed, for example, in U.S. Patent No. 7,906,111. Because of wide construct availability and extensive characterization, illustrative AAV vectors disclosed below are derived from serotype 2. Construction and use of AAV vectors and AAV proteins of different serotypes are discussed in Chao et al., Mol. Ther. 2:619-623, 2000; Davidson et al., PNAS 97:3428-3432, 2000; Xiao et al., J. Virol. 72:2224-2232, 1998; Halbert et al., J. Virol. 74:1524- 1532, 2000; Halbert et al., J. Virol. 75:6615-6624, 2001; and Auricchio et al., Hum. Molec.

Genet. 10:3075-3081, 2001.

[00159] The capsid VP proteins can be linked to suitable expression control sequences and encoded on plasmids or integrated into the yeast cell chromosome. The capsid VP genes can be codon optimized for expression in yeast. Because VPl, VP2, and VP3 can be expressed independently and without sharing overlapping sequences or relying on alternative transcript initiation or splicing, a finer control of VPl, VP2 and VP3 amounts and ratios can be achieved using the present method, as compared to AAV production using conventional mammalian cell culture. Furthermore, a hybrid AAV can be produced where the VPl, VP2 and VP3 genes do not all come from the same serotype. In other words, at least one of VP1, VP2, and VP3 is of a different serotype than the remaining VP proteins. Thus, the hybrid particle includes proteins from 2 or 3 serotypes.

[00160] Rep Proteins. In order to promote viral production, AAV Rep-producing genes can be expressed in the host cell. The rep genes can be linked to suitable expression control sequences and encoded on plasmids or integrated into the yeast cell chromosome. It has been found that infectious particles can be produced when at least one large Rep protein (Rep78 or Rep68) and at least one small Rep protein (Rep52 and Rep40) are expressed in yeast. In a specific embodiment all four of Rep 78, Rep68, Rep52 and Rep 40 are expressed. Alternately, Rep78 and Rep52, Rep78 and Rep40, Rep 68 and Rep52, or Rep68 and Rep40 are expressed. Examples below demonstrate the use of the Rep78/Rep52 combination. Rep proteins can be derived from AAV-2 or other serotypes.

[00161] Assembly-activating protein. In order to promote viral assembly, the host cell expresses recombinant assembly-activating protein (AAP). The AAP expressing gene can be linked to suitable expression control sequences and encoded on plasmids or integrated into the yeast cell chromosome. AAP can be derived from AAV-2 or other serotypes.

[00162] Helper Proteins. In addition to the capsid, Rep, and AAP genes, embodiments include exogenous polynucleotides that express helper proteins. Without limitation, helper gene products that can be expressed in the host cell in various combinations include Spodoptera frugiperda FKBP46, human FKBP52, Adenovirus El A, E1B, E2A, E4 and VA, Herpes simplex virus UL29, UL30, UL42, U15, UL8, UL52, and UL9. In an embodiment, the cell expresses at least one immunophilin analogue (i.e., an immunophilin or similar protein) and at least one helper virus gene product.

[00163] Purification. To purify rAAV virions from cultured host cells, a number of methods may be employed. In general, the cells are lysed and the virus can be purified. Alternatively, the virus is expressed into the supernatant and purified by centrifugation, filtration, tangential flow filtration, chromatography, or a combination thereof.

[00164] In one example of such a method, the insect cells are resuspended in lysis buffer (20 mM Tris-Cl pH=8, 150 mM NaCl, 0.5% deoxychloate), and lysed using glass beads. The lysate is treated with Benzonase (Sigma, St. Louis, Mo.) and centrifuged at 4000 g and the supernatant is chromatographed on Streamline HE column (Pharmacia), Phenyl Sepharose, and POROS HE (Potter et al., Methods Enzymol 346:413-30, 2002).

[00165] A further method using centrifugation in NaCl followed by centrifugation in a CsCl gradient is given in Example 5 of Ei.S. Patent Publication No. 2015/0071883. Yet another method using AVB Sepharose is given in Example 2, below.

[00166] Encapsidation/Infectivity. To assess vector genome encapsidation, the purified AAV virion can be treated with nuclease to degrade any non-encapsidated DNA. The encapsidated DNA will be protected from the nuclease and thus be detectable after the nuclease treatment.

The Examples below demonstrate vector genomes that survive Benzonase treatment, as determined by Southern blotting.

[00167] To assess virion performance, the purified rAAV virions are used to infect HEK293 cells in culture or are injected into mouse skeletal muscle to assess their infectivity by scoring for cells expressing GFP. Where the payload gene is not optically accessible, other detection techniques such as Western blotting, immunoassay, PCR, or reverse transcription PCR, or functional assay can be employed to assess infectivity. In Example 3 of U.S. Patent Publication No. 2015/0071883, immunoassay and coagulation assays are used to assess transduction of Rag2 mice with Factor VIII-expressing rAAV. Thus, the measure of infectivity can vary depending on the payload gene and model system.

[00168] Generally, the virions are infectious such that upon incubating a HEK293 cell in the presence of a virion solution containing 10⁷ (10^{^}7, 1E07) viral genomes, the exogenous gene is expressed in detectable amounts by the cell. Alternately, the virions are infectious such that upon incubating a HEK293 cell in the presence of a virion solution containing 10^{^}6 viral genomes, the exogenous gene is expressed in detectable amounts by the cell.

[00169] Formulation. Various formulations of rAAV are known in the art. Purified rAAV can be diluted or dialyzed into saline with optional buffer, carrier, and/or stabilizer. Known AAV formulations include those using polaxamer, PEG, sugar, polyhydric alcohols, or multivalent ion salts. See, e.g., U.S. Patent Nos. 8,852,607 and 7,704,721. An exemplary formulation is 1.38 mg/ml sodium phosphate, monobasic monohydrate, 1.42 mg/ml sodium phosphate, dibasic (dried), 8.18 mg/ml sodium chloride, 20 mg/ml mannitol and 2.0 mg/ml Poloxamer 188 (Pluronic F-68), pH 7.4. [00170] Other aspects and advantages of the present disclosure will be understood upon consideration of the following illustrative examples.

EXAMPLES

Example 1

Strain and culture media

[00171] S. cerevisiae strain YPH501 (MATa/MATa ura3-52/ura3-52 Iys2-801/lys2-801 ade2- 101/ade2-101 trpl-A63/trpl-A63 his3-A200/his3-A200 Ieu2-Al/Ieu2-Al) was obtained from Agilent Technologies. 20% glycerol stocks were maintained at -80°C. YPD broth (1% yeast extract, 2% peptone, 2% dextrose) was used for culture start-up. Synthetic complete (SC) media lacking the appropriate amino acids was used for yeast transformation. SC media supplemented with 0.1M Na2HP04/NaH2P04 phosphate buffer and 2% glucose or 3% galactose was used for fermentation of AAV-producing strains. Flasks were incubated in a MaxQ orbital shaker (Thermo Fisher) at 30°C and 250 rpm agitation.

[00172] Sf9 cells were cultured in Sf900III-SFM (Life Technologies). Flasks were incubated in a Multitron orbital shaker (Infors HT) at 28°C temperature and 125 rpm agitation.

Plasmid design

[00173] Coding sequences for AAV2 capsid and replication proteins were amplified from a pAAV RC2 plasmid and inserted into pESC 2-micron plasmids under the control of galactose- induced promoters, as described in Barajas et al. (Barajas et al, 2017). Briefly, all plasmids were generated using a pESC plasmid (Agilent Technologies) as vector. DB046 contains a His3 selection marker and VP3 and AAP expression cassettes controlled by GALl/10 bidirectional promoter. DB228 and DB138 plasmids contain a Leu2 selection marker and GAL-based Rep52 and VP1 expression cassettes. DB029 plasmid contains a Trpl selection marker and GAL-based Rep78 and VP2 expression cassettes. JA001 plasmid consolidated the aforementioned AAV coding sequences into one plasmid. Plasmid DB040 is a pAAV-GFP-based plasmid (Cell Biolabs) containing Ura3 and 2-micron sequences. JA002 plasmid resembles DB040, with the difference that a Leucine marker was placed instead of the original Uracil marker. Protein overexpression plasmids were generated using DB327 (pESC(U)-GALlO-), as a backbone vector. Specific primer sets (see Table 1) were designed to amplify coding sequences from yeast genomic DNA. Smaa-digested DB327 plasmid and amplified sequences were ligated by Gibson assembly. DB3272-micron and CEN variants were generated to promote high and low gene copy number, respectively.

[00174] The plasmid pFastBac (ThermoFisher) was modified to include a blasticidin resistance gene and the baculovirus HR5 region in the plasmid backbone, outside of the Tn7 transposable cassette, generating pFB-HR5-BSD. S. frugiperda HSC70 and HSP40 were PCR amplified with primers 1010/1011 and 1008/1009 respectively and inserted into Xhol-linearized pFB-HR5-BSD under the control of a polh promoter, generating plasmids pFB-HR5-BSD- HSC70 and pFB-HR5-BSD-HSP40. To generate the plasmid pFB-HR5-BSD-HSC70-HA- HSP40-HA, expressing the two HA-tagged proteins from a polh and a plO promoter respectively, the HSC70 gene was amplified with primers 1150/1140; a SV40 terminator-plO promoter DNA fragment was amplified with primers 1141/1142 from pFB-inCap-inRep (Chen, 2008); and HSP40 was amplified with primers 1143/1151 (see Table 5). The three DNA fragments were inserted by Gibson assembly into BamHI/XhoI-digested pFB-HR5-BSD. The resulting plasmids were transformed into E. coli DHlOBac strain to generate recombinant bacmids following the Bac-to-bac system (Thermo Fisher Scientific).

Baculovirus viral stocks

[00175] Three baculovirus strains were developed in the lab using the Bac-to-bac system (Thermo Fisher Scientific). rBV-GFP contains the green fluorescent protein gene controlled by a CMV promoter. The cassette is flanked by AAV inverted terminal repeats (ITRs). rBV-RepCap contains the Rep and Cap genes controlled by plO and polh promoters, respectively. rBV-HSP is used to overexpressed specific insect cell proteins. Viral stocks were generated in Sf9 cells. The stocks were maintained at 4°C in the dark.

Proteomic profiling study design

[00176] The experimental design was aimed at identifying protein expression differences between AAV-producing and non-producing YPH501 strains. The YPH501-AAV strain was developed by transformation with plasmids DB046, DB138, DB029 and DB040. A control strain was generated by transformation with 4 pESC empty plasmids. Fermentation was performed in 250-mL shake flasks containing 50 mL of SC medium + 2% glucose. Each strain was inoculated at an approximated cell density of 0.2 OD 600nm. An orbital shaker was used to agitate flasks at a rate of 240 rpm. After 24 hours of culture, medium was exchanged with fresh SC medium + 0.1M phosphate buffer + 2% galactose to induce AAV protein expression (Figure 1A). Culture was extended for four days after media exchange. Cell growth, pH, and AAV protein expression were monitored throughout the culture. This experiment was performed in triplicate, at three different times for both strains (n = 9). Yeast biomass samples were taken on days 0, 2 and 3 post induction to analyze their proteomic profile.

Sample preparation

[00177] Sample were prepared for mass spectrometry (MS) analysis following the methodology suggested by Paulo et al (Paulo et al., 2015). Cells were washed twice with water and suspended in a buffer containing 50 mM HEPES (pH 8.5), 8 M urea, 75 mM NaCl, and protease inhibitors Complete Mini (EDTA-free) and PhosStop (Roche). The cell suspension was concentrated to approximately 1.5-2 OD 600nm. Glass beads were added to the suspension in a cells: buffer: beads ratio of approximately 1:2:2. Cell suspensions were submitted to three homogenization cycles of 30 seconds each with 30-second rest intervals, using a Maxiprep 24 homogenizer. Lysates were centrifuged at lOOg x 5 min and supernatant was aliquoted for further treatment. Sample aliquots were reduced by incubation in 5 mM tris 2-carboxyethyl phosphine (TCEP) for 25 minutes at room temperature. Alkylation was subsequently performed by 30 minute incubation with lOmM iodoacetamide. Immediately after, samples were incubated in 15 mM Dithiothreitol (DTT), and protein fractions were separated by methanol chloroform precipitation. Protein concentration of all samples was monitored by using BCA assay kit (Thermo Fisher Scientific). Protein fractions were dissolved in 50 mM HEPES + 0.05%

Rapigest, and digested with trypsin (EMD Millipore) at 100:1 protein to protease ratio, for 6 hours at 37°C. Enzymatic digestion was stopped by addition of 1% formic acid. Prepared samples were flash frozen for further analysis.

Liquid chromatography - mass spectrometry

[00178] A chromatographic separation was performed using Acquity M-Class UPLC fitted with an Acquity HSS T3 column (1.8 pm, 1.0 x 150 mm, 100 A; Waters Corporation). Peptides were separated with a reversed-phase gradient elution running 0.1% formic acid and 0.1% formic acid in acetonitrile (Burdick and Jackson) from 3% B to 40% B over 80 minutes at 25 pL/min. Prior to injection on the column, 2 pg peptide sample solutions were spiked with 500 fmol of Hi3 E. coli peptide internal standard mixture (Waters Corporation) for subsequent quantitation by the “Hi3” method (Silva et al., 2006). Proteomics data was acquired on a Synapt G2-Si mass spectrometer (Waters Corporation) operating in HDMS^E mode. Raw mass spectrometry data was processed for proteomics analysis with Progenesis QI for Proteomics software (version 3.0, Nonlinear Dynamics). Chromatograms were aligned and normalized using the “all proteins” approach. Peptides were identified within Progenesis from a search of the Uniprot Saccharomyces cerevisiae database (UP000002311) appended to include key AAV protein amino acid sequences and Hi3 internal standard peptides. Peptide search criteria included 10 ppm mass measuring accuracy, fixed carbamidomethylation, variable methionine oxidation, and a 4% false discovery rate. Ion matching requirements were two or more fragments/peptide, three or more fragments/protein, and one or more peptides/protein.

Bioinformatics data analysis

[00179] Preliminary Progenesis protein expression data was refined by establishing a cut-off confidence ID value of 15, and the presence of at least two unique peptides per hit. Principal component analysis was performed in JMP 12 software (SAS) to visualize sample clustering and to identify potential run outliers. The analysis was run under the default estimation method.

Basic statistical analysis (mean, standard deviation, p--value) of MS data was performed using Progenesis QI software and Microsoft Excel. An adjusted ANOVA p-v alue of 5xl0^'5 was used to determine statistical difference in protein expression among conditions and/or time points.

[00180] Heatmapper software (Babicki et al., Nucleic Acids Res. 44(W1): W147-53, 2016) was used to identify and cluster proteins with similar protein expression changes. Expression patterns of time-course variability (log2 change) within each strain and between strains were evaluated. The “average” clustering method was selected for the analysis. DAVID bioinformatics database (available at the Laboratory of Human Retrovirolgy and Immunoinformatics website) was used for gene ontology enrichment analysis. A Benjamini corrected P-value of 0.05 was established for the analysis. Additional bioinformatics analysis was performed using STRING network interaction database (Elixir Core Data Resources). A high confidence interaction score (0.7) was selected for predicted interaction analysis.

Protein overexpression study [00181] The effect of protein overexpression on vector yield was assessed. Results from protein profiling led to the identification of protein candidates that could potentially improve AAV expression. Nineteen candidates were screened by using a AAV 2-plasmid yeast system (JA001 and JA002) on which a third plasmid containing the coding sequence of a protein of interest controlled by GALIO promoter was transformed. Four clones per strain were isolated and grown in 24-deep well plates following the fermentation strategy described above. 500 pL samples were taken, and benzonase-resistant vector yield from each yeast lysate was determined. Paired, one-tailed T-tests were performed between each variable and control strains to determine if the average yield of the variable strain was significantly higher.

AAV production in Sf9 cells

[00182] Sf9 cells were inoculated in a 250-mL shake flask containing 50 mL of Sf900III-SFM medium. Cells were incubated at 28°C and 135 rpm agitation. Three rBV stocks (rBV-GFP, rBV- RepCap, rBV-HSP) were added to the culture. Viable cell density, viability and cell diameter was monitored with the use of the VI-CELL® analyzer (Beckman Coulter). The culture progressed until viability percent is approximately 40% or lower. Crude harvest was centrifuged at 4300g x 15 min and then filtered with a 0.22 pm, PVDF -based syringe filter. AAV vg titer was determined by digital droplet PCR (ddPCR) analysis of the benzonase-treated harvest.

AAV analytical testing

[00183] ddPCR was performed as described in Barajas (Barajas et al, 2017) to quantify benzonase-resistant AAV DNA. Yeast treated material was diluted 100: 1000-fold to target the ddPCR dynamic range. Five pL of diluted material were mixed with 20 pL of Taqman-based master mix (BioRad) including GFP primers DB307/DB309 and a FAM dye-labeled probe DB308. Droplets were generated by an automated droplet generator (Biorad), and amplified material was analyzed in a QX200 droplet reader (Biorad) using Quantasoft software (Biorad).

Example 2

Proteome Profiling in AAV-Producing Yeast

[00184] Coding sequences for AAV2 capsid and replication proteins were amplified from a pAAV RC2 plasmid and inserted into pESC 2-micron plasmids under the control of galactose- induced promoters, as described in Barajas et al. (Barajas et al, 2017). Briefly, all plasmids were generated using a pESC plasmid (Agilent Technologies) as vector. DB046 contains a His3 selection marker and VP3 and AAP expression cassettes controlled by GALl/10 bidirectional promoter. DB228 and DB138 plasmids contain a Leu2 selection marker and GAL-based Rep52 and VP1 expression cassettes. DB029 plasmid contains a Trpl selection marker and GAL-based Rep78 and VP2 expression cassettes. JA001 plasmid consolidated the aforementioned AAV coding sequences into one plasmid. Plasmid DB040 is a pAAV-GFP-based plasmid (Cell Biolabs) containing Ura3 and 2-micron sequences. JA002 plasmid resembles DB040, with the difference that a leucine marker was placed instead of the original uracil marker. Protein overexpression plasmids were generated using DB327 (pESC(U)-GALlO-), as a backbone vector. Specific primer sets (Table 1) were designed to amplify coding sequences from yeast genomic DNA. Smal-digested DB327 plasmid and amplified sequences were ligated by Gibson assembly. DB3272-micron and CEN variants were generated to promote high and low gene copy number, respectively.

Table 1

Name Description Sequence

JA043 HSP82-F CGACTC ACT AT AGGGCCCATGGCT AGTG AAACTTTT G (SEQ ID NO: 32) JA044 HSP82-R CCATGTCGACGCCCCTAATCTACCTCTTCCATTTCGG (SEQ ID NO: 33)

JA045 HSC82-F C G ACT C ACTAT AGGGCCCAT G GCTG GT G AAACTTTT G (SEQ ID NO: 34) JA046 HSC82-R CCATGTCGACGCCCTTAATCAACTTCTTCCATCTCGG (SEQ ID NO: 35)

JA047 CPR6-F CGACTC ACT AT AGGGCCCAT G ACTAGACCT AAAACTTTTTTT G (SEQ ID NO: 36)

JA048 CPR6-R CCATGTCGACGCCCTCAGGAGAACATCTTCGAAAG (SEQ ID NO: 37)

JA049 SSA1-F CGACTCACTATAGGGCCCATGTCAAAAGCTGTCGG (SEQ ID NO: 38) JA050 SSA1-R CCATGTCGACGCCCTTAATCAACTTCTTCAACGGTTGG (SEQ ID NO: 39)

JA051 MDJ1-F CGACTCACTATAGGGCCCATGGCTTTCCAACAAGGTG (SEQ ID NO: 40) JA052 MDJ1-R CCATGTCGACGCCCTTAATTTTTTTTGTCACCTTTGATC (SEQ ID NO: 41)

JA053 SSC1-F CGACTC ACT AT AGGGCCCATGCTT GCTGCT AAAAAC AT AC (SEQ ID NO: 42)

JA054 SSC1-R CCATGTCGACGCCCTTACTGCTTAGTTTCACCAGATTC (SEQ ID NO: 43)

JA055 HSP60-F CGACTC ACT AT AGGGCCCATGTT GAGAT CATCCGTT G (SEQ ID NO: 44)

JA056 HSP60-R CCATGTCGACGCCCTTACATCATACCTGGCATTCC (SEQ ID NO: 45)

JA057 GAD1-F CGACTCACTATAGGGCCCATGTTACACAGGCACGGTTC (SEQ ID NO: 46)

JA058 GAD1-R CCATGTCGACGCCCTCAACATGTTCCTCTATAGTTTCTC (SEQ ID NO: 47) JA059 RLI1-F CGACTCACTATAGGGCCCATGAGTGATAAAAACAGTCGTATC (SEQ ID NO: 48)

JA060 RLI1-R CCATGTCGACGCCCTTAAATACCGGTGTTATCCAAG (SEQ ID NO: 49)

JA061 PAT1-F CGACTCACTATAGGGCCCATGTCCTTCTTTGGGTTAG (SEQ ID NO: 50)

JA062 PAT1-R CCATGTCGACGCCCTTACTTTAGTTCTGATATTTCACCATC (SEQ ID NO: 51)

JA063 RVB2-F CGACTCACTATAGGGCCCATGTCGATTCAAACTAGTGATCC (SEQ ID NO: 52)

JA064 RVB2-R CCATGTCGACGCCCTTATTCCGTAGTATCCATGGCATC (SEQ ID NO: 53)

JA065 RPT2-F CGACTCACTATAGGGCCCATGGGACAAGGTGTATCATC (SEQ ID NO: 54)

JA066 RPT2-R COAT GTCGACGCCCTCACAAGT AT AAACCTTCT AAATTTTCC (SEQ ID NO: 55)

JA067 RPN6-F CGACTCACTATAGGGCCCATGTCTCTGCCAGGTTCG (SEQ ID NO: 56)

JA068 RPN6-R CCATGTCGACGCCCCTAATACAAGACACTTGCCTTTTC (SEQ ID NO: 57)

JA069 PRE7-F CGACTCACTATAGGGCCCATGGCCACTATTGCATCAG (SEQ ID NO: 58)

JA070 PRE7-R CCATGTCGACGCCCTTAATCTCTTTTTAGCTCATAAAATTCTTTC (SEQ ID NO: 59)

JA071 GOR1-F CGACTCACTATAGGGCCCATGAGTAAGAAACCAATTGTTTTG (SEQ ID NO: 60)

JA072 GOR1-R CCATGTCGACGCCCTCAAACTAATGGCTTAGATTCATTGG (SEQ ID NO: 61)

JA073 GRE3-F CGACTCACTATAGGGCCCATGTCTTCACTGGTTACTCTTAATAAC (SEQ ID NO: 62)

JA074 GRE3-R CCATGTCGACGCCCTCAGGCAAAAGTGGGGAATTTAC (SEQ ID NO: 63)

CGACTCACTATAGGGCCCATGTCTGACTTAGTTAACAAGAAATTCC (SEQ ID NO:

JA075 AHP1-F 64)

JA076 AHP1-R CCATGTCGACGCCCCTACAAATGAGCCAAGACAC (SEQ ID NO: 65)

JA077 ZU01-F CGACTCACTATAGGGCCCATGTTTTCTTTACCTACCCTAACC (SEQ ID NO: 66)

JA078 ZU01-R CCATGTCGACGCCCTCACACGAAGTAGGACAAC (SEQ ID NO: 67)

JA079 YDJ1-F CGACTCACTATAGGGCCCATGGTTAAAGAAACTAAGTTTTACG (SEQ ID NO: 68)

JA080 YDJ1-R CCATGTCGACGCCCTCATT GAGAT GCACATT GAACAC (SEQ ID NO: 69)

JA081 SSE1-F CGACTCACTATAGGGCCCATGAGTACTCCATTTGGTTTAG (SEQ ID NO: 70)

JA082 SSE1-R CCATGTCGACGCCCTTAGTCCATGTCAACATCACC (SEQ ID NO: 71)

JA083 SSE2-F CGACTCACTATAGGGCCCATGAGCACTCCATTTGGC (SEQ ID NO: 72)

JA084 SSE2-R CCATGTCGACGCCCTTAATCAAGGTCCATGTTTTCATC (SEQ ID NO: 73)

JA085 HSP10-F CGACTCACTATAGGGCCCATGTCCACCCTTTTGAAGTC (SEQ ID NO: 74)

JA086 HSP10-R CCATGTCGACGCCCTTAGTCCTTGGCAATCTTAGCC (SEQ ID NO: 75)

JA087 CCP1-F CGACTCACTATAGGGCCCATGACTACTGCTGTTAGGC (SEQ ID NO: 76) JA088 CCP1-R CCATGTCGACGCCCCTATAAACCTTGTTCCTCTAAAGTC (SEQ ID NO: 77)

JA089 GTT1-F CGACTCACTATAGGGCCCATGTCGTTGCCAATTATCAAAG (SEQ ID NO: 78)

JA090 GTT1-R CCAT GTCGACGCCCTT AG AAATTGCTACCT AAAGC ACG (SEQ ID NO: 79)

JA091 SSA2-F CGACTCACTATAGGGCCCATGTCTAAAGCTGTCGGTATTG (SEQ ID NO: 80)

JA092 SSA2-R CCATGTCGACGCCCTTAATCAACTTCTTCGACAGTTGG (SEQ ID NO: 81)

JA093 HSP104-F CGACTCACTATAGGGCCCATGAACGACCAAACGCAATTTAC (SEQ ID NO: 82)

JA094 HSP104-R CCATGTCGACGCCCTTAATCTAGGTCATCATCAATTTCCATAC (SEQ ID NO: 83)

JA095 FUN12-F CGACTCACTATAGGGCCCATGGCGAAAAAGAGTAAAAAGAACC (SEQ ID NO:84) JA096 FUN12-R CCATGTCGACGCCCTCATTCGATGCCGAAAACGACC (SEQ ID NO: 85)

JA097 TIF5-F CGACT CACT AT AGGGCCCAT GTCT ATT AAT ATTT GT AGAGAT AATCAT G (SEQ ID NO: 86)

JA098 TIF5-R CCATGTCGACGCCCCTATTCGTCGTCTTCTTCATCATC (SEQ ID NO: 87)

JA099 HTS1-F CGACTCACT AT AGGGCCCATGCTT AGT AGAT CACT AAAT AAAGT AG (SEQ ID NO: 88)

JA100 HTS1-R CCATGTCGACGCCCTTATAATCCTTTAATTAAACGAGTGACC (SEQ ID NO: 89)

JA101 GAL4-F CGACTCACTATAGGGCCCATGAAGCTACTGTCTTCTATCG (SEQ ID NO: 90)

JA102 GAL4-R CCATGTCGACGCCCTTACTCTTTTTTTGGGTTTGGTGG (SEQ ID NO: 91)

[00185] To evaluate yeast proteome changes occurring because of AAV expression, fermentation runs using a yeast AAV-producing strain and a non-producing control were performed in triplicate at three different times. The results from fermentation runs are presented in Figure 1B-1D. Most conditions showed consistent growth profile throughout fermentation. There was no significant difference in growth rate trends after galactose induction, suggesting that AAV protein expression did not significantly impact cell growth (Fig. IB). pH trends were also comparable between strains (Fig. 1C), showing a subsequent mild decrease overgrowth in galactose. AAV protein expression was tracked in both strains, and mass spectrometry was used for their detection. Figure ID displayed the detection of Rep, Cap and AAP proteins only in the AAV-producing strain and not in the control strain.

[00186] Proteome profiling was carried out with Progenesis QI for mass spectrometry raw data processing. A total of 925 yeast proteins were identified, covering protein IDs present in several cellular structures such as cell wall, cytoplasm and nucleus. Approximately 70% met the confidence ID and unique peptide cut-off requirements for our profiling analysis. Principal component analysis (PCA) of samples from days 0, 2 and 3 post-induction was performed to visualize clustering of proteomic data among yeast samples. Analysis of day 0 post-induction samples showed no separation among control and recombinant strain samples (Fig 2A). This trend corroborated that, before induction, both strains shared basic metabolic features common of early logarithmic growth. A secondary PCA analysis of day 2 and day 3 post-induction samples evidenced a clear clustering of the control samples and the recombinant strain samples, being principal component 2 a transformed variable that explained 20.6% of proteome sample differences (Fig 2B). The identity of the variables that include component 2 might be implicated in significant biological processes associated with AAV production.

[00187] Mass spectrometry analysis identified 304 proteins that showed significant changes in protein accumulation throughout the fermentation process (adjusted p-value < 5xl0⁵). Heat map analysis of the proteome subset was performed in 3 sets that compared induction day and strain type, and change patterns were clustered based on similarity (Fig. 3 A). Clustering contributed to the identification of 134 proteins that showed contrasting expression patterns in control and recombinant strain samples. Gene ontology enrichment analysis was performed by using DAVID software. Table 2 displays biological processes identified from the original 304 protein subset. In addition to broad processes such as amino acid/carbon metabolism and oxidation-reduction processes, this list also included specific events like protein folding and refolding, translation, ribosomal subunit assembly and gluconeogenesis. GO analysis of the identified 134 proteins displayed only 4 hits, which included protein folding, translation and gluconeogenesis (Table 3). Table 2

Table 3

[00188] These results suggest the previously mentioned events might be directly or indirectly associated to rAAV expression in yeast. Further analysis performed with STRING software contributed to the generation of a prediction-based interaction network, based on the protein set ID and protein-protein interactions reported in the literature. Network results corroborated the presence of 4 important clusters of proteins identified during bioinformatic analysis: protein folding/refolding, cytoplasmic translation, gluconeogenesis and carboxylic acid metabolic processes (Fig. 3B).

[00189] Time-course mass spectrometry analysis of yeast samples surveyed changes in the proteomic profile of the rAAV-producing yeast strain. Bioinformatics and statistical tools played an important role in highlighting expression changes and clustering them as part of biological processes. With those results, processes that significantly varied when rAAV2 proteins were expressed were identified and led to the secondary hypothesis that could potentially link these few biological processes to bottlenecks in rAAV vector production. Vector Yield Optimization in rAA V-Producing Yeast

[00190] The results from the proteomic profiling described above highlighted events related to protein folding and conformational stress. Protein folding/refolding includes cellular activities aimed at shaping the native conformation of proteins (Gasser et al., 2008). In order to keep cellular homeostasis, cell responses are focused on correcting the conformation of misfolded proteins, either by refolding, sequestration, or degradation (Chen et al., 2011). Protein folding takes place in the endoplasmic reticulum (ER) and cytoplasm, and each compartment has its own arsenal of folding proteins capable of doing a variety of modification to the target protein. In recombinant strains, protein expression and processing machinery is mostly allocated in the ER, where the nascent protein is modified and prepared for secretion (Gasser et al., 2008; Mattanovich et al., 2004). In the present experiments, the AAV expression cassettes encode 6 non-glycosylated viral proteins that undergo processing in the cytoplasmic compartment. The proteomic profiling results highlighted overexpression of several cytoplasmic heat shock proteins (Hsp) and chaperones during the last days of galactose induction. This correlation implies a link between protein folding activities and the expression of rAAV proteins. No differences in expression of foldases and other chaperones associated with ER processing were seen, which gives support to the hypothesis that saturation of the protein processing machinery might be taking place, potentially leading to protein misfolding at the cytoplasmic compartment.

[00191] After examining the potential implications of expression change of these proteins, it was hypothesized that over-expression of specific host cell proteins identified in the profiling could provide stress-relief activity to the yeast cell, and potentially contribute to vector yield improvement. A set of low-copy and high-copy number plasmids containing expression cassettes for 19 yeast host cell proteins were generated. Overexpression of these proteins in a yeast strain transformed with two rAAV plasmids (JA001 and JA002), using a total of 3 plasmids for each yeast strain variant. As shown in figure 4, expression of some of these proteins using high-copy and low-copy number plasmids resulted in an improvement in rAAV vector yield. Variant strains SSA1, RVB2, SSE1, SSE2, CCP1 and GTT1 showed significant increases in vector yield that go as high as 3 -fold and 2-fold when 2-micron and CEN-based plasmids, respectively.

Table 4

[00192] Table 4 shows MS results regarding fold change activity of the principal heat shock proteins during induction time. Results showed a 2-fold increase in KAR2 protein (also known as BiP). This protein is a stress marker and its upregulation is usually linked to unfolded protein response (Hohenblum et al, 2004). This protein was one of the few ER-related proteins that changed in concentration after galactose induction of rAAV expression. The cytoplasmic proteins SSA1, SSA2, SSA4, SSE1 and SSE2 increased their expression levels more than 25%, and our protein overexpression studies confirmed their functional relevance for rAAV virion production. These chaperones belong to the HSC70 and HSP110 families, and are implicated in protein folding activity at the cytoplasm (Bush and Meyer, 1996; Dragovic et al, 2006). Big and small heat shock proteins showed different change in their expression patterns, which aligned with results reported by Geiler-Samerotte (Geiler-Samerotte et al, 2011). The authors referred to this particular phenomenon as cytoplasmic unfolded protein response, and it has been reported on other occasions when surface viral proteins are expressed in yeast (Ciplys et al, 2011). It is believed that chaperone action is crucial to mitigate negative impacts related to protein misfolding. Valaviciute et al (Valaviciute et al., 2016) evaluated the effect of overexpression and mild downregulation of HSP90, HSC70 and HSP40 chaperones and co-chaperones during recombinant expression of VP1 hamster polyomavirus protein in yeast. Downregulation of cytosolic chaperones such as SSA1/SSA2, SSA3/SSA4, HSP82 and HSC82 had a negative effect on VP1-EGFP levels. In addition, mild overexpression of these proteins translated into a surplus of VP1 yield. Their results suggested that these subgroups of proteins have a direct impact on protein processing, and by extension on active recombinant protein yield.

Example 3

Overexpression of Chaperone Host HSP Proteins in AA V Production

[00193] Overexpression of selected insect cell HSP protein homologues was carried out in Sf9 cells based on the findings observed in the yeast model described in Example 2. Since bioinformatics and protein analysis highlighted protein folding and refolding as events potentially associated to rAAV expression, cytosolic chaperone proteins with foldase activity were overexpressed. Sf-HSC70 and Sf-HSP40 were overexpressed during rAAV-GFP production and the yield was compared to control cells which do not overexpress a host chaperone protein.

[00194] The plasmid pFastBac (ThermoFisher) was modified to include a blasticidin resistance gene and the baculovirus HR5 region in the plasmid backbone, outside of the Tn7 transposable cassette, generating pFB-HR5-BSD. Sf-HSC70 and Sf-HSP40 were PCR amplified with primers 1010/1011 and 1008/1009 respectively and inserted into Xhol-linearized pFB-HR5- BSD under the control of a polH promoter, generating plasmids pFB-HR5-BSD-HSC70 and pFB-HR5-BSD-HSP40. The sequences for primers 1010, 1011, 1008, and 1009 are provided in table 5.

Table 5

[00195] To generate the plasmid pFB-HR5-BSD-HSC70-HA-HSP40-HA, expressing the two HA-tagged proteins from a polh and a plO promoter respectively, the Sf-HSC70 gene was amplified with primers 1150/1140; a SV40 terminator-plO promoter DNA fragment was amplified with primers 1141/1142 from pFB-inCap-inRep (Chen, 2008); and Sf-HSP40 was amplified with primers 1143/1151. The three DNA fragments were inserted by Gibson assembly into BamHI/XhoI-digested pFB-HR5-BSD. The resulting plasmids were transformed into E. coli DHlOBac strain to generate recombinant bacmids following the Bac-to-bac system (Thermo Fisher Scientific).

[00196] Overexpression of Sf-HSP40 and Sf-HSC70 led to a vector yield of 7xl0¹⁰ vg/mL, which represents a 50% volumetric yield improvement (Fig. 5A). This increase was associated with higher per-cell productivity, likely due to an enhanced folding and expression capacity of the tested cells (Fig. 5B). Overexpression of both Sf-HSP40 and Sf-HSC70 in the same cell (HSP40/70) had a similar effect as overexpression of Sf-HSP40 or Sf-HSC70 alone. [00197] The effect of overexpression of host heat shock proteins and additional chaperone proteins in insect host cell were further analyzed. As described above, baculovirus were generating including a bacmid expressing a host chaperone protein: Sf-HSP40, Sf-HSC70, Sf- HSP90, Hs-NUC, Sc-NSRl, S1-TOP2, Hs-GENl, or EGFP. Sf9 cells were transformed with three bacmids: i) a first baculovirus vector including the Rep-Cap bacmid (rBV-Cap-Rep), ii) a second baculovirus vector including the rAAV-GFP bacmid (rBV-AAV-GFP) and iii) a chaperone host protein bacmid (rBV-host prot). The characteristics of the Sf9 cells including these three baculovirus vectors were evaluated. For controls, only two bacmids were used and these bacmids expressed rBV-Cap-Rep and rBV-AAV-GFP. The Sf9 cells including the three bacmids had a similar average diameter on different days as those cells including only two bacmids.

[00198] The cell viability was similar in Sf9 cells including three bacmids after infection as those including only two bacmids. The Sf9 cells overexpressing NSR1, HSP40 and GEN1 had a cell viability greater than 92%, which was better than all other Sf9 cells including two or three bacmids. In addition, the density of viable cells was the greatest in Sf9 cells overexpressing Sc- NSRl, Sf-HSP40 or Hs-GENl, compared to all other Sf9 cells including two or three bacmids. The rBV titer produced by each of the Sf9 cells overexpressing a host chaperone protein are provided in Table 6 below.

Table 6

[00199] rAAV production using cells overexpressing a host chaperone protein gene was evaluated. Sf9 cells were infected with i) a first baculovirus vector including the Rep-Cap bacmid (RC rBV), ii) a second baculovirus vector including the rAAV-GFP bacmid (GFP rBV) and iii) a chaperone host protein bacmid (Host gene rBV) as described in Table 7. Following infection, cell viability measurements were recorded daily and rAAV particles were harvested. The cell viability measurements were analyzed with a VI-CELL® cell counter, where the cell density was determined based on a trypan blue exclusion method. The average vg titer was analyzed by ddPCR.

Table 7

[00200] The average cell diameter for the cells overexpressing a host chaperone protein was similar to the cells only expressing RC rBV and GFP rBV (denoted herein as “empty”). The cell diameter of cells overexpressing Sc-NSRl, AAP5 and EGFP were greater than the others. In addition, the percent cell viability was similar for all the cells. The percent viability of the cells expressing, AAP and EGFP had the highest cell viability, similar to the empty vector. [00201] As shown in Figure 6, rAAV titer was greater in the cells overexpressing host chaperone protein Sf-HSP40, Sf-HSC70, AAP5, Sf-TOP2, and HS-Genl compared to rAAV produced in the empty Sf9 cells. As a result, infection with a rBV including a combination of the host chaperone genes were investigated.

[00202] As described above, bacmids including i) Sf-HSC70 and Sf-HSP40 genes (denoted as “two genes”), and ii) Sf-HSC70, Sf-HSP40 and Sf-TOP2 genes (denoted as “three genes”) were generated and Sf9 cells were infected with these rBVs in combination with RC rBV and GFP rBV. The different genes included C-terminal tags such as a hemagglutinin tags or FLAG-tags. As shown in Figure 7, a combination of two or three host chaperone genes did not increase rAAV vg titer. In addition, the rAAV release from the Sf9 cells was reduced in all cells expressing one or more of Sf-HSC70, Sf-HSP40 or S1-TOP2 compared to the empty cells, with the exception of overexpression of HSP40 and Repl (see Fig. 8).

[00203] rAAV production using cells overexpressing a host chaperone protein gene were evaluated in Sf9 cells under conditions described in Aucoin, Marc G., Michel Perrier, and Amine A. Kamen. "Production of adeno-associated viral vectors in insect cells using triple infection: Optimization of baculovirus concentration ratios." Biotechnology and bioengineering 95.6 (2006): 1081-1092. Sf9 cells were infected with i) a first baculovirus vector including the Rep- Cap bacmid (RC rBV), ii) a second baculovirus vector including the rAAV-GFP bacmid (GFP rBV) and iii) a chaperone host protein bacmid (Host gene rBV) as described in Table 6. Following infection, cell viability measurements were recorded daily and rAAV particles were harvested post-infection. The average vg titer was analyzed by ddPCR.

Table 6

[00204] The percent cell viability was similar for all the cells post-infection. The percent viability of the cells expressing any combination of the host chaperone genes in Table 6 was greater than empty vector. The average cell diameter for the cells overexpressing a host chaperone protein was similar to the cells only expressing RC rBV and GFP rBV (denoted herein as “empty”). The cell diameter of all the cells overexpressing a host chaperone protein was greater than the cells that did not express a host chaperone protein. As shown in Figure 9, rAAV titer was greater in the cells overexpressing host chaperone protein Sf-HSP40, Sf-HSC70, Sf- HSP40-70, and S1-TOP2 compared to rAAV produced in the empty Sf9 cells.

Example 4

[00205] To further confirm and assess the effect of host protein overexpression on vector yield and product quality, additional production experiments will be performed using the insect cell/3 rBV system. rBVs carrying various nucleotide sequences encoding different regulatory proteins operably linked to different expression control elements will be generated to overexpress the regulatory proteins in evaluation. B V carrying GFP or empty vector will be generated additionally to be used as negative control for these experiments. Several BV Rep and/or Cap constructs will be generated to assess the production of various AAV serotypes from human and non-human hosts. It is noted that the Cap constructs may include identified capsid sequences that are difficult to produce in cells such as Sf9 cells. For example, this includes capsid sequences that unmodified insect cells were either unable to generate recombinantly or were able to generate undetectable concentrations of. The same Rep proteins (AAV2 Rep 78 and Rep 52) will be used for all production studies. An rBV carrying the Firefly luciferase (Flue) gene flanked by inverted terminal repeats was constructed.

[00206] Insect cell cultures will be infected with at least three BV: Flue, Rep, Cap, and Host Protein. Cultures will be harvested on the same day. Vector genome (vg) titer from harvest material will be determined by PCR (e.g., digital droplet PCR), using primer and probe sets specific for the Flue transgene. Capsids sequences that were difficult to generate in Sf9 cells will also be assessed to see if the modified expression of the regulatory protein improves generation of rAAV virions or infectious capsids. AAV capsids will be purified using affinity chromatography. Further analysis will be performed to determine the empty to full capsid ratio. Further purification will be performed to purify high density, DNA-containing capsids. For example, viral particle capsid size, presence of higher order capsid aggregates, non-encap si dated deoxyribonucleic acid and protein impurities, capsid integrity, amount of light capsids, molecular mass of capsid protein and encapsidated DNA, capsid titer and genome titer will be measure by SEC-HPLC or size exclusion chromatography with multiangle light scattering (SEC-MALS) as described in PCT Publication No. WO2021/062164 A1 and McIntosh, Nicole L., et al. Scientific reports 11.1 (2021): 1-12, both of which are incorporated in their entirety by reference. This purified material will be analyzed for capsid VP protein content and for cell-based potency via luciferase or GFP detection. Capsid VP proteins content as well as post translational modifications of the capsid VP proteins may also be measured by liquid chromatography-mass spectrometry.

[00207] While exemplary embodiments are described above, it is not intended that these embodiments describe all possible forms of the invention. Rather, the words used in the specification are words of description rather than limitation, and it is understood that various changes may be made without departing from the spirit and scope of the invention. Additionally, the features of various implementing embodiments may be combined to form further embodiments of the invention.

Claims

We claim:

1. A method for producing infectious recombinant adeno-associated virus (rAAV) virions, the method comprising: culturing an insect host cell having one or more vectors for rAAV virion production, wherein the insect host cell is modified to express a regulatory protein and the expression of the regulatory protein increases rAAV virion production in the insect host cell relative to rAAV virion production in an insect host cell without the modification.

2. A method for producing infectious recombinant adeno-associated virus (rAAV) virions, the method comprising: culturing an insect host cell having one or more vectors for rAAV virion production, wherein the insect host cell is modified to express a regulatory protein and the expression of the regulatory protein increases the infectivity of rAAV virions relative to rAAV virions produced in an insect host cell without the modification when the rAAV virions infect cells under same or comparative conditions.

3. A method for producing infectious recombinant adeno-associated virus (rAAV) virions, the method comprising: culturing an insect host cell having one or more vectors for rAAV virion production, wherein the insect host cell is modified to express a regulatory protein and the expression of the regulatory protein increases or decreases incorporation of at least one of VP1, VP2, and VP3 proteins into capsids of rAAV virions relative to incorporation of at least one of VP1, VP2, and VP3 proteins into capsids of rAAV virions produced in an insect host cell without the modification.

4. A method for producing infectious recombinant adeno-associated virus (rAAV) virions, the method comprising: culturing an insect host cell having one or more vectors for rAAV virion production, wherein the insect host cell is modified to express a regulatory protein and the expression of the regulatory protein decreases production of rAAV capsids devoid of encapsulated vector genomes relative to production of rAAV capsids devoid of encapsulated vector genomes in an insect host cell without the modification.

5. A method for producing infectious recombinant adeno-associated virus (rAAV) virions, the method comprising: culturing an insect host cell having one or more vectors for rAAV virion production, where the insect host cell is modified to express a regulatory protein and the expression of the regulatory protein alters post translational modifications of at least one of VP1 proteins, VP2 proteins, VP3 proteins, vector genomes, and Rep proteins relative to post translational modifications of at least one of VP1 proteins, VP2 proteins, VP3 proteins, vector genomes, and Rep proteins produced by an insect host cell without the modification; wherein the at least one of VP1 proteins, VP2 proteins, and VP3 proteins are incorporated into the capsids of rAAV virions and the vector genomes are encapsulated within the capsids of rAAV virions.

6. A method for producing infectious recombinant adeno-associated virus (rAAV) virions, the method comprising: culturing an insect host cell having one or more vectors for rAAV virion production, wherein the insect host cell is modified to express a regulatory protein and wherein an insect host cell without the modification does not generate rAAV virions or generates an undetectable concentration of rAAV virions.

7. The method of claim 6, wherein the insect host cell without the modification does not generate capsids encoded by the one or more vectors for rAAV virion production or generates an undetectable concentration of capsids encoded by the one or more vectors for rAAV virion production.

8. The method as in any one of claims 1-6, wherein the expression of the regulatory protein in the modified insect host cell during rAAV virion production is greater or lower than the expression of the regulatory protein in the insect host cell without the modification.

9. The method as in any one of claims 1-6, wherein the modified insect host cell comprises a nucleotide sequence encoding the regulatory protein and an expression control element operably linked to the nucleotide sequence.

10. The method of claim 9, wherein the expression control element is a promoter selected from at least one of Polh promoter, DIE1 promoter, p5 promoter, plO promoter, p40 promoter, metallothionein promoter, 39K promoter, p6.9 promoter, and orf46 promoter.

11. The method of claim 10, wherein the expression control element is a promoter comprising a nucleotide sequence of SEQ ID NO: 21, 22, 23, 24, 25, or 26, nt 163 to nt 301 of SEQ ID NO: 26, or nt 186 to nt 301 of SEQ ID NO: 26.

12. The method as in any one of claims 1-6, wherein the one or more vectors for rAAV virion production comprises a nucleotide sequence encoding at least one capsid protein and an expression control element operably linked to the nucleotide sequence.

13. The method as in any one of claims 1-6, wherein the one or more vectors for rAAV virion production comprises a nucleotide sequence encoding at least one Rep protein and an expression control element operably linked to the nucleotide sequence.

14. The method as in any one of claims 1-6, wherein the one or more vectors for rAAV virion production comprises a nucleotide sequence for generating vector genomes and the nucleotide sequence comprises an exogenous nucleotide sequence and at least one AAV inverted terminal repeat sequence.

15. The method as in any one of claims 1-6, wherein the one or more vectors for rAAV virion production comprises a nucleotide sequence for generating vector genomes and the nucleotide sequence comprises an exogenous nucleotide sequence interposed between a first AAV inverted terminal repeat sequence and a second AAV inverted terminal repeat sequence.

16. The method as in any one of claims 1-6, wherein the regulatory protein is HSP40, HSC70, HSP90, NUC, NSR1, TOP2, GEN1, or AAP5.

17. The method as in any one of claims 1-6, wherein the regulatory protein comprises at least one of an amino acid sequence that is at least 85% identical to any one of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, or 20; an amino acid sequence of SEQ ID NO: 2, 4, 6, 8, 9, 10, 12, 14, 16, 18, or 20; an amino acid sequence encoded by a nucleotide sequence this is at least 85% identical to any one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, or 19; and an amino acid sequence encoded by any one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, or 19.

18. The method as in any one of claims 1-6, wherein the insect host cell is an insect cell line derived from Spodoptera frugiperda , Aedes albopictus, Bombyxmori, Trichoplusia ni, Ascalapha odorata, Drosphila, Anophele, Culex , or Aedes.

19. The method as in any one of claims 1-6, wherein the insect host cell is Sf9, High Five, Se301, SeIZD2109, SeUCRl, Sf900+, Sf21, BTI-TN-5B1-4, MG-1, Tn368, HzAml, BM- N, Ha2302, Hz2E5 or Ao38.

20. The method of claim 12, wherein the at least one capsid protein comprises VP1 and VP3 proteins.

21. The method of claim 12, wherein the at least one capsid protein comprises VP1, VP2, and VP3 proteins.

22. The method of claim 12, wherein the at least one capsid protein is from AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV 12, AAV13, Bba21, Bba26, Bba27, Bba29, Bba30, Bba31, Bba32, Bba33, Bba34, Bba35, Bba36, Bba37, Bba38, Bba41, Bba42, Bba43, Bba44, Bcel4, Bcel5, Bcel6, Bcel7, Bcel8, Bce20, Bce35, Bce36, Bce39, Bce40, Bce41, Bce42, Bce43, Bce44, Bce45, Bce46, Bey20, Bey22, Bey23, Bma42, Bma43, Bpol, Bpo2, Bpo3, Bpo4, Bpo6, Bpo8, Bpol3, Bpol8, Bpo20, Bpo23, Bpo24, Bpo27, Bpo28, Bpo29, Bpo33, Bpo35, Bpo36, Bpo37, Brh26, Brh27, Brh28, Brh29, Brh30, Brh31, Brh32, Brh33, Bfml7, Bfml8, Bfm20, Bfm21, Bfm24, Bfm25, Bfm27, Bfm32, Bfm33, Bfm34, Bfm35, AAV-rhlO, AAV-rh39, AAV-rh43, or AAVanc80L65.

23. The method as in claim 20 or 21, wherein the VP1, VP2 and/or VP3 proteins form a capsid of a mixed serotype and wherein the VP1, VP2, and VP3 proteins do not all come from the same serotype

24. The method of claim 13, wherein the at least one Rep protein includes at least one a large Rep protein optionally selected from Rep78 and Rep 68, a small Rep protein, optionally selected from Rep 52 and Rep 40, and a combination thereof optionally comprising at least two of Rep78, Rep 68, Rep 52, and Rep 40.

25. The method of claim 13, wherein the at least one Rep protein is from AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV 12, AAV13, Bba21, Bba26, Bba27, Bba29, Bba30, Bba31, Bba32, Bba33, Bba34, Bba35, Bba36, Bba37, Bba38, Bba41, Bba42, Bba43, Bba44, Bcel4, Bcel5, Bcel6, Bcel7, Bcel8, Bce20, Bce35, Bce36, Bce39, Bce40, Bce41, Bce42, Bce43, Bce44, Bce45, Bce46, Bey20, Bey22, Bey23, Bma42, Bma43, Bpol, Bpo2, Bpo3, Bpo4, Bpo6, Bpo8, Bpol3, Bpol8, Bpo20, Bpo23, Bpo24, Bpo27, Bpo28, Bpo29, Bpo33, Bpo35, Bpo36, Bpo37, Brh26, Brh27, Brh28, Brh29, Brh30, Brh31, Brh32, Brh33, Bfml7, Bfml8, Bfm20, Bfm21, Bfm24, Bfm25, Bfm27, Bfm32, Bfm33, Bfm34, Bfm35, AAV-rhlO, AAV-rh39, AAV-rh43, or AAVanc80L65.

26. The method according to claim 14 or 15, wherein the exogenous polynucleotide comprises, in sequence and operably linked, a promoter, an exogenous gene, and a polyadenylation sequence.

27. The method according to claim 14 or 15, wherein the viral genomes are encapsidated as measured by treatment of the virions with benzonase and detecting intact vector genome by Southern blotting.

28. The method according to claim 14 or 15, wherein the exogenous gene encodes a serpin, a clotting factor, a muscle protein, a metabolic enzyme, a growth factor, a cytokine, an anti-angiogenic protein, an interferon, an interleukin, a neurotrophic factor, a metabolic hormone, an antisense RNA, an miRNA, or an RNAi.

29. The method according to claim 14 or 15, wherein the exogenous gene encodes alpha-one antitrypsin, clotting factor IX, clotting factor VIII, clotting factor VII, dystrophin, alpha- sarcoglycan, beta- sarcoglycan, delta- sarcoglycan, epsilon-sarcoglycan, tyrosine hydroxylase, aromatic acid decarboxylase, GTP cyclohydrolase I, erythropoietin, aspartoacylase (ASP A), Nerve growth factor (NGF), lysosomal beta-glucuronidase (GUSB), insulin, alpha- synuclein, basic fibroblast growth factor (FGF-2), IGF1, alpha-galactosidase A (alpha-gal A), neurotrophin-3, Neuroglobin (Ngb), angoigenic proteins (vascular endothelial growth factor (VEGF165)), GM-CSF (granulocyte-macrophage colony-stimulating factor), M-CSF (macrophage colony-stimulating factor), a tumor necrosis factor, a growth factors, TGF-beta, IL- 10, IL-13, IL-4, platelet-derived growth factor, CNTF (ciliary Neurotrophic factor), brain- derived neurotrophic factor (BDNF), or GDNF (glial cell line derived neurotrophic factor).

30. The method of claim 9, wherein the nucleotide sequence is maintained episomally within the modified host insect cell using selection markers and optionally under control of insect regulatory sequences.

31. The method of claim 9, wherein the nucleotide sequence is maintained within a recombinant baculovirus.

32. The method of claim 9, wherein the nucleotide sequence is integrated into a genome of recombinant baculovirus.

33. The method of claim 9, wherein the nucleotide sequence is integrated into a chromosome of the modified host insect cell, optionally under control of insect regulatory sequences.

34. The method as in any one of claims 1-33, further comprising purifying the rAAV virions produced by the insect host cell.

35. The method of claim 34 further comprising formulating the purified rAAV virions as a pharmaceutical product.

36. An rAAV pharmaceutical product produced by the method of any one of claims

1-35.

37. A method of treating a mammalian subject comprising infecting the mammalian subject with the rAAV pharmaceutical product of claim 36.

38. A pharmaceutical product of claim 37 for use in treating a mammalian subject in need thereof.

39. Use of the pharmaceutical product of claim 38 for the preparation of a medicament for treating a mammalian subject in need thereof.

40. A method for producing infectious recombinant adeno-associated virus (rAAV) virions, the method comprising: culturing a mammalian host cell having one or more vectors for rAAV virion production, wherein the mammalian host cell is modified to express a regulatory protein and expression of the regulatory protein increases rAAV virion production in the mammalian host cell relative to rAAV virion production in a mammalian host cell without the modification; wherein the regulatory protein selected from at least one of HSP40, HSP90, NUC, NSR1, TOP2, GEN1, and AAP5.

41. A method for producing infectious recombinant adeno-associated virus (rAAV) virions, the method comprising: culturing a mammalian host cell having one or more vectors for rAAV virion production, wherein the mammalian host cell is modified to express a regulatory protein and the expression of the regulatory protein increases the infectivity of rAAV virions relative to rAAV virions produced in an insect host cell without the modification when the rAAV virions infect cells under same or comparative conditions; wherein the regulatory protein selected from at least one of HSP40, HSP90, NUC, NSR1, TOP2, GEN1, and AAP5.

42. A method for producing infectious recombinant adeno-associated virus (rAAV) virions, the method comprising: culturing a mammalian host cell having one or more vectors for rAAV virion production, wherein the mammalian host cell is modified to express a regulatory protein and the expression of the regulatory protein increases or decreases incorporation of at least one of VPl, VP2, and VP3 proteins into capsids of rAAV virions relative to incorporation of at least one of VPl, VP2, and VP3 proteins into capsids of rAAV virions produced in a mammalian host cell without the modification; wherein the regulatory protein selected from at least one of HSP40, HSP90, NUC, NSR1, TOP2, GEN1, and AAP5.

43. A method for producing infectious recombinant adeno-associated virus (rAAV) virions, the method comprising: culturing a mammalian host cell having one or more vectors for rAAV virion production, wherein the mammalian host cell is modified to express a regulatory protein and the expression of the regulatory protein decreases production of rAAV capsids devoid of encapsulated vector genomes relative to production of rAAV capsids devoid of encapsulated vector genomes in a mammalian host cell without the modification; wherein the regulatory protein selected from at least one of HSP40, HSP90, NUC, sc- NSR1, TOP2, GEN1, and AAP5.

44. A method for producing infectious recombinant adeno-associated virus (rAAV) virions, the method comprising: culturing a mammalian host cell having one or more vectors for rAAV virion production, wherein the mammalian host cell is modified to express a regulatory protein and the expression of the regulatory protein alters post translational modifications of the expression of the regulatory protein alters post translational modifications of at least one of VP1 proteins, VP2 proteins, VP3 proteins, vector genomes, and Rep proteins relative to post translational modifications of at least one of VP1 proteins, VP2 proteins, VP3 proteins, vector genomes, or Rep proteins produced by an mammalian host cell without the modification; wherein the at least one of VP1 proteins, VP2 proteins, and VP3 proteins are incorporated into the capsids of rAAV virions and the vector genomes are encapsulated within the capsids of rAAV virions; wherein the regulatory protein selected from at least one of HSP40, HSP90, NUC, NSR1, TOP2, GEN1, and AAP5.

45. A method for producing infectious recombinant adeno-associated virus (rAAV) virions, the method comprising: culturing a mammalian host cell having one or more vectors for rAAV virion production, wherein the mammalian host cell is modified to express a regulatory protein, and wherein a mammalian host cell without the modification does not generate rAAV virions or generates an undetectable concentration of rAAV virions; wherein the regulatory protein selected from at least one of HSP40, HSP90, NUC, sc- NSR1, TOP2, GEN1, and AAP5.

46. The method of claim 45, wherein a mammalian host cell without the modification does not generate capsids encoded by the one or more vectors for rAAV virion production or generates an undetectable concentration of capsids encoded by the one or more vectors for rAAV virion production.

47. The method as in any one of claims 39-45, wherein the expression of the regulatory protein in the modified mammalian host cell during rAAV virion production is greater or lower than the expression of the regulatory protein in the mammalian host cell without the modification.

48. The method as in any one of claims 39-45, wherein the modified mammalian host cell comprises a nucleotide sequence encoding the regulatory protein and an expression control element operably linked to the nucleotide sequence.

49. The method as in any one of claims 39-45, wherein the one or more vectors for rAAV virion production comprises a nucleotide sequence encoding at least one capsid protein and an expression control element operably linked to the nucleotide sequence.

50. The method as in any one of claims 39-45, wherein the one or more vectors for rAAV virion production comprises a nucleotide sequence encoding at least one Rep protein and an expression control element operably linked to the nucleotide sequence.

51. The method as in any one of claims 39-45, wherein the one or more vectors for rAAV virion production comprises a nucleotide sequence for generating vector genomes and the nucleotide sequence comprises an exogenous nucleotide sequence and at least one AAV inverted terminal repeat sequence.

52. The method as in any one of claims 39-45, wherein the one or more vectors for rAAV virion production comprises a nucleotide sequence for generating the vector genomes and the nucleotide sequence comprises an exogenous nucleotide sequence interposed between a first AAV inverted terminal repeat sequence and a second AAV inverted terminal repeat sequence.

53. The method as in any one of claims 39-45, wherein the regulatory protein comprises at least one of an amino acid sequence that is at least 85% identical to any one of SEQ ID NO: 2, 6, 8, 10, 12, 14, 16, 18, or 20; an amino acid sequence of SEQ ID NO: 2, 6, 8, 10, 12, 14, 16, 18, or 20; an amino acid sequence encoded by a nucleotide sequence this is at least 85% identical to any one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, or 19; and an amino acid sequence encoded by any one of SEQ ID NO: 1, 5, 7, 9, 11, 13, 15, 17, or 19.

54. The method as in any one of claims 39-45, wherein the mammalian host cell is HEK293, HeLa, CHO, NS0, SP2/0, PER.C6, Vero, RD, BHK, HT 1080, A549, Cos-7, ARPE- 19, or MRC-5 cells.

55. The method of claim 49, wherein the at least one capsid protein comprises VP1 and VP3 protein.

56. The method of claim 49, wherein the at least one capsid protein comprises VP1, VP2, and VP3 proteins.

57. The method of claim 49, wherein the at least one capsid protein is from AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV 12, AAV13, Bba21, Bba26, Bba27, Bba29, Bba30, Bba31, Bba32, Bba33, Bba34, Bba35, Bba36, Bba37, Bba38, Bba41, Bba42, Bba43, Bba44, Bcel4, Bcel5, Bcel6, Bcel7, Bcel8, Bce20, Bce35, Bce36, Bce39, Bce40, Bce41, Bce42, Bce43, Bce44, Bce45, Bce46, Bey20, Bey22, Bey23, Bma42, Bma43, Bpol, Bpo2, Bpo3, Bpo4, Bpo6, Bpo8, Bpol3, Bpol8, Bpo20, Bpo23, Bpo24, Bpo27, Bpo28, Bpo29, Bpo33, Bpo35, Bpo36, Bpo37, Brh26, Brh27, Brh28, Brh29, Brh30, Brh31, Brh32, Brh33, Bfml7, Bfml8, Bfm20, Bfm21, Bfm24, Bfm25, Bfm27, Bfm32, Bfm33, Bfm34, Bfm35, AAV-rhlO, AAV-rh39, AAV-rh43, or AAVanc80L65.

58. The method according to claim 55 or 56, wherein the VP1, VP2 and/or VP3 proteins form a capsid of a mixed serotype, and wherein the VP1, VP2, and VP3 proteins do not all come from the same serotype.

59. The method of claim 50, wherein the at least one Rep protein comprises at least one of a large Rep protein optionally selected from Rep78 and Rep 68, a small Rep protein, optionally selected from Rep 52 and Rep 40, and a combination thereof optionally comprising at least two of Rep78, Rep 68, Rep 52, and Rep 40.

60. The method of claim 50, wherein the at least one Rep protein is from AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV 12, AAV13, Bba21, Bba26, Bba27, Bba29, Bba30, Bba31, Bba32, Bba33, Bba34, Bba35, Bba36, Bba37, Bba38, Bba41, Bba42, Bba43, Bba44, Bcel4, Bcel5, Bcel6, Bcel7, Bcel8, Bce20, Bce35, Bce36, Bce39, Bce40, Bce41, Bce42, Bce43, Bce44, Bce45, Bce46, Bey20, Bey22, Bey23, Bma42, Bma43, Bpol, Bpo2, Bpo3, Bpo4, Bpo6, Bpo8, Bpol3, Bpol8, Bpo20, Bpo23, Bpo24, Bpo27, Bpo28, Bpo29, Bpo33, Bpo35, Bpo36, Bpo37, Brh26, Brh27, Brh28, Brh29, Brh30, Brh31, Brh32, Brh33, Bfml7, Bfml8, Bfm20, Bfm21, Bfm24, Bfm25, Bfm27, Bfm32, Bfm33, Bfm34, Bfm35, AAV-rhlO, AAV-rh39, AAV-rh43, or AAVanc80L65.

61. The method according to claim 51 or 52, wherein the exogenous polynucleotide comprises, in sequence and operably linked, a promoter, an exogenous gene, and a polyadenylation sequence.

62. The method according to claim 51 or 52, wherein the viral genomes are encapsidated as measured by treatment of the rAAV virions with benzonase and detecting an intact vector genome by Southern blotting.

63. The method according to claim 51 or 52, wherein the exogenous gene encodes a serpin, a clotting factor, a muscle protein, a metabolic enzyme, a growth factor, a cytokine, an anti-angiogenic protein, an interferon, an interleukin, a neurotrophic factor, a metabolic hormone, an antisense RNA, an miRNA, or an RNAi.

64. The method according to any one of claims 49 to 52, wherein the exogenous gene encodes alpha-one antitrypsin, clotting factor IX, clotting factor VIII, clotting factor VII, dystrophin, alpha- sarcoglycan, beta- sarcoglycan, delta- sarcoglycan, epsilon-sarcoglycan, tyrosine hydroxylase, aromatic acid decarboxylase, GTP cyclohydrolase I, erythropoietin, aspartoacylase (ASP A), Nerve growth factor (NGF), lysosomal beta-glucuronidase (GUSB), insulin, alpha-synuclein, basic fibroblast growth factor (FGF-2), IGF1, alpha-galactosidase A (alpha-gal A), neurotrophin-3, Neuroglobin (Ngb), angoigenic proteins (vascular endothelial growth factor (VEGF165)), GM-CSF (granulocyte-macrophage colony-stimulating factor), M- CSF (macrophage colony-stimulating factor), a tumor necrosis factor, a growth factors, TGF- beta, IL-10, IL-13, IL-4, platelet-derived growth factor, CNTF (ciliary Neurotrophic factor), brain-derived neurotrophic factor (BDNF), or GDNF (glial cell line derived neurotrophic factor).

65. The method of claim 48, wherein the nucleotide sequence is maintained episomally within the modified mammalian host cell using selection markers and optionally under control of mammalian regulatory sequences.

66. The method of claim 48, wherein the nucleotide sequence is maintained in a plasmid.

67. The method of claim 48, wherein the nucleotide sequence is integrated into the chromosome of the modified mammalian host cell, optionally under control of mammalian regulatory sequences.

68. The method of any one of claims 39-67, further comprising purifying the rAAV virions produced by the mammalian host cell.

69. The method of claim 68 further comprising, formulating the purified rAAV virions as a pharmaceutical product.

70. An rAAV pharmaceutical product produced by a method of any one of claims 39- 69.

71. A method of treating a mammalian subject comprising infecting the mammalian subject with the rAAV pharmaceutical product of claim 70.

72. A pharmaceutical product of claim 70 for use in treating a mammalian subject in need thereof.

73. Use of the pharmaceutical product of claim 70 for the preparation of a medicament for treating a mammalian subject in need thereof.