ES2389066B1 - DIVA METHOD OF DIFFERENTIATION OF VACCINATED ANIMALS AGAINST BRUCELOSIS. - Google Patents

Abstract

DIVA method of identification of animals vaccinated against brucellosis. Strains of Brucella modified in its O antigen are described, so that they produce a new immunogenic epitope, different from those produced by wild Brucella strains and which, therefore, can differentiate vaccinated animals from those infected without vaccinating.

Description

DIVA method of differentiation of vaccinated animals against brucellosis

OBJECT OF THE INVENTION 5

The invention is attached to the technical field of animal health, in particular the differentiation between animals infected by a bacterium of the Brucella genus of animals vaccinated against said bacterium.

10 STATE OF THE TECHNIQUE

Brucellosis is an endemic zoonosis in much of the world. It affects animal health and production, has an important impact on international trade in animals, as well as products derived from them (among 15 others: milk, cheeses, dairy products, ctc.) And is the cause of human brucclosis Human disease is rarely fatal, but it is rnvalidating, long lasting and can leave permanent sequelae. Its treatment is expensive, because it requires the combination of antibiotics for prolonged periods, with a risk of relapse. Brucellosis is produced by the bacteria of the genus Brucella, which includes several 20 species. Among them, the so-called smooth species (or S "smooth") infect domestic animals such as ruminants and swine, in addition to wild mammals. These smooth species carry on their surface a characteristic antigen, the lipopolysaccharide (LPS) of the smooth type (S-LPS), carrier of a polysaccharide O (also called antigen no O or O chain). Some mutants of these smooth species may lose the polysaccharide O on the surface (rough mutants) and, however, be able to synthesize precursors of the polysaccharide O that penetrate inside the bacteria.

There are no vaccines for human use, and brucellosis control is based on animal vaccination, with subsequent identification of infected animals and their elimination. The only sure evidence of Brucella infection is culture isolation, but given its technical difficulty, cost and risks, serological tests are the most common diagnostic tool. Animal vaccination is the

most important pillar in the control and eradication of the disease. However, existing animal vaccines carry a smooth-type LPS and stimulate an immune response against the O chain very similar to that of the infection. This problem is very important, since it makes it difficult to distinguish vaccinated animals from those infected when, for example, an epidemic outbreak occurs, since the diagnosis is based on the detection of antibodies against the O-chain of the smooth-type LPS. .

The only vaccines against brucellosis successfully used in animals are live attenuated vaccines. The two classic reference vaccines, B. abortlls S 19 in cattle and B. melitensis Rev! in sheep and goats, they have proven their effectiveness both in controlled experiments and in field use. However, they retain the O-chain of LPS, which is the immuno-dominant antigen in serological tests. Therefore, its use interferes with the diagnosis and makes it difficult to differentiate between vaccinated and infected animals.

So far, several strategies for using these vaccines have been used to minimize, not totally eliminate, the problem of differentiating between vaccinated animals and infected animals (Nicolctti P, Vaccination. Animal Brucellosis. ERe Press, Boca Raton, 1990; 283 -299; Blasco 1M, Prev Vel Med 1997: 31: 275-283), such as:

one)

limit vaccination to young animals

2)

use reduced vaccine doses in adults.

3)

use the conjunctival route as a route for vaccination, instead of

the subcutaneous

These strategies are based on the observation that (1), animals that have not reached sexual maturity produce an antibody response to Brucella LPS of shorter duration than adults; (2), the lowest antigen load in a reduced dose; and (3), that the conjunctival route distributes the vaccine directly to the peri-exophageal lymph nodes and, in this way, the brucelas reach the target cells more quickly (dendritic cells of the lymph node). Although these strategies reduce the intensity and duration of

antibodies against the LPS O chain, do not completely solve the problem Y. In addition, they are irrelevant in most countries, or in geographic areas of extensive breeding, as they require very efficient animal marking and control systems and veterinary services and expensive.

Diagnostic tests have also been investigated which, although using the S-LPS, the polysaccharide O or the native hapten (NH) as an antigen, are sensitive to the amount and affinity of the antibodies, usually greater in infection than in vaccination. However, none of the aforementioned technical solutions differentiate vaccinated animals from infected animals with 100% sensitivity and specificity in all vaccination strategies, particularly in adult vaccination (W091 / 06633, Nielsen K, Ve! Microbiol 2002; 90: 447-459; Moriyón, l., Al., Vel Res 2004; 35: 1-38).

Finally, vaccine modifications have been investigated to nullify this problem. One of them is the rough mutant vaccines, devoid of the polysaccharide O attached to the rest of the LPS on the surface of the bacteria, but these are not sufficiently effective (W093 / 16728; Moriyón, l., Al., Vet Res 2004; 35 : 138; González D, al., PLoSOne 2008; 3: e2760.2008; Barrio, MB., Al., Vaccine 2009; 27: 1741-1749).

Another possibility is the use of recombinant proteins, subcellular or ONA-based vaccines and / or vaccine vectors, but these induce less protection than that provided by live attenuated vaccines.

The last proposed approach has been the incorporation of the green fluorescent protein (GFP) by means of an expression plasmid in Brucella to the vaccine strain S 19 (Chacón-Diaz C. el al., Vaccine 2011; 29 (3): 577-582 ). The S 19-GFP strain maintains the same biological properties as the reference in the murine model and the antibodies generated against this protein allow the discrimination of mice immunized with S 19-GFP, which have fluorescence, of the

5 lO

inflicted with S 19, which would not present it. However, experience teaches that, in the bruce sis, the anti-protein response is of a shorter duration than the response against the O-chain of the LPS. Therefore, although poor experimentation with S 19-GFP in natural hosts (cows, in this case), the existing evidence indicates that the response against GFP will be transitory compared to the response against the LPS chain O. This is a clear disadvantage, since a response against only the O-chain of the LPS does not allow the infected animals to be differentiated from those vaccinated, and thus the problem remains unsolved. The O-chain of smooth brucelas carries the immuno-dominant epitopes that give the corresponding serological tests the best sensitivity, but it is also the cause of interference from vaccination with smooth vaccines in the diagnosis of brucellosis.

fifteen

The O chain is a polysaccharide, specifically in Brucella it is a homopolymer of perosamine (4-amino-4,6-dideoxy-D-mannose), substituted by formyl groups in N position and that plays an essential role in its antigenic structure ( Bundle, DR. Al., Infeel ll / ll / llln 1989; 57: 2829-2836).

20 25

The present invention underlies the manipulation of the O antigen to generate labeled strains that differ antigenically from the virulent silverous strains, since it has now been proven that at least one epitope characteristic of the labeled strains is generated, useful for differentiating the antibodies directed against the vaccine (modified O chain), of those directed against virul e ntas strains (original O chain) and, therefore, vaccinated animals of those infected. To alter the structure of the Brucella O chain, substituents other than the formyl group have been incorporated into the perosamine residues.

DESCRIPTION OF THE FIGURES

30

Figure 1. Demonstration of the modification of perosamine and the appearance of N-acetylperosamine in the O-chain of BAH-aal LPS. Analysis by 1HNMR of the O-PS of B.aborllls (A) and BAB-aeel (B). Environment at 1 'Hlppm is observed

the signal corresponding to the methyl group, around 2 'Hfppm the one corresponding to acetyl group, around 4 1H / ppm the one corresponding to perosamine and around 8 I Hippm the corresponding to the fonnyl group.

Figure 2. The incorporation of acetyl groups into the O-chain of BAR-acel eliminates a typical epitope of B. aborfus. Reactivity of monoclonal antibodies against epitopes A (triangles), M (squares) and e (circles), against the LPS of BAB-parental (panel A), and against the LPS of BAB-acet (panel B). Abscissa: dilution of the serum; Ordered: Absorbance measured as optical density (0.0.) At 405 nm

Figure 3. The incorporation of acetyl groups into the O chain of B. Ahorfus 2308 generates a new or new immunogenic epitope (s). Reactivity against LPS of BAH-parental (A), BAB-acet (B) and E. cali 0157: H7 (e) of rabbit serum immunized with whole cells of absorbed and un absorbed BAB-acet. Abcisas: Title; Ordered Ab United measured as D.O. at 405 nm.

Rabbit serum immunized with BAB-accel: not absorbed (triangles); absorbed with parental BAS (black circles); absorbed with BAS-parental and BABacel (white circles) and negative control (rhombuses). Rabbit serum immunized with E. coli O 157: H7 (squares).

Figure 4. Schematic representation of the BAB? JwadB mutant construct by mutagenesis by phase deletion PCR. The ORF to be removed is represented by a gray arrow (the striped rectangle represents the deleted codons); the intergenic regions above and below the ORF sequence are represented in black; the oligonucleotides used in mutagenesis are indicated as Fl, R2, F3 and R4 (the complementary region between oligos R2 and F3 is represented with lighter stripes); the rectangles with

Square fill denotes kanamycin resistance (KmR) and sucrose sensitivity cassette (sacBR).

GENERAL DESCRIPTION OF THE INVENTION

To solve the ongoing technical problem in the state of the art regarding the current impossibility of effectively distinguishing, without requiring a large sanitary or veterinary infrastructure, animals vaccinated against brucclosis of animals not vaccinated but affected by an outbreak of the disease , the inventors of the present invention have developed the technical solution detailed below.

Said technical embodiment involves different elements, applications and variants, but all of them underlie the same technical concept: modify the O antigen of an LPS by replacing, in at least one Nformylperosamine residue existing in it, of a group formed in position 4-amino by an acyl group other than the formyl group, or by a sugar. The administration to vaccinated animals of this modified O antigen, either directly by part of a compound or composition, or by being part of microorganisms that contain it and / or are capable of expressing it, allows its identification as vaccinated animals. This identification is possible both if the vaccine strain provided that gives them protection against brucclosis contains said modified O antigen, as if it does not contain it but together with said vaccine strain it is administered: a) either the compound or the composition containing it, b ) either a strain that does not confer immunity against brucellosis, but that contains and / or expresses said modified O antigen and that therefore serves as a vaccination marker.

Following this unitary approach of the invention, one embodiment thereof consists of a gram-negative bacterium of the Brucella genus comprising an O antigen of an LPS, O of an NH, O of a biosynthetic precursor thereof, or of a fragment of any of the foregoing, characterized in that at least one of the N-formylperosamine residues of said O antigen has been modified by replacing the 4-amino formyl group of perosamine, with an acyl group, other than the formyl group, or by a sugar, selected from the group comprising hexoses and pentoses.

More specifically, in said gram-negative bacterium the acyl group other than

formyl group that replaces it in the N-formyl perosamine residues is selected from the group comprised of r: an acetyl group, a 3-dcoxy-L-glyccrotctronyl group, a 3-hydroxypropionyl group, an S (+) group 2- hydroxypropionyl and a R (-) 2-hydroxypropionyl group; preferably the acid group is an acetyl group.

As for the percentage of substitution, gram-negative bacteria are preferred where at least 20%, preferably at least 40%, and more preferably at least 60% of the N-formylperosamine residues of the O antigen have been replaced by N-acylpcrosamine residues. other than N-formylperosamine; preferably they have been replaced by N-acetylperosamines.

In another preferred embodiment of the invention, the gram-negative bacteria mentioned above further comprise a heterologous gene encoding: i) an N-acyltransferase capable of transferring an acid group, other than the formyl group, to the 4-amino position of the perosamines of the O antigen; OR

ii) an N-glycosyltransferase capable of transferring a sugar, selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen.

In a specific embodiment, the gram-negative bacteria mentioned above comprise a heterologous gene encoding an N-acyltransferase capable of transferring an acyl group selected from the group comprising: an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, and an R (-) 2-hydroxypropionyl group; preferably Naciltransferase is an N-acctyltransferase.

In a particular embodiment, the heterologous gene encoding said Nacethyltransferase comes from Escherichia coli OI 57: H7. Escherichia hermanii, Vibrio cholerae Hakata, Sa / lllonella group N, Stenotropholllonas lIIa / tophila, Citrobacter gillenii, Citrobacter youngae, or Caulobacter crescentus.

In a preferred embodiment the gram-negative bacterium of the genus Brucella which is used to carry out this invention is preferably B / 'ucella lIlelitensis Rev-l, Brucella abor / lIs SI9, or the Brucella mutant BABt1'W' {uIB.

In the present description all this set of bacteria of the genus Brucella comprising a modified O antigen as described above, are called bacteria of the invention.

The present invention also encompasses a product that consists of or comprises a molecule that, in turn, comprises the LPS O antigen, or an NH, O of a biosynthetic precursor thereof, or a fragment of any of the previous, characterized in that:

a) comes from a gram-negative bacterium with an O antigen comprising a homopolymer of N-formylperosamine; and where in at least one of the N-formylperosamine residues of the O antigen, the 4-amino formyl group of perosamine has been replaced by:

i) an acyl group, other than the formyl group; wherein the acyl group is preferably selected from the group comprising an acetyl group, a 3-dooxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, an R (-) 2-hydroxypropionyl group ; more preferably the acyl group is an acetyl group; or by

ii) a sugar, selected from the group comprising hexoses and pentoses; or b) comes from a gram-negative bacterium with an O antigen comprising

a heteropolymer fused by residues i) N-formylperosamine and N-acylperosamine, where this N-acylperosamine is distinct from N-fonnylperosamine, or ii) N-formylperosamine and N-glycosylperosamine; preferably the

Heteropolymer is bound by residues N-formylperosamine and N-acetylperosamine, N-fonni Iperosamine and 3-deox i-L-gl icerotetroni Iperosamine, N-formylperosamine and 3-hydroxypropionylperosamine,

N-formi lpcrosamine and S (+) 2-hydroxypropionylpcrosamine, or also N-formylperosamine and R (-) 2-hydroxypropionylperosamine;

more preferably the heteropolymer is formed by N-formyl pcrosamine and N-acct ilpcrosamine residues.

A preferred product among those mentioned above is that where the molecule comprising the O antigen comes from a gram-negative bacterium of the

Brucella genus of the invention.

A preferred embodiment of the invention consists of a product such as those mentioned above, where the molecule comprising the O antigen comes from a genetically modified bacterium, to which a heterologous gene encoding:

a) an N-acyltransferase capable of transferring an acyl group, other than the formyl group, to the 4-amino position of the perosamines of the O antigen; preferably an acyl group selected from the group comprising: an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, and an R (-) 2-hydroxypropionyl group ; more preferably the enzyme N-acyltransferase is an N-acetyltransferase; OR

b) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen.

Said product has at least 20%, preferably at least 40%, and more preferably, at least 60% of the residues of antigen 0, with a Nacilperosamine other than N-formylperosamine; preferably Nacilperosamin.a is an N-acetylperosamine. In the present description, the set of products is generically referred to as the product of the invention.

The invention also describes a process for obtaining a product of the invention as defined above, said process comprising the steps:

a) cultivate, under appropriate conditions, a modified gram-negative bacterium

genetically by the introduction of a heterologous gene encoding i) an N-acyltransferase capable of transferring an acyl group, other than the formyl group, to the 4-amino position of the pcrosamines of the O antigen; OR

Ii) an N-glycosyltransphrase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the pcrosamines of the O antigen; where the bacterium is preferably a bacterium of the invention; and b) isolate and / or purify said product of the invention.

A subject of the invention is also a method for obtaining antibodies, comprising: a) immunizing an animal with i) a bacterium of the invention, as defined above, or

Ii) a product of the invention, also as detailed above; and b) isolate and / or purify said antibodies. Object of the present invention are

also the antibodies obtainable by the procedure indicated above.

Therefore, a specific antibody against an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the foregoing, characterized in that :

a) at least one of the N-formylperosamine residues of said 0 antigen has been modified by replacing at least one fonnyl group, in the 4-amino position of perosamine, by:

i) an acyl group, other than the formyl group; where the acyl group is

preferably select from the group comprising an acetyl group, a

3-dooxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, a group

S (+) 2-hydroxypropionyl, an R (-) 2-hydroxypropionyl group, and more preferably the acyl group is an acetyl group; or by

ii) a sugar, selected from the group comprising hcxose and pentose; or b) said O antigen comprises a heteropolymer fused by residues i) N-forrnylpcrosamine and N-acylpcrosamine. where this N-acylpcrosamine is different from N-fonnilpcrosamine, or

ii) N-formylperosamine and N-glycosylperosamine; preferably the hetcropolyncro is fused by residues N-fonnilperosamine and N-acetyl perosamine,

N-fonnylperosamine and 3-deoxy-L-glycerotetronylperosamine, N-fonnylperosamine and 3-hydroxypropionylperosamine, N-formylperosamine and S (+) 2-hydroxypropionylperosamine, or also N-fonnylperosamine and R (-) 2-hydroxamine

more preferably the heteropolymer is formed by N-formylperosamine and N-acetylperosamine residues.

Preferably the antibodies described above are specific against an O antigen that comes from a bacterium of the invention. For the purposes of this description, the different antibodies described above are called antibodies of the invention.

The invention also relates to a bacterium of the invention, or a product of the invention, for use in medicine.

More specifically, the invention concerns the use of a bacterium of the invention,

or a product of the invention, in the manufacture of a medicament or a vaccine.

Specifically, the invention is about a bacterium of the invention, or a product of the invention, for use in the prevention of brucellosis.

Thus, the invention also comprises the use of a bacterium of the invention, or a product of the invention, in the manufacture of a medicament or a vaccine for the prevention of brucellosis.

The invention consists, in turn, of a medicament for the treatment of brucellosis, Ouna VaCuna for the prevention of the appearance of said disease comprising a bacterium of the invention, or a product of the invention.

Another preferred embodiment of the invention consists of a bacterium of the invention, or a product of the invention, or an antibody of the invention, for use in the diagnosis of brucclosis; preferably for the differentiation of Brucella infected animals from vaccinated animals against Brucella.

Similarly, the invention also relates to the use of a bacterium of the invention, or a product of the invention, or an antibody of the invention, in the manufacture of a composition, reagent or kit, for the diagnosis of brucellosis; preferably for the differentiation of Brucella infected animals from vaccinated animals against Brucella.

Another embodiment of the present invention, based on the same technical solution common to all embodiments included in the patent, is the use of a marker to differentiate Brucella-infected animals from vaccinated animals against the Brucella, wherein said marker is selected between:

a) an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the foregoing, from a bacterium of the invention;

b) a specific antibody against an O antigen of an LPS, O of an NH, O of a biosynthetic precursor thereof, or of a fragment of any of the foregoing, from a bacterium of the invention;

c) a DNA or RNA molecule that encodes:

i) an N-acyltransferase capable of transferring an acyl group, other than

forrnyl group, at the 4-amino position of the perosamines of the O antigen; where

the acyl group is preferably selected from the group comprising a

acetyl group, a 3-deoxy-L-glycerotetronyl group, a group 3

hydroxypropionyl, an S (+) 2-hydroxypropionyl group, an R (-) 2 group

hydroxypropionyl; and more preferably the acyl group is an acetyl group; or

ii) an N-glycosyltransphrase capable of transferring a selected sugar

from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen; d) a specific antibody against

i) an N-acyltransphrase capable of transferring an acyl group, other than the fonnyl group, to the 4-amino position of the perosamines of the O antigen; wherein the acyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+} 2-hydroxypropionyl group, an R (-} 2-hydroxypropionyl group; and more preferably the acyl group is an acetyl group, the enzyme N-acyltransfcrase being therefore an N-acctyltransfcrase; or against

ii) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen; and e) a combination of the above. For the purposes of this description, this set of different markers is

they call markers of the invention.

Along the same lines, the invention describes an in vitro diagnostic method for differentiating Brucella-infected animals from vaccinated animals against Brucella, which comprises detecting the presence in an animal sample of a marker selected from:

a) an O antigen of an LPS, O of an NH, O of a biosynthetic precursor thereof, or of a fragment thereof, from a bacterium of the invention;

b) a specific antibody against an O antigen of an LPS, O of an NH, O of a biosynthetic precursor thereof, or of a fragment thereof, from a bacterium of the invention;

the one DNA or RNA molecule that encodes: i) an N-acyltransferase capable of transferring an acyl group, other than the formyl group, to the 4-amino position of the O antigen perosamines; where he

acyl group is preferably selected from the group comprising an acetyl group,

In the 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, an R (-) 2-hydroxypropionyl group, and more preferably the acyl group is an acetyl group, therefore being the enzyme ima N-acyltransfcrase an N-acctyltransfcrase; OR

ii) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen; d) a specific antibody against

i) an N-acyltransferase capable of transferring an acyl group, other than the formyl group, to the 4-amino position of the pcrosamines of the O antigen; wherein the acyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, a S (+) 2-hydroxypropionyl group, a R (-) 2-hydroxypropionyl group, and more preferably the acyl group is an acetyl group, the enzyme N-acyltransferase being therefore an N-acetyltransferase; or in front of

ii) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen; and e) a combination of several of the above markers;

where the presence of at least one of said markers is indicative that said animal has been vaccinated against brucellosis.

In a preferred way of practicing the present invention the method described above is an immunoassay, preferably selected from an ELlSA, a plaque agglutination test and a tube agglutination test.

The invention in relation to the above-mentioned method comprises the following steps: a) detecting the presence in the sample of specific antibodies against an O antigen of an LPS, O of an NH, O of a biosynthetic precursor thereof, or

of a fragment of any of the above, from a gram-negative bacterium of the genus Brucella, other than a bacterium of the invention; Y

b) detect the presence in the sample of specific antibodies against an antigen O of an LPS, O of an NH, O of a biosynthetic prccursosr thereof, or 5 of a fragment of any of the above, from a bacterium of the

invention.

The method of the invention, in a variant, further comprises an intermediate step between a) and b) in which the sample is contacted with a ligand

10 specific to absorb the antibodies detected in a). Said specific wave or ligand to absorb the antibodies detected in a) is selected from the group consisting of:

a) a molecule comprising an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the above 15, from a gram-negative bacterium of the genus Brllcella, other

of a bacterium of the invention; or b) a gram-negative bacterium of the genus Brllcella, other than a bacterium of the invention.

The invention, in relation to the diagnostic method, can be carried out in vivo to differentiate Brucella infected animals from vaccinated animals against the Brucella. Said in vivo method, according to the present invention, comprises:

a) intracutaneously inoculate the subject, preferably an animal, with a suitable dose, according to its species and weight, of

i) an N-acyltransferase capable of transferring, to the 4-amino position of the perosamines of the 0 antigen, an acyl group, other than the formyl group; wherein the acyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-gli cerotetronyl group, a hydroxypropionyl group 330, an S (+) 2-hydroxypropionyl group, a R (-) 2-hydroxypropionyl group , and more preferably the acyl group is a group

acetyl, whereby the enzyme N-acyltransfcrase is an N-acctyltransfcrase; or from ii) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hxxose and pentoses, to the 4-amino position of the 5 pcrosamines of the O antigen; and b) observe the development of a delayed hypersensitivity skin reaction, preferably detectable by the formation of indurations or papules.

The invention also describes a diagnostic kit for differentiating Brucella-infected animals from vaccinated animals against Brucella, which comprises at least one component selected from:

a) a probe or ligand for specific antibodies against the O antigen of a lipopolysaccharide or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of them, wherein said O antigen comes from a bacterium

15 of the invention; b) an antibody of the invention;

e) an N-acyltransferase capable of transferring, to the 4-amino position of the perosamines of the 0 antigen, an acyl group, other than the formyl group; wherein the acyl group is preferably selected from the group comprising an acetyl group,

A 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, an R (-) 2-hydroxypropionyl group, and more preferably the acyl group is an acetyl group, being, therefore, the enzyme N-acyltransferase an N-acet ilt ra ns fcrase;

d) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen; Y

e) a polynucleotide for amplifying a gene encoding an N-acyltransferase according to c) or an N-glycosyltransferase according to d); preferably a polynucleotide to amplify the wbdR gene of E. coli OI 57: H7; more preferably the sequence

30 of the polynucleotide is SEQ.ID.NO. 9, SEQ.ID.NO. 10, SEQ.ID.NO. 11, and SEQ.ID.NO. 12.

In a preferred embodiment of the invention, the kit comprises at least one probe O ligand a) for the specific antibodies selected from the group formed

by:

a) a bacterium of the invention; Y

b) a product of the invention.

The kit of the invention, in an alternative, further comprises at least one reagent selected from:

a) a molecule comprising an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the above, from a gram-negative bacterium of the Brucella genus, other than a bacterium of the invention; or

b) a gram-negative bacterium of the genus Brucella, distinct from a bacterium of the invention.

Finally, the invention also describes a polynucleotide that comprises, or consists of, a sequence selected from: SEQ.ID.NO. 1, SEQ.lD.NO. 2, SEQ.ID.NO. 3, SEQ.ID.NO. 4, SEQ.ID.NO. 5, SEQ.ID.NO. 6, SEQ.ID.NO. 9, SEQ.ID.NO. 10, SEQ.ID.NO. 11, or SEQ.ID.NO. 12. For the purposes of the present description the above-mentioned polynucleotides are called polynucleotides of the invention.

Related to this last aspect of the invention, this also refers to the polynucleotides of the invention for use in the diagnosis of brucellosis and related thereto, the use of the polynucleotides of the invention for the manufacture of a composition, a reagent or a kit for the diagnosis of brucellosis.

In another aspect, the invention also relates to a method of prevention and / or treatment of brucellosis in a subject, preferably an animal, which comprises the administration to said subject, preferably an animal, of a therapeutically effective amount of a bacterium of the invention.

DETAILED DESCRIPTION OF THE INVENTION

Bacleria ~ 'of Brllcella carrying modified O antigen

Therefore, in a first aspect the invention relates to a gram bacteria

negative of the Brucella genus comprising an O antigen of an LPS, O of an NH,

Or of a biosynthetic precursor thereof, or of a fragment of any of the

previous (antigen 0, LPS, NH or biosynthetic precursors), characterized in that

minus one of the N-formylperosamine residues of said 0 antigen, has been

modified by replacing the formyl group, in the 4-amino position of the

perosamine, for:

a) an acyl group other than the formyl group; Or for

b) a sugar, selected from the group comprising hexoses and pentoses.

For brevity, as already mentioned, we will also refer to this gram-negative bacterium of the genus Brucella as "bacteria of the invention".

In a particular embodiment the Brucella is a smooth Brucella. Smooth bacteria of the genus Brllcella are those that comprise a smooth lipopolysaccharide (smooth LPS, LPS-S, or S-LPS) as a component of the outer membrane. This smooth lipopolysaccharide comprises 3 typical domains: lipid A, which allows the lipopolysaccharide to be anchored to the outer membrane of the bacteria; the oligosaccharide nucleus; and polysaccharide O, also referred to as the O chain, O antigen, or O polymer. In another embodiment, Brllcella is a rough Brllcella mutant that does not have an O chain attached to the rest of the LPS, but still has biosynthetic precursors thereof in its inside, like smooth bacteria.

The O antigen is a polysaccharide po which in Brucella essentially comprises an unbranched chain formed by a homopolymer of 4-phthalamide-4,6-dideoxy-D-mannose residues (alternatively called N-formylperosamine), linked by links to [1-2] .

The native haptcno (native hapten, or also NH) is another polysaccharide component of the brucelas, antigenically related to the LPS. Like LPS, the native hapten of these bacteria comprises a homopolymer of Nformylpcrosamines structurally equivalent to the LPS O antigen, but not

5 attached to the polysaccharide nucleus and there ask A, which we will also call as an O antigen or one of its equivalent terms.

The term "biosynthetic precussor thereof" refers to any free N-formylperosamine polysaccharide or oligosaccharide in the cytoplasm of a Brucella, or attached to its cell envelope by means of a lipid of the type of

bactoprcnoL

The bacterium of the invention can be any O-chain carrying bacterium of any species of the Brucella genus (smooth or rough) to which a modification has been made as defined in this description. Preferably said

Brucella is a B. melitensis or a B. abortus or a B. suis.

In one embodiment of the invention, the chain-bearing Brucella O is a vaccine strain of any of the aforementioned species. In a preferred embodiment of the invention the Brucella is B. melitensis Rev-l,

B. abortus S19, or B. abortus BAB: 1Y1: "adB.

The bacterium of the invention is characterized in that at least one of the residues

25 N-formylperosamine of the LPS O antigen, NH, biosynthetic precursor thereof or a fragment of any of the above, is modified, so that the 4-amino positionyl formyl group of perosamine is substituted: a) by an acyl group other than the tormyl group; or b) by a sugar, which can be a hexose or a pentose.

In one embodiment, the hexose or pentose that replaces the fonnyl group may be or be selected from allose, altrose, glucose, mannose, gulose, galactose,

Dosa, talosa, fruity, sorbose, abccuous, ribose, arabinose, xylose, lyxose, ribulose, or xylulose.

The term "acyl group" refers to a group derived from oxoacid by elimination of at least one hydroxyl group. It is a structure component R-CO-O-, where R is an aliphatic chain with or without additional groups.

In a preferred embodiment of the invention, the acyl group has been selected from the group comprising: an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, and a group R (-) 2-hydroxypropioni10.

In a more preferred embodiment, the acyl group is an acetyl group, so that the O antigen will comprise at least one N-acetylperosamine (4-acetamido-4,6-dideoxy-D-mannose) residue.

Thus, in one embodiment the O antigen of the LPS, of the NH, of the biosynthetic precursor thereof or of a fragment of any of the foregoing, comprises a heteropolymer formed by N-formylperosamine and N-acylperosamine residues, this being an N -acrylicpcrosamine other than Nformylperosamine, or alternatively by N-formylperosamine and Nglicosylperosamine residues. It preferably comprises a heteropolymer formed by residues:

N-formylperosamine and N-acetylperosamine;

N-formylperosamine and 3-deoxy-L-glycerotetronylpcrosamine;

N-fonnylperosamine and 3-hydroxypropionylperosamine;

N-fonnylperosamine and S (+) 2-hydroxypropionylperosamine; or

N-formylpcrosamine and R (-) 2-hydroxypropionylperosamine.

In a more preferred embodiment the heteropolymer is formed by the alternation of residues N-formylperosamine and N-acetylperosamine.

The proportion of each waste can be varied according to the

realizations In one embodiment, at least 20%, preferably at least 40% and more preferably at least 60% of the N-fonni lperosamine residues have been replaced by residues of the alternative N-acylperosamine. In a preferred embodiment, at least 20%, preferably at least 40% and more prcfcntcmcnte at least 60% of the O antigen residues are N-acctylperosamines.

Likewise, the distribution of the two residues in the hctcropolymer chain may vary, although it is preferable that the alternation of both residues be homogeneous along the chain.

The modified O antigen of the bacterium of the invention has at least one new immunogenic epitope, nonexistent in the field strains, and against which specific antibodies are generated. The bacterium of the invention is therefore antigenically labeled.

Accordingly, it is sufficient that the bacterium of the invention comprises an O antigen of an LPS, of an NH O of a biosynthetic precursor thereof, or of a fragment of any of the foregoing, so that said, O antigen of an LPS, NH or a biosynthetic precursor thereof, or of a fragment of any of the foregoing, comprises at least one new immunogenic epitope that is not present in field brucellas. The "field", "wild" or "wild" ténninos refer interchangeably to strains originally obtained from natural hosts.

The presence of said immunogenic epitope capable of generating specific antibodies can be determined, for example, by tests:

-

extraction of the LPS, NH, biosynthetic precursors thereof, or a fragment of any of the foregoing and characterization of the O antigen by nuclear magnetic resonance eH-NMR), as described in example 2;

-

an immunoassay to determine whether in animals immunized with the bacterium of the invention or with an extract comprising the modified O antigen,

generate specific antibodies against the modified O antigen, for example an agglutination O an ELJSA, as described in example 4; and, optionally, an immunoassay to determine the elimination of any of the typical cytopes of the O antigen from the field brucclas, as described in example 3. 5

As one skilled in the art will appreciate, the bacterium of the invention can be prepared by chemical modification methods, or also by genetic engineering techniques. In a preferred embodiment, the bacterium of the invention is obtained by genetic modification.

Thus, in one embodiment, the bacterium of the invention is also a bacterium which further comprises a heterologous gene encoding i) an N-acyltransferase capable of transferring an acyl group, other than the formyl group, to the 4-amino position of the perosamines of the O antigen; or

Ii) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen.

The acyl group that said N-acylthnferase is capable of transferring, O hexose O

The pentose that N-glycosyltransferase is capable of transferring can be any of those previously mentioned in the description of the characteristics of the O antigen of the bacterium of the invention.

In one embodiment, the acyl group is selected from the group comprising a

Acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, an R (-) 2-hydroxypropionyl group, and more preferably the aeyl group is an acetyl group . In this case, the heterologous gene encoding N-acyltransferase can be obtained by cloning the gene of any field bacteria comprising said gene. Likewise, said gene can be a gene

A heterologous encoding a variant of a mutated or modified N-acyltransferase, provided that this variant is capable of transferring the acyl group other than the formyl group to the 4-amino position of the perosamines of the O antigen.

The following strategy can be followed for the selection of 1In suitable heterologous gene: i) carry out a review of the bacteria (Table 2) that have an O antigen

5 consisting of N-acylpcrosamine residues with a group in position N other than the formyl group characteristic of the O antigen of the smooth Brucella species (a homopolymer of N-formylpcrosamine);

ii) identify the enzyme responsible for incorporating the different substitution of the formyl group in the 4-amino position; Ii) clone the DNA encoding said enzyme into an expression plasmid and introduce such plasmid into Brucella; and iv) analyze the structure and immunogenic properties of the LPS thus modified.

In a preferred embodiment said heterologous gene encodes a

N-acetyltransferase or a variant thereof capable of transferring an acetyl group to the 4-amino position of perosamine. This heterologous gene can be, among others, the gene that encodes an N-acetyltransferase of Escherichia coN O I57: H7, Escherichia hermanii, Vib rio cholerae Hakata, Salmonella group N, Stenotrophomonas maltophila, Citrohacter gillenii, Citrohacter and Olllbacter, or Call1ocent, cres or bacterium.

In one embodiment, the heterologous gene capable of transferring acetyl groups to the indicated position is, for example, the wbdR gene (NeBI; 16. 12.2010; ID: 962088; locus tag: z3 192; ORF in SEQ ID NO: 7) ; encoding E. coli N-acetyltransferase OI 57: H7.

Generally, the heterologous gene encoding N-acyltransferase or Nglicosyltransferase will be part of and will be integrated into an expression cassette or transcriptional unit, which allows transcription and production of Naciltransferase or N-glycosyltransferase in the Brucella receiving the heterologous gene , Y

30 comprising:

-

a regulatory region - promoter, functional in Brucella, which directs and regulates the transcription of the sequence encoding the N-aciltraTL ;; ferasa or the NgIicos iltrans ferasa; -a signal sequence of transcription initiation; 5-the sequence encoding N-acyltransfcrase or N-glycosyltransfcrase; and -a transcription termination signal sequence.

In one embodiment, the heterologous gene includes the polynucleotide sequence encoding N-acyltransferase or N-glycosyltransferase and also the rest of

10 elements that complete the transcnpcional unit of the gene in the bacterium from which said hctcrologist gene is obtained and that regulate the transcription and expression of said Naciltransferase or N-glycosyltransferase in said bacterium.

However, all or part of these non-coding polynucleotide sequences

15 could be replaced by others (for example a promoter region determined by another promoter region different from the previous one can be replaced), or even sequences with additional functionality could be introduced. In any case, the resulting heterologous gene will allow the transcription and expression of N-acyltransferase or N-glycosyltransferase in the recipient Brucella of said heterologous gene.

20 The construction of expression cassettes that form the heterologous gene; its introduction into expression vectors suitable for the introduction and genetic transfer of heterologous genes in bacteria; as well as the introduction and transfer of said vector to Brucella bacteria can be done by techniques

25 conventional genetic engineering and gene transfer known from the expert in this field (Sambrook al., 2001, "Molecular cloning, to Laboratory Manual", 2nd ed., Cold Spring Harbor Laboratory Press, N.Y. Vol 1-3 a).

It is an object of the invention a process for obtaining a

A bacterium, which comprises transferring an expression vector, capable of expressing itself in Brucella, to a gram-negative bacterium of the Brucella genus, comprising a heterologous gene encoding:

i) an N acyltransfcrase capable of transferring an aeyl group, other than the formyl group, to the 4-amino position of the perosamines of the O antigen; OR

ii) an N-glycosyltransphrase capable of transferring a sugar selected from the group comprising hcxose and pentoses, to the 4-amino position of the pcrosamines of the O antigen.

In one embodiment the expression vector may be for example pYRI-6 (see Table 1).

The N-acyltransferase can be any N-acyltransferase according to the embodiments described for the bacterium of the invention. In a particular embodiment, it is an N-acctyltransfcrase with the amino acid sequence depicted in SEQ ID NO: 8, which is encoded by the nucleotide sequence depicted in SEQ ID NO: 7.

As already indicated, the bacterium of the invention can be particularly

useful in DIVA systems, as a marked vaccine strain. D1VA means "Differentiation of Infected fiom Vaccinated Animals", a term coined in 1999 by J. T. van Oirschot (Central Veterinary Institute, Netherlands), which enables mass vaccination of a population of susceptible animals, without compromising the serological identification of convalescent individuals. This strategy requires the use of appropriate vaccines and specific diagnostic tests.

In another aspect, the invention also relates to a bacterium of the invention for use in medicine as a medicine or vaccine; and also to the use of a bacterium of the invention in the preparation of a medicament or vaccine; and also to a medicament or vaccine comprising a bacterium of the invention.

In another aspect, the invention relates to a bacterium of the invention for the prevention and treatment of brucellosis, and more preferably for the prevention of brucellosis. In other words, the invention also relates to the use of a bacterium of the invention in the preparation of a medicament or vaccine for the

prevention and treatment of brucclosis. more preferably for prevention of brucellosis.

The invention also relates to a method for prevention and / or treatment.

5 of brucclosis in a subject, preferably an animal, comprising administering to said subject or animal a therapeutic effective amount of a bacterium of the invention. An effective tcrapherapeutic amount, for the purposes of this specification, should be interpreted as an amount capable of preventing the onset of the disease and / or of remitting the symptoms inherent in said specification.

10 disease in an infected subject or animal until completely cured.

On the other hand, the bacterium of the invention can be useful in the complementary diagnostic methods and kits of a DIVA system, for example as probes or ligands for the binding, absorption and / or capture or blocking of antibodies.

15 specific against the antigen O characteristic of the bacterium of the invention, present in a biological sample of a subject or animal; or as a control reagent.

Therefore the invention also relates to the use of a bacterium of the invention.

20 in the preparation of a composition, reagent or kit for diagnosis, preferably for the diagnosis of brucellosis, more preferably for the differentiation of Brucella infected animals from vaccinated animals against Brucella; or in other words, the use of a bacterium of the invention in the preparation of a composition, reagent or kit for DIVA diagnosis of the

25 brucellosis

The invention also relates to a bacterium of the invention for diagnostic use, preferably for diagnosis of brucellosis, more preferred for the differentiation of Brucella infected animals from vaccinated animals against

30 Brucella; Or put another way, the bacterium of the invention for use in diagnosis D I VA of brucellosis.

ProducllI comprising a modified O antigen

As follows, a modified O antigen in the manner indicated may also be useful, for example, in vaccine compositions comprising cell fractions (subcellular vaccines) or as

reagent in methods and kits for diagnosis.

Therefore, in another aspect the invention relates to a product consisting of,

or comprising e, a molecule comprising, in turn, the LPS O antigen, of 10 NH, of a biosynthetic precursor thereof, or of a fragment of any of the foregoing, characterized in that:

a) comes from a gram-negative bacterium whose O antigen comprises a homopolymer of N-fonnylperosamines and where at least one of the N-formylperosamine residues of the O antigen, the 4-amino positionyl group of the

Perosamine has been replaced by: i) an acyl group, other than the fonnyl group; or by

ii) a sugar, selected from the group comprising hexoses and pentoses; or b) comes from a gram-negative bacterium with an O antigen comprising

20 a heteropolymer consisting of residues i) N-formylperosamine and N-acylperosamine. where this N-acylperosamine is different from N-formylperosamine, or ii) N-formylperosamine and N-gl icosylperosamine.

25 For brevity, as mentioned above, we will also refer to this product as "product of the invention"; and to said molecule comprising the O antigen as "molecule of the invention".

In one embodiment in which the substituent is an acyl group other than the group

30 formyl, this is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group and an R (-) 2- group hydroxypropionyl; and more preferably the acyl group is an acetyl group. In another embodiment in which the replacement of the

Formyl group is a hexose O pentose, sugar is selected from alosa, altrosa, glucose, mannose, gulose, galactose, dosa, talose, fruetosa, sarbosa, abecuosa, ribose, arabinose, xylose, lyxose, ribulose, O xylulose.

In a preferred embodiment the heteropolymer of the antigen is formed by residues selected from:

N-formylperosamine and N-acetylperosamine,

N-fonnylperosamine and 3-deoxy-L-glycerotetronylperosamine,

N-fonnylperosamine and 3-hydroxypropionylperosamine,

N-formylperosamine and S (+) 2-hydroxypropionylperosamine, or also

N-fonnylperosamine and R (-) 2-hydroxypropionylperosamine; more preferably, the heteropolymer is formed by Nformylperosamine and N-acetiJperosamine residues.

In one embodiment the product is a composition or mixture containing the molecule of the invention comprising said 0 antigen, for example an extract

or bacterial fraction comprising the LPS, NH, or biosynthetic precursors thereof, or a fragment of any of these. In one embodiment said composition or mixture is a medicament or a vaccine comprising the molecule of the invention.

In one embodiment the antigen ° of the molecule of the invention comes from

Brucella

In one embodiment the antigen ° of the molecule of the invention comes from a genetically modified bacterium, to which a hetcrologist gene encoding an N-acyltransferase or N-glycosyltransferase has been introduced as defined above in the description of the bacterium of the invention; preferably Naciltransferase is an N-acetyltransferase.

More preferably, said genetically modified bacterium is a bacterium of the invention.

The O antigen of the molecule of the invention can also come from a gram-negative bacterium other than Brucella and which, with the introduction of the heterologous gene encoding a suitable N-acyltransferase or N-glycosyltransferase, is capable of producing an LPS, a NH, biosynthetic precursors thereof, OR a fragment of any of the above, with an O antigen having the heteropolymeric structure already indicated. For example, the Yersinia enterocolitica serotype 0: 9 O antigen is essentially formed by a chain of a homopolymer of N-formylperosamines with a structure similar to that of the Brucella O antigen. From this bacterium it is possible to obtain the described heteropolymeric O antigen, also by introducing a hetcrologist gene encoding a suitable N-acyltransferase or N-glycosyltransferase, preferably a Nacethyltransfemsa.

On the other hand, as in the bacterium of the invention, the proportion of each of the residues in the O antigen of the molecule of the invention may vary according to embodiments. In an embodiment at least 20%, preferably at least 40% and more preferably at least 60% of the residues are Nacilperosamine other than N-formylperosamine. In a preferred embodiment, at least 20%, preferably at least 40% and more preferably at least 60% of the O antigen residues are N-acetylperosamine.

In a further aspect, the invention relates to a method for obtaining the product with the molecule of the invention, comprising:

a) cultivate, under appropriate conditions, a genetically modified gram-negative bacterium by introducing into the bacterium a heterologous gene that encodes

i) an N-acyltransfcrase capable of transferring an acyl group, other than

formyl group, at the 4-amino position of the perosamines of the O antigen; OR

ii) an N-glycosyltransphrase capable of transferring a selected sugar

from the group comprising hexoses and pentoses, to the 4-amino position of the

O antigen perosamines; Y

b) isolate and / or purify said product.

The characteristics and embodiments of N-acyltransferase and Nglycosyltransphrase have been described previously in describing the bacteria of the invention.

Thus, in a preferred embodiment the gram-negative bacterium is preferably a bacterium of the invention (a genetically modified Brucella as described above).

The term "cultivate under suitable conditions" refers to the fact that it is cultivated under conditions that allow the expression and production of the N-acyltransferase or Nglycosyltransferase encoded by the heterologous gene and under suitable conditions for this enzyme to act, thus forming the LPS, NH and biosynthetic precursors thereof, OR a fragment of any of the foregoing, containing the modified O antigen.

The characteristics of the heterologous gene and its different embodiments have been described previously.

On the other hand, the isolation and purification of the product can be carried out by conventional methods for the isolation and purification of LPS, NH, biosynthetic precursors thereof, or a fragment of any of the above, containing the commonly used O antigen in bacteriology. Some suitable methods for isolation and purification can be found in Aragón et al. (J Bacteriol 1996; 178: 1 070-1079).

The following aspects are also object of the invention: * The product of the invention for use in medicine, particularly as

medication or vaccine; and, in other words, also the use of the product of the invention in the preparation of a medicament or a vaccine;

* The product of the invention for the prevention and treatment of brucclosis,

5 more preferably for the prevention of brucclosis; or in other words, the use of the product of the invention in the preparation of a medicament or vaccine for the prevention and treatment of brucclosis, more preferably for the prevention of

brucellosis;

.. A method for the prevention and treatment of eg brucellosis in a subject or animal, which comprises administering to said subject or animal a tcrarapeutically effective amount of the product of the invention;

.. The use of the product of the invention in the preparation of a composition, reagent or diagnostic kit, preferably for the diagnosis of brucellosis; more preferably for the differentiation of Brucella infected animals from

15 animals vaccinated in front of Brucella; Or in other words, the use of the product of the invention in the preparation of a composition, reagent or kit for DIVA diagnosis of brucellosis;

.. The product of the invention for diagnostic use; preferably for the diagnosis of brucellosis, more preferably for the differentiation of animals infected by Brucella from vaccinated animals against Brucella; or said of another

mode, the product of the invention for use in the DIVA diagnosis of brucellosis;

.. The use of the product of the invention as an immunogen in the preparation of an immunogenic composition for the production of antibodies (specific against the antigen O characteristic of the bacterium, molecule or product of the invention).

Antibody against the modified O antigen

The inoculation or immunization of an animal with the bacterium, molecule or product of the invention results in the formation of specific antibodies against the modified O antigen already described. These specific antibodies are antibodies that do not recognize, that is, they do not form antigen-antibody immune complexes with

the field brucclas O antigen, constituted by the homopolymeric chain of N-formylperosamines.

These antibodies can be used for example in methods and kits for diagnosis of brucclosis, for example in competition immunoassays of the ELlSA type.

Therefore, in another aspect the invention also relates to a specific antibody against an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the foregoing,

characterized in that: a) at least one of the N-fonnylperosamine residues of said 0 antigen, has been modified by replacing at least one formyl group, in the 4-amino position of perosamine, by:

I) an acyl group, other than the formyl group; Or by i) a sugar, selected from the group comprising hexoses and pentoses; or b) said O antigen comprises a heteropolymer consisting of residues i) N-formylperosamine and N-acylperosamine, where this N20 acylperosamine is distinct from N-fonnylperosamine, or ii) N-formylperosamine and N-glycosylperosamine.

The characteristics of this modified O antigen, as well as some of the possible embodiments for the formyl and glycosyl substituent groups of the formyl group and its heteropolymeric structure have already been provided in the

description of the bacterium and product of the invention.

In one embodiment, the formyl group substituent is an acyl group selected from the group comprising an acetyl group, a 3-deoxy-L30 glycerotetronyl group, a 3-hydroxypropionyl group, an 8 (+) 2 hydroxypropionyl group, a

R (-) 2-hydroxypropionyl group, and more preferably it is an acetyl group.

In one embodiment the O antigen comprises a hctcropolymer formed by

residues selected from: N-fonnylperosamine and N-acetylpcrosamine, N formylpcrosamine and 3-dcoxy-L-glycyclotctronylperosamine,

5 N-formylpcrosamine and 3-hydroxypropionylpcrosamine, N-formylperosamine and S (+) 2-hydroxypropionylperosamine, or also N formylpcrosamine and R (-) 2-hydroxypropionylpcrosamine;

In an even more concrete embodiment, the hcteropolymer consists of 10 residues N-fonnilperosamine and N-acetylperosamine.

In one embodiment the antibody is specific for an O antigen that comes from a gram-negative bacterium of the Brucella genus, preferably from a bacterium of the invention.

The object of the invention is also: - a method for obtaining antibodies, comprising: a) immunizing an animal with: i) a bacterium of the invention, OR 20 ii) a product of the invention; and b) isolate and / or purify the antibodies; as well as an antibody obtainable by this procedure.

Immunization and antibody obtaining layers can be performed according to

25 conventional methods and techniques for obtaining antibodies, techniques all known to those skilled in the art (Hay, FC and Westwood, OMR, 2002. Practicallmmunology, 4rth edition, Blackwcll Sciencc Ud., Oxford. ISBN: 978-086542-96 1-1).

They are also a further object of the invention:

* The use of these antibodies in the preparation of a composition, reagent or diagnostic kit, preferably for the diagnosis of brucellosis, more preferably for the differentiation of animals inflicted by Brucella de

vaccinated animals in front of Brucella; or in other words, the use of these antibodies in the preparation of a composition, reagent or kit for DIVA diagnosis of brucclosis; Y

* The antibodies described in this section for diagnostic use, preferably for the diagnosis of brucellosis, more preferably for the differentiation of animals inflicted by Brucella from vaccinated animals against Brucella; Or in other words, the antibodies described above for use in the diagnosis O IV A of brucellosis.

Methods reagents and kits for diagnosis of brucellosis

The characteristic of the modified O chain of the bacterium and product of the invention of generating a new immunogenic epitope can be very useful and can be exploited as a marker in a system for DIVA diagnosis of brucellosis.

Thus, the invention relates in a further aspect to the use of a marker to differentiate Brucella-infected animals from vaccinated animals against the Brucella, wherein said marker is selected from:

a) an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the foregoing, from a bacterium of the invention;

b) a specific antibody against an O antigen of an LPS, O of an NH, O of a biosynthetic precursor thereof, or of a fragment of any of the foregoing, from a bacterium of the invention;

c) a DNA or RNA molecule that encodes

i) an N-acyltransferase capable of transferring an acylo group, other than

fomyl group, at the 4-amino position of the perosamines of the O antigen; where

the acyl group is preferably selected from the group comprising a

acetyl group, a 3-dkoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, a R (-) 2-hydroxypropionyl group; and more preferably the acyl group is an acetyl group; or

ii) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hcxose and pentoses, to the 4-amino position of the pcrosamines of the O antigen; d) a specific antibody against

i) an N-acyltransphrase capable of transferring an acyl group, other than the formyl group, to the 4-amino position of the O antigen perosamines; wherein the acyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, a R (-) 2-hydroxypropionyl group; and more preferably the acyl group is an acetyl group, the enzyme N-acyltransferase being therefore an N-acctyltransferase; or in front of

ii) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen; and e) a combination of the above.

For the purposes of the present description, as mentioned above, the aforementioned markers will hereinafter be referred to as markers of the invention.

The invention relates in another aspect to an in vitro diagnostic method, to differentiate Brucella-infected animals from vaccinated animals against Brucella (animals vaccinated with a bacterium of the invention), which comprises detecting the presence in a sample of the animal of a bookmark selected from:

a) an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the foregoing, from a bacterium of the invention;

b) a specific antibody against an O antigen of an LPS, O of an NH, O of 1In biosynthetic precursor thereof, or of a fragment of any of them, from a bacterium of the invention; e) an ONA or RNA molecule that encodes:

i) an N-acyltransfcrase capable of transferring an acyl group, other than the fonnyl group, to the 4-amino position of the O antigen perosamines; wherein the acyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, a R (-) 2-hydroxypropionyl group, and more preferably the acyla group is an acetyl group, the enzyme N-acyltransferase being therefore an N-acetyltransferase; or

ii) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen; d) a specific antibody against

i) an N-acyltransferase capable of transferring an acyl group, other than the formyl group, to the 4-amino position of the O antigen perosamines; wherein the acyl group is preferably selected from the group comprising an acetyl group, a 3-dcoxy-L-glycotetronyl group, a 3-hydroxypropionyl group, a S (+) 2-hydroxypropionyl group, a R (-) 2-hydroxypropionyl group, and more preferably the acyl group is an acetyl group, the enzyme N-acyltransferase being therefore an N-acetyltransferase; or in front of

ii) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen; and e) a combination of several of the above markers;

where the presence of one of said markers is indicative that said animal has

been vaccinated against brucellosis.

These 0 antigens, antibodies, N-acyltransfcrases, and N-glycosyltransfcrases have already been described in the previous sections; its characteristics and embodiments are applicable to the use of the marker and the diagnostic method now proposed.

The diagnostic method, hereinafter referred to as the DIVA method of the invention, can be performed on any biological sample of the animal. In particular it can be performed on any type of biological fluid; preferably on a sample of blood serum, whey or tears. In a more preferred embodiment the sample is blood serum.

The detection of the marker of the invention can be carried out by means of conventional biomarker detection techniques, selected according to the chemical characteristics of the chosen marker and the requirements of the specific application. Among others, immunoassay techniques, hybridization and DNA amplification techniques (eg PCR), and combinations thereof can be used.

In one embodiment, the DIVA diagnostic method is an immunoassay. An "immunoassay" refers to any analytical immunochemical technique that includes in some of its stages the formation of immune complexes, that is to say those resulting from the conjugation of antibodies and antigens, as quantification references of an analyte (substance present in the sample that is the object of analysis) determined. The analyte can be the antibody [eg, in our method the antibodies of the markers of the invention b) od)] or the antigen of the invention [eg, in our method the antigen O of the marker a)] . More preferably, the immunoassay is an immunoassay for the detection of a specific antibody against the O antigen from a bacterium of the invention.

Without limiting the scope of the invention, in one embodiment the immunoassay method is selected from an ELlSA (direct, indirect or competitive), an agglutination test (eg a plate agglutination, for example, with antigen Rose Bengal), a tube agglutination, a complement fixation and a fluorescence polarization test). The immunoassay with Rosa Bengal antigen is a method that detects binding antibodies by empying navalized Brucella cells, stained with Rose Bengal and suspended in an acid buffer that potentiates algutination against Brucella smooth LPS.

5 In a particular embodiment, the DIVA diagnostic method by immunoassay comprises the following stages:

a) detect the presence in the sample of specific antibodies against an O antigen of an LPS, O of an NH, O of a biosynthetic precursor thereof, or of a fragment of any of them, from a gram-negative bacterium

10 of the genus Brucella, other than a bacterium of the invention; Y

b) detect the presence in the sample of specific antibodies against an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of them, from a bacterium of the invention . For the purposes of the present description the term "fragment" means a part or

15 partial sequence with antigenic capacity, obtained from an O antigen of an LPS, O of an NH, or a biosynthetic precursor thereof.

The objective of step a) is to identify the presence in the antibody sample against the distinctive epitopes of the natural, unmodified O antigen, 20 of the LPS, of the NH, of biosynthetic precursors thereof, or of a fragment of any of the above, of the bacteria of the genus Brucella (homopolymeric chain of N-formylperosamines). For this purpose it can be used as a probe

or by binding any gram-negative bacterium of the genus Brucella whose antigen O keeps its immunogenic properties unchanged, eg a field Brucella.

25 This probe or ligand would act as an antigen in the formation of the immune complex with the antibody. Any product containing a molecule comprising the O antigen (immunogenically unchanged) of the LPS, NH, a biosynthetic precursor thereof, or a fragment of any of them (e.g. a bacterial extract).

In one embodiment, for detecting the antibodies in step b) a bacterium of the invention is used as a probe or ligand (preferably the one used

S

as a vaccine strain in the vaccination campaign), or a molecule of the invention comprising the O antigen from said bacterium of the invention. However, other probes or ligands that allow specific binding of these antibodies (eg a molecule, or a bacterium containing it), with the same hctcropolymeric structure of N-formylperosamine and Nacilperosamine residues [or N-] could also be used. glycosylperosamine according to the embodiment] than the antigen O of the bacterium of the invention, for example an antigen from other gram-negative bacteria, or molecules obtained by chemical synthesis).

10

The probes or liquors used in the stages interchangeably in suspension OR fixed to a substrate. to) Y b) they can to be

fifteen

In a more particular embodiment, the immunoassay further comprises, at an intent stage between stages a) and b), bringing the sample into contact with a specific ligand to absorb the antibodies detected in stage a). This specific ligand can be for example a Field Brucella, or an O antigen of an LPS, or of an NH, O of a biosynthetic precursor thereof, or of a fragment of any of these, from a Field Brucella .

twenty

1 immunoassay for double Rose Bengal.

25 30

In a simple embodiment, the immunoassay can be carried out using a double Rose Bengal. First, in stage a), the sample (eg a serum) is analyzed by the classic Bengal Rose, with bacteria of the same antigenic structure as the field strains. In case of positive reaction, the sample is absorbed with smooth field brucelas (intermediate stage) and then in stage c), a second modified Bengal Rose is made with a suspension of a bacterium of the invention [the same that was used as a vaccine strain l complementary to the DIVA system (for example BABacet, which has an O antigen with acetylated residues) l A positive reaction at this stage c) would indicate that the sample has antibodies against the new epitope formed, as the case, for N-acylperosamine (different from N-formyl perosamine; eg N-acet ilperosarnine) or

by N-glycosylpcrosamine; and that, therefore, comes from a vaccinated animal. On the contrary, a negative reaction in this second test, but positive in the first one, would indicate an infection.

5 Although this double Rose Bengal requires the intermediate step of antibody absorption, it is an economical and easily performed procedure, and therefore affordable in areas of low sanitary / veterinary infrastructure.

lnmunoassay by indirect ELlSA

In a typical embodiment, the immunoassay can be carried out by a double immunoassay. First, in step a), the sample (eg a serum) is analyzed by an indirect ELlSA, with antigens of the same antigenic structure as the field strains. In the case of a positive reaction, the sample is absorbed with smooth field brucelas (stage intent); and then stage e),

A second enzyme immunoassay is carried out with plates covered with the bacterium or molecule of the invention [the same one that was used as a complementary vaccine strain of the DIVA system (for example BABacet, which has an O antigen with acetylated residues)]. A positive reaction at this stage c) would indicate that the sample has antibodies against the new epitope formed, as the case may be, by the

20 N-acylperosamine (other than N-formi lperosamine; eg N-acetylperosamine) or by N-glycosylperosamine; and that, therefore, comes from a vaccinated animal. On the contrary, a negative reaction in this second trial, but positive in the first one, would indicate an infection.

25 1 EUSA competition immunoassay In a typical embodiment, the immunoassay can be carried out by a competition enzyme immunoassay. First, the sample (eg a serum) is incubated in EUSA type plates covered with the bacterium or molecule of the invention [the same one that was used as a complementary vaccine strain of the system

DIVA (for example BABacel, which has an O antigen with acetylated residues in the presence of an antibody, hence using the term "competition", against the new characteristic epitope (s) of the O antigen of the bacterium of the invention, previously labeled with an enzyme A decrease in reactivity (or

activity associated with the labeling enzyme) between the labeled antibody and the bacterium or molecule of the invention that covers the plaque indicates the presence (competition) in the serum of antibodies against the antigen of the invention and, consequently, is interpreted as serum from a vaccinated animal.

Diagnostic method by delayed hypersensitivity skin reaction test

In a further aspect, the invention relates to an in vivo method of DIVA diagnosis of brucellosis in an animal, which comprises intracutaneously inoculating the animal with a suitable dose, according to its species and weight, of an N-acyltransferase OR an N-glycosyltransferase. (purified by cloning, this being the same N-acyltransferase or N-glycosyltransferase of the heterologous gene with which the bacterium of the invention used as a vaccine strain was modified) and observing the development of a delayed hypersensitivity skin reaction (detectable by the formation of indurations or papules).

Molecular PCR detection

In one embodiment, the DIVA method of the invention comprises detecting in the sample a DNA or RNA molecule that encodes an N-acyltransferase capable of transferring, to the 4-amino position of the perosamines of the 0 antigen, an acyl group other than the formyl group ; or an N-glycosyltransferase capable of transferring to that same position a sugar selected from the group comprising hexoses and pentoses.

In a specific ralization in which the N-acyltransferase is the N-acetyltransfcrase encoded by the previously mentioned wbdR gene, the detection can be carried out by hybridization and amplification, using for example one of the following initiator pairs:

Couple A Direct Initiator, wbdR Fw (Jorward):

5 'ATGAATTTGTATGGTATTTTTGGT 3' (S EQJD, NO. 9), whose melting temperature (Tm) is 55.84 oC Reverse Initiator, wbdR Rv (reverse):

5 'TTAAATAGATGTTGGCGATCTT 3' (SEQ.ID.NO. 10), (Tm: 55.74 oC) PCR product size: 666 base pairs

Couple B Direct Initiator, wbdR Fw:

5 'TGATGTTTTGGCAGGAAAGA 3' (SEQ.ID.NO. 11), (Tm: 59.25 oC) reverse linker, wbdR Rv:

5 'TGGATTTCCGCACACAGTTA 3' (SEQ.ID.NO. 12), (Tm: 60.11 oC)

A further object of the invention is also a polynucleotide that comprises, or consists of, a sequence selected from SEQ.lD.NO. 1, SEQ.ID.NO. 2, SEQ.ID.NO. 3 SEQ.ID.NO. 4, SEQ.ID.NO. 5, SEQ.ID.NO. 6, SEQ.ID.NO. 9, SEQ.ID.NO. 10, SEQ.ID.NO. 11 and SEQ.ID.NO. 12; as well as the use of any of said polynucleotides for the molecular diagnosis of brucellosis, particularly for DIVA diagnosis. Similarly, the invention also encompasses the use of any of the aforementioned polynucleotides in the manufacture of compositions, reagents or diagnostic kits for brucellosis, particularly of the DIVA type.

In a further aspect, the invention relates to a diagnostic kit, to differentiate Brucella-infected animals from vaccinated animals against Brucella, which comprises at least one component selected from:

a) a probe or ligand for specific antibodies against the antigen ° of a lipopolysaccharide O of an NH, O of a biosynthetic precursor thereof, OR of a fragment of any of the foregoing, wherein said O antigen comes from a bacterium, molecule or product of the invention;

b) an antibody of the invention c) an N-acyltransferase capable of transferring, to the 4-amino position of the perosamines of the 0 antigen, an acyl group, other than the fonnyl group; where he

acyl group is preferably selected from the group comprising an acetyl group, 1In 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, a R (-) 2-hydroxypropionyl group; and more preferably the acyl group is an acetyl group, where, therefore, the enzyme N-acyltransfcrase an N

5 acctyltransfcrase;

d) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hxxose and pentoses, to the 4-amino position of the pcrosamines of the O antigen; Y

e) a polynucleotide to amplify a gene encoding an N-acyltransferase

10 according to e) or an N-glycosyltransferase according to d), preferably to amplify the wbdR gene of E. coli O 157: H7; more preferably the polynucleotide sequence is selected from: SEQ.ID.NO. 9, SEQ.ID.NO. 10, SEQ.ID.NO. II and SEQ.ID.NO. 12.

These O antigens, antibodies, N-acyltransferases, and N-glycosyltransferases have already been described in the previous sections; its features and embodiments are applicable to the components of this kit.

In one embodiment the kit comprises a probe or ligand for the specific antibodies as described in section a) selected from the group consisting of: a) a bacterium of the invention; and b) a product of the invention.

However, it could alternatively include other probes or ligands, for example a genetically modified Yersinia, or a molecule or product that

25 comprises the O antigen of a genetically modified Ye /: 'inia, with a heterologous gene that encodes an N-acyltransferase or an N-glycosyltransferase as defined above.

In another embodiment. The kit further comprises at least one reagent 30 selected from: a) a molecule comprising an O antigen of an LPS, O of an NH, O of a biosynthetic precursor thereof, or of a fragment of any of the

5

above, from a gram-negative bacterium of the genus Brucella, other than a bacterium of the invention; OR b) a gram-negative bacterium of the genus Brucella, other than a bacterium of the invention. In both cases, the O antigen is the cam-specific antigen of the field brucclas, formed by a homopolymer of N-formylperosamines.

EXAMPLES

the

In the following, some concrete examples of embodiments of the invention are described, as well as experimental tests, which do not in any case limit the invention.

fifteen

In all cases of using kits described below in the examples, the following procedures were carried out following the instructions of the manufacturers of the respective kits.

twenty

Example 1. Construction of Brucella strains bearing the gene (whdR) of an acetyl transferase. Bacterial strains and plasmids. The relevant characteristics of the bacterial strains and plasmids used are presented in Table 1.

Table 1 Strains and Plasmids

CepaJPlásmido Relevant characteristics Reference / Origin

Brucella abortus

BAS-parental

NalR spontaneous mutantc from

B.abortus 2308, which retains

the antigenic characteristics of

the original field strain

BAS-aect

BAB-parental expressing the

wbdR (acetyltransferase) gene from

E. coli O I57: H7; present a

O chain formed by waste

of N-formylperosamine and N

acetylperosamine

BABó, wadB

Mutantc in the core of the LPS;

S-LPS; attenuated in cells

dendritic and mice

BABó.wadB-acct

Mutant in the core of the LPS;

S-LPS; expresses the wbdR gene

(acetyltransferase) from E. coli

0157: H7

S I9

Vacuum strain used in

cattle

S I9-pYRI-6

Strain S 19; expresses the wbdR gene

(E. coli acctyltransfcrase)

0157: H7

Revl

Vaccine reference strain for

B. melitensis

Rcvl-pYRI-6

Revl strain; cxpresa the wbdR gene

(acctyltransfcrase) dc E. coli

0157: H7

(Sangari and Aguero, Microb. Pathog. 1991; 11: 443-446

Invention

Invention

Invention

(Nicoletti, P.L. 1990. Vaccination, p. 283-299. In K.H. Nielsen and J.R. Duncan (ed.), Animal BruceIlosis, eRC Press, Boca Raton) Invention

(Eberg and Faunce, J.Bacteriol. 1957;

73: 211-217). Invention

Table 1 Strains and Plasmids (Continued)

Strain / Plasmid Relevant characteristics Reference / Origin

E. ('oli

E, co1i01 57: H7

Sl7-IApir

ToplOF '

One shot

OMN1MAX TM

Enterohemorrhagic E. coli

Conjugate strain with the

RP4 plasmid inserted into the

chromosome

F '{lac1q, TnIO (TetR)} merAlI (mrr-hsdRMS-merBC) ~) 801aeZIIM15 IIIaeX74 reeA1 araD l3911 (ara leu) 7697 galU galK rpsL (StrR) endA 1 nupG F' {proABlaclqlacZIIM TTIR 15Tn) 6. (eedAB) mer A 6. (mrr hsdRMS-merBC) <1> 80 (lacZ) 6.M 15 lI (laeZYA argF) UI 6gendA 1 rceA 1 supE44t

hi 1 gyrA96relA 1 tonApa no Spanish Type Crops Collection

(CECT 4783)

(Simon et al., N atufe Biotechnology

1983; 1: 784-791)

Invitrogen; Elbow C303003 Invitrogcn; Elbow 12535029

Table I Strains and Plasmids (Continued)

CepaJPlásmido Relevant characteristics Reference / Origin

PDONR22 1 plasmids

pRHOOI

pYRI-5

pYRl-6

Cloning vector; contains

Invitrogcn; Elbow 12535029

the 3ttP regions that enable

BP reaction (system

Gatcway)

Derived from pMR 1 O KmR; CmR;

(Hallez et aL, Appl. Envil'On.

contains the attR regions that

Microbe/. 2007; 73: 1375

enable the LR reaction

1379)

(Gateway system)

Fragment of 727-bp

Invention

PCR amplified to

from the DNA of E. coJi

01 57: H7 containing the ORF

complete wbdR along with the

attB sites, cloned in the vector

pDONR221

Fmgmcnto attLl-attL2

Invention

plasmid pYRI-5 cloned in the

attR l-attR2 sites of pRHOO 1

pYR1-1 Plasmid containing the invention deletion of the wadB allele

pYRI-2 PI plasmid obtained by Subelonation invention of p YRI-I in the suicide plasmid pJQK

The bacteria were grown in tripticase-soy broth (TSB, BioMérieux) or in TSB plates with 1.5% bacteriological agar (TSA, Pronadisa). If necessary, for example when injecting bacteria carrying plasmid pYRI-6, the culture media were supplemented with 50, ug / mL kanamycin (Km) OR 20 ~ g / mL chloramphenicol (Cm) or 25 J..lg / rnL nalidixic acid (Nal) or 1.5 ~ g / rnL polimix ina

(Pmx). The strains were preserved in vials with skim milk at -80 ° C (Scharlau).

DNA analysis Plasmid or chromosomal DNA was extracted using the Qiaprcp spin Miniprcp kits (Qiagen GmbH, Hilden, Germany) and Ultraclean Microbial DNA lsolation Kit (Mo Bio Laboratories) respectively. If necessary, for example, when after visualizing an agarose gel PCR reaction, and once it has been verified that the product obtained is the expected size and that no specific nonspecific PCR products have been generated in said reaction, it is necessary to recover from The agarose gel was the PCR product obtained (example: cloning of the PCR product in a plasmid), the ONA fragments were extracted from agarose gel using the Qiack Gel extraction kit (Qiagen). DNA sequencing was performed using the BigDye 3.1 kit and an Applied Biosystems sequencer model 3130XL Genetic Analyzer. All primers were synthesized by Sigma-Genosys Ud. (Haverhill, United Kingdom).

Construction of the BAB ~ wadB.

The mutant in ORF BAB 1_0351 (wadB) was constructed by phase deletion, eliminating the region encoding the catalytic domain, using the genomic DNA of B. abortus 2308 as a template (Figure 4). The deletion was made maintaining the reading frame so that it did not have polar effects that altered the reading frame of adjacent genes. The primers used were designed from the sequence of B. abortus 2308 available in the NCBI database (bttp: li \ vw \ v. Brbi.nlrn.nih, gov! As of 15.02.20 11).

The mutant strain obtained was called BABt.hvadB. For its construction, two primers called wadB-FI (SEQ ID NO: 3) and wadB-R2 (SEQ ID NO: 4) were first synthesized and used to amplify a 296 bp fragment that included the codons included among the 48 base pairs of the wadB gene, as well as the 152 bp located in front of the start codon of the wadB gene. In addition, two other primers called wadB-F3 (SEQ] D NO: 5) and wadB-R4 (SEQ ID NO: 6) were synthesized which were used to amplify a 274 bp fragment that included the codons between base pairs 196 to 239 of the coding region (COS) of the wadB gene, and 139 bp after the stop codon of the waclB gene.

Both fragments obtained were ligated by superposition PCR using the wadB-FI (SEQ ID NO: 3) and wadB-R4 (SEQ ID NO: 6) primers for amplification and the complementary regions of the Yl ccbators: vdBR2 (SEQ ID NO: 4) and wadB-F3 (SEQ ID NO: 5) for overlay. The resulting fragment, which contains the wadB gene deletion allele, was cloned into the vector

10 pe R2.l (Invitrogen, Barcelona, Spain), giving rise to the plasmid pYRJ-l, which was subjected to a sccucnciación process to guarantee the maintenance of the reading frame and, subsequently it was subcloned in the positions BamHJ and XbaJ of the plasmid pJQK suicide (Scupham and Triplett, Gene 1997; 202: 53-59). The resulting mutant plasmid (p YRJ-2) was introduced by transformation into E. coh S 17.1 A-pir

15 (Simon et al .; Nature Biotechonology 1983; 1: 784-791) and then transferred to the bacterial strain B. abortus 2308 by conjugation.

The exconjugants where the first recombination had occurred (integration of the suicide vector in the chromosome) were selected in plaques of

20 tripticase-soy agar (TSA) with nalidixic acid (25.uglmL) and kanamycin (50.uglmL). To favor the second recombination (excision of the suicide vector after allelic exchange), the bacteria were grown in the absence of kanamycin and were selected on TSA plates with 5% nalidixic acid and sucrose.

The resulting colonies were selected by PCR using the wadB-FI (SEQ ID NO: 3) and wadB-R4 (SEQ ID NO: 6) primers, which amplify a 570 bp fragment in the mutant and a 10 fragment II bp in the parental strain. The generated mutation resulted in a 60% loss of the coding region of the wadB gene and an 88% loss of the glycosyltransferase domain. The mutant strain,

30 as mentioned above, it was called BABf1wadB.

The E. coli strain (O I57: H7) that contains the wbdR gene that codes for the

Acetyltransferase used in the present invention to modify the Brllcella strains is deposited in the Spanish Type Culture Collection, in the Paterna Science Park (Valencia, Spain), with No. CECT4783 (year 1996).

Construction of plasmid pYRJ-6. The construction of pYRJ-6 was carried out by using the "Gatcway® Rccombination Cloning Tcchnology" system from Invi! Rogen. The wbdR attB Fw (SEQ ID NO: 1) and wbdR attB Rv (SEQ ID NO: 2) primers specific to wbdR (ORF z3 192; SEQ ID NO: 7), which encodes the O-chain acctyltransfrase in E. coli 0157 : H7 (SEQ ID NO: 8), were designed according to the manufacturer's instructions and synthesized by Sigma-Gcnosys Ltd. (Haverhill, United Kingdom). These primers were used to amplify the wbdR gene from E. coli DNA OI57: H7. Next, the PCR product was cloned into the vector pDONR221 by site-specific recombination to give rise to plasmid pYRJ-5, and subsequently subcloned into pRHOOI (Hallez el al., App! Enviran Microbio! 2007; 73: 1375- 1379), to obtain plasmid pYRI-6, capable of replicating in Brucella.

Plasmid pYRJ-6 was introduced in E. coll S17-1 Apir and transferred to B. abortus 2308, by conjugation, thus obtaining the modified bacteria BAB-acel. The plasmid-bearing conjugates were selected in the tripticase-soy culture medium with bacteriological agar (TSA) and supplemented with nalidixic acid (Na l) and chloramphenicol (Cm), as described in example 1 (TSA-Nal-Cm ), at 37 ° C. These markers and the results of Example 2 demonstrate the presence of the plasmid and its genes in the construct.

Similarly, a transfer of plasmid pYRI-6 to the vaccine strains Rev1 and S 19 and the mutant BABtlwadB was performed, obtaining the modified strains Revl-pYRI-6, S 19-pYRI-6 YBAB! J \ vadB-acet respectively.

Example 2. B. ahlJrluS 2308 gene carrier (JI! HdR) of an acetyltransferase expresses normal amounts of a smooth O-chain LPS containing N-acetylperosamine.

LPS extraction. The BAS-parental LPS was extracted using the phenol method: water described by Leong et al. (Leong D. el al., Infect Imlltun 1970; I: 174-182) and adapted to Bmcella by Aragón et al., ./ Bacteria /., 1996;

178: I 070-1 079; Watch the a /., HÃ © leet / l II 11 a 2000; 68: 32 10-3218). To obtain the BAB-acet LPS, the aforementioned protocol was modified using 6 volumes of methane I and 1% methane I saturated with sodium acetate. For the extraction of the LPS of E. coli O15 7: H7, the method of SDS-proteinase K (Garin-Bastuji B. et al., Elin Microbio / 1990; 28: 2 169-2174) was modified. Nactivated bacteria (0.5 g wet weight) were resuspended by ultrasound in a 2% SDS -62.5 mM Tris-He l buffer (pH 6.8; 10 mL) and the mixture was incubated at 100 ° C for 10 min with intermittent agitation. Once the mixture was brought to room temperature, proteinase K (150, ug / mL; Merck) was added and incubated

for 3h at 55 ° C, and overnight at room temperature. The cell debris was removed by centrifugation (20,000 x g, 15 min, 4 ° C), and the supernatant was precipitated with 3 volumes of methanol and 1% methanol saturated with sodium acetate for Ih at _20 ° C. The precipitate was resuspended in 10 mL of distilled water and precipitated again under the same conditions. The new precipitate was resuspended in 2-3 mL of 62.5 mM Tris-Hcl buffer (PH 6.8) by ultrasound, treated with DNase (Sigma-Aldrich) and RNAase (Mobio), both at a final concentration of 10 , uglmL, at 3rC for 30 min and then with proteinase K at 55 ° C for 3h and one night at room temperature. Finally, the sample was precipitated using the conditions described above, settled (5,000 x g, 15 min, 4 ° C) and the solvent residues were evaporated with a stream of nitrogen.

NMR_H1 analysis • The spectra were performed at 25 and 70 ° C in a 0-20 solution using a Varian Innova 600 device and a photometer spectrum equipped with a 5 mm PFG-triple resonance probe. The chemical shift was recorded as ppm (data in parts per million) using 3trirnctylsilyl- (2,2,3,3- 'H4) -propanoate sodium (TSP, OH 0.00) as an external control. Fucron data

processed by empicating the computer program supplied by the house comcrci.al. Previously, to obtain the BAB-acet O-chain from a purified LPS preparation, acid hydrolysis was performed in 10 mM acetate buffer at pH 4.5 in the presence of 1% SOS (Caroff el al., Carbohydr Res. 1988; 5 175: 273-282) for 2h at 100 ° C. The mixture was frightened and neutralized with a solution of NaOH O, 2M, followed by a centrifugation 5000 x g, 10 min, the recovered sobrcnadantc was precipitated with 5 volumes of ethanol at -200C for 24

h. The mixture was then centrifuged at 5000 x g, 10 min, the precipitate was recovered and dialyzed for 3 cycles in acid methanol: distilled water (50:50 v / v)

10 followed by 3 cycles in distilled water to remove the remains of SOS. Finally. The sample (O chain) was recovered by centrifugation under the conditions mentioned above, resuspended in ultrapure water. It was lyophilized and its purity was evaluated by double gel diffusion.

15 Coagllination. It was performed following the technique described by (Díaz et al., Laboratory (Granada) 1980; 70: 509-525). Bacteria resuspended in saline serum were mixed with 10 IJ.L of a suspension of staphylococci sensitized with serum from rabbits infected with smooth brucelas.

20 To verify whether the heterologous expression of wbdR in Brucella was an alteration of the LPS synthesis process, it was extracted from BAB-acet and compared by means of SOS-PAGE and silver staining with that of BA B-parental. The yields obtained in each of the stages of the extraction and purification of the LPS of both BAB-acet and the parental strain were very similar, suggesting that there is no

25 quantitative differences in the LPS synthesized by both. On the other hand, we did not observe differences in the coagglutination tests of BAB-parental and BABacet with serum-sensitized staphylococci from animals infected with smooth brucelas. This shows that the expression of wbdR in Brllcella is compatible with the synthesis of a complete, smooth-type LPS, which is located on the bacterial surface.

Then, the LPS of BAB-acet and the parental strain were subjected to acid hydrolysis and the resulting polysaccharide was purified by chromatography and analyzed

using lH_NMR. While the polysaccharide spectrum of the parental strain showed the signals described for the homopolymers of N-formylperosamine in bonds (1 (1,2) (Pcrry and Bundle, Advances in brucelosis research. Texas A & M. Univcrisity Prcss, Collcgc station 1990; 76-88), smaller core signals

or ligosaccharide (González el al., PlosOne 2008; 3: e2760) (Figure 1), the BAB-acet polysaccharide showed all of these and an additional strong signal at 2 ppm corresponding to a new acetyl group (Figure 1). The integration of the formyl signal at 8.2 ppm indicated that the perosamine of the parental strain is approximately 90% N-formylated. In contrast, the signals of acetyl at 2.0 ppm and of the formyl at 8.2 ppm of the spectrum of the BAB-acet polysaccharide showed a formulation of approximately 40%, with the N-acetyl group constituting the remaining approximately 60%.

These results demonstrate that the expression of wbdR in Brucella is compatible with the synthesis of a complete LPS, which is located on the bacterial surface without apparent quantitative changes and has a heteropolymeric O-chain of N-formyl and N-acetylperosamine.

Example 3. The presence of wbdR-dependent N-acetylperosamine in the O chain eliminates the typical A-epitope of LPS-S of 8. abortll ~ ;.

Anücue, monoclonal post. Monoclonal monoclonal antibodies against the epitopes A, M and C used have been described in previous studies (Monreal el al., InJec. 1I / II / IIIn 2003; 71: 3261-3271 González el al., PlosOne 2008 3: e2760) .

EL / SA. It was performed in flat-bottom 96-well polystyrene plates (Thermo Scientific). The antigen used (LPS of BAB-parental, BAB-acel or E. coli O 157: H7) was adsorbed to the plate at a concentration of 2.5 J.lglml or 5, uglml in PBS.

Incubation was performed at 4 ° C overnight. After several washes with PBS-Tween 20 (PBS-T), successive dilutions of the antibodies were added and incubated 5 hours at 37 ° C. The plates were then washed three times with PBST and, for the detection of the antigen-antibody complexes, a mouse anti-Ig conjugate (Nordic Immunological Laboratories, Tilburg, Holland) labeled with pcroxidase was used. The development was performed with 0.2 mM ABTS and 0.13 mM / H20 2 in citrate buffer solution for 15 to 30 min at room temperature, in the dark and with stirring. The absorbance was measured at 405 nm.

To determine if the presence of the acetyl group alters the episodes A and characteristic of B. abortus, we analyze with ELlSA the reactivity of specific monoclonal anti-A [5 N-formylperosamines linked to (1-2)], anti-C [ (3 or 4 N-formylpcrosamines bonded together (a 1-2)] and anti-M [(a 1-2) -Nformylpcrosamine- (a 1-3) -N-formylpcrosamine- (a] -2)]. As can be seen in Figure 2, the presence of the acetyl group reduces the reaction of the anti-A monodonal, but not that of the anti-C monoclonal (the reactivity with the anti-M monoclonal introduced as a negative control was negative). demonstrated that the epitope A requires five or more consecutive N-formylperosamines bound together (at 1-2), microns quc the cytope e is associated with four or more consecutive N-formylpcrosamines bound together (at 1-2) (which they could include to a greater or lesser extent a link (to 1-3), depending on the degree of overlap.) Therefore, the acetylation generated eliminates the cont Inuity of five N-fonnilperosamines in bond (to 1-2), but respects four or less. Therefore, these results not only demonstrate the disappearance of the epitope A typical of B. abortus, but also indicate that N-acetylperosamine has not been concentrated in a section of chain 0, but has been distributed so homogeneous, since otherwise the epitope A would remain.

Example 4. The presence of wbdR-dependent N-acetylperosamine in the O chain of the LPS of B. ah (} rlw; generates new epitopes.

Preparation of rabbit immunoserums and absorptions. The animals were housed in suitable cages, with water and food ad Iibitum. Two 2.5 kg New-Zealand White female rabbits were used. Immunization was performed by intravenously injecting 1 ml of a suspension of phenol-inactivated BAB-acet bacteria, lyophilized and resuspeted in saline at a concentration of I mglrnL. At 2 and 4 days, two doses similar to the previous ones were administered intraperitoneally. Three weeks after the last immunization, the serum was extracted and the animals were slaughtered. The maintenance and slaughter of the animals was carried out following the Spanish (RD 1201/2005) and European regulations (directive 86/609 / EEC) in force under the supervision of the Ethical Committee of the Animal Maintenance Service of the Institution. To absorb the antibodies against B. abortus 2308 (BAB-parentaf), the rabbit immunoserum was contacted with a suspension of these phenol-inactivated bacteria at the rate of 1 rng bacteria / lOO, ul of serum. The mixture was incubated at room temperature for 4 h with timely stirring, centrifuged at 13200 rpm for 10 min (Eppendorf 5415R centrifuge) and the supernatant recovered. He

The same procedure was repeated with this envelope once again, and the resulting final supernatant was considered free of antibodies against B. abortus 2308. For the absorption of antibodies against BAB-acet the same procedure was followed, but using bacteria of BAB-accel ¡nactivated with phenol.

Coagglutination It was performed following the technique described by (Díaz el al., Laboratorio (Granada) 1980; 70: 509-525). Bacteria resuspended in saline serum were mixed with 10 IJ.L of a suspension of staphylococci sensitized with rabbit sleep immunized with BAB-acet and absorbed with whole BABparental cells.

EL / SA. It was performed in flat-bottom 96-well polystyrene plates (Thermo Scientific). The antigen used (LPS of BAB-parental, BAB-acet or E. coli O 157: H7) was adsorbed to the plate at a concentration of 2.5 J.lg / ml or 5, ug / ml in PBS. Incubation was performed at 4 ° C overnight. After several washes with PBS-Tween 20 (PBS-T), successive dilutions of the sera were added and incubated 5 hours at 37 ° C. The plates were then washed three times with PBST and, for the detection of antigen-antibody complexes, a goat anti-rabbit conjugate (Nordic Immunological Laboratories, Tilburg, Holland) labeled with peroxidase was used. The development was performed with 0.2 mM ABTS and 0.13 mM / H20 2 in citrate buffer solution for 15 to 30 min at room temperature, in the dark and with stirring. The absorbance was measured at 405 nm.

To analyze whether the incorporation of acetyl groups to the Brucella O chain generated a new or new epitopes, rabbits were immunized with whole BAB-acet cells activated with phenol. As can be seen in Figure 3, panels A and B, the serum showed lower ractivity in an ELlSA with the BAS-parent LPS

5 that with the homologous LPS carrier of N-formylated and N-acctylated pcrosamine, which suggests the existence of a new epitope or epitopes (s) related to the second type of substituents. To prove it, the serum was absorbed with parental BAS and we repeated the test. This absorption eliminated reactivity with the BABparental LPS, but not with the BAB-accel LPS.

To ratify the existence of specific antibodies of the structure containing N-acetylperosamine, a new ELJSA was performed comparing the reactivity of a rabbit serum immunized with E. coli OI 57: H7, and of the sera of rabbits immunized with BAB-acel absorbed and not absorbed, against the E. coli LPS

15 O 157: H7, whose O chain has acetylated perosamine.

The results (Figure 3, panel C) showed that serum against BAB-acet absorbed with BAB-parental reacts with the LPS of E. coli 01 57: H7 and that this reactivity disappears after absorbing with BAB-accel cells, which confirms that

20 BAB-acel has an immunogenic epitope associated with N-acetylperosamine. Furthermore, this result demonstrates that it is possible to develop a serological test to identify vaccinated animals by detecting antibodies against the N-acetylperosamine-associated epitopes present in the labeled vaccines (see Example 5).

Example S. Epitopes generated by N-acetylperosamine do not stimulate antibodies that react in diagnostic tests of brucellosis. Co-agglutination and EU SA were carried out as in example 4 above. 30

According to the presentation of the LPS-S, there are two types of diagnostic tests for brucellosis: those that use purified LPS-S and those that initiate suspensions of bruclas in the smooth phase. The first prototype is ELl SA with LPS-S of B. abo / 'tus; that of the second the Bengal Rose test. The reaction involves antibodies of the IgG, IgM and IgA classes.

5 The results of Example 4 with an EU SA with LPS-S of BAS-parental (Figure 3, panel A) and the specific immunoserum (absorbed in serum) of the epitopes associated with N-acctylperosamine demonstrate that these epitopes do not generate detectable antibodies in the tests of the first type. To verify that they do not do it in the second type, we test the Rose Bengal

10 by mixing 30 ~ LL of the immunoabsorbed or non-absorbed serum with 15 ~ L of the commercial antigen (Vctcrinary Laboratories Agency, New Haw Addlestone, UK) and this mixture was incubated with orbital shaking for 8 minutes. After this time, the test was read. The result with the serum containing only the antibodies against the epitope (s) generated by the N-acetylperosamine was

15 negative. Therefore, these results, together with those of Example 3, demonstrate that N-acetylperosamine generates a specific immunological marker absent from normal Brucella strains.

Example 6. Labeling with N-acetylperosamine of the O chain of the classic vaccines of B. melitensis and B. abortus, as well as other strains. Coagglutination and ELlSA were carried out as in example 4 above.

Whereas B. melitensis Revl and B. abortus S 19 are the best vaccines

25 to immunize sheep and goats against brucellosis, the O chain of these strains was modified. For this, the plasmid pYRJ-6 carrying wbdR was introduced by conjugation in the Revl yen strain S 19 Y. The resulting Rev I-acet construct was examined by co-agglutination with the BAB-QCel-absorbed immunoserum with B. abortus 2308. While that Rev loS 19 did not co-agglutinate, Rev I-acet and S 19-acet did it,

30 which demonstrates the presence on its surface of the epitope derived from Nacetylperosamine. The same results were obtained when we introduced plasmid pYRJ-6 into the BAB / J.wadB mutant (which retains the O chain, and is a potential candidate as a vaccine against B. abortus 2308 infection). In her

Introduction of the plasmid generated epitope derived from the N-acetylperosamine necessary to co-agglutinate with the immunoserum against BAB-acet absorbed with B. abortus 2308. These results demonstrate that the acylation of pcbdamine mediated by wbdR serves to mark antigenicinentnt vaccines against Brucella .

TrlbJll 2: BaNenas. C'uya caden.a O está '.: Cllstituidll total or p.arcildmeute for reslauo, ;; of pe-msamine whose sub:; tihlción N-.ard e: s other than the imormyl group).

Cru-i \ cterí ... tic.,.,. of 105 r-e: "iaoo d ~ but ~ ami.B. '

Ealat: ~ <¡

COllft'J Ar..Jcafe <,. Bacteria IMción G1llp <! N-itci.l [proportion] arucloBale-i / ReiffeIlcia

VibriQcho! T> rt'lt? 0 76 L S (+) 2-111droriprcpionil a (1,2) (Kondo ~ al., ~ 1l <: robIOL 1996; 14.:!: 2S79-288 »)

JI: dwleme 01 D 3- <koxí-L-fl.i ~ o- "(1.2) (lsshiki ei aL El..U". J. Bioche-m. 19%; 219: 583-588) Og.HWI tell '() lul tT1

(/)

v; cftoleme 1875 D 3-lridrffi ': i.proplúlllf a (1, 2) (Kondc eral., Biocbem. 1. 1993; 291531 535) N w

E chQlcme Hakaf3. D itl: 'e-ri¡ a (1,2) (I ;;. ;; hfr..i e-t al .. Microbiol ImmulIoL 1992; 36: 1201-00 ~ 1105)

'"OR

V. chol.:11'ae 0144 LR (-) 2-rudroxipmpionil 1 "1. (1,2) (S & 10 et al_. ~ 1] crvbio1.I! 1nm!.!. LOl. 1996: 40: 735- 741)

Escherichio coli 0157 D acetit a (1, 2) ~ +++ (Perry & Bundle, Ad \ '/ \ fK <:' Without Brucellos1s Research.> '"~ {L (1.3 / Coilege SV.Uiúll. Texai.A & M Uni ',' ~ r.si! And Pr ~ s1990_: p: í6-S8)

E.} ;, "1naJ? NiiJ D ocetil a (1.2). A (1) (Perry & Bundle-. Adv: Ulces in Brocd1o" is R ~~ arch.

{3: 2 ('! 2: 3] CoHeog <:' St: tticn. Texa ..... A&M Unl ...- ersi'ty Pre -;:; 1990; p: 76-SS}

Sa! MoneJta Gmup ND acetyl to (1.2), +++ (peny & Bundle. Ad: v · a. \ LCel> in B11Icello'iilJ> Rt- ~ em :( 'h. A, / 1,: o' ) 'CoHege Station. Teu <; A&M Umveriiíty P ,,,, 1990; p 76-gg)

T ~ bla 2 (('O llt1UUiH'ióJI): Bn.; - terins whose. :: ndetl-l O is \. ~ On - ;: f.¡lllda total j) partialmellt €' by r ~:; idulHde pe1'OSíllUma ('uyn substil11ción N "nor is it distinct nI gmpc fOf1l.do).

Stcnof) · aphQ!) Jor: a ~ D acct.U a)} to O)) + (P-eIT) · & Bwul1e, AJ. .... un¡: ~~ in Brucdlosi¡; Research mai: aphilrr (l 1] College Station. To :: xas.A & M Vni ", '~ rr.iry Prt'.ss 1990; p: 76-88)

O tl "Obactor gilie¡lfi D aC ~ ¡l (.l. (1, 2). (Lipimki ~, al., Eur. J. Biochem. 2002: 269: 93-99)

09 <\.%

O /) 'Obactcr youngtll.l DI \ C ~ ¡l (1 (l.2), a. (O .... chillll.ikova et al. Carbohydr. Re.l. 2004; 339: 88109 (l , J), ~ (1.3 \ S84)

Cr, ulobacte! "De ~ on¡) Cid! L acetyl. Unknown Possible (Av." T! Lm & Sl "rut, MiC! Obiolog \" ~ OOl, 147: 1.t51 1460)

tT1

a · C'samm / (/)

I +. pr ~ O :: llC.i ,,: _, {i.1l,;. o ~ in ..; 1 · Not in elllll Cef>> O "osamma It pt'.rosruwna;, Unic <lmellle el} any:,;. Stlctl POS (strain!;. NRCC perc 110 ell ce¡ms ATCe: (Peny N w

. & Buaak. t990b: Sauo el al., 1996)]. 4 No ('u enbc <: ": & p ('! · O ~ alJlu" lil <1 p <'rosamina.. \ S610 exi.s; t ~ e .... icl.encia. Gel! Kica, no ~ and e.studio. '> e ~ tructUíah

~

'"O'" ~

>

Claims (33)

l. A gram-negative bacterium of the genus Brucella comprising an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the above, characterized in that at least one of the residues N -formylperosamine of said O antigen has been modified by substituting the 4-amino phonyl group of perosamine for: a) an acyl group, other than the fomyl group, or by b) a sugar, selected from the group comprising hexoses and pentoses.

2.

A gram-negative bacterium according to claim 1, wherein the acyl group is selected from the group comprising: an acetyl group, a 3-deoxy-Lglycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group and a R (-) 2-hydroxypropionyl group; preferably the acyl group is an acetyl group.

3.

A gram-negative bacterium according to claim 2, wherein at least 20%, preferably at least 40% and more preferably at least 60% of the N-formylperosamine residues of the O antigen have been replaced by distinct N-acylperosamine residues of N-formylperosamine; preferably they have been replaced by N-acetylperosamines.

Four.

A gram-negative bacterium according to claims 1-3, further comprising a heterologous gene encoding: a) an N-acyltransferase capable of transferring an acyl group, other than the formyl group, to the 4-amino position of the perosamines of the O antigen; or

b) an N-glycosyltransferase capable of transferring a sugar, selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen.

5.

A gram-negative bacterium according to claim 4, wherein the Naciltransferase is capable of transferring a g-acyl group selected from the group consisting of: an acetyl group, a 3-deoxy-L-glycerotetronyl group, a group 3

hydroxypropionyl, an S (+) 2-hydroxypropionyl group, and an R (-) 2-hydroxypropionyl group; preferably N-acyltransferase is an N-acetyltransferase.

6.

A gram-negative bacterium according to claim 5, wherein the Nacethyltransferase is an N-acetyltransferase of Escherichia cofi O 157: H7, Escherichia hermanii, Vibrio cho / erae Hakata, Salmol1ella group N, SlenolrophomonGs mallophila. Ci / roboc / er gil / enii, Ci / robac / er yOllJ1gae, or Caulobacter crescentus.

7.

A gram-negative bacterium according to claims I to 6, wherein said bacterium is a Brucella meli / ensis Rev-l, Brucella abortlls S 19, or the Rum of Bmcella BABLlwadB.

8.

A product comprising, a molecule that, in turn, comprises the LPS O antigen, or an NH, or a biosynthetic precursor thereof, or a fragment of any of the foregoing, characterized in that:

a) comes from a gram-negative bacterium with an O antigen comprising a homopolymer of N-formylperosamine; and where at least one of the Nformylperosamine residues of the O antigen, the 4-amino formyl group of perosamine has been replaced by: i) an acyl group, other than the formyl group; wherein the acyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, a R (-) 2-hydroxypropionyl group ; more preferably the acyl group is an acetyl group; or by ii) a sugar, selected from the group comprising hexoses and pentoses; or b) comes from a gram-negative bacterium with an O antigen comprising a heteropolymer consisting of residues selected from: i) N-formylperosamine and N-acylperosamine where this N-acylperosamine is different from N-formylperosamine, or ii) N- formylperosamine and Ng lycosylperosamine; preferably the heteropolymer is formed by residues selected from: N-forrnylperosamine and N-acetylperosamine, N-fonnylperosamine and 3-deoxy-L-gl icerotetronylperosamine, N-formylperosamine and 3-hydroxypropionylperosamine, 5 N-formylperosamine and S (+) 2-hydroxypropionylperosamine, or also N-formylperosamine and R (-) 2-hydrox ipropionylperosamine; more preferably the heteropolymer is made up of Nformylperosamine and N-acetylperosamine residues. 9. A product consisting of a molecule comprising the LPS O antigen, or an NH, or a biosynthetic precursor thereof, or a fragment of any of the foregoing, characterized in that: a) comes from a gram-negative bacterium with an antigen ° comprising a homopolymer of N-fonnylperosamine; and where in at least one of the N-formylperosamine residues of the 0 antigen, the 4-amino formyl group of the Perosamine has been replaced by: i) an acyl group, other than the forrnyl group; wherein the acyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, a group S (+) 2-hydroxypropionyl, a R (-) 2-hydroxypropionyl group; more preferably the acyl group is an acetyl group; or by ii) a sugar, selected from the group comprising hexoses and pentoses; or b) comes from a gram-negative bacterium with an O antigen comprising a heteropolymer consisting of residues selected from: i) N-formylperosamine and N-acylperosamine, where this Nacilperosamine is different from N-fonnilperosamine, or ii) N- formylperosamine and N-glycosylperosamine; preferably the heteropolymer is formed by residues selected from: N-fonnylperosamine and N-acetylperosamine, N-formylperosamine and 3-deoxy-L-gI icerotetronylperosamine, N-formylperosamine and 3-hydroxypropionylperosamine, N-formylperosamine and S (+) 2-hydroxypropionylperosamine, or also N-formylperosamine and R (-) 2-hydroxypropionylperosamine; more preferably the heteropolymer is made up of Nformylperosamine and N-acetylperosamine residues. 10. A product according to any of claims 8 or 9, wherein the molecule comprising the O antigen comes from a gram-negative bacterium of the Brucella genus according to claims 1 to 7. A product according to claims 8 to 10, wherein the molecule comprising the O antigen comes from a genetically modified bacterium, to which a heterologous gene encoding: a) an N-acyltransferase capable of transferring an acyl group, other than the formyl group, to the 4-amino position of the perosamines of the O antigen; preferably 15 an acyl group selected from the group comprising: an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, and an R (-) 2-hydroxypropionyl group ; more preferably N-acyltransferase is an N-acetyltransferase; or b) an N-glycosyltransferase capable of transferring a sugar, selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen. 12. A product according to claims 8 to 11, wherein at least 20%, preferably at least 40% and more preferably, at least 60% of the 25 residues of the O antigen, are an N-acylperosamine other than N-formylperosamine; preferably N-aciLperosamine is an N-acetiLperosamine. 13. A method for obtaining a product according to claims 8 to 12 comprising: 30 a) cultivate, under appropriate conditions, a genetically modified gram-negative bacterium by introducing a heterologous gene that encodes i) an N-acyltransferase capable of transferring an aeyl group, other than the formyl group, to the 4-amino position of the O antigen perosamines; OR ii) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the 5 perosamines of the O antigen; wherein the gram-negative bacterium is preferably a Brucella according to claims 1 to 7; and b) isolate and / or purify said product. 10 14. A method for obtaining antibodies, comprising: a) immunizing an animal with: i) a gram-negative bacterium according to claims I to 7, or ii) a product according to claims 8 to 12; Y b) isolate and / or purify said antibodies. 15. A specific antibody against an O antigen of an LPS, O of an NH, O of a biosynthetic precursor thereof, or of a fragment of any of the foregoing, characterized in that a) at least one of the N-formylperosamine residues of said O antigen has been modified by replacing at least one formyl group, in the 4-amino position of perosamine, by: i) an acyl group, other than the formyl group; wherein the acyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, a group S (+) 2-hydroxypropionyl, an R (-) 2-hydroxypropionyl group, more preferably the acyl group is an acetyl group; or by ii) a sugar, selected from the group comprising hexoses and pentoses; or b) said O antigen comprises a heteropolymer formed by residues selected from: i) N-formylperosamine and N-acylperosamine, where this Nacilperosamine is different from N-formylperosamine, or ii) N-formylperosamine and N-g lycosylperosamine; preferably the heteropolymer is formed by residues selected from: N-fonnylperosamine and N-acetylperosamine, N-formylperosamine and 3-deoxy-L-gl icerotetronylperosamine, 5 N-formylperosamine and 3-hydroxypropionylperosamine, N-formylperosamine and S (+) 2-hydroxypropionylperosamine, or also N-formylperosamine and R (-) 2-hydroxypropionylperosamine; more preferably the heteropolymer is made up of Nformylperosamine and N-acetylperosamine residues.

16.

Antibody according to claim 15, wherein the O antigen comes from a gram-negative bacterium of the genus B17Icella according to claims 1 to 7.

17. An antibody obtainable by a method according to claim 14.

18.

A gram-negative bacterium according to claims 1 to 7, or a product according to claims 8 to 12, for use in medicine.

19. Use of a gram-negative bacterium according to claims 1 to 7, or a 20 product according to claims 8 to 12, in the manufacture of a medicament or a vaccine. 20. A gram-negative bacterium according to claims 1 to 7, or a product according to claims 8 to 12, for use, according to claim 19, in the prevention of brucellosis. 21. Use, according to claim 19, of a gram-negative bacterium according to claims 1 to 7, or a product according to claims 8 to 12, in the manufacture of a medicament or a vaccine for the prevention of brucellosis. 22. A medicament for the treatment of brucellosis, or a vaccine for the prevention of the occurrence of said disease comprising a gram bacteria negative according to claims 1 to 7. or a product according to claims 8 to 12.

2. 3.

A gram-negative bacterium according to claims 1 to 7, a product according to claims 8 to 12 or an antibody according to claims 15 to 17, for use in the diagnosis of brucellosis; preferably for the differentiation of Brucella infected animals from vaccinated animals against Brucella.

24.

Use of a gram-negative bacterium according to claims 1 to 7, a product according to claims 8 to 12 or an antibody according to claims 15 to 17, in the manufacture of a composition, reagent or kit, for the diagnosis of brucellosis; preferably for the differentiation of animals infected by Bmcella from animals vaccinated against Brucella.

25.

Use of a marker to differentiate Brucella infected animals from vaccinated animals against Brucella, where said marker is selected from:

a) an O antigen of an LPS, O of an NH, O of a biosynthetic precursor thereof, OR of a fragment of any of the above, from a gram-negative bacterium of the genus Brucel / a according to claims 1 to 7; b) a specific antibody against the O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the above, from a gram-negative bacterium of the Brucella genus according to the claims the 7; c) a DNA or RNA molecule that encodes: i) an N-acyltransferase capable of transferring an acyl group, other than the formyl group, to the 4-amino position of the perosamines of the O antigen; wherein the acyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, a S (+) 2-hydroxypropionyl group, a R (-) 2-hydroxypropionyl group, and more preferably the acyl group is an acetyl group; or 6. ii) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen; d) a specific antibody against: 5 i) an N-acyltransferase capable of transferring an acyl group, other than the fonnyl group, to the 4-amino position of the perosamines of the O antigen; wherein the aeyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, an R (-) 2 group Hydroxypropionyl; and more preferably the acyl group is an acetyl group; or in front of ii) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen; Y 15 e) a combination of the above. 26. A diagnostic method i / 1 vi / ro to differentiate animals infected by Bmcella from animals vaccinated against Bmcella, which comprises detecting the presence in a sample of the animal of a marker selected from: A) an O antigen of an LPS, O of an NH, O of a biosynthetic precursor thereof, or of a fragment thereof, from a gram-negative bacterium of the Brucella genus according to claims 1 to 7; b) a specific antibody against an O antigen of an LPS, ° of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of them, 25 coming from a gram-negative bacterium of the Brucella genus according to the claims 1 to 7; c) an ONA or RNA molecule that encodes i) an N-acyltransferase capable of transferring an acyl group, other than the formyl group, to the 4-amino position of the O antigen perosamines; wherein the acyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2 group hydroxypropionyl, a R (-) 2-hydroxypropionyl group, and more preferably the group acyl is an acetyl group; or ii) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen; d) a specific antibody against i) an N-acyltransferase capable of transferring an acyl group, other than the formyl group, to the 4-amino position of the O antigen perosamines; wherein the acyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, a R (-) 2-hydroxypropionyl group, and more preferably the acyl group is an acetyl group; or in front of ii) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the O antigen perosamines; Y e) a combination of several of the above markers; where the presence of at least one of said markers is indicative that said animal has been vaccinated against brucellosis.

27.

Method according to claim 26, characterized in that it is an immunoassay, preferably selected from an ELISA, a plaque agglutination test and a tube agglutination test.

28.

Method according to claims 26 or 27 comprising the following steps:

a) detect the presence in the sample of specific antibodies against an O antigen of an LPS, or of an NH, O of a biosynthetic precursor thereof, or of a fragment of any of the foregoing, from a gram-negative bacterium of the Brucella genus, other than a gram-negative bacterium of the Brucella genus according to claims 1 to 7; Y b) detect the presence in the sample of specific antibodies against an O antigen of an LPS, or of an NH, or of a biosynthetic precursor thereof, or of a fragment of any of the above, from a gram-negative bacterium of the Brucella genus according to claims 1 to 7.

29.

Method according to claim 28, further comprising an intermediate step between a) and b) in which the sample is contacted with a specific ligand to absorb the antibodies detected in a).

30

A diagnostic kit, to differentiate Brucella infected animals from vaccinated animals against Brucella, which comprises at least one component selected from:

a) a probe or ligand for specific antibodies against the O antigen of an LPS or of an NH, or of a biosynthetic precursor thereof, OR of a fragment of any of the foregoing, wherein said O antigen comes from a gram-negative bacterium of the Brucella genus according to claims 1 to 7; b) an antibody according to claims 15 to 17; c) an N-acyltransferase capable of transferring, to the 4-amino position of the perosamines of the 0 antigen, an acyl group, other than the formyl group; wherein the acyl group is preferably selected from the group comprising an acetyl group, a 3-deoxy-L-glycerotetronyl group, a 3-hydroxypropionyl group, an S (+) 2-hydroxypropionyl group, a R (-) 2-hydroxypropionyl group, and more preferably the acyl group is an acetyl group; d) an N-glycosyltransferase capable of transferring a sugar selected from the group comprising hexoses and pentoses, to the 4-amino position of the perosamines of the O antigen; Y e) a polynucleotide for amplifying a gene encoding an N-acyltransferase according to c) or an N-glycosyltransferase according to d); preferably a polynucleotide to amplify the wbdR gene of E. coli 0157: H7; more preferably the polynucleotide sequence is SEQ.ID.NO. 9, SEQ.ID.NO. 10, SEQ.ID.NO. 11, and SEQ.lD.NO. 12. 31. Kit according to claim 30, wherein the probe or ligand a) for specific antibodies is selected from the group consisting of: a) a gram-negative bacterium of the Brucella genus according to claims I to 7; Y 5 b) a product according to claims 8 to 12. 32. A kit according to any one of claims 30 to 31 further comprising at least one reagent selected from: a) a molecule comprising an O antigen of an LPS, or of an NH, or of a 10 biosynthetic precursor thereof, or a fragment of any of the above, from a gram-negative bacterium of the Brucella genus, other than a gram-negative bacterium of the Brucella genus according to claims 1 to 7; Y b) a gram-negative bacterium of the genus Bl1Icella, other than a gram-negative bacterium of the genus Brucella according to claims 1 to 7. 33. A polynucleotide comprising a sequence selected from: SEQ.ID.NO. 1, SEQ.ID.NO. 2, SEQ.ID.NO. 3, SEQ.ID.NO. 4, SEQ.ID.NO. 5, SEQ.ID.NO. 6, SEQ.ID.NO. 9, SEQ.LD.NO. 10, SEQ.LD.NO. 11, OSEQ.ID.NO. 12. 20 34. A polynucleotide consisting of a sequence selected from: SEQ.ID.NO. 1, SEQ.ID.NO. 2, SEQ. ID.NO. 3, SEQ.ID.NO. 4, SEQ.ID.NO. 5, SEQ LD.NO 6, SEQ LD.NO 9, SEQ.IDNO. 10, SEQ ID NO 11, and SEQ ID NO. 12. 35. A polynucleotide according to any of claims 33 or 34 for use in the diagnosis of brucellosis. 36. Use of a polynucleotide according to any of claims 33 or 34 for the manufacture of a composition, a reagent or a kit for the diagnosis of brucellosis.